regulatory mechanisms). stringency).

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "regulatory mechanisms). stringency)."


1 ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή.

2 ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει σε δύο προϊόντα (συνκαταστολείς) και το ένζυµο της πρώτης αντίδρασης αποτελεί καταστολέα (απο-καταστολέα), ο οποίος µπορεί να συνδεθεί µε το χειριστή µόνο όταν έχει τροποποιηθεί η δοµή του από τη σύνδεσή του µε τους συν-καταστολείς. Σαρυθµιστικόγονίδιοδρατοπρώτοδοµικόγονίδιο, ενώ τα άλλα δοµικά γονίδια κωδικοποιούν τα άλλα ένζυµα τηςπορείας. Το σύστηµα αυτό έχει αυτόνοµη ρύθµιση γιατί όταν υπάρχει διαθέσιµο µόνο το υπόστρωµα τόσο η µεταβολική πορεία όσοκαιηµεταγραφή µπορούν απρόσκοπτα να προχωρούν.

3 ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµηκαταστολή: Όταν σχηµατισθούν τα προϊόντα της αντίδρασης δενείναιδιαθέσιµοτοένζυµοτηςπρώτηςαντίδρασης, δεσµεύεται στο χειριστή ο καταστολέας (το σύµπλοκο ενζύµου και προϊόντων) και παρεµποδίζεται η µεταγραφή (αυτόνοµη καταστολή).

4 (ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµηκαταστολή) 2) Αυτόνοµηεπαγωγή. Μεταβολική πορεία στην οποία το ένζυµο της πρώτης αντίδρασης αποτελεί καικαταστολέαπουσυνδέεταιµετοχειριστή, µόνο όταν δεν έχει δεσµεύσει το υπόστρω- µα το οποίο στην συγκεκριµένη περίπτωση δρα σαν επαγωγέας Σαρυθµιστικόγονίδιοδρατοπρώτοδοµικόγονίδιο, ενώτα άλλα δοµικά γονίδια κωδικοποιούν τα άλλα ένζυµα της πορείας. Έχει αυτόνοµη ρύθµιση γιατί Α) παρουσία του υποστρώµατος τόσο η µεταβολική πορεία όσο και η µεταγραφή µπορούν απρόσκοπτα να προχωρούν. Β) όταν εξαντληθεί το υπόστρωµα της αντίδρασης δενείναιδιαθέσιµοτοένζυµοτηςπρώτηςαντίδρασης, δεσµεύεται στο χειριστή ο καταστολέας (το ένζυµο) και παρεµποδίζεται η µεταγραφή.

5 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ Η επέκταση των µηχανισµών λειτουργίας των ρεγγουλόνιων οδηγεί σε συστήµατα οµαδικής ρύθµισης πολλών οπερόνιων ταυτόχρονα µε αποτέλεσµα την ολοκλήρωση της µεταβολικής ρύθµισης (integration of regulatory mechanisms). Τα οπερόνια και ρεγγουλόνια παρέχουν στον οργανισµό τη δυνατότητα εξειδικευµένης απόκρισης σε περιβαλλοντικές αλλαγές. Τα ολοκληρωµένα ρυθµιστικά συστήµατα επιτρέπουν το συντονισµό µιας ολόκληρης σειράς αποκρίσεων, που όµως σχετίζονται λειτουργικά. Υπάρχουν δύο τουλάχιστον τέτοια συστήµατα, γνωστά σαν 1) Καταστολήκαταβολιτών (catabolite repression) και 2) Αυστηρόςήκαταπιεστικόςέλεγχος (stringent control, stringency).

6 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολήκαταβολιτών: Μια οµάδα οπερόνιων, που σχετίζονταιλειτουργι-κά, έχουνθετικόέλεγχο: Α) Με το ίδιο πρωτεϊνικό µόριο, το CAP (Catabolite ή Repressor Protein) ήπιο σωστά, στην πραγµατικό-τητα πρόκειται για ενεργοποιητή (Catabolite-gene Activator Protein). Β) Τον ίδιο επαγωγέα, που στην προκειµένη περίπτωση είναι το camp.

7 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Το CAP- camp συνδέεται µε τον εκκινητή πολλών οπερόνιων που όλα ρυθµίζουν καταβολικές πορείες(είναι ένας πλειοτροπικόςρυθµιστής). Καθένααπόταοπερόνιαπουελέγχονταιαπότο CAPcAMP µπορεί να εκφρασθεί, αλλά αυτό εξαρτάται και από ένα δεύτερο ρυθµιστικό µηχανισµό που χρησιµοποιεί το χειριστή. Στο ρυθµιστικό αυτό µηχανισµό συµµετέχει και το ειδικό για κάθε οπερόνιο (καταβολικό) υπόστρωµα, που συνδέεται µε τον καταστολέα και το µετατρέπει σε ανενεργή µορφή, µε αρνητική ρύθµιση.

8 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Παράδειγµα τέτοιας ρύθµισης συναντάται στα βακτήρια, όταν υπάρχει διαθέσιµη για αποικοδόµηση γλυκόζη, λακτόζη και αραβινόζη. Στο DNA υπάρχουν οπερόνια για τη γλυκόζη, λακτόζη και αραβινόζη, που κάθε ένα διαθέτει έναν εκκινητή και ένα χειριστή. Στον κάθε εκκινητή συνδέεται το CAP- camp, αλλά µε διαφορετικήχηµικήσυγγένειαγιατονκαθένα. Ο καταστολέας (διαφορετικός για κάθε οπερόνιο) υπάρχει σε δραστική µορφή και είναι συνδεδεµένος µε το χειριστή κάθεοπερονίουκαιπαρεµποδίζεταιηµεταγραφή.

9 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Όταν υπάρχουν διαθέσιµα µόρια γλυκόζης ή/και λακτόζης ή/και αραβινόζης τότε αυτά δεσµεύουν τον αντίστοιχο καταστολέα, τον κάνουν µη δραστικό µε αποτέλεσµα να αποµακρύνεται από το χειριστήκαιέτσιναείναιδυνατήηµεταγραφή. Συγκεκριµένα για τα βακτήρια, όταν υπάρχει διαθέσιµη γλυκόζη, τοεπίπεδοτου campδιατηρείταιχαµηλό. Ότανλείψειηγλυκόζηανεβαίνειησυγκέντρωσητου camp, σχηµατίζεται το CAP- camp και συνδέεται στις θέσεις των εκκινητών, αλλά δεν αρχίζει η µεταγραφή, γιατί υπάρχουν τα µόριατουκαταστολέασυνδεδεµέναστιςθέσειςτουχειριστή.

10 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Αν στο περιβάλλον υπάρχει λακτόζη, αυτή σχηµατίζει ανενεργό σύµπλοκο µε τον αντίστοιχο καταστολέα και έτσι επιτρέπειτηλειτουργίατου Lac-operon. Αν διατίθεται αραβινόζη, τότε ενεργοποιείται µε τον ίδιο τρόπο το Ara-operon. Αντίστοιχακαιγιατηγλυκόζη. Ανδιατίθενταικαιτατρίασάκχαραήσυνδυασµοίαυτών, τότε αποικοδοµείται η γλυκόζη, µετά η λακτόζη και τέλος η αραβινόζη.

11 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Η σειρά αυτή λόγω διαφοράς ευαισθησίας των δια-φόρων οπερόνιων στο CAP- camp, από τη διαφορετική χηµική συγγένεια του CAP- camp προς τους εκκινητήρες των τριών οπερόνιων. Το CAP- camp έχει µεγαλύτερη συγγένεια για το οπερόνιο της γλυκόζης, µετά της λακτόζης και τέλος αραβινόζης, µε αποτέλεσµα να ενεργοποιεί ανάλογα και τα αντίστοιχα οπερόνια.

12 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Ο µηχανισµός αυτός επιτρέπει στους οργανισµούς να διαλέγουντηδίαιτάτους, όταντοδιαιτολόγιοείναιµεγάλο. Σε συνδυασµό µε την χηµειοταξία (την ικανότητα των κυττάρων να οδεύουν προς κάποιες ουσίες) που και αυτή υπόκειται στο µηχανισµό της καταστολής των καταβολιτών ταβακτήριαδεδιαλέγουνµόνοτηντροφήτουςαπότη διαθέσιµη στο άµεσο περιβάλλον τους αλλά συνδυάζουν αυτή την επιλογή µε µετακίνηση σε άλλο περιβάλλον, πιο επιθυµητό από αυτά, όταν το περιβάλλον αυτό υπάρχει εκεί κοντά.

13 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών 2) Αυστηρός ή καταπιεστικός έλεγχος: Αντιστοιχεί στην έκφραση σφίξιµο του ζωναριού ή περίοδος ισχνών αγελάδων. Πρόκειται για: µηχανισµό συντονισµένου ελέγχου µιας οµάδας οπερόνιων, που σχετίζονται λειτουργικά (όπως στην προηγούµενη περίπτωση), αλλάσεπολύπιογενικόβαθµό, οοποίοςµεταξύτων άλλων περιλαµβάνει: αρνητική ρύθµιση και θετική ρύθµιση

14 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών 2) Αυστηρός ή καταπιεστικός έλεγχος: Αρνητική ρύθµιση: στη βιοσύνθεση rrna των ριβοσωµικών πρωτεϊνών (δηλαδή περιορισµός αριθµούριβοσωµάτων) trnaκαι Θετική ρύθµιση: ορισµένων βιοσυνθετικών οπερόνιων αµινοξέων (His,Try, Ile, Val) ή/και καταβολικών οπερόνιων (Lac-operon), και επίδραση στη διαπερατότητα των µεµβρανών στηβιοσύνθεσηλιποπολυσακχαριτώνκ.λπ.

15 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών 2) Αυστηρός ή καταπιεστικός έλεγχος: Στο πλειοτροπικό αυτό αποτέλεσµα το ρόλο του επαγωγέα παίζουν δύο µόρια-σήµατα η τετρα-φωσφορική γουανοσίνη (ppgpp) και η πεντα-φωσφορική γουανοσίνη (pppgpp), οι οποίες όταν πρωτοανακαλύφθηκαν από τον O.Maaloe µε χαρτοηλεκτροφόρησηονοµάστηκανµαγικέςκηλίδεςικαιιι. Το ppgpp είναι ένα παράδειγµα του ειδικού εκείνου τύπου των µορίων-σηµάτων, για τα οποία ο Ames πρότεινε τον όρο αλαρµόνες. Οι ενώσεις ppgpp, camp, cgmp χρησιµεύουν: στο να αναπροσανατολίζουν τις κυτταρικές επενδύσεις ενέργειας σεανταπόκρισηκάποιαςδύσκοληςκατάστασης (stress) σεέναµεταβολικόπεδίο.

16 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών 2) Αυστηρός ή καταπιεστικός έλεγχος: Σε έλλειψη αµινοξέων δηµιουργείται περίσσεια ελεύθερων trna, τα οποία µπορούν να εισχωρήσουν (αντιστρεπτά) στις θέσεις Α και Ρ των ριβοσωµάτων, ενός συµπλόκου ριβοσώµατος-mrna. Αν κάποιο από τα ελεύθερα trna που εισχωρούν στην θέσηα συµβαίνει να έχει την αντικωδική τριάδα που αντιστοιχεί στην κωδική τριάδα του mrna που βρίσκεται εκείνη τι στιγµήστηθέσηα,τότε: µε το δεσµό µεταξύ της κωδικής-αντικωδικής τριάδας που αναπτύσσεται το ελεύθερο trna προσανατολίζεται στην κανονική του θέση.

17 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών 2) Αυστηρός ή καταπιεστικός έλεγχος: Στηθέσηαυτήηδιαδοχή TψCGτου τρίτου βραχίονα του trna (που λέγεται βραχίονας ψευδο-ουριδίνης) µπορεί να αλληλεπιδράσει µε µια ριβοσωµική πρωτεΐνη γνωστή σαν αυστηρός παράγοντας (SF). Ηβιοσύνθεσητου SFκατευθύνεταιαπόέναειδικόγονίδιο, γνωστόσαν rela, γιατί µετάλλαξη του rela οδηγεί στο λεγόµενο χαλαρό έλεγχο (relaxed control). Το σύµπλοκο TψCG- SF ευνοεί τη βιοσύνθεση ppgpp και pppgppαπό GDP. Η ppgpp είναι αλλοστερικός ρυθµιστής της πολυµεράσης του RNA, ηοποίαρυθµίζειτηµεταγραφικήτηςεπιλογή.

18 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών) 2) Αυστηρός ή καταπιεστικός έλεγχος: ηλαδήηπολυµεράσηςτου RNA αλλάζειτηχηµικήτηςσυγγένειαπροςτιςπεριοχές R C των υποκινητών διαφόρων οπερόνιων που σχετίζονται λειτουργικά, όχιαπότηνάποψηανείναιόλαταοπερόνιααναβολικά ήόλακαταβολικά, αλλάγενικάµετηνοικονοµίατουκυττάρουσε περιπτώσεις, που όπως αναφέρθηκαν, αντιστοιχούν στην έκφραση σφίξιµο του ζωναριού ή περίοδος ισχνών αγελάδων.

19 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών) 2) Αυστηρός ή καταπιεστικός έλεγχος: Πρόκειται, δηλαδή για ένα µηχανισµό δραστικής αναπροσαρµογής της γενικής µεταβολικής στρατηγικής τουκυττάρου, µε σκοπό την αντιµετώπιση περιβαλλοντικών ή ενδοκυτταρικώνκαταστάσεων. Γιατολόγοαυτόκαιβακτήριαµεµεταλλαγµένοτο γονίδιο rela αντιµετωπίζουν µεγάλες δυσκολίες στην ανάπτυξή τους, όταν µεταβληθούν απότοµα οι περιβαλλοντικές συνθήκες.

20 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών) 2) Αυστηρός ή καταπιεστικός έλεγχος: Οµηχανισµόςµετονοποίοη ppgppαλλάζειτις προτιµήσεις της πολυµεράσης του RNA δεν είναι γνωστός µε λεπτοµέρειες. Φαίνεται ότι είναι αποτέλεσµα πολύπλοκων αλληλεπιδράσεωνκαιµεάλλασυστατικάτουκυττάρου, όπως τονπαράγονταέναρξης IF2, άλλουςπαράγοντες (όπως EF-T, EF-G,IF-2 κ.λπ.), το fmet-trnaf και άλλα trna τα οποία φέρουν αµινοξέα, των οποίων οι αλληλεπιδράσεις µε την πολυµεράσηείναιγνωστές.

21 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών) 2) Αυστηρός ή καταπιεστικός έλεγχος: Περιληπτικά οι αλληλεπιδράσεις µε την πολυµεράση και οι άλλοιπαράγοντεςπουεµπλέκονταιέχουνωςεξής: Η πολύµεράση του RNA σχηµατίζει σύµπλοκα µε το fmettrna F καιτονπαράγοντα IF 2. Το πρώτο σύµπλοκο (πολύ-µεράση RNA - fmet-trna F ) έχει in vitro δραστικότητα: αυξηµένη στη µεταγραφή Lac-operon και διαφορετική στη µεταγραφή σταθερώνγονιδίων.

22 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1)Καταστολή καταβολιτών) 2)Αυστηρός ή καταπιεστικός έλεγχος: Το δεύτερο σύµπλοκο (πολυµεράση RNA- IF 2 ) ευνοεί τη µεταγραφή rrna και το σχηµατισµό συµπλόκου. Υπάρχει εποµένως ανταγωνισµός για το fmettrna F από την πολύµεράση του RNA και τοσύµπλοκο mrna-30s υποµονάδα RNA.

23 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1)Καταστολή καταβολιτών) 2)Αυστηρός ή καταπιεστικός έλεγχος: Όταν ελαττωθεί το mrna ευνοείται ο σχηµατισµός του συµπλόκου πολυµεράση RNA - fmet-trna F καιηµεταγραφήτου Lac-operon. Περίσσεια mrna ελαττώνει το διαθέσιµο fmet-trna F και ευνοεί το σχηµατισµό του συµπλόκου πολυµεράση RNA - IF 2 και της µεταγραφής rrna

24 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1)Καταστολή καταβολιτών) 2)Αυστηρός ή καταπιεστικός έλεγχος: Η ppgpp ανταγωνίζεται µε τον IF 2 γιατην πολυµεράση RNA, και εξηγείται η αναστολή τηςµεταγραφής rrna, ριβοσωµικών πρωτεϊνών κ.λπ. Η ευνοϊκή επίδραση της ppgpp στη µεταγραφή του Lac-operon (ήάλλαοπερόνια) µπορείναοφείλεται: Ι) στο σύµπλοκο πολυµεράση RNA-ppGpp ΙΙ) σε σχηµατισµό άλλου συµπλόκου (π.χ. πολύµεράση RNA - ppgpp - fmet-trna F ) ΙΙΙ) στην πιθανότητα να µην αναστέλλει η ppgpp το σχηµατισµό του συµπλόκου πολυµεράση RNA -fmet-trnaf.

25 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1)Καταστολή καταβολιτών) 2)Αυστηρός ή καταπιεστικός έλεγχος: Όλες αυτές οι δυνατότητες είναι πολύ πιθανές τόσοστηνπερίπτωσητου Lac-operon, όσοκαισταάλλαοπερόνιαπουηµεταγραφήτουςευνοείταιαπό την ppgpp. Πολλά trna τα οποία φέρουν αµινοξέα, ευνοούν τη µεταγραφή των αντίστοιχων οπερόνιων (π.χ. το His-tRNA του His-operonκ.λπ.) όπωςστηνπερίπτωση fmet-trna F - Lac-operon. Ειδικά, η ταχύτητα µεταγραφής του His-operon αυξάνεται ανάλογαµετησυγκέντρωσητου ppgppκαιότανδεν υπάρχει έλλειψη His, γεγονός που δείχνει ότι και οι τρεις από τις δυνατότητες που αναφέρθηκαν µπορεί να συµβάλλουν. Ηειδικήεπίδρασητης ppgppστο His-operonείναινα ρυθµίζει τη σύνθεση των βιοσυνθετικών ενζύµων της ιστιδίνης, ανάλογα µε τις ανάγκες για ιστιδίνη και τη σχετική διαθεσιµότητα άλλων αµινοξέων.

26 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Ανκαιοκύριοςτρόποςρύθµισηςτωνγονιδίωνείναιη ρύθµισήτουςστηναρχήτηςµεταγραφής (Ρύθµιση1), υπάρχουν και άλλοι τρόποι ρύθµισης που δρουν κατά την πορεία της µεταφοράς της πληροφορίας από το RNA στην πρωτεΐνη (Ρύθµιση2). Ένας από αυτούς τους τρόπους ρύθµισης, αποτελεί και η ρύθµιση, που γίνεται αφούηπολυµεράσητου RNA έχεισυνδεθείµετογονίδιο στον υποκινητή και έχειήδηαρχίσειησύνθεσητου RNA. ηλαδή πρόκειται για ένα µηχανισµό που κάνει σύζευξη των πορειών της µεταγραφής και τηςµετάφρασης. Τοφαινόµενοαυτό, µετοοποίογίνεταιηρύθµισηµερικών αµινοξέων, είναι γνωστό σαν εξασθένηση (attenuation).

27 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Σαν παράδειγµα θα χρησιµοποιηθεί η περίπτωση της ρύθµισης του αµινοξέος θρυπτοφάνη (Try), το οπερόνιο της οποίας δενέχειρύθµισηµετοµηχανισµότηςκαταστολήςτων καταβολιτών,

28 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Αλλά η ρύθµισης του αµινοξέος θρυπτοφάνη (Try) γίνεται αφ ενόςµενµετηναυτόνοµηρύθµιση (αυτόνοµη καταστολή) αφ ετέρουδεµετοφαινόµενοτηςεξασθένησης.

29 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Στοοπερόνιοτης Try, µεταξύτου χειριστή και του πρώτου δοµικού γονιδίου, υπάρχει µια περιοχή που αποτελεί µια ελεγχόµενη θέση τερµατισµού της µεταγραφής και λέγεταιεξασθενητής. Το mrnaτης Try, πριναπότο κωδικόνιο της έναρξης των δοµικών γονιδίων, έχει µια αλληλουχία-οδηγό που φέρει δύο διαδοχικά κωδικόνια Try. Οι αλληλουχίες οδηγοί για τα διάφορα αµινοξέα, έχουν σχετικά µεγάλη αναλογία από το ρυθµιζόµενο αµινοξύ, µε αποτέλεσµα να αποτελούν µηχανισµό αναγνώρισης των επιπέδωντουρυθµιζόµενουαµινοξέοςµέσαστοκύτταρο. Το mrna της Try φέρει 4 τµήµατα (1,2,3 και 4) που ανά δύο µπορούν να σχηµατίσουν δίκλωνη αλυσίδα, µέσω των συµπληρωµατικώντουςβάσεων.

30 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ ΌτανηTryείναιδιαθέσιµησεπερίσσεια, ηέναρξητης µεταγραφής του οπερονίου της παρεµποδίζεται, γιατί στη θέση του χειριστή έχει δεσµευθεί το σύµπλοκο Tryκαταστολέας. αυτόνοµη ρύθµιση (αυτόνοµη καταστολή)

31 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Καθώς µειώνεται η συγκέντρωση της Try και αρχίζει να ελευθερώνεταιηθέσητουχειριστή, ξεκινάκαιηµεταγραφή.

32 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Αµέσωςµόλιςσυντεθείτο 5 άκροτου mrna, δεσµεύονται οι υποµονάδες του ριβοσώµατος και ξεκινά η µετάφραση τηςαλληλουχίας-οδηγού, εφ όσον υπάρχουν διαθέσιµα µέσα στοκύτταροαµινοξέακαι Try. 5 Επειδή στο ριβόσωµα, που βρίσκεται πολύκοντάστηνπολυµεράσητου RNA (την ακολουθεί) εισέρχεται και η περιοχή 1 αλλάκαιηπεριοχή 2, µπορείνασχηµατισθείµόνοηδίκλωνηαλυσίδααπότα τµήµατα 3+4. Τότε η δοµή του mrna (βρόγχος) εµποδίζει την πολυµεράση του RNA να δράσει και ευνοεί τον τερµατισµό της µεταγραφής στην περιοχή του εξασθενητή, και η πολυµεράση του RNA αποχωρίζεται από το οπερόνιο.

33 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Όταν δεν υπάρχει πια διαθέσιµη Try σταµατά η βιοσύνθεση της αλληλουχίας-οδηγού στο ριβόσωµα παραµένει δεσµευµένηµόνοηπεριοχή 1. Τότε όµως µπορεί να σχηµατισθεί δίκλωνη αλυσίδα ανάµεσα στις περιοχές 2+3 η περιοχή 4 να παραµένει µονόκλωνη αλυσίδα και ηδοµήτου mrnaευνοείτησυνέχιση τηςµεταγραφήςκαιπέρααπότηθέση του εξασθενητή.

34 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Στους ευκαρυωτικούς υπάρχουν, οι ακόλουθοιεπιπλέοντρόποιρύθµισης, οι οποίοι συµβαίνουν αφού έχει ολοκληρωθεί η µεταγραφή: 1) Ωρίµανσητου RNA (2 ο επίπεδο) Εκτός από την ωρίµανση του RNA, όπως έχει περιγραφεί, είναι γνωστό και το φαινόµενο της εναλλακτικής ωρίµανσης, το οποίο συµβαίνει συχνά στα ευκαρυωτικά γονίδια που περιέχουν πολλαπλά εξώνια στις γεννώµενεςήαρχικέςήπρόδροµεςµεταγραφέςτους.

35 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 1) Ωρίµανση του RNA (2ο επίπεδο) Έτσι, εµφανίζονται διαφορετικοί τύποι ωρίµανσης σε διαφορετικούς τύπους διαφοροποιηµένων κυττάρων στον ίδιο οργανισµό.

36 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 2) Ρύθµισητηςµετάφρασης (4 ο επίπ.) Γιατηρύθµισηκατάτηµετάφρασηδενυπάρχουντόσαστοιχεία, όπως για τη µεταγραφή, όπου πιστεύεται ότι κυρίως γίνεται η ρύθµιση, χωρίς αυτό να µειώνει τη σηµασίατηςρύθµισηςµετάτηµεταγραφή. Ακόµα δεν έχει διευκρινισθεί η έκταση της συνεισφοράς της µεταφραστικής ρύθµισης στην όλη ρύθµιση του κυττάρου. Πάντωςπιστεύεταιότιηρύθµισηαρχίζειαπότοστάδιοτης έναρξης της πρωτεϊνοσύνθεσης. Γενικά η ρύθµιση της µετάφρασης αποτελεί ένα πολύπλοκο µεν αλλά ενδιαφέροντα µηχανισµό, στον οποίο µεταξύ άλλων συµµετέχουν :

37 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 2α) Ρύθµιση της µετάφρασης (4ο επίπεδο) Οι παράγοντες έναρξης, οι οποίοι είναι δραστικοί στη µη φωσφορυλιωµένη τους µορφή και µη δραστικοί στη φωσφορυλιωµένη µορφή (eif 2 ).

38 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 2β) Ρύθµισητηςµετάφρασης (4ο επίπεδο) Ειδικάπρωτεϊνικάµόριαπουεπιδρούνστηµετάφραση, π.χ. η πρωτεΐνη που κατευθύνεται από ένα γονίδιο να καταστέλλει την µετάφρασή της, όχι µε τη σύνδεσή της σε κάποιαθέσητου DNA (όπωςέχειαναφερθείµέχριτώρα), αλλάµετησύνδεσήτηςστο mrnaπουπροέκυψεαπότο αντίστοιχο γονίδιο και έτσι να παρεµποδίζει την περαιτέρω µετάφραση του mrna.

39 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 3) ε ρυθµίζεται µόνο η ταχύτητα της µεταγραφής, αλλά και η συχνότητα µετάφρασης του mrna. Σε ένα πολυκιστρονικό mrna οι µεσαίες πρωτεΐνες βγαίνουν σε περισσότερα αντίτυπα. ηλαδή, όλα τα γονίδια δεµεταφράζονταισείδιοαριθµόαντιτύπων. Αυτόόµωςδενµπορείναεξηγηθείµεταόσα, µέχριτώρα, έχουν αναφερθεί, παρά µόνο µε την υπόθεση ότι τα ριβοσώµατα µπορούν να αρχίσουν µετάφραση mrna, όχιµόνοαπότο 5 άκροτους (τηναρχήτους) αλλά και από ενδιάµεσα σηµεία. Πότε και µε τι συχνότητα γίνεται αυτό, είναι άγνωστο.

40 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 4) Παράγοντες που επιδρούν στη σταθερότητατου mrna (5 ο επίπεδο). 5) Τροποποίησηπολυπεπτιδικής αλυσίδας Η αρχική πολυπεπτιδική αλυσίδα µπορεί να τροποποιηθεί µε διάφορους τρόπους, έτσι ώστε να προκύψουν διαφορετικά πολυπεπτίδια ή πρωτεΐνες στους διάφορους ιστούς.

mrna mrna). mrna mrna mrna)

mrna mrna). mrna mrna mrna) ΡΥΘΜIΣΗ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ ΚΑI ΚΑΤ' ΕΠΕΚΤΑΣΗ ΤΗΣ ΠΡΩΤΕΪΝIΚΗΣ ΣΥΝΘΕΣΗΣ ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ Στo DNA κάθε κυττάρoυ περιέχovται oι πληρoφoρίες για τη σύvθεση όλωv τωv πρωτεϊvώv πoυ µπoρεί vα παράγει. Κάθε στιγµή

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ (Γενετικό υλικό των βακτηρίων ρύθμιση της γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 Γενετικό υλικό των βακτηρίων Αποτελείται από ένα μόριο DNA σε υπερελιγμένη μορφή και τα άκρα του

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 (+ κεφάλαιο 15 Hartwell) Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. igenetics 2

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση Περιεχοµενα 1. Τι σηµαινει ρυθµιζω για την κυτταρικη µηχανη? 1. Η κυτταρικη ρυθµιση ειναι πολυεπιπεδη 2. Επιπεδο Μεταγραφης-Pύθµιση έκφρασης γονιδίων-tο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA.

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 1 -Ρυθμιζόμενα, ιδιοστατικά γονίδια και γονίδια κυτταρικής οικονομίας:

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 2 Ιδιοστατικά γονίδια Ρυθμιζόμενα γονίδια

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α. συνεπικρατή

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα


ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. σελ. 24 σχ. βιβλίου «Κάθε φυσιολογικό μεταφασικό χρωμόσωμα...η απεικόνιση αυτή αποτελεί τον καρυότυπο». «Ο αριθμός και η μορφολογία

Διαβάστε περισσότερα

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών.

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. (σελ. 24) Κάθε φυσιολογικό μεταφασικό... τον καρυότυπο. Δύο συμπεράσματα που μπορούν να

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα


Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: W:

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: W: Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Γκύζη 14-Αθήνα Τηλ :


Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα ΘΕΜΑ Α ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα



Διαβάστε περισσότερα