Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα"


1 Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

2 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος περιέχει εκτός από άτομα C και έτεροάτομα Ν, Ο ήs) Ετεροκυκλικές ενώσεις είναι συνηθισμένες κι έχουν σπουδαία βιολογική δράση

3 2. Ακόρεστες ετεροκυκλικές ενώσεις με πενταμελή δακτύλιο Πυρρόλιο, φουράνιο και θειοφαίνιο: πιο γνωστές ακόρεστες ετεροκυκλικές ενώσεις Χημεία παραπάνω ετεροκυκλικών δακτυλίων ιδιάζουσα, π.χ. πυρρόλιο αν και είναι ταυτόχρονα αμίνη και συζυγιακό διένιο δεν παρουσιάζει καμία από τις παραπάνω χημικές ιδιότητες

4 3. Δομές πυρρολίου, φουρανίου και θειοφαινίου (5μελείς δακτύλιοι) Πυρρόλιο, φουράνιο και θειοφαίνιο δίνουν προϊόντα ηλεκτρονιόφιλης υποκατάστασης λόγω αρωματικού χαρακτήρα Κάθε ένωση περιέχει έξη π ηλεκτρόνια σε ένα κυκλικό συζυγιακό σύστημα στο οποίο υπάρχει αλληλοεπικάλυψη των τροχιακών p

5 4. Δομή πυρρολίου Μονήρες ζεύγος ηλεκτρονίων του αζώτου αποτελεί τμήμα της αρωματικής εξάδας και είναι λιγότερο διαθέσιμο για σχηματισμό δεσμών με οξέα

6 5. Αντιδράσεις πυρηνόφιλης υποκατάστασης πυρρολίου, φουρανίου και θειοφαινίου Πραγματοποιούνται αντιδράσεις αλογόνωσης, νίτρωσης, σουλφονίωσης και ακυλίωσης Friedel-Crafts Δραστικότητα αυξάνεται ως εξής: φουράνιο>πυρρόλιο> θειοφάινιο

7 6. Ηλεκτρονιόφιλη νίτρωση πυρρολίου Ηλεκτρονιόφιλη υποκατάσταση συνήθως στον C2 γιατί αυτή η θέση είναι η πλουσιότερη ηλεκτρονικά θέση του δακτυλίου

8 7. Πυριδίνη: ετεροκυκλική ένωση με 6μελή δακτύλιο Πυριδίνη: αζωτούχο ανάλογο του βενζολίου Επίπεδο αρωματικό μόριο, γωνία δεσμών 120 ο, μήκος δεσμός C-C 1.39 Å (τιμή ενδιάμεση μεταξύ απλού και διπλού δεσμού) Πέντε άτομα άνθρακα και το sp 2 -υβριδισμένο άτομο του Ν συνεισφέρει από ένα π ηλεκτρόνιο στην αρωματική εξάδα Σε αντίθεση με πυρρόλιο, μονήρες ζεύγος ηλεκτρονίων του Ν καταλαμβάνει τροχιακό sp 2 στο επίπεδο του δακτυλίου και δε συμμετέχει σε σχηματισμό δεσμών

9 8. Σχετική βασικότητα αζωτούχων ενώσεων σε κυκλική διάταξη Πυριδίνη ισχυρότερη βάση από πυρρόλιο διότι μονήρες ζεύγος ηλεκτρονίων Ν πυριδίνης δε συμμετέχει σε π αρωματικό σύστημα Αλκυλαμίνες ισχυρότερες βάσεις από πυριδίνη διότι μονήρες ζεύγος ηλεκτρονίων Ν πυριδίνης βρίσκεται σε sp 2 τροχιακό ενώ Ν αλκυλαμίνης σε sp 3 τροχιακό

10 9. Ηλεκτρονιόφιλη υποκατάσταση πυριδίνης Δακτύλιος πυριδίνης υφίσταται πολύ δύσκολα αντιδράσεις ηλεκτρονιόφιλης υποκατάστασης Αλογόνωση και σουλφονίωση πραγματοποιούνται κάτω από δραστικές συνθήκες, νίτρωση επιτυγχάνεται αλλά σε χαμηλή απόδοση ενώ αντιδράσεις Friedel- Crafts δε λαμβάνουν χώρα Παραπάνω αντιδράσεις δίνουν προϊόντα υποκατεστημένα στη 3 η θέση

11 10. Εξήγηση χαμηλής δραστικότητας πυριδίνης 1. Ελάττωση ηλεκτρονικής πυκνότητας του δακτυλίου λόγω έλξης ηλεκτρονίων από ηλεκτροαρνητικότερο άτομο Ν 2. Οξεοβασική σχέση ανάμεσα στο βασικό άτομο Ν και προσβάλλον ηλεκτρονιόφιλο

12 11. Πυρηνόφιλη υποκατάσταση πυριδίνης 2- και 4- υποκατεστημένες αλογονοπυριδίνες υφίστανται με σχετική ευκολία πυρηνόφιλη αρωματική υποκατάσταση

13 12. Ετεροκυκλικές ενώσεις με συμπυκνωμένους δακτυλίους Από βιολογική άποψη σπουδαιότεροι ετεροκυκλικοί δακτύλιοι πυριμιδίνης και πουρίνης

14 13. Νουκλεϊκά οξέα και νουκλεοτίδια Δεοξυριβονουκλεϊκό οξύ (DNA) και ριβονουκλεϊκό οξύ (RNA): μόρια φορείς της γενετικής πληροφορίας ενός κυττάρου DNA: μόριο στο οποίο βρίσκονται κωδικοποιημένες όλες οι πληροφορίες σχετικά με φύση, ανάπτυξη, διαίρεση και λειτουργία κυττάρου Νουκλεϊκά οξέα: βιοπολυμερή που απαρτίζονται από νουκλεοτίδια, που ενώνονται μεταξύ τους προς σχηματισμό αλυσίδων Νουκλεοτίδιο αποτελείται από ένα νουκλεοζίτη συνδεδεμένο με φωσφορική ομάδα και κάθε νουκλεοζίτης από ένα σάκχαρο (αλδοπεντόζη) συνδεδεμένο με μία ετεροκυκλική βάση πουρίνης ή πυριμιδίνης

15 14. Σάκχαρα και ετεροκυκλικές ενώσεις νουκλεϊκών οξέων Σάκχαρο RNA: ριβόζη Σάκχαρο DNA: 2 -δεοξυριβόζη RNA ετεροκυκλικές βάσεις Δύο πουρίνες (αδενίνη και γουανίνη) Δύο υποκατεστημένες πυριμιδίνες (κυτοσίνη και ουρακίλη) DNA ετεροκυκλικές βάσεις Δύο πουρίνες (αδενίνη και γουανίνη) Δύο υποκατεστημένες πυριμιδίνες (κυτοσίνη και θυμίνη)

16 15. Νουκλεοζίτες και νουκλεοτίδια Υ=Η τοσάκχαρο είναι δεοξυριβόζη (DNA) Υ=ΟΗ το σάκχαρο είναι ριβόζη (RNA) DNA και RNA: ετεροκυκλικές αμίνες (βάσεις) ενώνονται με το C1 του σακχάρου ενώ η φωσφορική ομάδα μέσω εσωτερικού δεσμού με το C5 του σακχάρου

17 16. Ονομασίες και δομές DNA & RNA DNA & RNA: παρόμοια από χημική άποψη Μέγεθος και βιολογικός ρόλος τους πολύ διαφορετικός Μόρια DNA τεράστια Μ.Β. μέχρι τα 150 δισεκατομμύρια και απαντούν κυρίως μέσα στον πυρήνα του κυττάρου Μόρια RNA πολύ μικρότερα τεράστια με Μ.Β. μέχρι και απαντούν κυρίως έξω από τον πυρήνα του κυττάρου

18 17. Δομή DNA Νουκλεοτίδια συνδέονται στο DNA μέσω εστερικού φωσφορικού δεσμού ανάμεσα στην 5 -φωσφορική ομάδα ενός νουκλεοτιδίου και 3 -υδρόξυλομάδα του σακχάρου ενός άλλου νουκλεοτιδίου Το ένα άκρο έχει ελεύθερη υδροξυλομάδα (το άκρο 3 ) και το άλλο ελέυθερη φωσφορική ομάδα (το άκρο 5 )

19 18. Ακολουθία νουκλεοτιδίων Δομή νουκλεϊκών οξέων εξαρτάται από ακολουθία νουκλεοτιδίων Ακολουθία νουκλεοτιδίων περιγράφεται ξεκινώντας από το άκρο 5 και προσδιορίζοντας τις βάσεις με τη σειρά που απαντούν χρησιμοποιώντας συντομογραφίες Α αδενίνη, T θυμίνη G γουανοσίνη και C κυτιδίνη

20 19. Μοντέλο Watson-Crick (1953) Διαφορετικoί ιστοίίδιου βιολογικού είδους εμφανίζουν ίδια αναλογία ετεροκυκλικών βάσεων (αδενίνη & θυμίνη και κυτοσίνη & γουανίνη σε ίση αναλογία) 2ταγής δομή DNA: 2 πολυνουκλεοτιδικοί κλώνοι σε δομή διπλής έλικας Κλώνοι έχουν αντίθετη κατεύθυνση, συγκρατούνται με δεσμούς Η ανάμεσα σε συγκεκριμένα ζευγάρια βάσεων Αδενίνη (Α) με Θυμίνη (Τ) και Γουανίνη (G) με Κυτoσίνη (C)

21 20. Συμπληρωματικότητα κλώνων DNA Κλώνοι διπλής έλικας DNA όχι ταυτόσημοι αλλά συμπληρωματικοί Όταν στον ένα κλώνο βάση C ή A στον άλλο βάση G ή T, αντίστοιχα Διπλή έλικα DNA: πλάτος 20 Å και σε κάθε πλήρη περιέλιξη: 10 ζεύγη βάσεων Ύψος κάθε πλήρους περιέλιξης 34 Å

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χηµεία Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει µόνο άτοµα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

Κεφάλαιο 6. Κατάταξη των οργανικών ενώσεων

Κεφάλαιο 6. Κατάταξη των οργανικών ενώσεων Κεφάλαιο 6 Κατάταξη των οργανικών ενώσεων Σύνοψη Στο κεφάλαιο αυτό γίνεται αναφορά στους τρόπους ταξινόμησης των οργανικών ενώσεων και παρέχονται κάποια στοιχεία για κάθε κατηγορία. Ιδιαίτερη αναφορά γίνεται

Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 15: Βενζόλιο και αρωματικότητα

Οργανική Χημεία. Κεφάλαιο 15: Βενζόλιο και αρωματικότητα Οργανική Χημεία Κεφάλαιο 15: Βενζόλιο και αρωματικότητα 1. Αρωματικές ενώσεις Αρωματικές ενώσεις: ενώσεις με ευχάριστη οσμή Αρωματικές ενώσεις αναφέρονται συνήθως στο βενζόλιο και σε ενώσεις με συγγενική

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 16: Χημεία του βενζολίου: ηλεκτρονιόφιλη αρωματική υποκατάσταση

Οργανική Χημεία. Κεφάλαιο 16: Χημεία του βενζολίου: ηλεκτρονιόφιλη αρωματική υποκατάσταση Οργανική Χημεία Κεφάλαιο 16: Χημεία του βενζολίου: ηλεκτρονιόφιλη αρωματική υποκατάσταση 1. Αντιδράσεις αρωματικών ενώσεων Σημαντικότερη αντίδραση αρωματικών ενώσεων: ηλεκτρονιόφιλη αρωματική υποκατάσταση

Διαβάστε περισσότερα

Κεφάλαιο 7 ΑΛΚΑΛΟΕΙΔΗ Τα αλκαλοειδή δεν αποτελούν μια ομογενή ομάδα ενώσεων, αποτέλεσμα να είναι ιδιαίτερα δύσκολος ο προσδιορισμός τους. με Ένας γενικότερος ορισμός των αλκαλοειδών αναφέρει ότι αυτά είναι

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Ε. Μαλαμίδου-Ξενικάκη

Ε. Μαλαμίδου-Ξενικάκη Ε. Μαλαμίδου-Ξενικάκη Θεσσαλονίκη 2015 Ηλεκτρονιόφιλη προσβολή σε παράγωγα του βενζολίου Ασπιρίνη Η ασπιρίνη παρασκευάζεται βιομηχανικά με εκλεκτική ηλεκτρονιόφιλη αρωματική υποκατάσταση της φαινόλης.

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα


ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Οργανική Χημεία. Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες

Οργανική Χημεία. Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες Οργανική Χημεία Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες 1. Καρβονυλικές ενώσεις Καρβονυλική ομάδα C=O σημαντικότερη λειτουργική ομάδα οργανικής χημείας Καρβονυλικές ομάδες βρίσκονται

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (10/3/2014) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (10/3/2014) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (10/3/2014) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια- Φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα


ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Ηλεκτρονιόφιλη αρωµατική υποκατάσταση

Ηλεκτρονιόφιλη αρωµατική υποκατάσταση Ηλεκτρονιόφιλη αρωµατική υποκατάσταση Νικόλαος Αργυρόπουλος Θεσσαλονίκη 2007 Τυπικές αντιδράσεις ηλεκτρονιόφιλης αρωµατικής υποκατάστασης Ηλεκτρονιόφιλη προσθήκη στα αλκένια Μηχανισµός C C C C C C Το ηλεκτρονικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


2 1 2 3 4 5 6 7 8 9 Η μικρότερη σταθερότητα της βινυλικής ρίζας (για παράδειγμα σε σχέση με τη μεθυλική) θα μπορούσε να εξηγηθεί στη βάση του πόσο ισχυρά έλκονται τα ηλεκτρόνια από το κάθε άτομο άνθρακα.

Διαβάστε περισσότερα

Μεσομερείς Δομές ή Δομές Συντονισμού

Μεσομερείς Δομές ή Δομές Συντονισμού Μεσομερείς Δομές ή Δομές Συντονισμού Σε περίπτωση ενώσεων που περιέχουν πολλαπλούς δεσμούς όπως το αιθυλένιο (αιθένιο), ο διπλός δεσμός δημιουργείται με συνεισφορά ενός ηλεκτρονίου από κάθε άτομο άνθρακα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Οργανική Χημεία. Βιολογικές Επιστήμες Βιολογία Γεωπονία Ιατρική κ.α. Βιοχημεία. Οργανική Χημεία. Φυσικές Επιστήμες Φυσική Μαθηματικά

Οργανική Χημεία. Βιολογικές Επιστήμες Βιολογία Γεωπονία Ιατρική κ.α. Βιοχημεία. Οργανική Χημεία. Φυσικές Επιστήμες Φυσική Μαθηματικά Πέτρος Ταραντίλης Αναπληρωτής Καθηγητής Εργαστήριο Χημείας, Τμήμα Επιστήμης Τροφίμων και Διατροφής του Ανθρώπου Ιερά Οδός 75, 118 55 Αθήνα, e-mail: ptara@aua.gr, Τηλ.: 210 529 4262, Fax: 210 529 4265 Βιοχημεία

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

ιδάσκοντες: Γιώργος Αϊβαλάκις, Επίκουρος Καθ. Γιώργος Καραµπουρνιώτης, Αναπληρωτής Καθ. Κώστας Φασσέας, Αναπληρωτής Καθ.

ιδάσκοντες: Γιώργος Αϊβαλάκις, Επίκουρος Καθ. Γιώργος Καραµπουρνιώτης, Αναπληρωτής Καθ. Κώστας Φασσέας, Αναπληρωτής Καθ. ιδάσκοντες: Γιώργος Αϊβαλάκις, Επίκουρος Καθ. Γιώργος Καραµπουρνιώτης, Αναπληρωτής Καθ. Κώστας Φασσέας, Αναπληρωτής Καθ. ιάρθρωση του µαθήµατος Κώστας Φασσέας Κεφάλαια: 1,2,3,6,8 Γιώργος Αϊβαλάκις Κεφάλαια:

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 17 & 18: Αλκοόλες, θειόλες, αιθέρες και εποξείδια

Οργανική Χημεία. Κεφάλαιο 17 & 18: Αλκοόλες, θειόλες, αιθέρες και εποξείδια Οργανική Χημεία Κεφάλαιο 17 & 18: Αλκοόλες, θειόλες, αιθέρες και εποξείδια 1. Αλκοόλες Ενώσεις που περιέχουν ομάδες υδροξυλίου συνδεδεμένες με κορεσμένα άτομα άνθρακα υβριδισμού sp 3 Βάσει παραπάνω ορισμού,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (22/2/2016) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια-φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαια 20 & 21: Καρβοξυλικά οξέα, παράγωγα τους και αντιδράσεις ακυλο υποκατάστασης

Οργανική Χημεία. Κεφάλαια 20 & 21: Καρβοξυλικά οξέα, παράγωγα τους και αντιδράσεις ακυλο υποκατάστασης Οργανική Χημεία Κεφάλαια 20 & 21: Καρβοξυλικά οξέα, παράγωγα τους και αντιδράσεις ακυλο υποκατάστασης 1. Καρβοξυλικά οξέα Σημαντικά ακυλο (-COR) παράγωγα Πλήθος καρβοξυλικών ενώσεων στη φύση, π.χ. οξικό

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες Σχολή: Περιβάλλοντος Τμήμα: Επιστήμης Τροφίμων και Διατροφής Εκπαιδευτής: Χαράλαμπος Καραντώνης Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. Καθηγητής Μόσχος Πολυσίου / Εργαστήριο Γενικής Χημείας Γ.Π.Α.

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. Καθηγητής Μόσχος Πολυσίου / Εργαστήριο Γενικής Χημείας Γ.Π.Α. ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ Καθηγητής Μόσχος Πολυσίου / Εργαστήριο Γενικής Χημείας Γ.Π.Α. ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ Η Οργανική Χημεία μελετά τις ενώσεις του άνθρακα. Ο Wohler το828 πρώτος παρασκεύασε οργανική ένωση από ανόργανο

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

Περίληψη 1 ου Κεφαλαίου

Περίληψη 1 ου Κεφαλαίου Περίληψη 1 ου Κεφαλαίου Άτοµο: θετικά φορτισµένος πυρήνας περικυκλωµένος από αρνητικά φορτισµένα ηλεκτρόνια Ηλεκτρονική δοµή ατόµου περιγράφεται από κυµατοσυνάρτηση Ηλεκτρόνια καταλαµβάνουν τροχιακά γύρω

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

Κεφάλαιο 3. Στοιχειώδεις αντιδράσεις στην Οργανική Χημεία

Κεφάλαιο 3. Στοιχειώδεις αντιδράσεις στην Οργανική Χημεία Κεφάλαιο 3 Στοιχειώδεις αντιδράσεις στην Οργανική Χημεία Σύνοψη Στο κεφάλαιο αυτό παρουσιάζονται οι στοιχειώδεις αντιδράσεις στην Οργανική Χημεία, οι οποίες μπορούν να διαχωριστούν στις εξής κατηγορίες:

Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα


ΓΕΝΙΚΗ ΚΑΙ ΑΝΟΡΓΑΝΗ ΧΗΜΕΙΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΓΕΝΙΚΗ ΚΑΙ ΑΝΟΡΓΑΝΗ ΧΗΜΕΙΑ Ενότητα # (12): Αλογόνα Ακρίβος Περικλής Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης

Διαβάστε περισσότερα

O 3,44 S 2,58 N 3,04 P 2,19

O 3,44 S 2,58 N 3,04 P 2,19 Περιοδικός Πίνακας (Σύστημα) των Ατόμων Περιοδικό σύστημα είναι ο πίνακας στον οποίο κατατάσσονται όλα τα άτομα με βάση τον αριθμό των πρωτονίων (θετικά φορτισμένα σωματίδια) που ευρίσκονται στον πυρήνα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εισαγωγικά. Σύνταξη, ταξινόμηση και τάξεις οργανικών ενώσεων. Τρόποι γραφής οργανικών ενώσεων. Λειτουργικές ομάδες.

Εισαγωγικά. Σύνταξη, ταξινόμηση και τάξεις οργανικών ενώσεων. Τρόποι γραφής οργανικών ενώσεων. Λειτουργικές ομάδες. ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ - Μάθημα «ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ» Ακαδημαϊκό έτος 2012-2013 ΠΡΟΓΡΑΜΜΑ ΘΕΩΡΗΤΙΚΩΝ, ΕΡΓΑΣΤΗΡΙΑΚΩΝ ΚΑΙ ΦΡΟΝΤΙΣΤΗΡΙΑΚΩΝ ΜΑΘΗΜΑΤΩΝ ΤΡΙΤΗ 9.00-12.00 (Ι3 - Θεωρία) ΠΕΜΠΤΗ 10.00 12.00 (I3-Θεωρία) ή (Εργαστήρια)

Διαβάστε περισσότερα

ΗΜΥ 001 -Υγεία και Τεχνολογία. Σενάρια Ιατρικής Φαντασίας (Γενετική)

ΗΜΥ 001 -Υγεία και Τεχνολογία. Σενάρια Ιατρικής Φαντασίας (Γενετική) ΗΜΥ 001 -Υγεία και Τεχνολογία Σενάρια Ιατρικής Φαντασίας (Γενετική) Γενετική ηµιουργήµατα της φύσης συνέπεια στα µορφολογικά χαρακτηριστικά τους αναπαραγωγική διαδικασία οι απόγονοι µοιάζουν σε µικρό ή

Διαβάστε περισσότερα

Οργανική Χημεία. Πέτρος Ταραντίλης Επίκουρος Καθηγητής Εργαστήριο Χημείας, Γενικό Τμήμα, Τηλ.: , Fax:

Οργανική Χημεία. Πέτρος Ταραντίλης Επίκουρος Καθηγητής Εργαστήριο Χημείας, Γενικό Τμήμα,   Τηλ.: , Fax: Πέτρος Ταραντίλης Επίκουρος Καθηγητής Εργαστήριο Χημείας, Γενικό Τμήμα, Ιερά Οδός 75, 118 55 Αθήνα, e-mail: ptara@aua.gr, Τηλ.: 210 529 4262, Fax: 210 529 4265 Θεωρία -Ύλη μαθήματος Ανθρακας-ταξινόμηση

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Δημοσιεύτηκε στο Science in School (http://www.scienceinschool.org)

Δημοσιεύτηκε στο Science in School (http://www.scienceinschool.org) Δημοσιεύτηκε στο Science in School (http://www.scienceinschool.org) Αναπαριστώντας τον διπλό έλικα του DNA με τη χρήση ανακυκλωμένων υλικών Ο Διονύσιος Καρούνιας, η Ευανθία Παπανικολάου και ο Αθανάσιος

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Οι James Watson και Francis Crick δίπλα από το μοντέλο της διπλής έλικας του DNA που τους εξασφάλισε το Βραβείο Νόμπελ. 2015 2 Β.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΜΙΝΕΣ. Νικόλαος Αργυρόπουλος

ΑΜΙΝΕΣ. Νικόλαος Αργυρόπουλος ΑΜΙΝΕΣ Νικόλαος Αργυρόπουλος ΑΜΙΝΕΣ-1: Φυσικοί αντιπρόσωποι 3 C 3 CC C 3 C 3 C 3 Κωδεϊνη Μορφίνη 3 CC Ηρωϊνη C 3 C 3 C 3 C 3 C 3 C 3 Κωνιίνη Νικοτίνη Κοκαϊνη Ατροπίνη Ph ΑΜΙΝΕΣ-2 Ταξινόμηση-Ονοματολογία

Διαβάστε περισσότερα


ΚΑΡΒΟΞΥΛΙΚΑ ΟΞΕΑ ΚΑΙ ΠΑΡΑΓΩΓΑ ΚΑΡΒΟΞΥΛΙΚΑ ΟΞΕΑ ΚΑΙ ΠΑΡΑΓΩΓΑ Εισαγωγή στα Καρβοξυλικά Οξέα Ονοματολογία των Καρβοξυλικών Οξέων Δομή και Ιδιότητες των Καρβοξυλικών Οξέων Παρασκευή των Καρβοξυλικών Οξέων Αντιδράσεις των Καρβοξυλικών Οξέων

Διαβάστε περισσότερα

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων Διαλέξεις Χημείας -2014 Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων 1. Συστατικά 1. Ριβόζη-Δεοξυριβόζη 2. Πουρίνες-Πυριμιδίνες 2. Νουκλεοσίδια ή νουκλεοζίτες

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα



Διαβάστε περισσότερα

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια Περιγραφή μαθήματος Επανάληψη σημαντικών εννοιών από την Οργανική Χημεία Χημική σύσταση των κυττάρων Μονοσακχαρίτες Αμινοξέα Νουκλεοτίδια

Διαβάστε περισσότερα

άνθρακα εκτός από CO, CO 2, H 2 CO 3, και τα ανθρακικά άλατα ( CO 2- Οργανική Χημεία : Η χημεία των ενώσεων του άνθρακα

άνθρακα εκτός από CO, CO 2, H 2 CO 3, και τα ανθρακικά άλατα ( CO 2- Οργανική Χημεία : Η χημεία των ενώσεων του άνθρακα Οργανικές ενώσεις : Όλες οι ενώσεις του άνθρακα εκτός από CO, CO 2, H 2 CO 3, και τα ανθρακικά άλατα ( CO 2-3 ) Οργανική Χημεία : Η χημεία των ενώσεων του άνθρακα Προέλευση οργανικών ενώσεων : κυρίως από

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

Α Ε Τ. ΤΕΙ Αθήνας. Στ. Μπογιατζής, επίκουρος καθηγητής ΤΕΙ Αθήνας. ΤΕΙ Αθήνας / ΣΑΕΤ / Στ. Μπογιατζής

Α Ε Τ. ΤΕΙ Αθήνας. Στ. Μπογιατζής, επίκουρος καθηγητής ΤΕΙ Αθήνας. ΤΕΙ Αθήνας / ΣΑΕΤ / Στ. Μπογιατζής Στ. Μπογιατζής, επίκουρος καθηγητής Ομοιοπολικές χημικές ενώσεις Ενώσεις του άνθρακα Χαρακτηριστικές ομάδες Τετραεδρική μοριακή δομή Επίπεδη τριγωνική μοριακή δομή Ευθύγραμμη μοριακή δομή Τα οργανικά μόρια

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΦΥΣΙΚΗ. Μαθηματική Εισαγωγή. Στοιχεία Διανυσματικού, Διαφορικού και Ολοκληρωτικού Λογισμού Εισαγωγή Διαίρεση Μηχανικής.

ΓΕΝΙΚΗ ΦΥΣΙΚΗ. Μαθηματική Εισαγωγή. Στοιχεία Διανυσματικού, Διαφορικού και Ολοκληρωτικού Λογισμού Εισαγωγή Διαίρεση Μηχανικής. ΓΕΝΙΚΗ ΦΥΣΙΚΗ Ι. ΜΗΧΑΝΙΚΗ Μαθηματική Εισαγωγή. Στοιχεία Διανυσματικού, Διαφορικού και Ολοκληρωτικού Λογισμού Εισαγωγή Διαίρεση Μηχανικής. Α Μηχανική Υλικού Σημείου Στατική Υλικού Σημείου, Σύνθεση δυνάμεων,

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 1: Δομή και δεσμοί

Οργανική Χημεία. Κεφάλαιο 1: Δομή και δεσμοί Οργανική Χημεία Κεφάλαιο 1: Δομή και δεσμοί 1. Οργανική χημεία Οργανικές ενώσεις μέχριτομισότου1800 αναφέρονταν σε ενώσεις από ζωντανούς οργανισμούς Wöhler το 1828 έδειξε ότι η ουρία, μία οργανική ένωση,

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα

Ηλεκτρονικά Φαινόμενα

Ηλεκτρονικά Φαινόμενα Ηλεκτρονικά Φαινόμενα Το επαγωγικό όμως φαινόμενο οδηγεί στη διάχυση της πόλωσης και στο υπόλοιπο μόριο. Έτσι πολώνονται, με φθίνουσα όμως ένταση, και οι επόμενοι άνθρακες που είναι συνδεδεμένοι μέσω σ

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 26: Βιομόρια: υδατάνθρακες

Οργανική Χημεία. Κεφάλαιο 26: Βιομόρια: υδατάνθρακες Οργανική Χημεία Κεφάλαιο 26: Βιομόρια: υδατάνθρακες 1. Γενικά Ενώσεις που απαντούν σε κάθε ζωντανό οργανισμό Άμυλο και ζάχαρη στις τροφές και κυτταρίνη στο ξύλο, χαρτί και βαμβάκι είναι καθαροί υδατάνθρακες

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα

πολώνεται δύσκολα πολώνεται εύκολα

πολώνεται δύσκολα πολώνεται εύκολα Η αρχή του σκληρού ή µαλακού οξέος (ή βάσης) σκληρό οξύ µικρό σε µέγεθος χηµικό είδος πολώνεται δύσκολα µαλακό οξύ µεγάλο σε µέγεθος χηµικό είδος πολώνεται εύκολα Θρέψη Φυτών. Μπουράνης, Σ. Χωριανοπούλου

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Με ποια πειράµατα οι επιστήµονες κατέληξαν στο συµπέρασµα ότι το DNA είναι το γενετικό υλικό του κυττάρου. Ποιες οι διαφορές

Διαβάστε περισσότερα

Κεφάλαιο 15 Αρωματικοί Υδρογονάνθρακες

Κεφάλαιο 15 Αρωματικοί Υδρογονάνθρακες Κεφάλαιο 15 Αρωματικοί Υδρογονάνθρακες Σύνοψη Οι αρωματικοί υδρογονάνθρακες είναι κατηγορία υδρογονανθράκων που διαφέρουν σημαντικά από τους υπόλοιπους αλειφατικούς υδρογονάνθρακες (αλκάνια, αλκένια, αλκύνια)

Διαβάστε περισσότερα

Ηλεκτρονιόφιλα Πυρηνόφιλα αντιδραστήρια. Επίκουρος καθηγητής Χρήστος Παππάς

Ηλεκτρονιόφιλα Πυρηνόφιλα αντιδραστήρια. Επίκουρος καθηγητής Χρήστος Παππάς Ηλεκτρονιόφιλα Πυρηνόφιλα αντιδραστήρια Επίκουρος καθηγητής Χρήστος Παππάς 1 Ηλεκτρονιόφιλα - πυρηνόφιλα αντιδραστήρια Ηλεκτρονιόφιλα λέγονται τα αντιδραστήρια τα οποία δέχονται ένα ή δύο ηλεκτρόνια σε

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα


ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΟΝ ΕΡΟΤΗΣΕΟΝ ΑΠΑΝΤΗΣΕΙΣ ΤΟΝ ΕΡΟΤΗΣΕΟΝ 45 Κεφάλαιο 1 Το νενειικό υλικό 1. To DNA σε δύο διαφορετικά κύτταρα ανθρώπου βρέθηκε ότι αποτελείται στο ένα από 3x10 9 και στο άλλο από 6x1 θ 9 ζεύγη βάσεων. Πώς πορεί να εξηγηθεί

Διαβάστε περισσότερα

Οργανική Χηµεία. Κεφάλαιο 26: Βιοµόρια: υδατάνθρακες

Οργανική Χηµεία. Κεφάλαιο 26: Βιοµόρια: υδατάνθρακες Οργανική Χηµεία Κεφάλαιο 26: Βιοµόρια: υδατάνθρακες 1. Γενικά Ενώσεις που απαντούν σε κάθε ζωντανό οργανισµό Άµυλο και ζάχαρη στις τροφές και κυτταρίνη στο ξύλο, χαρτί και βαµβάκι είναι καθαροί υδατάνθρακες

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα