Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»"

Transcript

1 Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

2 DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας: Αντιγραφή DNA Μεταγραφή DNA mrna Μετάφραση mrna Πρωτεΐνες Διαφορές Μεταξύ Προκαρυωτικών και Ευκαρυωτικών Οργανισμών Αποκλίσεις από το Κεντρικό Δόγμα Παραδείγματα

3 DNA RNA: ΒΑΣΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ Κυτοσίνη Συμπληρωματικές Βάσεις: Α Τ (A U) C G Κυτοσίνη Γουανίνη Γουανίνη Αδενίνη Ουρακίλη Αζωτούχες Βάσεις Συμπληρωματικό Ζεύγος Βάσεων Κορμός Πεντόζης Φωσφορικής Ρίζας Αδενίνη Θυμίνη Δεσμοί Υδρογόνου Αζωτούχες Βάσεις Ριβονουκλεϊκό Οξύ Δεοξυριβονουκλεϊκό Οξύ Αζωτούχες Βάσεις

4 DNA: RNA: DNA RNA: ΡΟΛΟΣ Μακρομόριο Αποθήκευσης Πληροφοριών και Εντολών για τα Δομικά και Λειτουργικά Χαρακτηριστικά του Έμβιου Κόσμου Αγγελιαφόρο (messenger) RNA (mrna) Μεταφορέας Εντολών από το DNA στο «Εργοστάσιο Παραγωγής»Δομικών και Λειτουργικών Πρωτεϊνών (Ριβοσώματα) Μεταφορικό (transfer) RNA (trna) Μεταφορέας Αμινοξέων για τη Σύνθεση των Πρωτεϊνών Ριβοσωμικό (ribosomal) RNA (rrna) Κύριο Δομικό Συστατικό των Ριβοσωμάτων

5 ΑΝΤΙΓΡΑΦΗ ΚΕΝΤΡΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΡΟΗ ΚΩΔΙΚΟΠΟΙΗΜΕΝΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΜΕΤΑΓΡΑΦΗ DNA mrna ΠΡΩΤΕΪΝΗ

6 ΓΕΝΕΤΙΚΟΣ ΚΩΔΙΚΑΣ Γενετικό Αλφάβητο Καταγραφής Εντολών για την Παραγωγή των Δομικών και Λειτουργικών Πρωτεϊνών (Φαινότυπος) Κωδικόνιο: Τριπλέτα Νουκλεοτιδίων που περιέχει την πληροφορία για 1 Αμινοξύ 4 3 =64 Δυνατοί Συνδυασμοί Τριπλετών Νουκλεοτιδίων 20μόνο Αμινοξέα ΓΙΑΤΙ; Εκφυλισμός Γενετικού Κώδικα: Περισσότερα από 1 Κωδικόνια για 1 Αμινοξύ (Ποτέ το Αντίστροφο!) Κ ω δ ι κ ό ν ι α Ποικιλομορφία στο Τρίτο Αμινοξύ Μείωση πιθανότητας έκφρασης μίας μετάλλαξης στην πρωτεΐνη

7 1 η Βάση Κωδικονίου 2 η Βάση Κωδικονίου 3 η Βάση Κωδικονίου ΓΕΝΕΤΙΚΟΣ ΚΩΔΙΚΑΣ ΠΟΛΥΠΕΠΤΙΔΙΟ ΠΡΩΤΕΪΝΗ ΚΥΤΤΑΡΟ ΑΛΦΑΒΗΤΟ ΠΡΟΤΑΣΗ ΚΕΦΑΛΑΙΟ ΒΙΒΛΙΟ

8 Συνεπώς: ΓΕΝΕΤΙΚΟΣ ΚΩΔΙΚΑΣ Μην Ξεχνάμε: Αλληλουχία DNA (Μέσω Γενετικού Κώδικα) Αλληλουχία Αμινοξέων Δομική Διαμόρφωση Πρωτεΐνης Προσδιορισμός Λειτουργίας Πρωτεΐνης Ο Γενετικός Κώδικας είναι Καθολικός Υποδηλώνει την Εξειδικευμένη Σχέση Γονοτύπου Φαινοτύπου ΒΑΣΗ ΕΥΑΙΣΘΗΣΙΑΣ ΚΑΙ ΕΙΔΙΚΟΤΗΤΑΣ ΜΟΡΙΑΚΩΝ ΤΕΧΝΙΚΩΝ ΣΤΗ ΣΥΓΧΡΟΝΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ

9 Παράδειγμα: ΓΕΝΕΤΙΚΟΣ ΚΩΔΙΚΑΣ Εντεροϊοί του Ανθρώπου: 79 Ορότυποι και συνεχώς ανακαλύπτονται νέοι Η Αντιγονική Ταυτότητα που προσδιορίζει τον Ορότυπο βρίσκεται στη VP1 Καψιδική Πρωτεΐνη:

10 ΓΕΝΕΤΙΚΟΣ ΚΩΔΙΚΑΣ Νουκλεοτιδική Αλληλουχία Γονιδίου που Κωδικοποιεί την Αλληλουχία Αμινοξέων της Αντιγονικής VP1 Περιοχής του Καψιδίου που προσδιορίζει τον Ορότυπο Ταυτοποίηση Οροτύπων: Ανοσοβιολογικές Μέθοδοι: Δύσκολο, πολλοί Ορότυποι και Διασταυρούμενες Αντιδράσεις Ανίχνευση με PCR γονιδίου που κωδικοποιεί VP1 και Εύρεση Νουκλεοτιδικής Αλληλουχίας του: Πλέον Κατάλληλη Μεθοδολογία Λόγω Γενετικού Κώδικα η Νουκλεοτιδική Αλληλουχία Αντιστοιχεί Απόλυτα στην Αλληλουχία των Αμινοξέων που προσδιορίζουν τον Ορότυπο

11 ΑΝΤΙΓΡΑΦΗ DNA Διαιώνιση της Ζωής (Διατήρηση των Γενετικών Πληροφοριών που την Εκφράζουν) Μητρικός Κλώνος Ημισυντηρητικός Τρόπος: Κάθε ένας από τους 2 Κλώνους λειτουργεί ως Μήτρα για την παραγωγή ενός Θυγατρικού Κλώνου μέσω της συμπληρωματικότητας των αζωτούχων βάσεων Πολύπλοκο Ενζυμικό Σύστημα για τη διάνοιξη των κλώνων και τη δημιουργία των 2 θυγατρικών από την DNA Πολυμεράση: Μητρικός Κλώνος Θυγατρικός Κλώνος Θυγατρικός Κλώνος

12 ΑΝΤΙΓΡΑΦΗ DNA

13 ΑΝΤΙΓΡΑΦΗ DNA

14 ΜΕΤΑΓΡΑΦΗ DNA mrna Παραλαβή της Γενετικής Πληροφορίας από τον Αγγελιαφόρο mrna για να τη μεταφέρει στα «Εργοστάσια» Εκτέλεσής της (Ριβοσώματα) Ένας από τους 2 Κλώνους λειτουργεί ως Μήτρα για την παραγωγή του mrna μέσω της συμπληρωματικότητας των νουκλεοτιδικών αζωτούχων βάσεων DNA εξαρτώμενη RNA Πολυμεράση: Κεντρικό Ένζυμο παραγωγής του mrna

15 ΜΕΤΑΓΡΑΦΗ DNA mrna Παράγοντες Μεταγραφής (Πρωτεΐνες) RNA Πολυμεράση (Πρωτεΐνη) C T A A T G T G A T T A C A... Περιοχές Σύνδεσης C T A A T G T... G A T T A C A

16 ΜΕΤΑΓΡΑΦΗ DNA mrna Παράγοντες Μεταγραφής (Πρωτεΐνες) RNA Πολυμεράση (Πρωτεΐνη) Συμπληρωματικό mrna

17 ΜΕΤΑΓΡΑΦΗ DNA mrna

18 ΜΕΤΑΦΡΑΣΗ mrna ΠΡΩΤΕΪΝΕΣ Πραγματοποιείται στα ΡΙΒΟΣΩΜΑΤΑ: Σύμπλοκα rrna και Πρωτεϊνών Μεγάλη (60S Ευκαρυωτικοί 50S Προκαρυωτικοί) και Μικρή (40S Ευκαρυωτικοί 30SΠροκαρυωτικοί) Υπομονάδα Το Μεταφορικό RNA (trna) μεταφέρει τα αμινοξέα τα οποία αντιστοιχούν σε συγκεκριμένα κωδικόνια του mrna Συνεπώς, κάθε μόριο trna είναι ειδικό για τη μεταφορά ενός και μόνο από τα 20 αμινοξέα μέσω της συμπληρωματικής σύνδεσης κωδικονίου στο mrna και αντικωδικονίου στο trna:

19 ΜΕΤΑΦΡΑΣΗ mrna ΠΡΩΤΕΪΝΕΣ Κορμός Υποδοχής Αμινοξέων Θηλειά ΤΨC Θηλειά D Ποικιλόμορφη Θηλειά Αντικωδικόνιο

20 ΜΕΤΑΦΡΑΣΗ mrna ΠΡΩΤΕΪΝΕΣ Το ριβόσωμα προσκολλάται στο σημείο έναρξης της μετάφρασης πάνω στο mrna Μεγάλη Ριβοσωμική Υπομονάδα Αντικωδικόνιο trna Κωδικόνιο Έναρξης (Αμινοξύ Μεθειονίνη) Μικρή Ριβοσωμική Υπομονάδα

21 ΜΕΤΑΦΡΑΣΗ mrna ΠΡΩΤΕΪΝΕΣ Στη συνέχεια, το ριβόσωμα προχωρά κατά μήκος του mrna, συνθέτοντας μία αλληλουχία αμινοξέων (πολυπεπτιδική αλυσίδα) που αντιστοιχεί στην αλληλουχία του mrna: Αναπτυσσόμενο Πολυπεπτίδιο Ολοκληρωμένη Πρωτεΐνη Κωδικόνιο Έναρξης Κωδικόνιο Λήξης Κίνηση Ριβοσώματος

22 ΜΕΤΑΦΡΑΣΗ mrna ΠΡΩΤΕΪΝΕΣ

23 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ ΠΡΟΚΑΡΥΩΤΙΚΩΝ ΚΑΙ ΕΥΚΑΡΥΩΤΙΚΩΝ ΟΡΓΑΝΙΣΜΩΝ Απουσία Διαμερισματοποίησης στα Προκαρυωτικά Κύτταρα Όλες οι διαδικασίες πραγματοποιούνται στον ίδιο ενδοκυττάριο χώρο Έναρξη Μετάφρασης πριν τελειώσει η διαδικασία της Μεταγραφής Πυρήνας Πυρηνίσκος Μιτοχόνδριο Πυρηνοειδές Μαστίγιο Τοίχωμα Ριβοσώματα Μεμβράνη Ευκαρυωτικό Κύτταρο Προκαρυωτικό Κύτταρο

24 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ ΠΡΟΚΑΡΥΩΤΙΚΩΝ ΚΑΙ ΕΥΚΑΡΥΩΤΙΚΩΝ ΟΡΓΑΝΙΣΜΩΝ Ιντρόνια (Μη Κωδικές Περιοχές) και Εξόνια (Κωδικές Περιοχές) στο ευκαρυωτικό mrna Επεξεργασία του mrna αμέσως μετά τη Μεταγραφή για αφαίρεση των Ιντρονίων (Μάτισμα) και την τελική Μετάφραση των Εξονίων στα Ριβοσώματα Συστήματα ελέγχου ροής της Γενετικής Πληροφορίας σε όλα τα επίπεδα και στους 2, με περισσότερο πολύπλοκα συστήματα στους ευκαρυωτικούς οργανισμούς

25 ΠΑΡΑΔΕΙΓΜΑΤΑ ΕΦΑΡΜΟΓΗΣ ΣΤΗ ΣΥΓΧΡΟΝΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Αντιγραφή DNA: Αλυσιδωτή Αντίδραση της Πολυμεράσης (PCR) In vitro Κλωνοποίηση Γενετικού Υλικού Τμήμα DNA για ανίχνευση 3ος Κύκλος 4ος Κύκλος ΕΚΘΕΤΙΚΗ ΑΥΞΗΣΗ 1ος Κύκλος 2ος Κύκλος 2 2 = 4 αντίγραφα 2 3 = 8 αντίγραφα 32 αντίγραφα 16 αντίγραφα

26 ΠΑΡΑΔΕΙΓΜΑΤΑ ΕΦΑΡΜΟΓΗΣ ΣΤΗ ΣΥΓΧΡΟΝΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μεταγραφή DNA mrna: Transcription Mediated Amplification (TMA): Ισοθερμική μέθοδος ανίχνευσης RNA και DNA στόχων μέσω ενός συστήματος DNA εξαρτώμενης RNA Πολυμεράσης και Αντίστροφης Μεταγραφάσης Χρησιμοποιείται στην ανίχνευση M. tuberculosis, C. trachomatis & HCV NASBA (Nucleic Acid Sequence Based Amplification): Αντίστοιχη ισοθερμική μέθοδος πολλαπλασιασμού RNA στόχων που βασίζεται στηδράση παρόμοιυ συστήματος T7 RNA Πολυμεράσης και Αντίστροφης Μεταγραφάσης

27 ΠΑΡΑΔΕΙΓΜΑΤΑ ΕΦΑΡΜΟΓΗΣ ΣΤΗ ΣΥΓΧΡΟΝΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μετάφραση DNA mrna: Γενετική Μηχανική για την παραγωγή Επιθυμητών Γονιδιακών Προϊόντων, π.χ.: Παραγωγή Ανοσογόνων Πολυπεπτιδίων για τη χρήσης τος ως Εμβόλια Επιφανειακό Αντιγόνο Ιού Ηπατίτιδας Β

28 ΑΠΟΚΛΙΣΕΙΣ ΑΠΟ ΤΟ ΚΕΝΤΡΙΚΟ ΔΟΓΜΑ ΑΝΤΙΓΡΑΦΗ ΑΝΤΙΓΡΑΦΗ RNA DNA ΜΕΤΑΓΡΑΦΗ ΑΝΤΙΣΤΡΟΦΗ ΜΕΤΑΓΡΑΦΗ mrna ΠΡΩΤΕΪΝΗ

29 ΑΠΟΚΛΙΣΕΙΣ ΑΠΟ ΤΟ ΚΕΝΤΡΙΚΟ ΔΟΓΜΑ Αντιγραφή RNA RNA Ιούς (π.χ. Οικογένειες Picornaviridae, Retroviridae) πραγματοποιείται από RNA εξαρτώμενη RNA Πολυμεράση RNA Ιοί: Το Γενετικό Υλικό δρα άμεσα ως mrna (Θετικής Πολικότητας), ήείναιαρνητικής Πολικότητας και Αντιγράφεται στο Συμπληρωματικό του Κλώνο για να γίνει mrna (Θετικής Πολικότητας) και να καθοδηγήσει τη Μετάφραση των Ιϊκών Πρωτεϊνών Hepadnaviridae (Ιός Ηπατίτιδας Β) Retroviridae (HIV) Αντίστροφη Μεταγραφή (Μετατροπή RNA σε DNA Αντίστροφη Ροή Γενετικής Πληροφορίας)

30 ΑΠΟΚΛΙΣΕΙΣ ΑΠΟ ΤΟ ΚΕΝΤΡΙΚΟ ΔΟΓΜΑ Αντίστροφη Μεταγραφή: Συμπληρώνει Μοριακές Τεχνικές για την Ανίχνευση RNA Ιών και mrna, π.χ.: RT PCR (Reverse Transcription PCR) για την ανίχνευση Εντεροϊών, Ιών της Γρίππης, κ.λ.π., καθώς και mrna γονιδίων υπεύθυνων για μικροβιολογικά σημαντικούς φαινοτύπους (π.χ. Σχηματισμό Βιοφίλμ)

31 ΣΑΣ ΕΥΧΑΡΙΣΤΩ

32 Σε ποια είδη μικροοργανισμών παρατηρείται αντιγραφή RNA: Βακτήρια Μύκητες Ιοί Πρωτόζωα ΕΡΩΤΗΣΕΙΣ

33 ΕΡΩΤΗΣΕΙΣ Η αντίστροφη μεταγραφή αποτελεί εξαίρεση του κεντρικού δόγματος της Βιολογίας. Συνεπώς, ως εργαστηριακή τεχνική μπορεί να χρησιμοποιηθεί μόνο: Για τη διάγνωση λοιμώξεων από ρετροϊούς και τον ιό της Ηπατίτιδας Β Για τη διάγνωση λοιμώξεων από όλους τους ιούς Για τη διάγνωση μόνο ιογενών λοιμώξεων Για τη διάγνωση ιογενών λοιμώξεων και τη διερεύνηση της ποσοτικής έκφρασης κλινικά σημαντικών γονιδίων προκαρυωτικών και ευκαρυωτικών οργανισμών

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ : «Μελέτη της υπολογιστικής πολυπλοκότητας μοντελοποίησης των Γενετικών Δικτύων με τη χρήση Κυψελιδωτών Αυτομάτων»

ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ : «Μελέτη της υπολογιστικής πολυπλοκότητας μοντελοποίησης των Γενετικών Δικτύων με τη χρήση Κυψελιδωτών Αυτομάτων» ΤΕΙ ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΣΔΟ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΛΗΡΟΦΟΡΙΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ : «Μελέτη της υπολογιστικής πολυπλοκότητας μοντελοποίησης των Γενετικών Δικτύων με τη χρήση Κυψελιδωτών Αυτομάτων» ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

Τ.Ε.Ι. ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΣΔΟ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗ ΠΛΗΡΟΦΟΡΙΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ: «ΠΡΟΣΟΜΟΙΩΣΗ ΓΕΝΕΤΙΚΩΝ ΔΙΚΤΥΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΕΞΕΛΙΚΤΙΚΩΝ ΜΗΧΑΝΩΝ»

Τ.Ε.Ι. ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΣΔΟ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗ ΠΛΗΡΟΦΟΡΙΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ: «ΠΡΟΣΟΜΟΙΩΣΗ ΓΕΝΕΤΙΚΩΝ ΔΙΚΤΥΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΕΞΕΛΙΚΤΙΚΩΝ ΜΗΧΑΝΩΝ» Τ.Ε.Ι. ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΣΔΟ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗ ΠΛΗΡΟΦΟΡΙΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ: «ΠΡΟΣΟΜΟΙΩΣΗ ΓΕΝΕΤΙΚΩΝ ΔΙΚΤΥΩΝ ΜΕ ΤΗ ΧΡΗΣΗ ΕΞΕΛΙΚΤΙΚΩΝ ΜΗΧΑΝΩΝ» ΣΥΝΤΑΚΤΡΙΑ/ΕΚΦΩΝΗΤΡΙΑ ΟΙΚΟΝΟΜΙΔΟΥ ΕΥΓΕΝΙΑ ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι

Διαβάστε περισσότερα