Επεκτάσεις των νόµων του Mendel µέρος ΙΙΙ. Π. Πάσχου, PhD, DABMG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Επεκτάσεις των νόµων του Mendel µέρος ΙΙΙ. Π. Πάσχου, PhD, DABMG"


1 Επεκτάσεις των νόµων του Mendel µέρος ΙΙΙ Π. Πάσχου, PhD, DABMG

2 Επεκτάσεις των νόµων του Mendel Φυλοσύνδετη κληρονοµικότητα Ατελής κυριαρχία και συγκυριαρχία Πολλαπλά αλληλόµορφα Αβιώσιµα γονίδια (θνησιγόνα) Αλληλεπίδραση γονιδίων (π.χ. Επίσταση) Πλειοτροπισµός: ένα γονίδιο επηρεάζει πολλούς χαρακτήρες Περιβαλλοντικές επιδράσεις υναµικές µεταλλάξεις Εξωπυρηνική κληρονοµικότητα Πολυπαραγοντική κληρονοµικότητα Σύνδεση ανάµεσα σε γονίδια που βρίσκονται στο ίδιο χρωµόσωµα

3 Γενετική βάση νοσηµάτων Παραδοσιακοί µηχανισµοί Χρωµοσωµικές ανωµαλίες Μονογονιδιακά νοσήµατα Πολυγονιδιακά/πολυπαραγοντικά νοσήµατα Ασυνήθιστοι µηχανισµοί Μωσαϊκισµός Γονεϊκή αποτύπωση (imprinting) Μονογονεϊκή δισωµία - Uniparental disomy (UPD) Μητρική ή πατρική επίδραση - Parent of origin effects Ασταθές DNA (trinucleotide repeat disorders) Μητρική (κυτταροπλασµατική) κληρονοµικότητα

4 υναµικές µεταλλάξεις Μια µετάλλαξη που αλλάζει από γενιά σε γενιά Νοσήµατα τρινουκλεοτιδικών επαναλήψεων Τρία νουκλεοτίδια επαναλαµβάνονται περισσότερες φορές από το κανονικό π.χ. CAGCAGCAGCAGCAGCAGCAGCAGCAG Τρινουκλεοτιδικές επαναλήψεις Προκαλούν ασθένεια όταν ξεπεράσουν το φυσιολογικό όριο Κάτω από ένα όριο είναι σταθερές στη µίτωση και τη µείωση Πάνω από ένα όριο είναι ασταθείς

5 Νοσήµατα τρινουκλεοτιδικών επαναλήψεων Γενετική προσδοκία (Anticipation): Η παρατήρηση ότι τα συµπτώµατα µιας νόσου χειροτερεύουν από γενιά σε γενιά. Επίσης η νόσος εµφανίζεται προοδευτικά σε µικρότερη ηλικία Οφείλεται στην ασταθή φύση των τρινουκλεοτιδικών επαναλήψεων

6 Νοσήµατα που οφείλονται σε απώλεια λειτουργίας (loss of function mutations) Υπολειπόµενα ή φυλοσύνδετα υπολειπόµενα Η επανάληψη είναι σε µη κωδικοποιούσα περιοχή Ιντρόνιο 1 του FRDA 5 UTR του FMR1 Χαρακτηρίζονται από πολύ µεγάλο αριθµό επαναλήψεων Το µήκος των επαναλήψεων σχετίζεται µε τη σοβαρότητα της ασθένειας Μείωση ή καταστολή της µεταγραφής του γονιδίου (Transcriptional silencing - loss of function)

7 Fragile X κλινικά χαρακτηριστικά φυλοσύνδετο υπολειπόµενο άνδρες: Μεγάλα αυτιά Προτεταµένο µέτωπο και σαγόνι µακροορχιδισµός Ήπια ως σοβαρή νοητική καθυστέρηση 20% των ανδρών µε µετάλλαξη δεν εµφανίζουν τη νόσο γυναίκες: υσκολία στη µάθηση Ήπια νοητική καθυστέρηση Ντροπαλή συµπεριφορά Κάποιοι φορείς παρουσιάζουν συµπτώµατα

8 Fragile X Syndrome (ανωµαλίες τρινουκλεοτιδικών επαναλήψεων) δεύτερη αιτία νοητικής υστέρησης (µετά το Down) 1 / 3600 άνδρες και 1 / 5000 γυναίκες FMR1 γονίδιο περιοχή επαναλήψεων CGG φυσιολογικά άτοµα µέχρι 56 CGG επαναλήψεις CGG επαναλήψεις προµετάλλαξη πάνω από 200 επαναλήψεις πλήρης µετάλλαξη µεθυλίωση του γονιδίου απώλεια της λειτουργίας του FMR1

9 Fragile X syndrome

10 Αταξία του Friedreich Η πιο συχνή κληρονοµούµενη αταξία 2-4/100000, συχνότητα φορέων 1/60-1/100 Έναρξη νόσου: ηλικία % των ασθενών είναι οµόζυγοι για µια επιµήκυνση AAG (expansion) ( επαναλήψεις) 4% έχουν ένα αλληλόµορφο µε πολλές επαναλήψεις και ένα αλληλόµορφο µε µια σηµειακή µετάλλαξη

11 Friedreich Ataxia Age Of Onset V AAG Size Smaller Allele Age of onset Age of onset GAA repeat size of smaller allele GAA ΑΑG repeat size of smaller allele

12 Κλινικά χαρακτηριστικά: Μυοτονική δυστροφία Αδυναµία των µυών του προσώπου, των άκρων, του λαιµού, µυοτονία, καταράκτες, ατροφία γονάδων, καρδιοµυοπάθεια, διαβήτης Σοβαρή µορφή (συνήθως κληρονοµείται από τη µητέρα): Συγγενής µυοτονική δυστροφία, πολύ σοβαρή µυοπάθεια και νοητική καθυστέρηση από τη γέννηση συχνότητα: 5-10/ κληρονοµικότητα: αυτοσοµικό επικρατές µε µητρική γενετική προσδοκία, (πιοσοβαρήνόσοςαπόγενιά σε γενιά)

13 Γενετική προσδοκία στη µυοτονική δυστροφία

14 Χρωµόσωµα: 19q13 Γονίδιο: µυοτονίνη Μυοτονική δυστροφία Μετάλλαξη: αυξηµένος αριθµός επαναλήψεων CTG στην περιοχή 3 UTR του γονιδίου Μείωση του ποσοστού µεταγραφής του γονιδίου ιαθέσιµος γενετικός έλεγχος φορέων: PCR και Southern blot test

15 Μυοτονική δυστροφία (DM) Μυική αδυναµία / καταράκτης / µυοτονία / υπογονιµότητα Επαναλήψεις CTG <37- φυσιολογικό >50- εµφάνιση νόσου ήπια συµπτώµατα Σοβαρή συγγενής µορφή >1000 Η συγγενής µορφή (παρούσα από τη γέννηση) κληρονοµείται σχεδόν πάντα από τη µητέρα

16 DM: Γενετική προσδοκία

17 Νοσήµατα που προκαλούνται από νέα λειτουργία gain of function mutations Αυτοσωµικά επικρατή Αύξηση αριθµου επαναλήψεων CAG, σε περιοχές που εκφράζονται Πολυγλουταµινικά νοσήµατα Σχετικά µικρή αύξηση του αριθµού των επαναλήψεων Συνήθως νευροεκφυλιστικά νοσήµατα

18 Xορεία του Huntington Κλινικά χαρακτηριστικά Χορεία άνοια υσκολία στο λόγο Προοδευτική επιδείνωση Μέσοςόροςηλικίας εµφάνισης έτη

19 Huntington s Μια µεγάλη οικογένεια από τη Βενεζουέλα µε πολλούς ασθενείς χρησιµοποιήθηκε για τη χαρτογράφηση του γονιδίου 1993 το πρώτο γονίδιο που χαρτογραφήθηκε µε κλωνοποίηση θέσης 4p γονίδιο Huntingtin gene Τα αλληλόµορφα που προκαλούν νόσο έχουν πολλές επαναλήψεις µιας αλληλουχίας CAG στο εξόνιο 1

20 Νόσος του Huntington Νευροεκφυλιστική νόσος 1: Αυτοσωµική επικρατής Επανάληψη CAG Polyglutamine Επαναλήψεις >29 ασταθής µετάλλαξη >40 πλήρης νόσος Πιο συχνά κληρονοµείται από τον πατέρα Η σοβαρή νεανική µορφή κληρονοµείται πάντα από τον πατέρα πρωτεϊνη = Huntingtin άγνωστη λειτουργία Η αύξηση των επαναλήψεων της προσδίδει άγνωστη τοξική λειτουργία

21 Huntington s disease

22 Huntington Disease Αριθµός επαναλήψεων συµπτώµατα

23 Νόσος του Huntington: µέγεθος επαναλήψεων και ηλικία έναρξης

24 Σπονδυλοπαρεγκεφαλιδική αταξία Ι Spinocerebellar ataxia I (SCA I) Κλινικά χαρακτηριστικά: εµφάνιση σε ενήλικες (ηλικία 35) προοδευτική αταξία, περιφερική νευροπάθεια, % των κληρονοµούµενων αταξιών Αυτοσωµική επικρατής µε πατρική γενετική προσδοκία χρωµόσωµα: 6p23 µετάλλαξη: αύξηση επαναλήψεων CAG σε µια περιοχή του γονιδίου ataxin πρωτείνη µε άγνωστη λειτουργία

25 Σπονδυλοπαρεγκεφαλιδικές αταξίες - SCAs Συνήθως εµφάνιση σε ενήλικες Προοδευτικός εκφυλισµός και θάνατος συνήθως χρόνια µετά την έναρξη Οφείλονται σε αύξηση επαναλήψεων σε γονίδια που ονοµάζονται αταξίνες - ataxins Αρνητική συσχέτιση ανάµεσα στον αριθµό των επαναλήψεων και την ηλικία έναρξης Όλες οφείλονται σε επαναλήψεις CAG εκτός από την SCA 8 (CTG) Γενετική προσδοκία από την πατρική κληρονόµηση

26 Spinocerebellar Ataxias (SCAs) SCA CHR Normal Range Expanded FEATURE Range SCA 1 6p SCA 2 12q Slow saccades SCA 3 14q SCA4 16q Sensory neuropathy SCA5 11 pure SCA 6 19p /21-33 Older age of onset SCA 7 3p Macular dystrophy, Younger onset SCA 8 13q?? SCA9?? SCA10 22q 5 nucleotide repeat Epilepsy (ATTCT) SCA11 15q Pure SCA >65 Tremor SCA13 19q Childhood onset, mild MR SCA14 19q Late onset pure SCA SCA15 3p Slowly progressive pure SCA SCA16 8q Pure SCA SCA17 6q TBP gene Complicated SCA

27 Τι προκαλεί την αύξηση του αριθµού των επαναλήψεων; 1- Λάθος στον διπλασιασµότουdna πριν από τη µίτωση 2- Λάθος στην επιδιόρθωση 3- Άνισος επιχιασµός κατά τη µείωση

28 Λάθη στον διπλασιασµό Hairpin formation after the passage of the replication fork (Origin switch model) Hairpin formation before fork passage (Fork shift model) Fork stalling leads to double strand breaks and expansion during repair

29 Replication Slippage

30 Λάθη στην επιδιόρθωση του DNA Breaks in the vicinity of a repeat allow hairpin formation and gaps thus created are filled in by mismatch repair KO mice with mutations in MMR proteins (MSH2, MSH3 and PMS2) show stabilisation and/or contractions of CAG/CTG repeats

31 Άνισος επιχιασµός x +

32 Άνισος επιχιασµός Recombination between sequences flanking repeats is rare in most disorders. Loss of recombination proteins has little effect on instability Recombination does appear to be a major source of instability with interrupted repeats e.g. in 50% of de novo inherited cases of facioscapulohumeral muscular dystrophy

33 Περίληψη δυναµικές µεταλλάξεις Αστάθεια από γενιά σε γενιά Οαριθµός των επαναλήψεων αλλάζει από γονείς σε παιδιά Το φύλο του γονέα µε τηµετάλλαξη έχει σηµασία Σε κάποιες περιπτώσεις είναι πιο ασταθείς µεταλλάξεις από τη µητέρα σε άλλες από τον πατέρα Γενετική προσδοκία Σοβαρότερος φαινότυπος από γενιά σε γενιά Καλύτερο παράδειγµα: µυοτονική δυστροφία Προµεταλλάξεις Μέγεθος επαναλήψεων που είναι ασταθές στην κληρονόµησή του αλλά δεν δίνει φαινότυπο Παράδειγµα: Εύθραυστο X Σχέση γονότυπου-φαινότυπου Όσο µεγαλύτερος ο αριθµός των επαναλήψεων τόσο µικρότερη η ηλικία έναρξης και πιο σοβαρά τα συµπτώµατα

34 Diseases caused by expansion of non-coding trinucleotide repeats (HMG 9:909) Disease Fragile X(A) Fragile X(E) Friedreich ataxia (recessive!) Myotonic dystrophy Spinocerebellar ataxia type 8 Spinocerebellar ataxia type 12 Gene/ locus FMR1 Xq27.3 FMR2 Xq28 X25 9q DMPK 19q13 SCA8 13q21 SCA12 5q31-33 tnr Location Disease mechanism CGG 5 untranscribed GCC 5 untranscribed Loss of FMR1 function Loss of FMR2 function GAA Intron 1 Loss of frataxin function CTG 3 untranslated CTG 3 untranslated CAG 5 untranscribed Loss of function? RNA effects (no protein)? Loss of function

35 Diseases caused by expansion of expressed trinucleotide repeats (HMG 9:909) Disease SBMA (Kennedy) SCA 3 Gene/ locus SCA3 (MJD1) SCA 6 SCA6 19p13 calcium channel protein locus protein CAG repeat size Normal Disease AR Xq13-21 Androgen receptor (intermediate alleles!) Huntington s HD 4p16.3 Huntingtin DRPLA DRPLA 12p Atrophin SCA type 1 SCA1 6p23 Ataxin * SCA 2 SCA2 12q24.1 Ataxin q32.1 Ataxin SCA 7 SCA7 13p12-13 Ataxin



38 Γονεϊκή αποτύπωση - Imprinting Για τα περισσότερα γονίδια εκφράζεται και το πατρικό και το µητρικό αλληλόµορφο Γονεϊκή αποτύπωση είναι η επιγενετική σήµανση ενός γονιδίου κατά τη γαµετογένεση ανάλογα µε τον γονέα στον οποίο γίνεται η γαµετογένεση και ως αποτέλεσµα η έκφραση µόνο του ενός αλληλοµόρφου στους απογόνους Καταστέλλεται δηλαδή η έκφραση του µητρικού ή του πατρικού αλληλοµόρφου Ο µηχανισµός περιλαµβάνει τη µεθυλίωση κυτοσινών και αναιρείται κατά τη γαµετογένεση

39 αποτυπωµένα γονίδια Imprinted genes Πιστεύεται ότι υπάρχουν Εµπλέκονται σε πολλές φάσεις της ανάπτυξης Εµβρυική ανάπτυξη Κυτταρική αύξηση Ανάπτυξη του εγκεφάλου Ενήλικη συµπεριφορά

40 Γονεϊκή αποτύπωση Ο Mendel έδειξε ότι µε αµοιβαίες διασταυρώσεις είχε τα ίδια αποτελέσµατα. Εξαίρεση: γονεϊκή αποτύπωση Οφαινότυποςτωναποτυπωµένων (σιωπηλών) γονιδίων εξαρτάται από τη γονεϊκή προέλευση Τα γονίδια µητρικής προέλευσης εκφράζονται διαφορετικά από τα γονίδια πατρικής προέλευσης Οφείλεται στη δοµή τηςχρωµατίνης (µεθυλίωση) Το αποτύπωµα «σβήνεται» και ξαναδηµιουργείται σε κάθε γενιά Στα παιδιά µιας γυναίκας, η γενετική πληροφορία από τον πατέρα της (τον παππού) συµπεριφέρεται σύµφωνα µε το µητρικό αποτύπωµα

41 * Imprinted gene

42 Γονεϊκή αποτύπωση ΚΑΤΑΣΤΟΛΗ ΤΗΣ ΕΚΦΡΑΣΗΣ Πατρικό αποτύπωµα Μητρικό αποτύπωµα

43 Παράδειγµα: Το γονίδιο που προκαλεί το φαινότυπο είναι πάντα σιωπηλό (imprinted) όταν κληρονοµείται από το ωάριο. Παραµένει ενεργό όταν κληρονοµείται από το σπέρµα. Η µετάλλαξη είναι επικρατής +/+ +/- + wildtype - product X mutant no product - product = µεταλλαγµένος φαινότυπος = φυσιολογικό +/- +/+ +/+ +/- Πατρική αποτύπωση Πατρική αποτύπωση Μητρική αποτύπωση = φυσιολογικό +/+ +/- +/- +/+ +/- +/- +/+ +/- +/- +/- +/+ +/- +/- +/+ +/- +/+ +/-

44 Imprinting

45 Γονεϊκή αποτύπωση στις γενετικές ασθένειες Μπορεί να οφείλονται σε Έλλειψη της περιοχής στο χρωµόσωµα που κληρονοµήθηκε από τον ένα γονιό Απώλεια της αποτύπωσης εκφράζονται και τα δύο αλληλόµορφα Μονογονεϊκή δισωµία - Uniparental disomy Prader-Willi syndrome, Angelman syndrome Beckwith-Wiedemann syndrome, Russell-Silver syndrome



48 Σύνδροµο Prader-Willi 70% έχουν µια έλλειψη στο πατρικό 15q12 25% έχουν και τα δύο χρωµοσώµατα 15 από τη µητέρα τους (maternal UPD)

49 Prader-Willi κλινικά χαρακτηριστικά Νοητική καθυστέρηση παχυσαρκία πολυφαγία Αλλοιώσεις του δέρµατος Μικρά χέρια και πόδια Κρυπτοορχιδισµός Μικρά γεννητικά όργανα 70% Έλλειψη 15q11- q13 από τον πατέρα)

50 Σύνδροµο Angelman 70% have 70% Έλλειψη των maternally-derived µητρικών γονιδίων στο 15deletion of 15q12 20% µετάλλαξη 2% των have µητρικών γονιδίων στο 15 patupd15 2% µονογονεϊκή Άλλη αιτία? δισωµία

51 Angelman κλινικά χαρακτηριστικά Βαριά νοητική καθυστέρηση Απρεπές και υπερβολικό γέλιο επιληψία αφασία 70% Έλλειψη µητρικού15q11-q13


53 Μονογονεϊκή δισωµία Uniparental disomy (UPD) και τα δύο οµόλογα προέρχονται από τον ένα γονιό πατέρα π.χ.: 2 χρωµοσώµατα 7 από τη µητέρα και κανένα από τον Ισοδισωµιά και ετεροδισωµία

54 Uniparental disomy (UPD) µητέρα 7A 7B πατέρας 7C 7D Ισοδισωµία Παιδιά µε µονογονεϊκή δισωµία από τη µητέρα 7A 7A Ετεροδισωµία 7A 7B


56 Μονογονεϊκή δισωµία Γιατί είναι πρόβληµα ανκαιταδύοοµόλογα προέρχονται από τον ένα γονιό?

57 Εξωπυρηνική κληρονοµικότητα µιτοχόνδριο πυρήνας χλωροπλάστης (φυτικά κύτταρα)

58 Μιτοχονδριακά γονίδια Τα µιτοχόνδρια είναι οργανίδια που παράγουν το µεγαλύτερο µέρος της ενέργειας στα ευκαρυωτικά κύτταρα (αερόβιος µεταβολισµός - κύκλος του Krebs και αλυσίδα µεταφοράς ηλεκτρονίων) Τα µιτοχόνδρια έχουν ένα µικρό κυκλικό µόριο DNA όπως τα βακτήρια Σύµφωνα µε τηνενδοσυµβιωτική θεωρία (Lynn Margulis) τα µιτοχόνδρια (και οι χλωροπλάστες) προέρχονται από βακτήρια που συµβιώσαν στο εσωτερικό ευκαρυωτικών κυττάρων Με το πέρασµα του χρόνου τα περισσότερα βακτηριακά γονίδια µεταφέρθηκαν στον πυρήνα αλλά περίπου 30 από αυτά έχουν παραµείνει στο µιτοχονδριακό γονιδίωµα

59 Αερόβιο προκαρυωτικό κύτταρο Ενδοσυµβιωτική Θεωρία mrna Protein OxP hos Ενδοκυττάρωση mrna Protein OxP hos Αερόβιο ευκαρυωτικό κύτταρο Protein mrna mrna Protein OxP hos Protein mrna Αναερόβιο πρόδροµο ευκαρυωτικό κύτταρο Μεταφορά γονιδίων Protein mrna

60 Αποδείξεις για την ενδοσυµβιωτική θεωρία Οµολογία αλληλουχίας οργανιδίων µε προκαρυωτικά κύτταρα Μιτοχόνδρια α-πορφυρά βακτήρια Χλωροπλάστες κυανοβακτήρια Χρειάζονται τόσο τα δικά τους όσο και πυρηνικά γονιδιακά προϊόντα για το σχηµατισµό τους Το γονιδίωµά τους µοιάζει περισσότερο µε προκαρυωτικό παρά µε ευκαρυωτικό: µικρό κυκλικό - χωρίς ιστόνες Ο µηχανισµός παραγωγής πρωτεϊνών µοιάζει περισσότερο µε προκαρυωτικό: rrna και ριβοσώµατα fmet, και όχι Met, είναι το πρώτο αµινοξύ Αντιδρούν διαφορετικά σε αντιβιοτικά και αναστολείς της πρωτεϊνικής σύνθεσης (η ριφαµπικίνη για παράδειγµα αναστέλλει την RNA πολυµεράση στα βακτήρια και τα µιτοχόνδρια αλλά όχι στον πυρήνα)

61 Εξωπυρηνική κληρονοµικότητα Μη Μενδελιανή κληρονοµικότητα: ε γίνεται διαχωρισµός εξαρτηµένος από τις ίνες της µιτωτικής ατράκτου. ηλαδή τα γονίδια που βρίσκονται έξω από τον πυρήνα (µιτοχονδριακό και χλωροπλαστικό γονιδιώµα) κληρονοµούνται ανεξάρτητα από τα πυρηνικά γονίδια Συνήθως επικρατεί ο γονότυπος που προέρχεται µόνο από τον ένα από τους δύο γονείς ενώ στα ανώτερα ζώα τα µιτοχόνδρια κληρονοµούνται µόνο από τις µητέρες ιαµερισµατοποίηση Η έκφραση και η ρύθµιση των γονιδίων των κυτταροπλασµατικών οργανιδίων γίνεται ανεξάρτητα από τα γονίδια του πυρήνα τα γονίδια αυτά µεταγράφονται και το mrna τους µεταφράζεται µόνο µέσα στο οργανίδιο

62 Τα γονίδια του γονιδιώµατος ενός οργανιδίου: Εξωπυρηνικά Μεταγράφονται και µεταφράζονται στο ίδιο κυτταρικό διαµέρισµα Τα πυρηνικά γονίδια εκφράζονται µε κυτταροπλασµατική σύνθεση ιαφορετικό σύστηµα αντιγραφής ιαφορετικός ρυθµός λαθών κατά την αντιγραφή ιαφορετικός ρυθµός µεταλλάξεων από το πυρηνικό DNA Μιτοχόνδρια Χλωροπλάστες

63 Μιτοχονδριακό πρότυπο κληρονοµικότητας Τα µιτοχόνδρια κληρονοµούνται µόνο από τη µητέρα Έτσι οι µιτοχονδριακοί χαρακτήρες που εµφανίζονται στη µητέρα, εµφανίζονται και στα παιδιά Με τον τρόπο αυτό ήταν δυνατό να δειχθεί ότι το ανθρώπινο είδος πρωτοεµφανίστηκε στην Αφρική και η κοινή µητέρα όλων µας έζησε πριν από χρόνια.

64 Mitochondrial Genome Size Variations in Eucaryotic Kingdom Kingdom Range of Geometry Gene Mitochondrial Organization Genome Sizes (kb) Animals Vertebrates Circular Compact Invertebrates Circular Mainly compact Plants >2000 Mainly Non-compact circular Fungi >100 Mainly Semi- (yeasts + moulds) circular compact

65 Το µιτοχόνδριο... Το ανθρώπινο µιτοχονδριακό γονιδίωµα είναι ~ 17 kb µε 37 γονίδια Κύρια λειτουργία η παραγωγή ATP µε οξειδωτική φωσφορυλίωση Χρησιµοποιεί γονίδια τόσο από το δικό του γονιδίωµα όσο και από τον πυρήνα

66 Το µιτοχονδριακό γονιδίωµα Το µιτοχονδριακό γονιδίωµα είναι16.6kb 22 γονίδια trna 13 γονίδια για πολυπεπτίδια της αναπνευστικής αλυσίδας 2 γονίδια rrna Τροποποιηµένος γενετικός κώδικας. UGA= Tryptophan και όχι stop AUA= Methionine και όχι Isoleucine όπως στον πυρήνα

67 Human Mitochondrial DNA H strand synthesis H strand transcription CYB D-loop 7S DNA 16S rrna 23S rrna H STRAND ND6 L strand transcription ND1 ND kb ND2 L STRAND ND4 Genes encoding proteins rrna genes ND4L ND3 CO3 L strand synthesis CO2 ATPase 8 ATPase 6 CO1 trna genes

68 Οι περισσότερες πρωτεΐνες των µιτοχονδρίων µεταφράζονται στο κυτταρόπλασµα από πυρηνικά γονίδια και µεταφέρονται στο µιτοχόνδριο Protein Complex Encoded by Encoded by mitochondrial genome nuclear genome Oxidative phosphorylation NADH dehydrogenase 7 subunits >41 subunits Succinate CoQ reductase 0 subunits 4 subunits Cytochrome b-c1 complex 1 subunit 10 subunits Cytochrome c oxidase complex 3 subunits 10 subunits ATP synthase complex 2 subunits 14 subunits Protein synthesis apparatus 2 rrnas All mitochondrial 22 trnas ribosomal proteins (13 mrnas) (~70 in total) Other mitochondrial proteins None All, e.g., mitochondrial DNA polymerase, RNA polymerase, other enzymes, structural proteins, Etc.

69 Human Genome Organization HUMAN GENOME Coding DNA Genes and generelated sequences Nuclear genome 3000 Mb genes 30% 70% Unique or moderately repetitive 10% 90% Noncoding DNA Extragenic DNA Two rrna genes Mitochondrial genome 16.6 kb 37 genes Unique or low copy number 22 trna genes 80% 20% 13 polypeptideencoding genes Moderate to highly repetitive Pseudogenes Gene fragments Introns, untranslated sequences, etc. Tandemly repeated or clustered repeats Interspersed repeats

70 Genetic Organization of Yeast Mitochondrial DNA 21S rrna var CO2 Exons Introns ATPase 9 Cytochrome b ATPase 6 ATPase 8 84 kb CO3 par 15S rrna Noncoding CO1

71 Εξωπυρηνικό DNA... Τα ευκαρυωτικά γονιδιώµατα περιλαµβάνουν εξωπυρηνικό DNA (µιτοχόνδρια και χλωροπλάστες) Ο τρόπος µε τον οποίο κληρονοµείται το DNA αυτό δεν ακολουθεί τους νόµους του Mendel Μητρική κληρονοµικότητα Ανθρώπινο µιτοχονδριακό DNA: κυκλικό µόριο 37 γονίδια: 13 πολυπεπτίδια, 22 trnas, 2 rrnas Το µιτοχόνδριο δοµείται από πρωτεΐνες από δύο γονιδιώµατα Ενδοσυµβιωτική θεωρία για την εξέλιξη του µιτοχονδριακού DNA

72 Χλωροπλάστες Το γονιδίωµά τους έχει διαφορετικό µέγεθος από είδος σε είδος -Arabidopsis ~150 kb µε ~130 γονίδια Κύρια λειτουργία η φωτοσύνθεση Χρησιµοποιούν γονίδια από το δικό τους γονιδίωµα και από το πυρηνικό DNA

73 Χλωροπλάστες Μέγεθος; kb, γονίδια Παρόµοια µε τοmt. Τα γονίδια rrna σχετίζονται µε τα αντίστοιχα βακτηριακά 50% τωνγονιδίωνσυµµετέχουν στην πρωτεϊνική σύνθεση Όπως και το mt.; Μέρος κάποιων πρωτεϊνών κωδικοποείται από τον πυρήνα Άλλες πρωτείνες κωδικοποιούνται πλήρωςαπότοδικότουςγονιδίωµα

74 Μονογονεϊκή κληρονοµικότητα (uniparental inheritance) X X org m org + org + org m org + org m Συχνά ο θηλυκός γαµέτης είναι ο µοναδικός που παρέχει κυτταρόπλασµα κατά τη γονιµοποίηση οπότε κληρονοµούνται µόνο τα µητρικά οργανίδια

75 Loblolly Pine Cytoplasmic Inheritance Τα µιτοχόνδρια κληρονοµούνται από τη µητέρα Οι χλωροπλάστες κληρονοµούνται από τον πατέρα

76 Κατά το σχηµατισµό του ζυγωτού: Ησυµβόλή των δύο γονιών δεν είναι ισοδύναµη Συµβάλλει µόνο ο ένας γονιός Η µη µενδελιανή κληρονοµικότητα προκύπτει από την παρουσία των γονιδιωµάτων των µιτοχονδρίων και των χλωροπλαστών, τα οποία κληρονοµούνται ανεξάρτητα από τα πυρηνικά γονίδια

77 Στον άνθρωπο... Κατά τη γονιµοποίηση ενός ωαρίου, µόνο µιτοχόνδρια από το ωάριο συµµετέχουν στο σχηµατισµό του ζυγωτού Τα µιτοχόνδρια από το σπερµατοζωάριο δε συµµετέχουν Οι παθήσεις που οφείλονται σε µιτοχονδριακές µεταλλάξεις κληρονοµούνται από τις µητέρες

78 Μητρική κληρονοµικότητα Προσβάλλονται και τα δύο φύλα Μεταβίβαση µόνο από τις µητέρες

79 Οµοπλασµία και ετεροπλασµία Κάποιες φορές ένα άτοµο έχει περισσότερα από ένα είδος µιτοχονδρίων αυτό όνοµάζεται ετεροπλασµία. Αφού τα µιτοχόνδρια µοιράζονται τυχαία στα θυγατρικά κύτταρα κατά την κυτταρική διαίρεση, διαφορετικά κύτταρα παίρνουν διαφορετικές αναλογίες των ειδών των µιτοχονδριών που υπάρχουν στο αρχικό κύτταρο. Αν ο ένας τύπος µιτοχονδρίου φέρει µια µετάλλαξη, τότε η έκφραση των συµπτωµάτων θα διαφέρει από ιστό σε ιστό ανάλογα µε την αναλογία µεταλλαγµένων και µη µεταλλαγµένων µιτοχονδρίων. Ετεροπλασµία Γενετική παρέκκλιση- Random drift κατά τύχη επικρατεί το µεταλλαγµένο µιτοχόνδριο Φαινοτυπικός ουδός - Threshold Effect Η φαινοτυπική έκφραση εξαρτάται από το βαθµό οµοπλασµίας ή ετεροπλασµίας

80 Μιτοχονδριακές παθήσεις στον άνθρωπο Οι µιτοχονδριακές µεταλλάξεις γενικά επηρεάζουν τους ιστούς εκείνους που έχουν υψηλές απαιτήσεις για ενέργεια (οξειδωτική φωσφορυλίωση) Συχνά επηρεάζεται το νευροµυϊκό και προκαλείται εγκεφαλοπάθεια, µυοπάθεια, αταξία, αµφιβληστροειδοπάθεια, και απώλεια της λειτουργίας των εξωτερικών οφθαλµικών µυών

81 µιτοχονδριακές ασθένειες ο φαινότυπος εξαρτάται από: τα γονίδια που εµπλέκονται τον τύπο της µετάλλαξης (missense/nonsense/deletion) το ποσοστό των µεταλλαγµένων και φυσιολογικών µιτοχονδρίων τον ιστό

82 Clinical Features of Mitochondrial disease 2: Features suggestive of mitochondrial illness Neuromuscular External opthalmoplegia Ptosis Deafness Neuropathy Migraine Seizures Encephalomyopathy Dementia Ataxia Stroke-Like episodes Spastic paraparesis Neuropathy Pigmentary retinopathy Optic atrophy Dystonia Cardiac HCOM Heart Block Endocrine Diabetes Mellitus Hypogonadism Infertility GIT Dysphagia Vomiting Pseudo-obstruction Pancreatic failure Liver failure Haematological Sideroblastic anaemia Pancytopenia Psychiatric Depression Psychosis Dermatological Lipomatosis Renal Aminoaciduria Tubule dysfunction Fanconi syndrome

83 Μιτοχονδριακές παθήσεις στον άνθρωπο Κληρονοµική οπτική νευροπάθεια του Leber: συνεχής φθορά του οπτικού νεύρου απώλεια της όρασης Σύνδροµο MERRF (Myoclonic Epilepsy and Ragged Red Fibers): Επιληπτικές κρίσεις, κώφωση, αταξία MELAS (Μιτοχονδριακή εγκεφαλοµυοπάθεια, γαλακτική οξείδωση και επεισόδια αποπληξίας) NARP (νευρογενής µυϊκή αδυναµία, αταξία και µελαγχρωµατική αµφιβληστροειδοπάθεια Kearns-Sayre: Προοδευτική απώλεια όρασης και ακοής, καρδιακές ανωµαλίες CPEO: Χρόνια εξελικτική εξωτερική οφθαλµοπληγία

84 Myoclonic Encephalopathy with Ragged Red Fibers (MERRF) κλινικά χαρακτηριστικα άταξία επιληψία υποτονία Μυική αδυναµία Λακτική οξείδωση Μυική βιοψία κόκκινες ίνες (ragged red fibers) Ανώµαλος µεταβολισµός ενέργειας στα µυϊκά κύτταρα


86 Μητρική επίδραση Ο µητρικός γονότυπος καθορίζει το φαινότυπο των απογόνων Το ωάριο δίνει στο ζυγωτό πολλές πρωτεΐνες και RNA που µπορούν να αλλάξουν το φαινότυπό του (ο µητρικός φαινότυπος δεν έχει σηµασία) (ο γονότυπος των απογόνων δεν έχει σηµασία)

87 Μητρική επίδραση στο σαλιγκάρι Ο µητρικός γονότυπος καθορίζει τον φαινότυπο των απογόνων

88 Μητρική επίδραση Ο γονότυπος της µητέρας καθορίζει τον φαινότυπο των απογόνων Συνήθως επικρατήυπολειπόµενα χαρακτηριστικά

Μη Μενδέλειος Κληρονομικότητα

Μη Μενδέλειος Κληρονομικότητα Μη Μενδέλειος Κληρονομικότητα Αριάδνη Καλπίνη-Μαύρου Καθηγήτρια Γενετικής Πανεπιστημίου Αθηνών Εργαστήριο Ιατρικής Γενετικής Μενδέλειος κληρονομικότητα Γενετικά νοσήματα κληρονομούνται με τη μεταβίβαση

Διαβάστε περισσότερα


ΜΕΝΔΕΛΙΚΑ ΚΛΗΡΟΝΟΜΟΥΜΕΝΑ ΝΟΣΗΜΑΤΑ ΜΕΝΔΕΛΙΚΑ ΚΛΗΡΟΝΟΜΟΥΜΕΝΑ ΝΟΣΗΜΑΤΑ Νοσήματα κληρονομούμενα με μενδελικό τρόπο : ~4000 Από αυτά, τα ~3300 οφείλονται σε μεταλλάξεις σε ~2000 γονίδια 50% αυτοσωματικά επικρατή ~35% αυτοσωματικά υπολειπόμενα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα


Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα



Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΟΣ ΕΛΕΓΧΟΣ ΝΕΥΡΟΓΕΝΕΤΙΚΩΝ ΝΟΣΗΜΑΤΩΝ ΓΕΝΕΤΙΚΟΣ ΕΛΕΓΧΟΣ ΝΕΥΡΟΓΕΝΕΤΙΚΩΝ ΝΟΣΗΜΑΤΩΝ P ευρύ φάσμα εξετάσεων, που αφορά κοινά αλλά και σπανιότερα νευρογενετικά νοσήματα P εμπεριστατωμένος έλεγχος με συνδυαστική ανάλυση και σύγχρονες τεχνικές, με

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα


3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα. Μέρος A

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα. Μέρος A ΚΕΦΑΛΑΙΟ 11 Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα Μέρος A ΠΕΡΙ ΕΝΕΡΓΕΙΑΣ Α. Η λειτουργία απλών µηχανών εξαρτάται από ενέργεια: - κίνηση αυτοκινήτου= βενζίνη / πετρέλαιο

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 4 Ιουνίου 2014 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό Απαντήσεις στο μάθημα της Βιολογίας Κατεύθυνσης ΘΕΜΑ 1 Ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 Ο 1.σχολικό βιβλίο σελ. 109 «Με τον όρο ζύμωση και αντιβιοτικά» 2.σχολικό βιβλίο σελ. 119-120 «Τα αντισώματα μπορούν

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. A Α2. Γ Α3. Α4. Β Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ B1. Τα µονοκλωνικά αντισώµατα µεταξύ των άλλων χρησιµοποιούνται και για την επιλογή οργάνων συµβατών

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ ÓÕÃ ÑÏÍÏ ΘΕΜΑ Α Α1. A Α2. Γ Α3. Α4. Β Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ B1. Τα µονοκλωνικά αντισώµατα µεταξύ των άλλων χρησιµοποιούνται και για την επιλογή οργάνων συµβατών

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα