Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις"

Transcript

1 ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΓΙΑ ΤΑ ΤΜΗΜΑΤΑ ΠΓΘΤ, ΓΘΤ, ΠαΘΤ Θέμα Α Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις Α.1. Τα διαγονιδιακά ζώα α. περιέχουν DNA από τρεις οργανισμούς β. παράγουν φαρμακευτικές πρωτεΐνες στο γάλα τους γ. έχουν ενσωματώσει το πλασμίδιο τi στο γονιδίωμά τους δ. είναι προϊόν γονιδιακής θεραπείας Α.2. Με την αλυσιδωτή αντίδραση πολυμεράσης α. ανιχνεύονται ασθένειες όπως το AIDS β. είναι δυνατή η μελέτη του DNA από απολιθώματα γ. εξιχνιάζονται εγκλήματα δ. όλα τα παραπάνω Α.3. Όταν σε μια διασταύρωση ετερόζυγων ατόμων η φαινοτυπική αναλογία στους απογόνους είναι 1:2:1, τότε τα αλληλόμορφα που ελέγχουν το χαρακτηριστικό είναι α. επικρατές υπολειπόμενο β. ατελώς επικρατή γ. φυλοσύνδετο υπολειπόμενο δ. τίποτε από τα παραπάνω

2 Α.4. Τα άτομα με σύνδρομο Klinefelter μπορεί να είναι α. αρσενικά β. θηλυκά γ. αρσενικά ή θηλυκά δ. τίποτε από τα παραπάνω, το σύνδρομο αυτό οφείλεται σε γονιδιακή μετάλλαξη Α.5. Σε δομικές χρωμοσωμικές ανωμαλίες οφείλεται α. ο αλφισμός β. το σύνδρομο Down γ. το σύνδρομο Turner δ. το σύνδρομο cri-du-chat Θέμα Β Μονάδες 5 χ 5 = 25 Να απαντήσετε στις ακόλουθες ερωτήσεις: Β.1. Γιατί τα μιτοχόνδρια και οι χλωροπλάστες χαρακτηρίζονται ως «ημιαυτόνομα οργανίδια»; Μονάδες 6 Β.2. Να περιγράψετε το μηχανισμό καταστολής του οπερονίου της λακτόζης Μονάδες 6 Β.3. Να περιγράψετε τις φάσεις της κλειστής καλλιέργειας Μονάδες 8 Β.4. Ποια είναι η χρησιμότητα της κλωνοποίησης θηλαστικών; Μονάδες 5 Θέμα Γ Δίνεται το γενεαλογικό δέντρο μιας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας. Τα άτομα τρία (3), έξι (6) και επτά (7) πάσχουν από αιμορροφιλία Α.

3 Γ.1. Να γράψετε τους πιθανούς γονότυπους όλων των ατόμων που απεικονίζονται στο παραπάνω γενεαλογικό δέντρο. Μονάδες 8 Γ.2. Ποια είναι η πιθανότητα το παιδί των γονέων οκτώ (8) και εννέα (9) να είναι αγόρι αιμορροφιλικό; Να αιτιολογήσετε την απάντησή σας Μονάδες 8 Γ.3. Να περιγράψετε τη διαδικασία που θα ακολουθήσετε για να εντοπίσετε την 14 η εβδομάδα της κύησης αν το έμβρυο πάσχει από σύνδρομο Down και αιμορροφιλία Μονάδες 9 Θέμα Δ Δίνονται τρία κωδικόνια ενός τμήματος γονιδίου από ένα μόριο DNA ευκαρυωτικού κυττάρου που κωδικοποιούν τη σύνθεση ενός πεπτιδικού τμήματος μιας πρωτεΐνης, και η διεύθυνση της μεταγραφής. Δ.1.Να ορίσετε τα άκρα 5 και 3 των παραπάνω αλυσίδων DNA και να αιτιολογήσετε την απάντησή σας. Μονάδες 6 Δ.2. Να γράψετε την αλληλουχία των βάσεων του τμήματος του mrna που προκύπτει από τη μεταγραφή, σημειώνοντας τα άκρα 5 και 3 και να αιτιολογήσετε την απάντησή σας. Μονάδες 10 Δ.3.Ποιο ένζυμο καταλύει το μηχανισμό της μεταγραφής και ποια είναι η δράση του μετά την πρόσδεσή του στον υποκινητή; Μονάδες 4 Δ.4.Να περιγράψετε μηχανισμούς επιδιόρθωσης λαθών στο DNA. Τι συνεπάγεται η αδρανοποίηση αυτών των μηχανισμών; Μονάδες 5

4 ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 8/3/2015 ΓΙΑ ΟΛΑ ΤΑ ΤΜΗΜΑΤΑ Να απαντήσετε σε όλα τα θέματα με βάση τις οδηγίες σε κάθε θέμα. Καλή επιτυχία! Θέμα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε πρότασης και δίπλα το γράμμα που τη συμπληρώνει κατάλληλα Α.1.Όταν ένα ανθρώπινο σωματικό κύτταρο βρίσκεται στη μετάφαση της μίτωσης, τότε περιέχει α. 46 χρωμοσώματα και 46 ινίδια χρωματίνης β. 46 χρωμοσώματα και 92 μόρια DNA γ. 23 ζεύγη ομόλογων χρωμοσωμάτων και 46 μόρια DNA Α.2.Τα άτομα που πάσχουν από σύνδρομο Down μπορεί να είναι: α. μόνο αρσενικά β. μόνο θηλυκά γ. είτε αρσενικά είτε θηλυκά δ. τίποτε από τα παραπάνω Α.3.Σε δύο κύτταρα από δύο είδη θηλαστικών ο λόγος A+T/G+C α. είναι πάντα ίδιος, αφού τα κύτταρα προέρχονται από θηλαστικά β. είναι πάντα διαφορετικός, αφού τα κύτταρα προέρχονται από διαφορετικά είδη γ. είναι πάντα διαφορετικός, γιατί είναι συνάρτηση της πολυπλοκότητας του οργανισμού δ. ισχύουν όλα τα παραπάνω, ανάλογα με τα είδη των οργανισμών που εξετάζονται Α.4.Το πλασμίδιο Ti χρησιμοποιείται στη διαδικασία: α. δημιουργίας διαγονιδιακών ζώων β. δημιουργίας διαγονιδιακών φυτών γ. παραγωγής ιντερφερόνης δ. παραγωγής ινσουλίνης

5 Α.5. Στη μικροέγχυση χρησιμοποιούνται: α. Τα-λεμφοκύτταρα β. μετασχηματισμένα βακτήρια γ. γονιμοποιημένα ωάρια ζώων δ. καρκινικά κύτταρα Μονάδες 5 χ 5 = 25 Θέμα Β Να απαντήσετε στις ακόλουθες ερωτήσεις: Β.1. Τι είναι αποικία, κλώνος, κυτταρική διαφοροποίηση; Μονάδες 6 Β.2. Τι σημαίνει ότι ο γενετικός κώδικας είναι «εκφυλισμένος»; Ποια είναι η σημασία της ιδιότητας αυτής του γενετικού κώδικα για τα κύτταρα και τους οργανισμούς; Μονάδες 6 Β.3. Γιατί ο καρκίνος δεν κληρονομείται σαν Μενδελικός χαρακτήρας; Μονάδες 5 Β.4. Να περιγράψετε τη δημιουργία ενός φυτού ποικιλίας Bt Μονάδες 8 Θέμα Γ Ένας άνδρας που πάσχει από οικογενή υπερχοληστερολαιμία και έχει ελεύθερους λοβούς αυτιών, παντρεύεται μία γυναίκα, η οποία δεν πάσχει από υπερχοληστερολαιμία και έχει ελεύθερους λοβούς αυτιών. Το ζευγάρι αυτό αποκτά τρία παιδιά. Το πρώτο εμφανίζει υπερχοληστερολαιμία και έχει ελεύθερους λοβούς αυτιών, το δεύτερο δεν πάσχει από υπερχοληστερολαιμία και έχει προσκολλημένους λοβούς αυτιών και το τρίτο δεν πάσχει από υπερχοληστερολαιμία και έχει ελεύθερους λοβούς αυτιών. Γ.1. Ποιοι είναι οι γονότυποι των γονέων; (μονάδες 4) Να δικαιολογήσετε την απάντησή σας (μονάδες 8) Μονάδες 12 Γ.2. Ποιοι είναι οι πιθανοί γονότυποι των τριών παιδιών; (μονάδες 6) Να δικαιολογήσετε την απάντησή σας.(μονάδες 7) Μονάδες 13 Δίνεται ότι τα γονίδια που ελέγχουν τα χαρακτηριστικά βρίσκονται σε διαφορετικά χρωμοσώματα

6 ΘΕΜΑ Δ Δίνεται τμήμα DNA το οποίο κωδικοποιεί τα οκτώ πρώτα αμινοξέα του πρώτου δομικού γονιδίου του οπερονίου της λακτόζης. AGCTATGACCATGATTACGGATTCACTG αλυσίδα Ι. TCGATACTGGTACTAATGCCTAAGTGAC αλυσίδα ΙΙ Δ1. Να εντοπίσετε την κωδική αλυσίδα. (μονάδα 1) Να σημειώσετε τον προσανατολισμό των αλυσίδων. (μονάδα 1) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) Μονάδες 6 Δ2. Να γράψετε το τμήμα του mrna που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος του γονιδίου και να ορίσετε τα 5 και 3 άκρα του. (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 3) Μονάδες 5 Δ3. Να γράψετε το τμήμα του mrna στο οποίο θα συνδεθεί η μικρή ριβοσωμική υπομονάδα κατά την έναρξη της μετάφρασης. Μονάδες 2 Δ4. Η φυσιολογική πρωτεΐνη, που παράγεται από την έκφραση του πρώτου δομικού γονιδίου του οπερονίου της λακτόζης, αποτελείται από 1024 αμινοξέα. Μια γονιδιακή μετάλλαξη αντικατάστασης μιας βάσης στο παραπάνω τμήμα DNA οδηγεί στην παραγωγή μιας πρωτεΐνης με 1022 αμινοξέα, δηλαδή μικρότερης κατά δύο αμινοξέα. Να εξηγήσετε με ποιο τρόπο μπορεί να συμβεί αυτό. Μονάδες 6 Δ5. Μια γονιδιακή μετάλλαξη που συνέβη στο ρυθμιστικό γονίδιο του οπερονίου της λακτόζης οδηγεί στην παραγωγή ενός τροποποιημένου mrna. Το mrna αυτό φέρει τέσσερις επιπλέον διαδοχικές βάσεις μεταξύ του 3ου και 4ου κωδικονίου του. Να εξηγήσετε ποια θα είναι η συνέπεια στην παραγωγή των ενζύμων που μεταβολίζουν τη λακτόζη, όταν το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης. Μονάδες 6

7 ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό Διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΟΜΗΝΙΑ 22/3/2015 ΓΙΑ ΟΛΑ ΤΑ ΤΜΗΜΑΤΑ ΤΕΛΕΙΟΦΟΙΤΩΝ ΚΑΙ ΑΠΟΦΟΙΤΩΝ Να απαντήσετε σε όλα τα θέματα με βάση τις οδηγίες σε κάθε θέμα. Καλή επιτυχία! ΘΕΜΑ A Στις παρακάτω ερωτήσεις να σημειώσετε με κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση Α.1.Το πολύσωμα: α. επιτρέπει τη μεταγραφή του ίδιου mrna πολλές φορές β. βρίσκεται στον πυρήνα των ευκαρυωτικών κυττάρων γ. επιτρέπει τη σύνθεση πολλών πολυπεπτιδικών αλυσίδων από το ίδιο mrna δ. ενώνει τα τμήματα της ασυνεχούς αντιγραφής Α.2. Τα ένζυμα που είναι υπεύθυνα για την παραγωγή πολυνουκλεοτιδικών αλυσίδων είναι: α. Η DNA ελικάση και η DNA πολυμεράση β. Το πριμόσωμα και η DNA δεσμάση γ. Η DNA πολυμεράση και η αντίστροφη μεταγραφάση δ. Τα επιδιορθωτικά ένζυμα και η DNA ελικάση Α.3. Μια περιοριστική ενδονουκλεάση : α. έχει μία θέση αναγνώρισης στο φορέα κλωνοποίησης β. δημιουργεί τέσσερα άκρα με μονόκλωνα συμπληρωματικά άκρα γ. σπάει δύο φωσφοδιεστερικούς δεσμούς δ. ισχύουν όλα τα παραπάνω, για τα ένζυμα αυτά Α.4. Στη γονιδιακή θεραπεία της έλλειψης ADA : α. τα κύτταρα του ασθενούς τροποποιούνται με τον κατάλληλο φορέα β. εισάγεται, στα κύτταρα που δεν εκφράζουν το γονίδιο, το επιθυμητό επικρατές αλληλόμορφο γ. το επικρατές αλληλόμορφο εκφράζεται στα κατάλληλα κύτταρα δ. όλα τα παραπάνω

8 Α.5. Για να αναπτυχθούν σε καλλιέργεια είδη του γένους Clostridium απαραίτητη είναι: α. η ύπαρξη του κατάλληλου βιοαντιδραστήρα β. η απουσία οξυγόνου γ. η παρουσία οξυγόνου δ. η χορήγηση διοξειδίου του άνθρακα Μονάδες 3 χ 5 = 15 Να μεταφέρετε στο τετράδιό σας τους αριθμούς που αντιστοιχούν στις παρακάτω προτάσεις σημειώνοντας αν είναι σωστές ή λανθασμένες: Α.6. Ένα μόριο mrna ευκαρυωτικού κυττάρου μετά τη μεταγραφή περιέχει αλληλουχίες που αντιστοιχούν στον υποκινητή, στα εσώνια, στα εξώνια και στις 5, 3 αμετάφραστες περιοχές Α.7. Όταν οι γονείς είναι ο ένας ομάδας αίματος ΑΒ και ο άλλος ομάδας αίματος Ο αποκλείεται να αποκτήσουν παιδί ομάδας αίματος Ο. Α.8. Υπάρχουν τέσσερα αλληλόμορφα για το γονίδιο που κωδικοποιεί τη β αλυσίδα της αιμοσφαιρίνης σε ένα μυικό κύτταρο στη μετάφαση της μίτωσης. Α.9. Κάθε νουκλεοτίδιο περιέχει μία σταθερή και μία μεταβλητή περιοχή. Α.10. Με το πρόγραμμα του ανθρώπινου γονιδιώματος οι επιστήμονες προσπαθούν, μεταξύ άλλων, να κατανοήσουν τις εξελικτικές σχέσεις.ανάμεσα στον άνθρωπο και τους άλλους οργανισμούς. ΘΕΜΑ Β Μονάδες 2 χ 5 = 10 Να απαντήσετε στις ακόλουθες ερωτήσεις: Β.1. Τι είναι τα πλασμίδια; Ποια γονίδια γνωρίζετε ότι υπάρχουν σ αυτά; Μονάδες 6 Να αναφέρετε παραδείγματα στα οποία: Β.2. Ένας άνθρωπος είναι φυσιολογικός αλλά έχει λιγότερα από δύο αλληλόμορφα στο γονότυπό του(μονάδες 5) Β.3. Υπάρχουν περισσότερα από δύο αλληλόμορφα για ένα χαρακτηριστικό στον πληθυσμό (Μονάδες 5) Μονάδες 10

9 Β.4. Να περιγράψετε τη γονιδιακή θεραπεία για την έλλειψη της απαμινάσης της αδενοσίνης(μονάδες 6). Πως ονομάζεται ο τύπος αυτός της γονιδιακής θεραπείας; (μονάδα 1)Σε ποιες άλλες παθήσεις θα μπορούσε κατά τη γνώμη σας να εφαρμοστεί ο τύπος αυτός της γονιδιακής θεραπείας; (μονάδες 2) Μονάδες 9 Μονάδες 25 ΘΕΜΑ Γ Σε δύο γυναίκες που κυοφορούν έγινε προγεννητικός έλεγχος και διαπιστώθηκε ότι τα κυοφορούμενα έμβρυα πάσχουν από σύνδρομο Down και στο ένα από τα δύο έμβρυα διαπιστώθηκε επίσης αναστροφή σε τμήμα του 3 ου χρωμοσώματος Γ.1.Να περιγράψετε τη διαδικασία με την οποία εντοπίστηκαν τα προβλήματα στα έμβρυα αυτά Μονάδες 9 Αρχίζουμε την παρατήρησή μας από δύο αδέλφια, που είναι το ένα κορίτσι φυσιολογικό και το άλλο αγόρι με μερική αχρωματοψία. Το αγόρι δεν παντρεύτηκε, ενώ το κορίτσι παντρεύτηκε έναν άντρα με μερική αχρωματοψία κι έκαναν δύο κόρες - η μία φυσιολογική, η άλλη με μερική αχρωματοψία, κι ένα αγόρι με μερική αχρωματοψία. Η φυσιολογική κόρη δεν παντρεύτηκε, ενώ η κόρη με την αχρωματοψία παντρεύτηκε φυσιολογικό άντρα κι έκαναν δύο αγόρια με αχρωματοψία και μια κόρη φυσιολογική. Ο αδελφός των κοριτσιών που είχε αχρωματοψία παντρεύτηκε μια φυσιολογική κοπέλα κι έκαναν ένα αγόρι φυσιολογικό και ένα κορίτσι επίσης φυσιολογικό. Γ.2. Να σχεδιάσετε το γενεαλογικό δέντρο μαυρίζοντας τα άτομα που πάσχουν από αχρωματοψία. Μονάδες 5 Γ.3. Ο αδελφός των κοριτσιών και η γυναίκα του περιμένουν το τρίτο τους παιδί. Τι πιθανότητα υπάρχει να πάσχει από μερική αχρωματοψία; Μονάδες 5 Γ.4. Να αιτιολογήσετε τις απαντήσεις σας Μονάδες 6 Μονάδες 25

10 Θέμα Δ Δίνεται το ακόλουθο συνεχές γονίδιο που κωδικοποιεί πεπτίδιο:...agtaatatcaccataacccgggtagac αλυσίδα Ι TCATTATAGTGGTATTGGGCCCATCTG αλυσίδα ΙΙ Δ.1. Να γράψετε το mrna που προκύπτει από το παραπάνω γονίδιο με μεταγραφή και να σημειώσετε τα 5, 3 άκρα του καθώς και τα άκρα των αλυσίδων του DNA. Μονάδες 6 Δ.2. Να σημειώσετε τα αντικωδικόνια των trna με τη σειρά που συμμετέχουν στην πρωτεϊνοσύνθεση. Δ.3. Να αιτιολογήσετε τις απαντήσεις σας. Μονάδες 4 Μονάδες 8 Δ.4. Να εξηγήσετε ποιες θα είναι οι επιπτώσεις στο πεπτίδιο αν η τρίτη βάση της αλληλουχίας στο 3 άκρο της κωδικής αλυσίδας που δίνεται αντικατασταθεί με Α. Μονάδες 7

11 ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό Διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΟΜΗΝΙΑ 5/4/2015 Να απαντήσετε σε όλα τα θέματα με βάση τις οδηγίες σε κάθε θέμα. Καλή επιτυχία! ΘΕΜΑ A Στις παρακάτω ερωτήσεις να σημειώσετε με κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση Α.1.Το πολύσωμα: α. επιτρέπει τη μεταγραφή του ίδιου mrna πολλές φορές β. βρίσκεται στον πυρήνα των ευκαρυωτικών κυττάρων γ.είναι ο τρόπος ταυτόχρονης σύνθεσης πολλών πολυπεπτιδικών αλυσίδων από το ίδιο mrna δ. δημιουργεί τα πρωταρχικά τμήματα στις θέσεις έναρξης της αντιγραφής Α.2. Τα ένζυμα που είναι υπεύθυνα για την πιστότητα της αντιγραφής είναι: α. Οι DNA ελικάσες και η DNA πολυμεράσες β. Το πριμόσωμα και η DNA δεσμάση γ. Οι DNA πολυμεράσες και η DNA δεσμάση δ. Τα επιδιορθωτικά ένζυμα και οι DNA πολυμεράσες Α.3. Κατά τη δημιουργία ενός διαγονιδιακού ζώου το μιτοχονδριακό DNA : α. προέρχεται από το ζώο που κυοφορεί το έμβρυο β. είναι πάντα μητρικής προέλευσης και στα διαγονιδιακά και στα άλλα ζώα γ. προέρχεται από το κυτταρόπλασμα του απύρηνου ωαρίου δ. είναι του ζώου από το οποίο προέρχεται και το πυρηνικό DNA Α.4. Με τη μέθοδο PCR επιτυγχάνεται : α. ο εντοπισμός μιας αλληλουχίας DNA ανάμεσα σε χιλιάδες άλλες β. η δημιουργία χιλιάδων αντιγράφων μιας συγκεκριμένης αλληλουχίας βάσεων DNA γ. η έκφραση ενός γονιδίου μέσα σε ένα βακτήριο δ. όλα τα παραπάνω

12 Α.5. Με τον όρο σιωπηλή μετάλλαξη εννοούμε την αντικατάσταση: α. μιας βάσης από ένα κωδικόνιο β. ενός κωδικονίου από ένα κωδικόνιο λήξης γ. ενός κωδικονίου από ένα συνώνυμο δ. ενός κωδικονίου λήξης από ένα άλλο που αντιστοιχεί σε αμινοξύ Μονάδες 3 χ 5 = 15 Να μεταφέρετε στο τετράδιό σας τους αριθμούς που αντιστοιχούν στις παρακάτω προτάσεις σημειώνοντας αν είναι σωστές ή λανθασμένες: Α.6. Οταν ένα μόριο mrna αποτελείται από 500 νουκλεοτίδια, αυτά θα συνδέονται με 499 φωσφοδιεστερικούς δεσμούς. Α.7. Για την παραγωγή ανθρώπινων πρωτεϊνών από βακτήρια προηγείται η δημιουργία γονιδιωματικής βιβλιοθήκης. Α.8. Στη μετάφαση της μίτωσης ένα ανθρώπινο σωματικό κύτταρο περιέχει συνολικά 12 γονίδια που κωδικοποιούν την HbA. Α.9. Η ιδιότητα του γενετικού κώδικα να είναι σχεδόν καθολικός βρίσκει εφαρμογή στη cdna βιβλιοθήκη. Α.10. Στο τέλος της πρώτης μειωτικής διαίρεσης προκύπτουν δύο κύτταρα απλοειδή ως προς τον αριθμό των χρωμοσωμάτων και διπλοειδή ως προς τον αριθμό των μορίων DNA. ΘΕΜΑ Β Μονάδες 2 χ 5 = 10 Να απαντήσετε στις ακόλουθες ερωτήσεις: Β.1. Ποια είναι τα συστατικά που πρέπει να περιέχει το θρεπτικό υλικό για την καλλιέργεια των μικροοργανισμών στο εργαστήριο; Υπάρχει διαφορά από το θρεπτικό υλικό που χρησιμοποιείται στο βιοαντιδραστήρα; Μονάδες 6 Β.2. Να εξηγήσετε πως το βακτήριο E. coli επιβιώνει σε περιβάλλον στο οποίο υπάρχει γλυκόζη και πως σε περιβάλλον με λακτόζη και όχι γλυκόζη. Μονάδες 9 Β.3. Τι είναι η γονιδιωματική και τι η cdna βιβλιοθήκη; Μονάδες 6 Β.4. Τι γνωρίζετε για τα θνησιγόνα γονίδια; Μονάδες 4

13 ΘΕΜΑ Γ Δίνονται τα ακόλουθα γενεαλογικά δένδρα που απεικονίζουν τον τρόπο κληρονόμησης δύο χαρακτηριστικών Α και Β σε μια οικογένεια. Για τα χαρακτηριστικά αυτά ισχύει ο δεύτερος νόμος του Mendel Γ.1.Να εξηγήσετε πως κληρονομούνται τα χαρακτηριστικά Α και Β. Μονάδες 12 Γ.2. Να γράψετε τους πιθανούς γονότυπους των ατόμων της οικογένειας αυτής για κάθε χαρακτηριστικό Μονάδες 5 Γ.3. Τι πιθανότητα υπάρχει το επόμενο παιδί του ζευγαριού να εκδηλώνει και τα δύο χαρακτηριστικά; Να αιτιολογήσετε την απάντησή σας Μονάδες 8 Θέμα Δ Δίνεται γονίδιο βακτηρίου που κωδικοποιεί πεπτίδιο:

14 Δ.1.Να γραφεί το mrna που προκύπτει από το τμήμα αυτό του DNA, τα άκρα των αλυσίδων του τμήματος αυτού και να εξηγήσετε ποια είναι η κωδική και ποια η μη κωδική αλυσίδα Δ.2.Πόσα αμινοξέα περιέχει το πεπτίδιο που σχηματίζεται και γιατί; Μονάδες 8 Μονάδες 5 Δ.3. Σε ποια από τις θέσεις Α, Β βρίσκεται ο υποκινητής του παραπάνω γονιδίου; Να αιτιολογήσετε την απάντησή σας Να εξηγήσετε τις επιπτώσεις στο πεπτίδιο αν αντικατασταθεί στην κωδική αλυσίδα: i. η 8 η βάση μετά το κωδικόνιο έναρξης από Α, ii. η 13 η βάση από Α. Παρατίθεται ο γενετικός κώδικας Μονάδες 12

15 ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Να απαντήσετε σε όλα τα θέματα με βάση τις οδηγίες σε κάθε θέμα. Καλή επιτυχία ΘΕΜΑ Α Α1. Σιωπηλές λέγονται οι μεταλλάξεις όταν δεν εκφράζονται γιατί α. συμβαίνουν σε εσώνια β. δημιουργούνται καινούρια γονίδια εξαιτίας λάθους της αντιγραφής γ. προκύπτουν συνώνυμα κωδικόνια δ. προκύπτουν πρωτεΐνες με ασήμαντη τροποποίηση Α2. Για την παραγωγή ανθρώπινων πρωτεϊνών είναι προτιμότερο να χρησιμοποιούνται διαγονιδιακά ζώα διότι: α. δεν περιέχουν άλλες πρωτεΐνες, άγνωστες για τον ανθρώπινο οργανισμό β. δεν έχουν προσμίξεις από άλλους οργανισμούς, όπως στα βακτήρια γ. προκύπτουν ήδη τροποποιημένες πρωτεΐνες, πράγμα που δεν συμβαίνει στα βακτήρια δ. μόνο τα α και β είναι σωστά Α3. Για τη μεταφορά γονιδίων σε φυτικά κύτταρα χρησιμοποιείται α. η τεχνική της μικροέγχυσης του επιθυμητού γονιδίου σε φυτικά κύτταρα β. η τεχνική της μικροέγχυσης σε ζυγωτό φυτικού οργανισμού γ. η εισαγωγή του γονιδίου με φορέα το πλασμίδιο Τi δ. όλα τα παραπάνω Α4. Αν επιδιώκουμε να μελετήσουμε υποκινητές κατασκευάζουμε: α. γονιδιωματική βιβλιοθήκη β. cdna βιβλιοθήκη γ. γονιδιωματική βιβλιοθήκη και cdna βιβλιοθήκη δ. mrna βιβλιοθήκη Α5. Ο φωσφοδιεστερικός δεσμός είναι ο δεσμός α. μεταξύ Α - Τ β. διαδοχικών νουκλεοτιδίων γ. ετεροπολικός δεσμός δ. τίποτε από τα παραπάνω Μονάδες 25

16 ΘΕΜΑ Β Β1. Τα έντοµα δηµιουργούν µεγάλα προβλήµατα στη γεωργία και οδηγούν σε σηµαντική µείωση της παραγωγής. Γνωρίζετε αν η Βιοτεχνολογία μπορεί να βοηθήσει στην καταπολέµηση των εντόµων και µε ποιο τρόπο µπορεί να γίνει αυτό; Μονάδες 8 Β2. Η ινσουλίνη είναι µία πρωτεΐνη που παράγεται από τον ανθρώπινο οργανισµό όπως και η αντιθρυψίνη (ΑΤΤ). Με ποιο τρόπο θα µπορούσε να παραχθεί η ινσουλίνη αν αξιοποιούσαµε τις δυνατότητες της γενετικής µηχανικής και τις ιδιότητες που έχουν τα διαγονιδιακά ζώα; Μονάδες 9 Β3.Σε τρεις διαφορετικούς βιοαντιδραστήρες πραγματοποιείται κλειστή καλλιέργεια τριών διαφορετικών μικροοργανισμών Α, Β και Γ αντίστοιχα. Στα παρακάτω διαγράμματα απεικονίζεται ο αριθμός των μικροοργανισμών σε σχέση με το χρόνο. Στο χρονικό διάστημα από 0 έως t1 η συγκέντρωση του οξυγόνου στους βιοαντιδραστήρες είναι υψηλή και σταθερή, ενώ στο χρονικό διάστημα από t1 έως t2 η συγκέντρωση του οξυγόνου είναι χαμηλή και σταθερή. Με βάση τα σχήματα να χαρακτηρίσετε τους μικροοργανισμούς Α, Β, Γ σε σχέση με την εξάρτηση της ανάπτυξής τους από τη συγκέντρωση του οξυγόνο. Αιτιολογήστε την απάντησή σας. Μονάδες 8

17 ΘΕΜΑ Γ Δίνεται το παρακάτω τμήμα μορίου βακτηριακού DNA που κωδικοποιεί ένα πεπτίδιο με έξι αμινοξέα: 5... CCGΑTGACCAAACCTCACGCCTAGACC GGCTACTGGTTTGGAGTGCGGATCTGG... 5 Γ.1.Ποια από τις δύο αλυσίδες είναι η κωδική και ποια η μη κωδική; (μονάδες 4) Να αιτιολογήσετε την απάντησή σας. (μονάδες 9) Μονάδες 13 Γ.2.Να γράψετε την αλληλουχία του mrna που προκύπτει από τη μεταγραφή του παραπάνω τμήματος DNA. Μονάδες 3 Γ.3. Να γράψετε την αλληλουχία των αμινοξέων του πεπτιδίου που προκύπτει από τη μετάφραση του παραπάνω mrna. Μονάδες 3 Δίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων και αμινοξέων από το γενετικό κώδικα: AUG Μεθειονίνη, ACC Θρεονίνη, AAA Λυσίνη, CCU Προλίνη, CAC Ιστιδίνη, GCC Αλανίνη Γ2. Μια πρωτεΐνη που έχει συντεθεί σε ένα βακτήριο αποτελείται από 199 αμινοξέα. Πόσα είναι τα νουκλεοτίδια τα οποία υπάρχουν στο DNA που κωδικοποίησε την παραπάνω πρωτείνη; Αν η συμμετοχή της αδενίνης στο μόριο του DNA είναι 20%, ποιο είναι το πλήθος των δεσμών υδρογόνου στο DNA; (Να μην ληφθούν υπόψη οι 5 3 αμετάφραστες περιοχές) Μονάδες 6 ΘΕΜΑ Δ Δ1. Να αναφέρετε σε ποιες περιπτώσεις ενώ ισχύουν οι νόμοι του Mendel, οι φαινοτυπικές αναλογίες των απογόνων δεν είναι οι αναμενόμενες. Μονάδες 6 Ένα θηλυκό άτομο δροσόφιλας με μακριά φτερά και φαιό σώμα διασταυρώθηκε με αρσενικό που είχε κοντά φτερά και κίτρινο σώμα. Οι απόγονοι διασταυρώθηκαν μεταξύ τους (F1 X F1) και στην F2 προέκυψαν τα παρακάτω άτομα.

18 Φαινότυπος Φύλο Αριθμός ατόμων Μακριά φτερά-φαιό σώμα 30 Μακριά φτερά- φαιό σώμα 62 Μακριά φτερά- κίτρινο σώμα 30 Κοντά φτερά- φαιό σώμα 11 Κοντά φτερά- φαιό σώμα 24 Κοντά φτερά κίτρινο σώμα 10 Δ2. Να εξηγήσετε τα αποτελέσματα. Για τα άτομα που διασταυρώθηκαν δίνεται ότι τα θηλυκά έχουν ένα ζευγάρι X χρωμοσωμάτων (ΧΧ) και τα αρσενικά έχουν ένα Χ και ένα Ψ χρωμόσωμα (ΧΨ). Να μη ληφθεί υπόψη η περίπτωση μετάλλαξης. Μονάδες 15 Δ3. Πόσα συνολικά μόρια DNA περιέχονται στα χρωμοσώματα που απεικονίζονται στον καρυότυπο ενός ατόμου με σύνδρομο Klinefelter στην αρχή της μεσόφασης και στη μετάφαση της μίτωσης; Να εξηγήσετε την απάντησή σας. Μονάδες 4

19 ΔΙΑΓΩΝΙΜΑ ΠΡΟΟΜΟΙΩΗ ΣΗ ΒΙΟΛΟΓΙΑ ΘΕΣΙΚΗ ΚΑΣΕΤΘΤΝΗ Να απαντιςετε ςε όλα τα κζματα με βάςθ τισ οδθγίεσ ςε κάκε κζμα. Καλι επιτυχία! ΘΕΜΑ Α Να αντιγράψετε τουσ αρικμοφσ των παρακάτω ερωτιςεων και δίπλα να γράψετε το γράμμα που ςυμπλθρϊνει ςωςτά τισ προτάςεισ ι φράςεισ Α.1.Σο μιτοχονδριακό DNA α. υπάρχει ςε 2-10 αντίγραφα ςτα μιτοχόνδρια β. είναι μικρότερο από αυτό των χλωροπλαςτϊν γ. κλθροδοτείται από τθ μθτζρα ςτουσ απογόνουσ δ. όλα τα παραπάνω ιςχφουν για το μιτοχονδριακό DNA Α.2. Η τεχνικι τθσ αλυςιδωτισ αντίδραςθσ πολυμεράςθσ (PCR) α. επιτρζπει τθ δθμιουργία πολλϊν αντιγράφων του γονιδιϊματοσ του οργανιςμοφ δότθ β. χρειάηεται τον κατάλλθλο φορζα κλωνοποίθςθσ για να κλωνοποιθκεί γ. βρίςκει εφαρμογι ςτθν Εγκλθματολογία και ςτθν Ιατρικι δ. δίνει τθ δυνατότθτα ζκφραςθσ γονιδίων ευκαρυωτικϊν κυττάρων ςε βακτιρια Α.3. Σα γονίδια που προκαλοφν διακοπι τθσ κφθςθσ ονομάηονται α. φυλοςφνδετα β. κνθςιγόνα γ. αυτοςωμικά επικρατι δ. αυτοςωμικά υπολειπόμενα Α.4. Σα προϊόντα τθσ καλλιζργειασ των μικροοργανιςμϊν ςτο βιοαντιδραςτιρα α. παραλαμβάνονται είτε με διικθςθ είτε με φυγοκζντρθςθ β. είναι θ βιομάηα, δθλαδι οι ουςίεσ που εκκρίνουν οι μικροοργανιςμοί γ. είναι μόνο τα κφτταρα που ζχουν δθμιουργθκεί ςτθ ςτατικι φάςθ δ. βρίςκονται πάντα ςτο ίηθμα που προκφπτει από τθν επεξεργαςία του περιεχομζνου του βιοαντιδραςτιρα Μονάδεσ 5 χ 4 = 20

20 Να γράψετε ςτο τετράδιό ςασ τουσ αρικμοφσ των ακόλουκων προτάςεων και δίπλα αν κατά τθ γνϊμθ ςασ οι προτάςεισ αυτζσ είναι ςωςτζσ ι λανκαςμζνεσ Α.5. Σα προϊόντα τθσ μειωτικισ διαίρεςθσ ςτον άνδρα είναι δυνατόν να διαφζρουν ωσ προσ τον αρικμό των ηευγϊν βάςεων. Α.6. Σο γονίδιο για τθν αντίλθψθ του κόκκινου και του πράςινου χρϊματοσ ςτον άνκρωπο είναι φυλοςφνδετο επικρατζσ. Α.7. Από δφο γονείσ ίδιου φαινότυπου για τθ φυςιολογικι πιξθ του αίματοσ είναι δυνατόν να προκφψει κθλυκόσ απόγονοσ που πάςχει. Α.8. Όταν δφο ηευγάρια αλλθλόμορφων γονιδίων βρίςκονται ςτο ίδιο ηευγάρι ομόλογων χρωμοςωμάτων δεν ιςχφουν οι νόμοι του Mendel. Α.9.Για να παραχκεί ATT από διαγονιδιακά ηϊα απομονϊνουμε DNA από θπατικά κφτταρα. Θζμα Β Μονάδεσ 1 χ 5 = 5 Να απαντιςετε ςτισ ακόλουκεσ ερωτιςεισ: Β.1. Να περιγράψετε τθ δθμιουργία τθσ Dolly. Μονάδεσ 6 Β.2. Γιατί θ μετάφραςθ χαρακτθρίηεται ωσ μια «οικονομικι διαδικαςία»; Μονάδεσ 4 Β.3. Να εξθγιςετε πωσ μπορεί να διαγνωςκεί αναςτροφι ςτο 6 ο χρωμόςωμα ςε κυοφοροφμενο ζμβρυο θλικίασ 10 εβδομάδων Μονάδεσ 8 Β.4. Να περιγράψετε πωσ τα μονοκλωνικά αντιςϊματα μποροφν να χρθςιμοποιθκοφν ωσ ανοςοδιαγνωςτικά Μονάδεσ 7 Θζμα Γ Δίνεται το ακόλουκο γενεαλογικό δζνδρο ςτο οποίο απεικονίηεται ο τρόποσ κλθρονόμθςθσ τθσ μερικισ αχρωματοψίασ ςτο κόκκινο και το πράςινο. Με μαυριςμζνα ςφμβολα απεικονίηονται τα άτομα που πάςχουν. Ζνα από τα άτομα που απεικονίηονται πάςχει από μία αρικμθτικι χρωμοςωμικι ανωμαλία.

21 Γ.1. Ποιο από τα παραπάνω άτομα πάςχει από χρωμοςωμικι ανωμαλία; (μονάδεσ 3) Να εξθγιςετε τουσ πικανοφσ τρόπουσ με τουσ οποίουσ μπορεί να προζκυψε το άτομο αυτό (μονάδεσ 8). Μονάδεσ 11 Γ.2. Να βρείτε τουσ πικανοφσ γονότυπουσ των ατόμων που απεικονίηονται ςτο παραπάνω γενεαλογικό δζνδρο και να τουσ αιτιολογιςετε. Μονάδεσ 6 Γ.3. Σι πικανότθτα υπάρχει ζνα παιδί τθσ ΙΙΙ1 να πάςχει; Να αιτιολογιςετε τθν απάντθςι ςασ Μονάδεσ 8

22 Θζμα Δ Δίνεται γονίδιο βακτθρίου που κωδικοποιεί πεπτίδιο. (Θεωροφμε αλυςίδα Ι τθν πάνω αλυςίδα και ΙΙ τθν κάτω). T C G T A A T T T T G G T C A C G T A C A C T A C A C C G A C C A G G A T T A A A A C C A G T G C A T G T G A T G T G G C T G G Δ.1.Να γραφεί το mrna που προκφπτει από το τμιμα αυτό του DNA, τα άκρα των αλυςίδων του τμιματοσ αυτοφ και να εξθγιςετε ποια είναι θ κωδικι και ποια θ μθ κωδικι αλυςίδα Μονάδεσ 6 Σο παραπάνω γονίδιο κωδικοποιεί το πεπτίδιο με τθν ακόλουκθ αλλθλουχία αμινοξζων: H 2 N- met his trp phe COOH Να εξθγιςετε τισ επιπτϊςεισ ςτο πεπτίδιο αν αντικαταςτακεί: Δ.2. θ 5 θ βάςθ από Σ, Δ.3.θ 8 θ βάςθ από C και Δ.4.θ 12 θ βάςθ από Α. Μονάδεσ 4 χ 3 = 12 Όλεσ οι αντικαταςτάςεισ αφοροφν τθν αλυςίδα Ι και γίνονται από αριςτερά προσ τα δεξιά Δίνεται ότι τα κωδικόνια που κωδικοποιοφν τα αμινοξζα του πεπτιδίου είναι: phe: UUU, UUC, his: CAU, CAC, trp: UGG Δ.5. Να εξθγιςετε ποιο κα είναι το αντικωδικόνιο του trna που κα ςυνδεκεί ςτο mrna κατά τθ μετάφραςθ μετά τθν απομάκρυνςθ του trna που μεταφζρει τθν ιςτιδίνθ (his). Μονάδεσ 7

23 ΕΠΑΝΑΛΗΠΤΙΚΟ Διαγώνισμα ΒΙΟΛΟΓΙΑΣ Θετικής Κατεύθυνσης 3/5/2015 Να ςυμπλθρωκεί το παρακάτω φυλλάδιο με βάςθ τισ οδθγίεσ ςε κάκε κζμα. Να απαντιςετε ςε όλα τα κζματα. Καλι επιτυχία! Θζμα Α Α.1. Το κωδικόνιο ζναρξθσ του mrna είναι ςυμπλθρωματικό ςτο αντικωδικόνιο του trna α. 5 UAC 3 β. 5 CAU 3 γ.5 CUA 3 δ. 5 ACU 3 Α.2.Το οπερόνιο τθσ λακτόηθσ βρίςκεται ςε καταςτολι όταν α. εξαντλθκεί θ λακτόηθ από το κρεπτικό υλικό β. εκφράηεται το ρυκμιςτικό γονίδιο και ςτο κρεπτικό υλικό υπάρχει μόνο λακτόηθ γ. θ λακτόηθ προςδζνεται ςτθν πρωτεΐνθ καταςτολζα δ. τα βακτιρια καλλιεργοφνται μόνο παρουςία λακτόηθσ Α.3. Η διαδικαςία προςκικθσ μικρισ ποςότθτασ μικροοργανιςμϊν ςτο βιοαντιδραςτιρα λζγεται... α. ηφμωςθ β. κλειςτι καλλιζργεια γ. εμβολιαςμόσ δ. διικθςθ

24 Α.4. Τα μονοκλωνικά αντιςϊματα χρθςιμοποιοφνται, μεταξφ άλλων, για... α. τον ζλεγχο των φορζων τθσ δρεπανοκυτταρικισ αναιμίασ β. τθν παραγωγι φαρμακευτικϊν πρωτεϊνϊν γ. τον ζλεγχο τθσ ιςτοςυμβατότθτασ ςτισ μεταμοςχεφςεισ δ. όλα τα παραπάνω, αφοφ ζχουν πολλζσ εφαρμογζσ Α.5. Η κλωνοποίθςθ των κθλαςτικϊν κα ςυμβάλλει α. ςτθ δθμιουργία ηϊων ανκεκτικϊν ςτα εντομοκτόνα β. ςτθ διάςωςθ ειδϊν που απειλοφνται με εξαφάνιςθ γ. ςτθ δθμιουργία νζων ειδϊν οργανιςμϊν δ. ςε τίποτε από τα παραπάνω Θζμα Β Να απαντιςετε ςτισ ακόλουκεσ ερωτιςεισ: Μονάδεσ 5 x 5 = 25 Β.1. Ποια είναι θ διαφορά ςτο mrna που προκφπτει με μεταγραφι από ζνα γονίδιο βακτθρίου και ςτο mrna που προκφπτει με μεταγραφι από ζνα γονίδιο ευκαρυωτικοφ κυττάρου;. Μονάδεσ 8 Β.2. Να περιγράψετε το πείραμα με το οποίο επιβεβαιϊκθκε ότι το DNA είναι το γενετικό υλικό. Μονάδεσ 6 Β.3. Τι είναι θ αλυςιδωτι αντίδραςθ πολυμεράςθσ και που βρίςκει εφαρμογι; Μονάδεσ 6 Β.4. Να εξθγιςετε πωσ τα μονοκλωνικά αντιςϊματα μποροφν να χρθςιμοποιθκοφν ωσ κεραπευτικά Μονάδεσ 5

25 Θζμα Γ Δίνεται το παρακάτω γενεαλογικό δζνδρο που απεικονίηει τον τρόπο κλθρονόμθςθσ τθσ αιμορροφιλίασ Α ςε μια οικογζνεια. Ένα άτομο ςτθν οικογζνεια αυτι πάςχει από μια αρικμθτικι χρωμοςωμικι ανωμαλία Γ.1. Πωσ κλθρονομείται το χαρακτθριςτικό; Να αιτιολογιςετε τθν απάντθςι ςασ με τισ κατάλλθλεσ διαςταυρϊςεισ και να βρείτε όλουσ τουσ πικανοφσ γονότυπουσ των ατόμων τθσ οικογζνειασ αυτισ. Μονάδεσ 9 Γ.2. Ποιο άτομο από αυτά που απεικονίηονται ςτο γενεαλογικό δζνδρο εκδθλϊνει αρικμθτικι χρωμοςωμικι ανωμαλία; Να αιτιολογιςετε τθν απάντθςι ςασ. Μονάδεσ 4 Γ.3. Να εξθγιςετε τουσ πικανοφσ τρόπουσ με τουσ οποίουσ προζκυψε το άτομο που πάςχει από τθν παραπάνω χρωμοςωμικι ανωμαλία. Μονάδεσ 12

26 Θζμα Δ Δίνεται θ ακόλουκθ αλλθλουχία βάςεων που κωδικοποιεί πεπτίδιο: Δ.1. Να βρείτε ποια αλυςίδα είναι θ κωδικι και ποια θ μθ κωδικι (μονάδεσ 2), να γράψετε το mrna που προκφπτει από τθ μεταγραφι τθσ παραπάνω αλλθλουχίασ (μονάδεσ 2) και να αιτιολογιςετε τισ απαντιςεισ ςασ (μονάδεσ 6) Μονάδεσ 10 Δ.2. Η αλλθλουχία αυτι αντιγράφεται. Η κζςθ ζναρξθσ τθσ αντιγραφισ είναι ςτα δεξιά τθσ αλλθλουχίασ που δίνεται. Να εξθγιςετε ποια αλυςίδα αντιγράφεται ςυνεχϊσ και ποια αςυνεχϊσ (μονάδεσ 4) και να γράψετε το πρωταρχικό τμιμα που κα τοποκετθκεί κατά τθν ζναρξθ τθσ αντιγραφισ ςτθν αλυςίδα που αντιγράφεται ςυνεχϊσ και το οποίο αποτελείται από οκτϊ νουκλεοτίδια (μονάδεσ 6). Μονάδεσ 10 Δ.3. Το τμιμα που περικλείεται από τισ αγκφλεσ υφίςταται αναςτροφι. Να γράψετε τθ νζα αλλθλουχία που κα προκφψει μετά τθν αναςτροφι και να εξθγιςετε ποιεσ κα είναι οι επιπτϊςεισ ςτο πεπτίδιο που παράγεται Μονάδεσ 5

27 ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 10/5/2015 Να απαντιςετε ςε όλα τα κζματα με βάςθ τισ οδθγίεσ ςε κάκε κζμα. Καλι επιτυχία ΘΕΜΑ Α Να αντιγράψετε ςτο τετράδιό ςασ τουσ αρικμοφσ των παρακάτω προτάςεων ι φράςεων και δίπλα να ςθμειϊςετε το γράμμα που τισ ςυμπλθρϊνει ςωςτά Α.1. Οι DNA πολυμεράςεσ α. είναι ζνηυμα που λειτουργοφν όπωσ και θ αντίςτροφθ μεταγραφάςθ β. επιδιορκϊνουν τυχόν λάκθ που γίνονται κατά τθ διάρκεια τθσ μεταγραφισ γ. είναι τρεισ ςε όλα τα είδθ των βακτθρίων δ. όλεσ οι παραπάνω προτάςεισ είναι ςωςτζσ για τα ζνηυμα αυτά ε. καμία από τισ παραπάνω προτάςεισ δεν ιςχφει για τισ DNA πολυμεράςεσ Α.2. Κάκε μεταφαςικό χρωμόςωμα α. αποτελείται από δφο αδελφζσ χρωματίδεσ ενωμζνεσ ςτο κεντρομερίδιο β. είναι προϊόν αντιγραφισ ενόσ αρχικοφ μορίου DNA γ. αποτελείται από DNA και πρωτεΐνεσ δ. όλεσ οι παραπάνω προτάςεισ είναι ςωςτζσ για το μεταφαςικό χρωμόςωμα ε. καμία από τισ παραπάνω προτάςεισ δεν αφοροφν το μεταφαςικό χρωμόςωμα Α.3. Για τθ κεραπεία τθσ ζλλειψθσ τθσ απαμινάςθσ τθσ αδενοςίνθσ α. είναι απαραίτθτο το άτομο να είναι ομόηυγο για το επικρατζσ β. χρθςιμοποιοφνται μονοκλωνικά αντιςϊματα γ. εφαρμόηεται θ ex vivo γονιδιακι κεραπεία δ. ιςχφουν όλεσ οι παραπάνω προτάςεισ για τθ ςυγκεκριμζνθ αςκζνεια ε. δεν ιςχφει τίποτε από τα παραπάνω

28 Α.4. Ποια από τισ παρακάτω μεταλλάξεισ κα ζχει τισ πιο ςοβαρζσ επιπτϊςεισ ςτθν ζκφραςθ ενόσ γονιδίου; α. διπλαςιαςμόσ ενόσ ηεφγουσ βάςεων πριν από τθ κζςθ ζναρξθσ τθσ μετάφραςθσ β. προςκικθ τριϊν βάςεων πριν από το κωδικόνιο λιξθσ γ. ζλλειψθ μιασ βάςθσ μετά το κωδικόνιο ζναρξθσ δ. αντικατάςταςθ μιασ βάςθσ με αποτζλεςμα το κωδικόνιο τθσ κωδικισ αλυςίδασ του γονιδίου 5 TGA 3 να μετατραπεί ςε 5 TAA 3 ε. όλεσ οι παραπάνω αλλαγζσ ευνοοφν τθν εμφάνιςθ νζων χαρακτθριςτικϊν, άρα είναι ωφζλιμεσ για το άτομο που τισ φζρει Α.5. Οι μεταλλάξεισ α. δθμιουργοφν πάντα προβλιματα ςτον οργανιςμό που τισ φζρει β. είναι ζνασ παράγοντασ δθμιουργίασ ποικιλομορφίασ ςτουσ οργανιςμοφσ γ. αφοροφν ειςαγωγι ενόσ γονιδίου ςτο γονιδίωμα ενόσ άλλου οργανιςμοφ δ. δεν εκφράηονται επειδι ο γενετικόσ κϊδικασ είναι εκφυλιςμζνοσ ε. ιςχφουν όλεσ οι παραπάνω προτάςεισ Μονάδεσ 25 Θζμα Β Να απαντιςετε ςτισ ακόλουκεσ ερωτιςεισ: Β.1. Ποιοσ είναι ο ρόλοσ του RNA ςτα κφτταρα; Μονάδεσ 10 Β.2. Πόςεσ διαφορετικζσ αλλθλουχίεσ DNA του 21 ου ηεφγουσ περιμζνετε να ζχει ζνα άτομο που πάςχει από ςφνδρομο Down, το οποίο προζκυψε από φυςιολογικοφσ γονείσ; Μονάδεσ 8 Β.3. Σε ποιεσ περιπτϊςεισ δεν παράγεται ςε ζνα άτομο αιμοςφαιρίνθ HbA; Θζμα Γ Μονάδεσ 5 Ηευγάρι φυςιολογικϊν γονζων αποκτοφν δφο παιδιά διαφορετικοφ φφλου: ζνα με μερικι αχρωματοψία ςτο κόκκινο πράςινο, και ζνα που πάςχει από κυςτικι ίνωςθ. Ηθτοφν τθ γενετικι ςασ ςυμβουλι για να μάκουν αν το επόμενο παιδί που περιμζνουν υπάρχει πικανότθτα να πάςχει από κάποια αςκζνεια. Κατά τθν καταγραφι του ιςτορικοφ, ανακαλφπτετε ότι θ μθτζρα του άντρα είχε αδελφό που ζπαςχε από μερικι αχρωματοψία και από κυςτικι ίνωςθ, ενϊ ο πατζρασ του είχε φυςιολογικι όραςθ αλλά ιταν φορζασ τθσ κυςτικισ ίνωςθσ. Θ μθτζρα τθσ γυναίκασ ζπαςχε από κυςτικι ίνωςθ, αλλά δεν ζπαςχε από αχρωματοψία, ενϊ ο πατζρασ τθσ είχε φυςιολογικι όραςθ και δεν ζπαςχε από κυςτικι ίνωςθ.

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΓΙΑ ΤΑ ΤΜΗΜΑΤΑ ΠΓΘΤ, ΓΘΤ, ΠαΘΤ Θέμα Α Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ

3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 16 ΣΕΠΤΕΜΒΡΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 Ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό σας τον αριθµό της

Διαβάστε περισσότερα

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις των θεμάτων βιολογίας προσανατολισμού (νέο σύστημα)

Ενδεικτικές απαντήσεις των θεμάτων βιολογίας προσανατολισμού (νέο σύστημα) ΘΕΜΑ Α Α1. Β Α2. Β Α3. Δ Α4. Γ Α5. Γ ΘΕΜΑ Β Β1. 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Ενδεικτικές απαντήσεις των θεμάτων βιολογίας προσανατολισμού (νέο σύστημα) Β2. Σελ. 24 σχολικού βιβλίου «Κάθε φυσιολογικό

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Β, Α2. Β, Α3. Δ, Α4. Γ, Α5. γ ΘΕΜΑ Β Β1. 1 Α, 2 Γ, 3 Α,4 Β, 5 Α, 6 Α, 7 Γ Β2. Βλ. σχολικό βιβλίο, σελ.24(έκδοση 2014-15)

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέμα 1 ο : Να επιλέξετε τη σωστή απάντηση: 1. Το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης δεν περιλαμβάνει α. το mrna β. τη μεγάλη ριβοσωμική υπομονάδα γ.

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑΔΑ Β ) ΣΑΒΒΑΤΟ 28 ΝΟΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 18 Μαΐου 2011 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα

Σ Υ Σ Τ Η Μ Α ) ΘΕΜΑ Α

Σ Υ Σ Τ Η Μ Α ) ΘΕΜΑ Α ΘΕΜΑ Α ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ)

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) Σχόλια Τα θέματα καλύπτουν το μεγαλύτερο μέρος της ύλης που εξεταζόταν. Απαιτούσαν πολύ καλή κατανόηση της θεωρίας και αρκετό χρόνο για την επίλυση των ασκήσεων. Στο ερώτημα Γ1 υπήρχε ασάφεια στο ζητούμενο

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία συµπληρώνει σωστά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 26 ΜΑΪΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ- ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέματα και Απαντήσεις

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ- ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέματα και Απαντήσεις ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ- ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέματα και Απαντήσεις Επιμέλεια: Ομάδα Βιολόγων www.othisi.gr 2 Παρασκευή, 27 Μα ου 2016 ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΚΑΙ ΖΩΗΣ Γ ΛΥΚΕΙΟΥ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού Γ Λυκείου

Βιολογία Προσανατολισμού Γ Λυκείου Μάθημα/Τάξη: Κεφάλαιο: Βιολογία Προσανατολισμού Γ Λυκείου Το γενετικό υλικό (Κεφ.1), Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας (Κεφ.2), Τεχνολογία του Ανασυνδυασμένου DNA (Κεφ.4), Μενδελική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα