mrna mrna). mrna mrna mrna)

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "mrna mrna). mrna mrna mrna)"

Transcript

1 ΡΥΘΜIΣΗ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ ΚΑI ΚΑΤ' ΕΠΕΚΤΑΣΗ ΤΗΣ ΠΡΩΤΕΪΝIΚΗΣ ΣΥΝΘΕΣΗΣ ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ Στo DNA κάθε κυττάρoυ περιέχovται oι πληρoφoρίες για τη σύvθεση όλωv τωv πρωτεϊvώv πoυ µπoρεί vα παράγει. Κάθε στιγµή όµως µεταγράφovται κάπoια oρισµέvα γovίδια (όχι όλα), τα oπoία στη συvέχεια µεταφράζovται ώστε vα παραχθoύv κάπoιες συγκεκριµέvες πρωτεΐvες, διεργασία πoυ γίvεται όταv τo κύτταρo έχει τη δεδoµέvη στιγµή αvάγκη απόαυτέςτιςσυγκεκριµέvεςπρωτεΐvες. (Έκφραση διαφορετικών γονιδίων σε συνάρτηση µε το χρόνο) Στα διαφoρoπoιηµέvα κύτταρα, σε πoλυκυτταρικoύς oργαvισµoύς, εvώ όλα τα κύτταρα έχoυv τo ίδιo DNA (ίδια γovίδια στo oλικό γovιδίωµα), εvτoύτoις συµβαίνει έκφραση διαφορετικών γονιδίων µόνιµα.

2 Όλα τα παραπάvω δείχvoυv ότι υπάρχει κάπoιoς µηχαvισµός µε τov oπoίo επιτυγχάvεται η µεταγραφή, κάθε φoρά, εvός oρισµέvoυ γovιδίoυ. ηλαδή, ησυχνότηταµετηνοποίαγίνεταιηροήτων πληροφοριών από το DNA προς τις πρωτεΐνες βρίσκεται υπό τον έλεγχο ρυθµιστικών µηχανισµών.

3 Οόροςρύθµισητηςέκφρασηςτωνγονιδίων (control of gene expression) αναφέρεται στη ρύθµιση της βιοσύνθεσης τωνπρωτεϊνών, δηλαδήστηρύθµισητηςροήςτηςπληροφορίαςαπότο DNAστηνπρωτεΐνη. Για τα προκαρυωτικά κύτταρα υπάρχουν πολλά στοιχεία (γιατηρύθµισητηςέκφρασηςτωνγονιδίων). Για τα ευκαρυωτικά υπάρχουν διαθέσιµα λίγα στοιχεία που δενεξηγούνταιπλήρως. Στα προκαρυωτικά κύτταρα η ρύθµιση των γονιδίων γίνεται: µέσα από τη ρύθµιση της αρχής της µεταγραφής, του τέλους της µεταγραφής και του χρόνου ηµιζωής του mrna.

4 Σταευκαρυωτικάκύτταρα, ηρύθµισηµπορείναγίνεισε 5 διαφορετικά επίπεδα: 1 ο )Ρυθµίζονταςπότεήπώςένασυγκεκριµένογονίδιο µεταγράφεται (ρύθµισηστοεπίπεδοτηςµεταγραφής). Η ρύθµιση αυτή περιλαµβάνει τη γονιδιακή ρύθµιση (gene control) ή ρύθµιση γονιδίων (control of genes) που αναφέρεται στη ρύθµιση της συχνότητας που µεταγράφονται τα δοµικά γονίδια και τηςδραστικότηταςτωνδοµικώνγονιδίων. Ο όρος ρύθµιση της δραστικότητας των γονιδίων (control of gene activity) αναφέρεται στη ρύθµιση της µεταγραφής του DNA προς RNA, δηλαδή στη ρύθµισητηςροήςτηςπληροφορίαςαπότο DNA προς RNA.

5 2 ο )Ρυθµίζονταςτηδιαδικασίατης µεταγραφής. 3 ο )Επιλέγονταςποιααπόταώριµα mrna στον πυρήνα του κυττάρου θα απελευθερωθούν στο κυτόπλασµα (ρύθµιση στο επίπεδο της µεταφοράς του mrna). 4 ο )Επιλέγονταςποιααπότα mrnaτουκυτοπλάσµατοςθα µεταφερθούν στα ριβοσώµατα (ρύθµιση στο επίπεδο της µετάφρασης) ή 5 ο )Επιλέγονταςνασταθεροποιήσεισυγκεκριµένα mrnaτου κυτοπλάσµατος (ρύθµιση της αποικοδόµησης του mrna)

6 1 ο ) ΡΥΘΜΙΣΗΣΤΟΕΠΙΠΕ ΟΤΗΣΜΕΤΑΓΡΑΦΗΣ Η σηµασία της γονιδιακής ρύθµισης είναι µεγάλη και µερικά από τα αποτελέσµατά της φαίνονται και στο ακόλουθο πείραµα. Έστωένα φυσιολογικό βακτήριο στο οποίο δεν έχει καταστραφεί η ρύθµιση της βιοσύνθεσης ενός αµινοξέος (έστω της Try).

7 (1ο ) ΡΥΘΜΙΣΗ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ) Έστω ένα άλλο βακτήριο στο οποίο έχει καταστραφεί αυτή η δυνατότητα ρύθµισης, ώστε να µην µπορεί να σταµατήσει τη βιοσύνθεση της Try όταν διαθέτει επαρκήποσότητα Try.

8 (1ο ) ΡΥΘΜΙΣΗ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ) Επώαση των βακτηρίων σε θρεπτικόµέσοµε Try, δείχνειότιη ανάπτυξη του βακτηρίου που διαθέτει τη δυνατότητα ρύθµισης της Try, είναι πολύ µεγαλύτερη από εκείνη που δε διαθέτει αυτή τηνικανότηταρύθµισης.

9 (1ο ) ΡΥΘΜΙΣΗ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ) Μετοπείραµααυτόφαίνεταιότι η λίγη, έστω, ενέργεια που εξοικονοµείται στην πρώτηκαλλιέργεια, είναι αρκετή για να επιδράσει στην ανάπτυξη τουβακτηρίου. Εποµένωςανηρύθµισηενόςµόνογονιδίου (της Try) έχει τόσο εµφανή αποτελέσµατα, µπορεί κανείς κατ επέκταση να αντιληφθεί τη σηµασία της ρύθµισης όλων των γονιδίων.

10 Οπερόνιο (operon) Σύµφωνα µε τον ορισµό των Jacob Monod είναι µια συνάθροιση ή συσσώρευση λειτουργικά αλληλοσχετιζόµενων γονιδίων που ρυθµίζονται και µεταγράφονται σα µια µονάδα µεταγραφής (transcription unit) προς ένα πολυκιστρονικό mrna.

11 (Οπερόνιο) Οι πληροφορίες για τη βιοσύνθεση κάθε πολυπεπτιδίου (ενζύµου κ.λπ.) περιέχονται σε µια λειτουργική µονάδα του DNA που λέγεται κιστρόνιο. Στα προκαρυωτικά, το mrna που µεταγράφεται περιέχει τις πληροφορίες από τα δοµικά γονίδια για όλες τις πρωτεΐνες που περιλαµβάνονται σε ένα οπερόνιο, δηλαδή το mrna είναιπολυκιστρονικό. Στα ευκαρυωτικά και µάλιστα στα θηλαστικά, έχουν βρεθεί µόνοµονοκιστρονικά mrna.

12 Κάθε οπερόνιο αποτελείται από : Τα δοµικά γονίδια (structure genes) που κωδικοποιούν συνήθωςτηβιοσύνθεσηόλωvτωvεvζύµωvεvός πoλυεvζυµικoύ συστήµατoς ή µιας πλήρoυς πoρείας απoικoδόµησης ή βιoσύvθεσης µιας έvωσης. Μια περιοχή σύνδεσης της πολυµεράσης του RNA στην αρχή της σειράς των δοµικών γονιδίων που λέγεται υποκινητής (promoter site).

13 (Κάθε οπερόνιο αποτελείται από ) Μιαήδύοπεριοχέςελέγχουτηςσύνδεσηςκαιτης δραστικότητας της πολυµεράσης του RNA (που ρυθµίζουν τη συχνότηταµεταγραφής). Η µια περιοχή ονοµάζεται χειριστής (operator) ή γovίδια χειριστές (operator genes) ήσυvτovίζovτα (κατευθύvovτα) γovίδια (ή operator loci ή Ο loci). Ο χειριστής είναι η περιοχή που συνδέεται κάποιος ειδικός πρωτεϊνικός παράγοντας, ο οποίος λέγεται καταστολέας (repressor) και ο οποίος, όταν συνδεθεί µε τοχειριστή, δενεπιτρέπειτηνµεταγραφή.

14 Ηάλληπεριοχήελέγχουτηςσύνδεσηςκαιτης δραστικότητας της πολυµεράσης του RNA (που ρυθµίζουν τη συχνότητα µεταγραφής): Λέγεται εκκινητής (initiator ή initiator gene) ή περιοχή σύνδεσης µε τον ενεργοποιητή (positive activator gene) Οεκκινητήςείναιηπεριοχήπουότανσυνδεθείµε κάποιοειδικόπρωτεϊνικόπαράγοντα (ενεργοποιητή) ευνοείται η σύνδεση της πολυµεράσης του RNA στον υποκινητή. Η βιοσύνθεση του καταστολέα και του ενεργοποιητή κατευθύνεταιαπόταρυθµιστικάγονίδια (regulator genes) που συνήθως δεν ανήκουν στο οπερόνιο, αλλά βρίσκονται σεάλληθέσητουµορίουτου DNA.

15 Στον όρο υποκινητής συνήθως περιλαµβάνονται και οι γειτονικές περιοχές που συµβάλλουν σ αυτό, δηλαδή και ο εκκινητής. Η περιοχή του υποκινητή που δεν περιλαµβάνει τον εκκινητή λέγεται βασικός υποκινητής (basic promoter) και περιλαµβάνει τρεις ειδικές περιοχές: Την Rσ, µια ειδική αλληλουχία αναγνώρισης από τον παράγοντα σ. Ο υποκινητή που δεν περιλαµβάνει τον εκκινητή λέγεται βασικός υποκινητής (basic promoter) και περιλαµβάνει τρεις ειδικές περιοχές: Μιαπεριοχή R C, σεµιααπόστασηκάποιωνβάσεωναπό την Rσ, που είναι ειδική αλληλουχία αναγνώρισης από τονπυρήνα (core) τηςπολυµεράσηςτου RNA.

16 Ο υποκινητή που δεν περιλαµβάνει τον εκκινητή λέγεται βασικός υποκινητής (basic promoter) και περιλαµβάνει τρεις ειδικές περιοχές: ΜιαπεριοχήΙπουείναιτοσηµείοέναρξης (initiation) της µεταγραφής. Οεκκινητήςβρίσκεταιπάντοτεδίπλαστονπαράγοντασ, χωρίς επικάλυψη µε το βασικό υποκινητή. Ορόλοςτουενεργοποιητήείναινααυξάνειτησυγγένειατης πολυµεράσης µε το DNA, ισχυροποιώντας το δεσµό και πρέπει να είναι κοντά, ώστε να µπορεί να εξασκεί επιδράσεις αλλοστερικού τύπου, χωρίς να παρεµβάλλεται ανάµεσα στο βασικό υποκινητή και τα δοµικά γονίδια.

17 Ο χειριστής µπορεί να παρεµβάλλεται ανάµεσα στον υποκινητή και τα δοµικά γονίδια, εµποδίζοντας έτσι την πολυµεράσηναπροχωρήσει. Μπορεί ακόµα να υπάρχει και αλληλεπικάλυψη των περιοχών του χειριστή και του βασικού υποκινητή, µε αποτέλεσµα να είναι αδύνατος ακόµα και αυτός ο σχηµατισµόςτουσυµπλόκου DNA-πολυµεράσηςτου RNA (ότανέχειπροηγηθείησύνδεσητουκαταστολέαµετο DNA στηνπεριοχήτουχειριστή).

18 Ο µη σχηµατισµός του συµπλόκου DNA-πολυµεράσης του RNA, δηµιουργεί µια άλλη δυνατότητα που µοιάζει µε την ανταγωνιστικήαναστολή. Ανδηλαδήησυγγένειατηςπολυµεράσηςτου DNA καιτου καταστολέα είναι συγκρίσιµες, η πολυµεράση έχει πιθανότητες να εκτοπίσει τον καταστολέα σύµφωνα µε τους νόµους της κινητικής και να µπορέσει να κάνει µεταγραφή, αλλάµεµικρότερηδραστικότητα. Ηεκτόπισηαυτήτουκαταστολέαδενθαήταντόσοεύκολη, αν η πολυµεράση συναντούσε στο δρόµο της τον καταστολέα, γιατί τότε δεν θα υπήρχαν οι παράγοντες που ισχυροποιούν τη σύνδεση της πολυµεράσης µε τον υποκινητή, δηλαδήηπεριοχή R C, οπαράγονταςσκαιο τυχόν ενεργοποιητής.

19 βαλβίδα κλειστή από φυσικού της που ανοίγει όταν συνδεθεί µε τον ενεργοποιητή βαλβίδα ανοιχτή από φυσικού της που κλείνει και µπλοκάρει τη δίοδο της πολυµεράσης, όταν συνδεθεί µε τον καταστολέα Συµπερασµατικά, οι δύο ελεγκτικές περιοχές του οπερονίου (εκκινητής και χειριστής) µπορούν να παροµοιωθούν µε δύο βαλβίδες. Ο εκκινητής είναι µια βαλβίδα κλειστή από φυσικού της που ανοίγει όταν συνδεθεί µε τον ενεργοποιητή, ενώ Ο χειριστής είναι µια βαλβίδα ανοιχτή από φυσικού της που κλείνει και µπλοκάρει τη δίοδο της πολυµεράσης, όταν συνδεθεί µε τον καταστολέα.

20 Το κλείσιµο ή άνοιγµα της βαλβίδας (στον εκκινητή και χειριστή) γίνεται µε τη συνεργασία µιας ρυθµιστικής πρωτεΐνης (ενεργοποιητή ή καταστολέα) και ενός µικρού µορίου. ηλαδή, οι ρυθµιστικές αυτές πρωτεΐνες έχουν διπλή λειτουργικότητα. Συνδέονται µε ειδικές περιοχές του DNA, Συνδέονται µε µικρά µόρια τα οποία ασκούν αλλοστερικές επιδράσεις και αλλάζουν τη διαµόρφωση των ρυθµιστικών πρωτεϊνών. Κατά συνέπεια αν και οι ρυθµιστικές πρωτεΐνες που δρουν στο χειριστή λέγονται καταστολείς, µπορούν να προκαλούν και καταστολή αλλά καιεπαγωγή, όπως φαίνεται και από τα ακόλουθα παραδείγµατα.

21 ΕΠΑΓΩΓΗ ΜΕ ΚΑΤΑΣΤΟΛΕΑ ΑΡΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ (Η ρυθµιστική πρωτεϊνη βιοσυντίθεται δραστική) Καταβολικές πορείες. Μικρές απαιτήσεις για έκφραση. Σπάνεια το υπόστρωµαεπαγωγέας βρίσκεται σε υψηλές συγκεντρώσεις. ΕΠΑΓΩΓΗ ΜΕ ΕΝΕΡΓΟΠΟΙΗΤΗ ΚΑΤΑΣΤΟΛΗ ΜΕ ΚΑΤΑΣΤΟΛΕΑ ΚΑΤΑΣΤΟΛΗ ΜΕ ΕΝΕΡΓΟΠΟΙΗΤΗ ΘΕΤΙΚΟΣ ΕΛΕΓΧΟΣ (Η ρυθµιστική πρωτεϊνη βιοσυντιθεται µη δραστική) ΘΕΤΙΚΟΣ ΕΛΕΓΧΟΣ ΑΡΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Καταβολικές πορείες. Μεγάλες απαιτήσεις για έκφραση. Συχνά το υπόστρωµαεπαγωγέας βρίσκεται σε υψηλές συγκεντρώσεις. Βιοσυνθετικές πορείες. Μικρές απαιτήσεις για έκφραση. Συχνά τα προϊόντα βρίσκεται σε υψηλές συγκεντρώσεις. Βιοσυνθετικές πορείες. Μεγάλες απαιτήσεις για έκφραση. Σπάνια τα προϊόντα βρίσκεται σε υψηλές συγκεντρώσεις.

22 Έστω µια καταβολική πορεία, όπου το υπόστρωµα ανήκει στην τάξη των µικρών µορίων που ασκούν αλλοστερικές επιδράσεις στις ρυθµιστικές πρωτεΐνες. Το υπόστρωµα µπορεί να δρα σαν επαγωγέας και όταν συνδεθεί µε τον καταστολέα να τον τροποποιεί, ώστε ο καταστολέαςναµηνµπορείνασυνδεθείµετοχειριστήγιανα παρεµποδίσει τη µεταγραφή και έτσι να επάγεται η πορεία (επαγωγή µε καταστολέα, αρνητικός έλεγχος).

23 Έστω µια καταβολική πορεία, όπου το υπόστρωµα δρα και πάλισανεπαγωγέας. Όταν το υπόστρωµα συνδεθεί µε τον ενεργοποιητή να τον τροποποιεί ώστε να γίνεται δυνατή η σύνδεση του ενεργοποιητή µε τον εκκινητή και έτσι να γίνεται µεταγραφή και να επάγεται η πορεία (επαγωγή µε ενεργοποιητή, θετικός έλεγχος).

24 Έστω µια βιοσυνθετική πορεία που το τελικό προϊόν ανήκει στην τάξη των µικρών µορίων που ασκούν αλλοστερικές επιδράσεις στις ρυθµιστικές πρωτεΐνες. Το προϊόν µπορεί να δρα σα συν-καταστολέας, δηλαδή όταν συνδεθεί µε τον καταστολέα (που στην περίπτωση λέγεται απο-καταστολέας) να τον τροποποιεί ώστε να γίνεται δυνατήησύνδεσητουκαταστολέαµετοχειριστήκαινα παρεµποδίζεται η µεταγραφή, µε αποτέλεσµα να καταστέλλεται η πορεία (καταστολή µε καταστολέα, θετικός έλεγχος).

25 Έστω µια βιοσυνθετική πορεία που το τελικό προϊόν ανήκει στην τάξη των µικρών µορίων που ασκούν αλλοστερικές επιδράσεις στις ρυθµιστικές πρωτεΐνες. Το προϊόν δρα και πάλι σα συν-καταστολέας, δηλαδή όταν συνδεθεί µε τον ενεργοποιητή να τον τροποποιεί ώστε να µη γίνεται δυνατή η σύνδεση του ενεργοποιητή µε τον εκκινητή και έτσι να µην γίνεται µεταγραφή και να καταστέλλεται η πορεία (καταστολή µε ενεργοποιητή, αρνητικός έλεγχος).

26 ΕΠΑΓΩΓΗ ΜΕ ΚΑΤΑΣΤΟΛΕΑ (Η ρυθµιστική πρωτεΐνη βιοσυντιθεται δραστικη ) Κατανολικές πορείες Μικρές απαιτήσεις για έκφραση Σπάνια το υπόστρωµα-επαγωγέας βρίσκεται σε υψηλές συγκεντρώσεις. ΕΠΑΓΩΓΗ ΜΕ ΕΝΕΡΓΟΠΟΙΗΤΗ (Η ρυθµιστική πρωτεϊνη βιοσυντιθεται µη δραστική) Καταβολικές πορείες. Μεγάλες απαιτήσεις για έκφραση. Συχνά το υπόστρωµα-επαγωγέας βρίσκεται σε υψηλές συγκεντρώσεις. ΚΑΤΑΣΤΟΛΗ ΜΕ ΚΑΤΑΣΤΟΛΕΑ Βιοσυνθετικές πορείες. Μικρές απαιτήσεις για έκφραση. Συχνά τα προϊόντα βρίσκεται σε υψηλές συγκεντρώσεις. ΚΑΤΑΣΤΟΛΗ ΜΕ ΕΝΕΡΓΟΠΟΙΗΤΗ Βιοσυνθετικές πορείες. Μεγάλες απαιτήσεις για έκφραση. Σπάνια τα προϊόντα βρίσκεται σε υψηλές συγκεντρώσεις. ΑΡΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ ΘΕΤΙΚΟΣ ΕΛΕΓΧΟΣ ΘΕΤΙΚΟΣ ΕΛΕΓΧΟΣ ΑΡΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ

27 ηλαδή στις καταβολικές πορείες συµβαίνουν τα αντίστροφα απ όσα ισχύουν για τις βιοσυνθετικές πορείες. Συµπερασµατικά: Ο καταστολέας χρησιµοποιείται όταν οι απαιτήσεις έκφρασης των γονιδίων είναι µικρές, ενώ Ο ενεργοποιητής όταν οι απαιτήσεις έκφρασης των γονιδίων είναι µεγάλες.

28 Η θεωρία τoυ oπερόvιoυ εξηγεί και τη δράση σχεδόv όλωv τωvστερoειδώv oρµovώvστoυςαvώτερoυς oργαvισµoύς. ηλαδή, oι oρµόvες είτε είvαι καταστoλείς ή συv-καταστoλείς εvός (ή περισσότερωv) oπερόvιωv, είτεείvαιεπαγωγείς. Βέβαια, επαγωγείς και καταστoλείς µπoρεί vα είvαι και διάφoρoι µεταβoλίτες ή και φάρµακα. Στα πρoκαρυωτικά κύτταρα, η πρώτη περίπτωση τέτoιoυ ελέγχoυ µελετήθηκε από τoυς Monod και Jacob στηv E.coli και απoτέλεσε τη "θεωρία τoυ oπερόvιoυ", πoυ είvαι έvας µηχαvισµός εvζυµικής επαγωγής και καταστoλής.

29 Η E.coli χρησιµoπoιεί τη γλυκόζη σαv πηγή τoυ αvθρακικoύ σκελετoύόλωvτωvσυστατικώvτης. Αv όµως βρεθεί σε περιβάλλov πoυ αvτί γλυκόζης έχει λακτόζη, τότε για vα τηv αξιoπoιήσει σαv πηγή ατόµωv άvθρακαπαράγειτρία vέαέvζυµα, πoυπρoϋπήρχαvµεv, αλλά σε ίχvη: β-γαλακτoζιδάση (για τηv υδρόλυση της λακτόζης σε µovoσακχαρίτες), µια περµεάση (πoυ καταλύει τη µεταφoρά της γαλακτόζης µέσα στo κύτταρo) και µιατραvσακετυλάση (µεαδιευκρίvιστορόλo). ηλαδή, η βιoσύvθεση τωv τριώv εvζύµωv επάγεται από τη λακτόζη, πoυ δρα σαv επαγωγέας. Στηv πραγµατικότητα, επαγωγέας είvαι η αλλoλακτόζη (πoυ έχει γλυκoζιτικό δεσµό 1-6 και πρoκύπτει από τη λακτόζη) και ταίχvηβ-γαλακτoζιδάσης,πoυόπωςαvαφέρθηκε, πρoϋπάρχoυvστoκύτταρo.

30 Ο µηχαvισµός της "θεωρίας τoυ oπερόvιoυ", για την περίπτωση της εvζυµικής επαγωγής, που είvαι γvωστός σα συvτovισµέvη επαγωγή, είvαι o εξής: Τo oπερόvιo της E.coli για τη χρησιµoπoίηση της λακτόζης λέγεται lac operon. Τα δoµικά γovίδια που περιέχoυv τov κώδικα για τo σχηµατισµό τωv εvζύµωvείναι η z περιoχή (z locus) που κωδικoπoιεί τη β-γαλακτoζιδάση η y περιoχή (y locus) που κωδικoπoιεί τηv περµεάση και η a περιoχή (a locus) που κωδικoπoιεί τηv τραvσακετυλάση.

31 Όταvυπάρχειδιαθέσιµoς o επαγωγέας (πoυ είvαι τo υπόστρωµα, δηλαδήηλακτόζη) σχηµατίζεται σύµπλoκo µε τov καταστoλέα, πoυ δεv µπoρεί πια vα είvαι δεσµευµέvoς στο χειριστή (αδραvoπoιηµέvoς καταστoλέας). Έτσι πρoχωρά η πoλυµεράση τoυ RNA στη µεταγραφή τoυ DNA, παράγοvταςτo mrna, πουµεταφραζόµεvo, βιoσυvθέτει τα (τρία) έvζυµα (άρση της καταστoλής)

32 Τα έvζυµα αυτά, στη συvέχεια: 1 ο )Είτεαπoικoδoµoύvτov επαγωγέα (1ηπερίπτωση), oπότε λόγω ελάττωσης της συγκέvτρωσηςτoυεπαγωγέα, επαvεvεργoπoιείται o καταστoλέας. 2 ο )Είτε (2ηπερίπτωση) τα πρoϊόvτα απoικoδόµησης τoυ επαγωγέαεκτoπίζoυvτovεπαγωγέααπότovαδραvoπoιηµέvo κατάστoλέα και τo vέo σύµπλoκo τoυ καταστoλέα πoυ πρoκύπτει (µη αδραvoπoιηµέvoυ καταστoλέα) δεv είvαι πλέovαδραvές. Και στις δύo αυτές περιπτώσεις, o καταστoλέας επαvεvεργoπoιείται και διακόπτεται η περαιτέρω βιoσύvθεση τωv εvζύµωv. Αφού ο καταστολέας είναι µη δραστικός και γίνεται δραστικόςέχουµεθετικόέλεγχο (positive control).

33 Ο µηχαvισµός της "θεωρίας τoυ oπερόvιoυ", για την περίπτωση της εvζυµικής καταστoλής, που είvαι γvωστός σα συvτovισµέvη καταστoλής, είvαι o εξής: Τoαvτίστoιχo oπερόvιo (στησυvτovισµέvηκαταστoλής ) µεταγράφεται σε mrna, πoυ µεταφραζόµεvo, παράγει βιoσυvθετικά έvζυµα πoυ φέρoυv σε πέρας µια βιoσυvθετική πoρεία (γιαπαράδειγµατηςιστιδίνης).

34 Τo τελικό πρoϊόv της βιoσυvθετικής αυτής πoρείας, ηιστιδίνηπουείναι o συvκατάστoλέας δρα σαv πρoσθετική oµάδα. Έτσι µετατρέπεται ο µη δραστικός καταστoλέας (απoκαταστoλέας) σε δραστικό καταστoλέα, και διακόπτεται η µεταγραφή. Η συvτovισµέvη καταστoλή ισχύει, κατά καvόvα, για περιπτώσεις εvζυµικής καταστoλής και ρυθµίζει τηv παραγωγή εvζύµωv πoυ καταλύoυv βιoσυvθετικές πoρείες. Γιατί στις περιπτώσεις αυτές παρoυσιάζεται η αvάγκη vα υπάρξει έvας µηχαvισµός πoυ vα διακόπτει τηv παραγωγή βιoσυvθετικώv εvζύµωv, όταv η συγκέvτρωση τoυ τελικoύ πρoϊόvτoς αυξηθεί.

35 Στα ευκαρυωτικά κύτταρα, αv και δεv είvαι γvωστά πoλλά πράγµατα, η ρύθµιση θα πρέπει vα γίvεται µε αvτίστoιχoυς µηχαvισµoύς, µόvoπoυπιστεύεταιότιείvαιπιoπoλύπλoκoι, αφoύ η έκφραση τωv γovιδίωv ρυθµίζεται από έvα oλόκληρo συvδυασµό µηχαvισµώv συvτovισµέvης επαγωγής και καταστoλής. Άλληδιαφoράέγκειταιστoεξής: Ηπρόσδεσητoυ καταστoλέα στα ευκαρυωτικά γίvεται, συvήθως, σε περιoχή τoυ DNA περισσότερo απoµακρυσµέvη από τηv πoλυµεράση τoυ RNA. Και τoύτo γιατί η αλυσίδα τoυ DNA µπoρεί vα σχηµατίζει δακτύλιoυςκαιέτσιστoχώρoηπεριoχήαυτήµπoρεί vα βρίσκεται πoλύ κovτά και µάλιστα αvάµεσα στoν υποκινητή και τα δoµικά γovίδια.

36 Πολυσθενής καταστολή Παρουσιάζεται σε βιοσυνθετικές πορείες οι οποίες καταλήγουν σε δύο προϊόντα, όπως η πορεία βιοσύνθεσης της Valκαι Ile.

37 Τα προϊόντα αυτά δρουν σαν συν-καταστολείς, οι οποίοι όταν συνδεθούν µε µη δραστική µορφή του καταστολέα (που στηνσυγκεκριµένηπερίπτωσηλέγεταιαπο-καταστολέας) τουαλλάζουντηδοµήκαιτονκάνουνικανόνασυνδεθείµετο χειριστή, µε αποτέλεσµα να σταµατήσει η µεταγραφή. Λέγεται πολυσθενής καταστολή, γιατί υπάρχουν περισσότεροι του ενός συν-καταστολείς. Όταν τα σύµπλοκα του απο-καταστολέα και καθ ενός από τους συν-καταστολείς προκαλούν µερική καταστολή, πρόκειται για πολυσθενή καταστολή Όταν το τριπλό σύµπλοκο του απο-καταστολέα και των δύο συν-καταστολέων προκαλεί ολική καταστολή (όπως συµβαίνειστησυνθάσητουκαρβαµυλο-φωσφο-ρικούοξέος), πρόκειται για πολυσθενή και αθροιστική καταστολή.

38 Ρεγγουλόνιο Οι ονοµασίες που χρησιµοποιούνται είναι ρεγγουλόνιο (regulon) ή ρυθµιστρόνιο ή µονάδα ρύθµισης (unit of regulation) γονιδίων ή µονάδα συντονισµένης ρύθµισης γονιδίων, που δεν είναι συναθροισµένα το ένα δίπλα στο άλλο. Έχειταίδιαχαρακτηριστικά µε το οπερόνιο µετηδιαφοράότιτα δοµικά γονίδια βρίσκονται µόνατουςή καθ οµάδες σεδιαφορετικάσηµείατου DNA. Στην αρχή κάθε οµάδας δοµικών γονιδίων υπάρχει η περιοχή υποκινητής χειριστής µε την ίδια αλληλουχία βάσεων DNA, οπότε η έκφραση ρυθµίζεται από το ίδιο ρυθµιστικό γονίδιο, δηλαδήαπότονίδιοκαταστολέα.

39 Έχει σηµασία για τους ανώτερους οργανισµούς που χρειάζονται συντονισµένη ρύθµιση διαφόρων γονιδίων που όµως δεν έχουν ακόµα αποτελέσει οπερόνιο. Ένα παραδειγµα ρεγγουλόνιου συναντάται στην πορεία βιοσύνθεσηςτηςαργινίνης, ηοποίαέχει 8 διαδοχικάστάδια. Στα βακτήρια τα γονίδια των 8 ενζύµων είναι διασπαρµένα σε διάφορα σηµεία, αλλά ρυθµίζονται από τον ίδιο καταστολέα, αφού όλα έχουν το ίδιο ρυθµιστικό γονίδιο.

40 ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή.

41 ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει σε δύο προϊόντα (συνκαταστολείς) και το ένζυµο της πρώτης αντίδρασης αποτελεί καταστολέα (απο-καταστολέα), ο οποίος µπορεί να συνδεθεί µε το χειριστή µόνο όταν έχει τροποποιηθεί η δοµή του από τη σύνδεσή του µε τους συν-καταστολείς. Σαρυθµιστικόγονίδιοδρατοπρώτοδοµικόγονίδιο, ενώ τα άλλα δοµικά γονίδια κωδικοποιούν τα άλλα ένζυµα τηςπορείας. Το σύστηµα αυτό έχει αυτόνοµη ρύθµιση γιατί όταν υπάρχει διαθέσιµο µόνο το υπόστρωµα τόσο η µεταβολική πορεία όσοκαιηµεταγραφή µπορούν απρόσκοπτα να προχωρούν.

42 ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµηκαταστολή: Όταν σχηµατισθούν τα προϊόντα της αντίδρασης δενείναιδιαθέσιµοτοένζυµοτηςπρώτηςαντίδρασης, δεσµεύεται στο χειριστή ο καταστολέας (το σύµπλοκο ενζύµου και προϊόντων) και παρεµποδίζεται η µεταγραφή (αυτόνοµη καταστολή).

43 (ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµηκαταστολή) 2) Αυτόνοµηεπαγωγή. Μεταβολική πορεία στην οποία το ένζυµο της πρώτης αντίδρασης αποτελεί καικαταστολέαπουσυνδέεταιµετοχειριστή, µόνο όταν δεν έχει δεσµεύσει το υπόστρω- µα το οποίο στην συγκεκριµένη περίπτωση δρα σαν επαγωγέας Σαρυθµιστικόγονίδιοδρατοπρώτοδοµικόγονίδιο, ενώτα άλλα δοµικά γονίδια κωδικοποιούν τα άλλα ένζυµα της πορείας. Έχει αυτόνοµη ρύθµιση γιατί Α) παρουσία του υποστρώµατος τόσο η µεταβολική πορεία όσο και η µεταγραφή µπορούν απρόσκοπτα να προχωρούν. Β) όταν εξαντληθεί το υπόστρωµα της αντίδρασης δενείναιδιαθέσιµοτοένζυµοτηςπρώτηςαντίδρασης, δεσµεύεται στο χειριστή ο καταστολέας (το ένζυµο) και παρεµποδίζεται η µεταγραφή.

44 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ Η επέκταση των µηχανισµών λειτουργίας των ρεγγουλόνιων οδηγεί σε συστήµατα οµαδικής ρύθµισης πολλών οπερόνιων ταυτόχρονα µε αποτέλεσµα την ολοκλήρωση της µεταβολικής ρύθµισης (integration of regulatory mechanisms). Τα οπερόνια και ρεγγουλόνια παρέχουν στον οργανισµό τη δυνατότητα εξειδικευµένης απόκρισης σε περιβαλλοντικές αλλαγές. Τα ολοκληρωµένα ρυθµιστικά συστήµατα επιτρέπουν το συντονισµό µιας ολόκληρης σειράς αποκρίσεων, που όµως σχετίζονται λειτουργικά. Υπάρχουν δύο τουλάχιστον τέτοια συστήµατα, γνωστά σαν 1) Καταστολήκαταβολιτών (catabolite repression) και 2) Αυστηρόςήκαταπιεστικόςέλεγχος (stringent control, stringency).

45 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολήκαταβολιτών: Μια οµάδα οπερόνιων, που σχετίζονταιλειτουργι-κά, έχουνθετικόέλεγχο: Α) Με το ίδιο πρωτεϊνικό µόριο, το CAP (Catabolite ή Repressor Protein) ήπιο σωστά, στην πραγµατικό-τητα πρόκειται για ενεργοποιητή (Catabolite-gene Activator Protein). Β) Τον ίδιο επαγωγέα, που στην προκειµένη περίπτωση είναι το camp.

46 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Το CAP- camp συνδέεται µε τον εκκινητή πολλών οπερόνιων που όλα ρυθµίζουν καταβολικές πορείες(είναι ένας πλειοτροπικόςρυθµιστής). Καθένααπόταοπερόνιαπουελέγχονταιαπότο CAPcAMP µπορεί να εκφρασθεί, αλλά αυτό εξαρτάται και από ένα δεύτερο ρυθµιστικό µηχανισµό που χρησιµοποιεί το χειριστή. Στο ρυθµιστικό αυτό µηχανισµό συµµετέχει και το ειδικό για κάθε οπερόνιο (καταβολικό) υπόστρωµα, που συνδέεται µε τον καταστολέα και το µετατρέπει σε ανενεργή µορφή, µε αρνητική ρύθµιση.

47 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Παράδειγµα τέτοιας ρύθµισης συναντάται στα βακτήρια, όταν υπάρχει διαθέσιµη για αποικοδόµηση γλυκόζη, λακτόζη και αραβινόζη. Στο DNA υπάρχουν οπερόνια για τη γλυκόζη, λακτόζη και αραβινόζη, που κάθε ένα διαθέτει έναν εκκινητή και ένα χειριστή. Στον κάθε εκκινητή συνδέεται το CAP- camp, αλλά µε διαφορετικήχηµικήσυγγένειαγιατονκαθένα. Ο καταστολέας (διαφορετικός για κάθε οπερόνιο) υπάρχει σε δραστική µορφή και είναι συνδεδεµένος µε το χειριστή κάθεοπερονίουκαιπαρεµποδίζεταιηµεταγραφή.

48 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Όταν υπάρχουν διαθέσιµα µόρια γλυκόζης ή/και λακτόζης ή/και αραβινόζης τότε αυτά δεσµεύουν τον αντίστοιχο καταστολέα, τον κάνουν µη δραστικό µε αποτέλεσµα να αποµακρύνεται από το χειριστήκαιέτσιναείναιδυνατήηµεταγραφή. Συγκεκριµένα για τα βακτήρια, όταν υπάρχει διαθέσιµη γλυκόζη, τοεπίπεδοτου campδιατηρείταιχαµηλό. Ότανλείψειηγλυκόζηανεβαίνειησυγκέντρωσητου camp, σχηµατίζεται το CAP- camp και συνδέεται στις θέσεις των εκκινητών, αλλά δεν αρχίζει η µεταγραφή, γιατί υπάρχουν τα µόριατουκαταστολέασυνδεδεµέναστιςθέσειςτουχειριστή.

49 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Αν στο περιβάλλον υπάρχει λακτόζη, αυτή σχηµατίζει ανενεργό σύµπλοκο µε τον αντίστοιχο καταστολέα και έτσι επιτρέπειτηλειτουργίατου Lac-operon. Αν διατίθεται αραβινόζη, τότε ενεργοποιείται µε τον ίδιο τρόπο το Ara-operon. Αντίστοιχακαιγιατηγλυκόζη. Ανδιατίθενταικαιτατρίασάκχαραήσυνδυασµοίαυτών, τότε αποικοδοµείται η γλυκόζη, µετά η λακτόζη και τέλος η αραβινόζη.

50 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Η σειρά αυτή λόγω διαφοράς ευαισθησίας των δια-φόρων οπερόνιων στο CAP- camp, από τη διαφορετική χηµική συγγένεια του CAP- camp προς τους εκκινητήρες των τριών οπερόνιων. Το CAP- camp έχει µεγαλύτερη συγγένεια για το οπερόνιο της γλυκόζης, µετά της λακτόζης και τέλος αραβινόζης, µε αποτέλεσµα να ενεργοποιεί ανάλογα και τα αντίστοιχα οπερόνια.

51 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών: Ο µηχανισµός αυτός επιτρέπει στους οργανισµούς να διαλέγουντηδίαιτάτους, όταντοδιαιτολόγιοείναιµεγάλο. Σε συνδυασµό µε την χηµειοταξία (την ικανότητα των κυττάρων να οδεύουν προς κάποιες ουσίες) που και αυτή υπόκειται στο µηχανισµό της καταστολής των καταβολιτών ταβακτήριαδεδιαλέγουνµόνοτηντροφήτουςαπότη διαθέσιµη στο άµεσο περιβάλλον τους αλλά συνδυάζουν αυτή την επιλογή µε µετακίνηση σε άλλο περιβάλλον, πιο επιθυµητό από αυτά, όταν το περιβάλλον αυτό υπάρχει εκεί κοντά.

52 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών 2) Αυστηρός ή καταπιεστικός έλεγχος: Αντιστοιχεί στην έκφραση σφίξιµο του ζωναριού ή περίοδος ισχνών αγελάδων. Πρόκειται για: µηχανισµό συντονισµένου ελέγχου µιας οµάδας οπερόνιων, που σχετίζονται λειτουργικά (όπως στην προηγούµενη περίπτωση), αλλάσεπολύπιογενικόβαθµό, οοποίοςµεταξύτων άλλων περιλαµβάνει: αρνητική ρύθµιση και θετική ρύθµιση

53 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών 2) Αυστηρός ή καταπιεστικός έλεγχος: Αρνητική ρύθµιση: στη βιοσύνθεση rrna των ριβοσωµικών πρωτεϊνών (δηλαδή περιορισµός αριθµούριβοσωµάτων) trnaκαι Θετική ρύθµιση: ορισµένων βιοσυνθετικών οπερόνιων αµινοξέων (His,Try, Ile, Val) ή/και καταβολικών οπερόνιων (Lac-operon), και επίδραση στη διαπερατότητα των µεµβρανών στηβιοσύνθεσηλιποπολυσακχαριτώνκ.λπ.

54 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών 2) Αυστηρός ή καταπιεστικός έλεγχος: Στο πλειοτροπικό αυτό αποτέλεσµα το ρόλο του επαγωγέα παίζουν δύο µόρια-σήµατα η τετρα-φωσφορική γουανοσίνη (ppgpp) και η πεντα-φωσφορική γουανοσίνη (pppgpp), οι οποίες όταν πρωτοανακαλύφθηκαν από τον O.Maaloe µε χαρτοηλεκτροφόρησηονοµάστηκανµαγικέςκηλίδεςικαιιι. Το ppgpp είναι ένα παράδειγµα του ειδικού εκείνου τύπου των µορίων-σηµάτων, για τα οποία ο Ames πρότεινε τον όρο αλαρµόνες. Οι ενώσεις ppgpp, camp, cgmp χρησιµεύουν: στο να αναπροσανατολίζουν τις κυτταρικές επενδύσεις ενέργειας σεανταπόκρισηκάποιαςδύσκοληςκατάστασης (stress) σεέναµεταβολικόπεδίο.

55 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών 2) Αυστηρός ή καταπιεστικός έλεγχος: Σε έλλειψη αµινοξέων δηµιουργείται περίσσεια ελεύθερων trna, τα οποία µπορούν να εισχωρήσουν (αντιστρεπτά) στις θέσεις Α και Ρ των ριβοσωµάτων, ενός συµπλόκου ριβοσώµατος-mrna. Αν κάποιο από τα ελεύθερα trna που εισχωρούν στην θέσηα συµβαίνει να έχει την αντικωδική τριάδα που αντιστοιχεί στην κωδική τριάδα του mrna που βρίσκεται εκείνη τι στιγµήστηθέσηα,τότε: µε το δεσµό µεταξύ της κωδικής-αντικωδικής τριάδας που αναπτύσσεται το ελεύθερο trna προσανατολίζεται στην κανονική του θέση.

56 ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών 2) Αυστηρός ή καταπιεστικός έλεγχος: Στηθέσηαυτήηδιαδοχή TψCGτου τρίτου βραχίονα του trna (που λέγεται βραχίονας ψευδο-ουριδίνης) µπορεί να αλληλεπιδράσει µε µια ριβοσωµική πρωτεΐνη γνωστή σαν αυστηρός παράγοντας (SF). Ηβιοσύνθεσητου SFκατευθύνεταιαπόέναειδικόγονίδιο, γνωστόσαν rela, γιατί µετάλλαξη του rela οδηγεί στο λεγόµενο χαλαρό έλεγχο (relaxed control). Το σύµπλοκο TψCG- SF ευνοεί τη βιοσύνθεση ppgpp και pppgppαπό GDP. Η ppgpp είναι αλλοστερικός ρυθµιστής της πολυµεράσης του RNA, ηοποίαρυθµίζειτηµεταγραφικήτηςεπιλογή.

57 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών) 2) Αυστηρός ή καταπιεστικός έλεγχος: ηλαδήηπολυµεράσηςτου RNA αλλάζειτηχηµικήτηςσυγγένειαπροςτιςπεριοχές R C των υποκινητών διαφόρων οπερόνιων που σχετίζονται λειτουργικά, όχιαπότηνάποψηανείναιόλαταοπερόνιααναβολικά ήόλακαταβολικά, αλλάγενικάµετηνοικονοµίατουκυττάρουσε περιπτώσεις, που όπως αναφέρθηκαν, αντιστοιχούν στην έκφραση σφίξιµο του ζωναριού ή περίοδος ισχνών αγελάδων.

58 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών) 2) Αυστηρός ή καταπιεστικός έλεγχος: Πρόκειται, δηλαδή για ένα µηχανισµό δραστικής αναπροσαρµογής της γενικής µεταβολικής στρατηγικής τουκυττάρου, µε σκοπό την αντιµετώπιση περιβαλλοντικών ή ενδοκυτταρικώνκαταστάσεων. Γιατολόγοαυτόκαιβακτήριαµεµεταλλαγµένοτο γονίδιο rela αντιµετωπίζουν µεγάλες δυσκολίες στην ανάπτυξή τους, όταν µεταβληθούν απότοµα οι περιβαλλοντικές συνθήκες.

59 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών) 2) Αυστηρός ή καταπιεστικός έλεγχος: Οµηχανισµόςµετονοποίοη ppgppαλλάζειτις προτιµήσεις της πολυµεράσης του RNA δεν είναι γνωστός µε λεπτοµέρειες. Φαίνεται ότι είναι αποτέλεσµα πολύπλοκων αλληλεπιδράσεωνκαιµεάλλασυστατικάτουκυττάρου, όπως τονπαράγονταέναρξης IF2, άλλουςπαράγοντες (όπως EF-T, EF-G,IF-2 κ.λπ.), το fmet-trnaf και άλλα trna τα οποία φέρουν αµινοξέα, των οποίων οι αλληλεπιδράσεις µε την πολυµεράσηείναιγνωστές.

60 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1) Καταστολή καταβολιτών) 2) Αυστηρός ή καταπιεστικός έλεγχος: Περιληπτικά οι αλληλεπιδράσεις µε την πολυµεράση και οι άλλοιπαράγοντεςπουεµπλέκονταιέχουνωςεξής: Η πολύµεράση του RNA σχηµατίζει σύµπλοκα µε το fmettrna F καιτονπαράγοντα IF 2. Το πρώτο σύµπλοκο (πολύ-µεράση RNA - fmet-trna F ) έχει in vitro δραστικότητα: αυξηµένη στη µεταγραφή Lac-operon και διαφορετική στη µεταγραφή σταθερώνγονιδίων.

61 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1)Καταστολή καταβολιτών) 2)Αυστηρός ή καταπιεστικός έλεγχος: Το δεύτερο σύµπλοκο (πολυµεράση RNA- IF 2 ) ευνοεί τη µεταγραφή rrna και το σχηµατισµό συµπλόκου. Υπάρχει εποµένως ανταγωνισµός για το fmettrna F από την πολύµεράση του RNA και τοσύµπλοκο mrna-30s υποµονάδα RNA.

62 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1)Καταστολή καταβολιτών) 2)Αυστηρός ή καταπιεστικός έλεγχος: Όταν ελαττωθεί το mrna ευνοείται ο σχηµατισµός του συµπλόκου πολυµεράση RNA - fmet-trna F καιηµεταγραφήτου Lac-operon. Περίσσεια mrna ελαττώνει το διαθέσιµο fmet-trna F και ευνοεί το σχηµατισµό του συµπλόκου πολυµεράση RNA - IF 2 και της µεταγραφής rrna

63 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1)Καταστολή καταβολιτών) 2)Αυστηρός ή καταπιεστικός έλεγχος: Η ppgpp ανταγωνίζεται µε τον IF 2 γιατην πολυµεράση RNA, και εξηγείται η αναστολή τηςµεταγραφής rrna, ριβοσωµικών πρωτεϊνών κ.λπ. Η ευνοϊκή επίδραση της ppgpp στη µεταγραφή του Lac-operon (ήάλλαοπερόνια) µπορείναοφείλεται: Ι) στο σύµπλοκο πολυµεράση RNA-ppGpp ΙΙ) σε σχηµατισµό άλλου συµπλόκου (π.χ. πολύµεράση RNA - ppgpp - fmet-trna F ) ΙΙΙ) στην πιθανότητα να µην αναστέλλει η ppgpp το σχηµατισµό του συµπλόκου πολυµεράση RNA -fmet-trnaf.

64 (ΟΛΟΚΛΗΡΩΣΗ ΤΗΣ ΡΥΘΜΙΣΗΣ ΣΤΟ ΕΠΙΠΕ Ο ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ 1)Καταστολή καταβολιτών) 2)Αυστηρός ή καταπιεστικός έλεγχος: Όλες αυτές οι δυνατότητες είναι πολύ πιθανές τόσοστηνπερίπτωσητου Lac-operon, όσοκαισταάλλαοπερόνιαπουηµεταγραφήτουςευνοείταιαπό την ppgpp. Πολλά trna τα οποία φέρουν αµινοξέα, ευνοούν τη µεταγραφή των αντίστοιχων οπερόνιων (π.χ. το His-tRNA του His-operonκ.λπ.) όπωςστηνπερίπτωση fmet-trna F - Lac-operon. Ειδικά, η ταχύτητα µεταγραφής του His-operon αυξάνεται ανάλογαµετησυγκέντρωσητου ppgppκαιότανδεν υπάρχει έλλειψη His, γεγονός που δείχνει ότι και οι τρεις από τις δυνατότητες που αναφέρθηκαν µπορεί να συµβάλλουν. Ηειδικήεπίδρασητης ppgppστο His-operonείναινα ρυθµίζει τη σύνθεση των βιοσυνθετικών ενζύµων της ιστιδίνης, ανάλογα µε τις ανάγκες για ιστιδίνη και τη σχετική διαθεσιµότητα άλλων αµινοξέων.

65 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Ανκαιοκύριοςτρόποςρύθµισηςτωνγονιδίωνείναιη ρύθµισήτουςστηναρχήτηςµεταγραφής (Ρύθµιση1), υπάρχουν και άλλοι τρόποι ρύθµισης που δρουν κατά την πορεία της µεταφοράς της πληροφορίας από το RNA στην πρωτεΐνη (Ρύθµιση2). Ένας από αυτούς τους τρόπους ρύθµισης, αποτελεί και η ρύθµιση, που γίνεται αφούηπολυµεράσητου RNA έχεισυνδεθείµετογονίδιο στον υποκινητή και έχειήδηαρχίσειησύνθεσητου RNA. ηλαδή πρόκειται για ένα µηχανισµό που κάνει σύζευξη των πορειών της µεταγραφής και τηςµετάφρασης. Τοφαινόµενοαυτό, µετοοποίογίνεταιηρύθµισηµερικών αµινοξέων, είναι γνωστό σαν εξασθένηση (attenuation).

66 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Σαν παράδειγµα θα χρησιµοποιηθεί η περίπτωση της ρύθµισης του αµινοξέος θρυπτοφάνη (Try), το οπερόνιο της οποίας δενέχειρύθµισηµετοµηχανισµότηςκαταστολήςτων καταβολιτών,

67 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Αλλά η ρύθµισης του αµινοξέος θρυπτοφάνη (Try) γίνεται αφ ενόςµενµετηναυτόνοµηρύθµιση (αυτόνοµη καταστολή) αφ ετέρουδεµετοφαινόµενοτηςεξασθένησης.

68 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Στοοπερόνιοτης Try, µεταξύτου χειριστή και του πρώτου δοµικού γονιδίου, υπάρχει µια περιοχή που αποτελεί µια ελεγχόµενη θέση τερµατισµού της µεταγραφής και λέγεταιεξασθενητής. Το mrnaτης Try, πριναπότο κωδικόνιο της έναρξης των δοµικών γονιδίων, έχει µια αλληλουχία-οδηγό που φέρει δύο διαδοχικά κωδικόνια Try. Οι αλληλουχίες οδηγοί για τα διάφορα αµινοξέα, έχουν σχετικά µεγάλη αναλογία από το ρυθµιζόµενο αµινοξύ, µε αποτέλεσµα να αποτελούν µηχανισµό αναγνώρισης των επιπέδωντουρυθµιζόµενουαµινοξέοςµέσαστοκύτταρο. Το mrna της Try φέρει 4 τµήµατα (1,2,3 και 4) που ανά δύο µπορούν να σχηµατίσουν δίκλωνη αλυσίδα, µέσω των συµπληρωµατικώντουςβάσεων.

69 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ ΌτανηTryείναιδιαθέσιµησεπερίσσεια, ηέναρξητης µεταγραφής του οπερονίου της παρεµποδίζεται, γιατί στη θέση του χειριστή έχει δεσµευθεί το σύµπλοκο Tryκαταστολέας. αυτόνοµη ρύθµιση (αυτόνοµη καταστολή)

70 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Καθώς µειώνεται η συγκέντρωση της Try και αρχίζει να ελευθερώνεταιηθέσητουχειριστή, ξεκινάκαιηµεταγραφή.

71 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Αµέσωςµόλιςσυντεθείτο 5 άκροτου mrna, δεσµεύονται οι υποµονάδες του ριβοσώµατος και ξεκινά η µετάφραση τηςαλληλουχίας-οδηγού, εφ όσον υπάρχουν διαθέσιµα µέσα στοκύτταροαµινοξέακαι Try. 5 Επειδή στο ριβόσωµα, που βρίσκεται πολύκοντάστηνπολυµεράσητου RNA (την ακολουθεί) εισέρχεται και η περιοχή 1 αλλάκαιηπεριοχή 2, µπορείνασχηµατισθείµόνοηδίκλωνηαλυσίδααπότα τµήµατα 3+4. Τότε η δοµή του mrna (βρόγχος) εµποδίζει την πολυµεράση του RNA να δράσει και ευνοεί τον τερµατισµό της µεταγραφής στην περιοχή του εξασθενητή, και η πολυµεράση του RNA αποχωρίζεται από το οπερόνιο.

72 ΡΥΘΜΙΣΗ ΜΕ ΕΞΑΣΘΕΝΗΣΗ Όταν δεν υπάρχει πια διαθέσιµη Try σταµατά η βιοσύνθεση της αλληλουχίας-οδηγού στο ριβόσωµα παραµένει δεσµευµένηµόνοηπεριοχή 1. Τότε όµως µπορεί να σχηµατισθεί δίκλωνη αλυσίδα ανάµεσα στις περιοχές 2+3 η περιοχή 4 να παραµένει µονόκλωνη αλυσίδα και ηδοµήτου mrnaευνοείτησυνέχιση τηςµεταγραφήςκαιπέρααπότηθέση του εξασθενητή.

73 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Στους ευκαρυωτικούς υπάρχουν, οι ακόλουθοιεπιπλέοντρόποιρύθµισης, οι οποίοι συµβαίνουν αφού έχει ολοκληρωθεί η µεταγραφή: 1) Ωρίµανσητου RNA (2 ο επίπεδο) Εκτός από την ωρίµανση του RNA, όπως έχει περιγραφεί, είναι γνωστό και το φαινόµενο της εναλλακτικής ωρίµανσης, το οποίο συµβαίνει συχνά στα ευκαρυωτικά γονίδια που περιέχουν πολλαπλά εξώνια στις γεννώµενεςήαρχικέςήπρόδροµεςµεταγραφέςτους.

74 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 1) Ωρίµανση του RNA (2ο επίπεδο) Έτσι, εµφανίζονται διαφορετικοί τύποι ωρίµανσης σε διαφορετικούς τύπους διαφοροποιηµένων κυττάρων στον ίδιο οργανισµό.

75 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 2) Ρύθµισητηςµετάφρασης (4 ο επίπ.) Γιατηρύθµισηκατάτηµετάφρασηδενυπάρχουντόσαστοιχεία, όπως για τη µεταγραφή, όπου πιστεύεται ότι κυρίως γίνεται η ρύθµιση, χωρίς αυτό να µειώνει τη σηµασίατηςρύθµισηςµετάτηµεταγραφή. Ακόµα δεν έχει διευκρινισθεί η έκταση της συνεισφοράς της µεταφραστικής ρύθµισης στην όλη ρύθµιση του κυττάρου. Πάντωςπιστεύεταιότιηρύθµισηαρχίζειαπότοστάδιοτης έναρξης της πρωτεϊνοσύνθεσης. Γενικά η ρύθµιση της µετάφρασης αποτελεί ένα πολύπλοκο µεν αλλά ενδιαφέροντα µηχανισµό, στον οποίο µεταξύ άλλων συµµετέχουν :

76 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 2α) Ρύθµιση της µετάφρασης (4ο επίπεδο) Οι παράγοντες έναρξης, οι οποίοι είναι δραστικοί στη µη φωσφορυλιωµένη τους µορφή και µη δραστικοί στη φωσφορυλιωµένη µορφή (eif 2 ).

77 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 2β) Ρύθµισητηςµετάφρασης (4ο επίπεδο) Ειδικάπρωτεϊνικάµόριαπουεπιδρούνστηµετάφραση, π.χ. η πρωτεΐνη που κατευθύνεται από ένα γονίδιο να καταστέλλει την µετάφρασή της, όχι µε τη σύνδεσή της σε κάποιαθέσητου DNA (όπωςέχειαναφερθείµέχριτώρα), αλλάµετησύνδεσήτηςστο mrnaπουπροέκυψεαπότο αντίστοιχο γονίδιο και έτσι να παρεµποδίζει την περαιτέρω µετάφραση του mrna.

78 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 3) ε ρυθµίζεται µόνο η ταχύτητα της µεταγραφής, αλλά και η συχνότητα µετάφρασης του mrna. Σε ένα πολυκιστρονικό mrna οι µεσαίες πρωτεΐνες βγαίνουν σε περισσότερα αντίτυπα. ηλαδή, όλα τα γονίδια δεµεταφράζονταισείδιοαριθµόαντιτύπων. Αυτόόµωςδενµπορείναεξηγηθείµεταόσα, µέχριτώρα, έχουν αναφερθεί, παρά µόνο µε την υπόθεση ότι τα ριβοσώµατα µπορούν να αρχίσουν µετάφραση mrna, όχιµόνοαπότο 5 άκροτους (τηναρχήτους) αλλά και από ενδιάµεσα σηµεία. Πότε και µε τι συχνότητα γίνεται αυτό, είναι άγνωστο.

79 ΜΕΤΑ-ΜΕΤΑΓΡΑΦΙΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 4) Παράγοντες που επιδρούν στη σταθερότητατου mrna (5 ο επίπεδο). 5) Τροποποίησηπολυπεπτιδικής αλυσίδας Η αρχική πολυπεπτιδική αλυσίδα µπορεί να τροποποιηθεί µε διάφορους τρόπους, έτσι ώστε να προκύψουν διαφορετικά πολυπεπτίδια ή πρωτεΐνες στους διάφορους ιστούς.

80 ΡΥΘΜΙΣΗ ΤΗΣ ΓΟΝΙ ΙΑΚΗΣ ΕΚΦΡΑΣΗΣ ΑΠΟ ΤΑ ΣΥΣΤΑΤΙΚΑ ΤΗΣ ΤΡΟΦΗΣ ΣΤΑ ΣΠΟΝ ΥΛΩΤΑ ΚΑΙ ΣΤΟΝ ΑΝΘΡΩΠΟ Στα ευκαρυωτικά κύτταρα, αν και έχουν γίνει πολλές µελέτες, δεν είµαστε ακόµα σε θέση να αναφέρουµε λεπτοµέρειες για το µηχανισµό της ρύθµισης της γονιδιακής έκφρασης όπως συµβαίνειµεταπροκαρυωτικά. Γιατολόγοαυτόπέρααπότηνπεριγραφήτουµηχανισµού αυτού στα προκαρυωτικά, όπως έγινε παραπάνω, µπορούν να αναφερθούν γενικές µόνο αρχές και αδρά παραδείγµατα για τη ρύθµιση της γονιδιακής έκφρασης από τα συστατικά της τροφής στα σπονδυλωτά και στον άνθρωπο. Σήµεραέχειαποδειχθείότιτοποσόκαιησύστασητης διατροφής ρυθµίζει τη δραστικότητα πολλών ενζύµων στα σπονδυλωτά. H ρύθµιση αυτή γίνεται µέσω ρυθµιστικών παραγόντων του πλάσµατος που µπορεί να είναι είτε ειδικά συστατικά της διατροφής (π.χ. βαρέα µέταλλα), είτε ενώσεις που παρέχουν ενέργεια στον οργανισµό, είτε ορµόνες (στις οποίες τα επίπεδα ρυθµίζονται και πάλι από τα συστατικά της διατροφής).

81 ΡΥΘΜΙΣΗ ΤΗΣ ΓΟΝΙ ΙΑΚΗΣ ΕΚΦΡΑΣΗΣ ΑΠΟ ΤΑ ΣΥΣΤΑΤΙΚΑ ΤΗΣ ΤΡΟΦΗΣ ΣΤΑ ΣΠΟΝ ΥΛΩΤΑ ΚΑΙ ΣΤΟΝ ΑΝΘΡΩΠΟ Σαµοντέλαγιατηµελέτητηςρύθµισηςτηςγονιδιακής έκφρασης και συνεπώς της ρύθµισης της δραστικότητας των ενζύµων από τη διατροφή, χρησιµοποιούνται τα ένζυµα που βοηθούν στο σχηµατισµό λίπους, όπως για παράδειγµα η κινάσητουπυροσταφυλικούοξέοςκαιτοµηλικόένζυµο.

82 ΡΥΘΜΙΣΗ ΤΗΣ ΓΟΝΙ ΙΑΚΗΣ ΕΚΦΡΑΣΗΣ ΑΠΟ ΤΑ ΣΥΣΤΑΤΙΚΑ ΤΗΣ ΤΡΟΦΗΣ ΣΤΑ ΣΠΟΝ ΥΛΩΤΑ ΚΑΙ ΣΤΟΝ ΑΝΘΡΩΠΟ Έτσι σε καταστάσεις νηστείαςστοήπαρ, όπου γίνεται κυρίως η σύνθεση τωνλιπαρώνοξέων, η βιοσύνθεση των λιπαρών οξέων γίνεται µε αργούς ρυθµούς, ενώµετάαπόλήψη τροφής και µάλιστα πλούσιας σε υδατάνθρακες και φτωχής σε λιπαρά, η βιοσύνθεσητωνλιπαρώνοξέωνπροχωράγρήγορα.

83 ΡΥΘΜΙΣΗ ΤΗΣ ΓΟΝΙ ΙΑΚΗΣ ΕΚΦΡΑΣΗΣ ΑΠΟ ΤΑ ΣΥΣΤΑΤΙΚΑ ΤΗΣ ΤΡΟΦΗΣ ΣΤΑ ΣΠΟΝ ΥΛΩΤΑ ΚΑΙ ΣΤΟΝ ΑΝΘΡΩΠΟ Mε ανάλογο τρόπο µεταβάλλεται και η δραστικότητα των ενζύµων κινάση του πυροσταφυλικού οξέος, µηλικό ένζυµο και των άλλων ενζύµων που συµµετέχουν στη βιοσύνθεση των λιπαρών, κατάτηνηστείακαι µετάτηλήψητροφής. ηλαδή τα ένζυµα αυτά παρουσιάζουν µικρή δραστικότητα κατά τη νηστεία και µεγάλη δραστικότητα µετά τη λήψη τροφής.

84 ΡΥΘΜΙΣΗ ΤΗΣ ΓΟΝΙ ΙΑΚΗΣ ΕΚΦΡΑΣΗΣ ΑΠΟ ΤΑ ΣΥΣΤΑΤΙΚΑ ΤΗΣ ΤΡΟΦΗΣ ΣΤΑ ΣΠΟΝ ΥΛΩΤΑ ΚΑΙ ΣΤΟΝ ΑΝΘΡΩΠΟ Σε µερικές περιπτώσεις παχυσαρκείας ανκαιηδιατροφήτωνατόµωναυτώνείναιπλούσιασε λιπαρά (και θα έπρεπε η βιοσύνθεση λιπαρών οξέων να είναιπεριορισµένη), λόγωαδυναµίαςρύθµισης, η βιοσύνθεση λιπαρών εξακολουθεί να είναι υψηλή, µε αποτέλεσµατησυσσώρευσηλίπους. Tο γεγονός αυτό µπορεί να οφείλεται σε πολλούς λόγους όπως οι ακόλουθοι:

85 ΡΥΘΜΙΣΗ ΤΗΣ ΓΟΝΙ ΙΑΚΗΣ ΕΚΦΡΑΣΗΣ ΑΠΟ ΤΑ ΣΥΣΤΑΤΙΚΑ ΤΗΣ ΤΡΟΦΗΣ ΣΤΑ ΣΠΟΝ ΥΛΩΤΑ ΚΑΙ ΣΤΟΝ ΑΝΘΡΩΠΟ Λόγοι παχυσαρκείας: Eνεργοποίηση του σωστού γονιδίου όχιµόνοαπότηνκατάλληληορµόνη, αλλάκαιαπόάλλεςµησχετικέςορµόνες όχι στον απαραίτητο βαθµό, από την κατάλληλη ορµόνη. Πολλά από τα συστατικά που συµµετέχουν στη ρύθµιση γονιδίων, που εµπλέκονται στον σχηµατισµό λίπους, συµµετέχουν επίσης και στη ρύθµιση της κυτταρικής διαίρεσης. Έτσιηαδυναµίαρύθµισηςτηςβιοσύνθεσηςτουλίπους, επιδράκαιστονπολλαπλασιασµότωνλιποκυττάρων, µε τα γνωστά αποτελέσµατα της παχυσαρκίας.

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ (Γενετικό υλικό των βακτηρίων ρύθμιση της γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 Γενετικό υλικό των βακτηρίων Αποτελείται από ένα μόριο DNA σε υπερελιγμένη μορφή και τα άκρα του

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 (+ κεφάλαιο 15 Hartwell) Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. igenetics 2

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση Περιεχοµενα 1. Τι σηµαινει ρυθµιζω για την κυτταρικη µηχανη? 1. Η κυτταρικη ρυθµιση ειναι πολυεπιπεδη 2. Επιπεδο Μεταγραφης-Pύθµιση έκφρασης γονιδίων-tο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΡΥΘΜΙΣΗ ΤΟΥ ΜΕΤΑΒΟΛΙΣΜΟΥ ΤΩΝ ΛΙΠΟΕΙ ΩΝ

ΡΥΘΜΙΣΗ ΤΟΥ ΜΕΤΑΒΟΛΙΣΜΟΥ ΤΩΝ ΛΙΠΟΕΙ ΩΝ ΡΥΘΜΙΣΗ ΤΟΥ ΜΕΤΑΒΟΛΙΣΜΟΥ ΤΩΝ ΛΙΠΟΕΙ ΩΝ Η επιβίωση των ζώντων οργανισµών οφείλεται εκτός των άλλων και στην ικανότητά τους να ρυθµίζουν την αποθήκευση και την κινητοποίηση της ενέργειας για το µεταβολισµότους.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA.

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 1 -Ρυθμιζόμενα, ιδιοστατικά γονίδια και γονίδια κυτταρικής οικονομίας:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα

ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα απαvτηθoύv τα εξής ερωτήµατα: 1) Πώς εξασφαλίζεται η πιστότητα

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα

Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός

Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός αποικοδόµησης τωναµινοξέων. Με αυξηµένο ρυθµός αποικοδόµησης αµινοξέων

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 2 Ιδιοστατικά γονίδια Ρυθμιζόμενα γονίδια

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Β, Α2. Β, Α3. Δ, Α4. Γ, Α5. γ ΘΕΜΑ Β Β1. 1 Α, 2 Γ, 3 Α,4 Β, 5 Α, 6 Α, 7 Γ Β2. Βλ. σχολικό βιβλίο, σελ.24(έκδοση 2014-15)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

µovόκλωvoυ DNA, πoυ δρα αφ' εvός µεv σαv εκκιvητήρας, αφ' ετέρoυ δεσαvεκµαγείo.

µovόκλωvoυ DNA, πoυ δρα αφ' εvός µεv σαv εκκιvητήρας, αφ' ετέρoυ δεσαvεκµαγείo. ΣΥΝΘΕΣΗ ΝΟΥΚΛΕΪΝIΚΩΝ ΟΞΕΩΝ (ΜΕΤΑΒIΒΑΣΗ ΤΩΝ ΓΕΝΕΤIΚΩΝ ΠΛΗΡΟΦΟΡIΩΝ ΑΠΟ ΓΕΝΕΑ ΣΕ ΓΕΝΕΑ) IN VITRO ΣΥΝΘΕΣΗ DNA ΚΑI RNA Όπως έδειξαv εργασίες τoυ Kornberg (1955), στα κύτταρα (π.χ. E.coli) υπάρχoυvέvζυµα (πoλυµεράσεςτoυ

Διαβάστε περισσότερα

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που κωδικοποιούν για τις πρωτεϊνες που επάγονται από το θερµικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

(Στάδια τεχνολογίας rdna)

(Στάδια τεχνολογίας rdna) (Στάδια τεχνολογίας rdna) Έτσιτακοσµίδια (σανπλασµίδια): Αφ ενόςµενπεριέχουνµιαθέσηγιατηδράση περιοριστικής ενδονουκλεάσης και συνεπώς εισαγωγής ξένου DNA (και µάλιστα µεγάλου µεγέθους), Αφ ετέρου δε,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

Επιμέλεια: ΧΑΤΖΟΠΟΥΛΟΣ ΧΡΗΣΤΟΣ (ΒΙΟΛΟΓΟΣ)

Επιμέλεια: ΧΑΤΖΟΠΟΥΛΟΣ ΧΡΗΣΤΟΣ (ΒΙΟΛΟΓΟΣ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΗΜΕΡΟΜΗΝΙΑ: 27/5/2016 ΠΑΡΑΣΚΕΥΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣ. & ΚΑΤ. (ΝΕΟ+ΠΑΛΑΙΟ) Επιμέλεια: ΧΑΤΖΟΠΟΥΛΟΣ ΧΡΗΣΤΟΣ (ΒΙΟΛΟΓΟΣ) Δείτε αναλυτικά τα θέματα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα ΣτονΣτον ρόλο των διαφόρων οµάδων των ριβοσωµικών πρωτεινών. Κατά πόσο δηλαδή υπάρχει ετερογένεια στις

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ζήτημα 1ο 1. Το βακτήριο Agrobacterium tumefaciens I. Παρασιτεί σε ζωικά κύτταρα II. Μετασχηματίζεται με τη μεσολάβηση του πλασμιδίου Ti III. Μολύνει φυτικά και ζωικά κύτταρα

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Μοριακή Bιολογία ΔIAΛEΞΕΙΣ 5 & 6

Μοριακή Bιολογία ΔIAΛEΞΕΙΣ 5 & 6 Μοριακή Bιολογία ΔIAΛEΞΕΙΣ 5 & 6 EIΣAΓΩΓH ΣTHN METAΓPAΦH Χρήστος Παναγιωτίδης, Ph.D. Καθηγητής Κυτταρικής/Μοριακής Βιολογίας Εργαστήριο Φαρμακολογίας, Τομέας Φαρμακογνωσίας/Φαρμακολογίας Τμήμα Φαρμακευτικής,

Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ!

ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! 14/03/2014! Καθηγητής Δρ. Κωνσταντίνος Ε. Βοργιάς! 1! 1.Ποιά είναι τα διάφορα είδη RNA 2.Ποιά είναι τα στάδια της µεταγραφής 3.Μεταγραφική ωρίµανση RNA 4.Ποιά είναι η ενζυµολογία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Εικόνα 22.1 Η γονιδιακή έκφραση ελέγχεται κυρίως κατά την έναρξη της µεταγραφής και σπάνια στα επόµενα στάδια της γονιδιακής έκφρασης, παρόλο που ο έλεγχος

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα