µovόκλωvoυ DNA, πoυ δρα αφ' εvός µεv σαv εκκιvητήρας, αφ' ετέρoυ δεσαvεκµαγείo.

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "µovόκλωvoυ DNA, πoυ δρα αφ' εvός µεv σαv εκκιvητήρας, αφ' ετέρoυ δεσαvεκµαγείo."


1 ΣΥΝΘΕΣΗ ΝΟΥΚΛΕΪΝIΚΩΝ ΟΞΕΩΝ (ΜΕΤΑΒIΒΑΣΗ ΤΩΝ ΓΕΝΕΤIΚΩΝ ΠΛΗΡΟΦΟΡIΩΝ ΑΠΟ ΓΕΝΕΑ ΣΕ ΓΕΝΕΑ) IN VITRO ΣΥΝΘΕΣΗ DNA ΚΑI RNA Όπως έδειξαv εργασίες τoυ Kornberg (1955), στα κύτταρα (π.χ. E.coli) υπάρχoυvέvζυµα (πoλυµεράσεςτoυ DNA) πoυκαταλύoυvτη σύvθεση DNA παρoυσία τριφωσφoρικώvδεoξυvoυκλεoτιδίωvκαι µovόκλωvoυ DNA, πoυ δρα αφ' εvός µεv σαv εκκιvητήρας, αφ' ετέρoυ δεσαvεκµαγείo.

2 Έτσι, σεκάθεκλώvoτoυ DNA-εκµαγείoυ σχηµατίζεται έvας vέoς κλώvoς µε τις συµπληρωµατικές τoυ βάσεις. Η επιµήκυvση ακoλoυθεί τηv κατεύθυvση 5' 3', εvώ συγχρόvως απελευθερώvεται πυρoφωσφoρικό oξύ. Μερικές πoλυµεράσες τoυ DNA έχει διαπιστωθεί ότι µπoρoύv ακόµα vα καταλύoυvκαιτηvεξωvoυκλεoλυτική υδρόλυση τωv κλώvωv τoυ DNA από κατεύθυvση 5' 3', αλλά και από 3' 5' (όπως, π.χ. η πoλυµεράση τoυ DNA απότηv E.coli).

3 Τo RNA (όπως τo DNA) µπoρεί vα συvτεθεί in vitroµετη βoήθεια της πoλυµεράσης τoυ RNA, πoυ βρέθηκε λίγα χρόvια µετά τηv αvακάλυψη της πoλυµεράσης τoυ DNA. Οι πoλυµεράσες τoυ RNA δεv παρoυσιάζoυv εξωvoυκλεoλυτικ ήδράση.

4 IN VIVO ΣΥΝΘΕΣΗ DNA (ΑΝΤIΓΡΑΦΗ - IΠΛΑΣIΑΣΜΟΣ ΤΟΥ DNA) Όπως αvαφέρθηκε στo "κεvτρικό δόγµα της µoριακής βιoλoγίας", η in vivo αvτιγραφή ή (αvα)διπλασιασµός τoυ DNA επιτελείται µε τις πληρoφoρίεςπoυπεριέχειτoίδιoτoµόριoτoυ DNA. ηλαδή, oι vέoικλώvoιτoυ DNAέχoυvτις συµπληρωµατικές βάσεις τωv κλώvωv τoυ DNA πoυ αvτιγράφoυv. Κάθε θυγατρική διπλή έλικα περιέχει έvαν κλώvo τηςµητρικής.

5 Ο µηχαvισµός αυτός λέγεται ηµισυvτηρητικός και απoδείχθηκε από τo παρακάτω πείραµα τωv Meselson και Stahl: Σε θρεπτικό υλικό πoυ περιείχε τo βαρύ ισότoπoτoυν( 15 Ν) αvαπτύχθηκε E.coli και συγκρίθηκε τo DNA της, πoυ περιείχε 15 Ν (βαρύ DNA) µετα vεoσυvτεθειµέvα DNA της ίδιας καλλιέργειας πoυ απoµovώθηκαv µετά από καλλιέργεια πρώτης και δεύτερης γεvεάς σε θρεπτικό υλικόµε 14 Ν.

6 (Πείραµα τωv Meselson και Stahl) Βρέθηκεότιη πυκvότητα όλoυ τoυ DNA, µετάτov πρώτo διπλασιασµό τωv κυττάρωv, ήταv ακριβώς εvδιάµεσης πυκvότητας (ηµιβαρύ DNA) από εκείvη τoυ βαρέoς DNAκαι τoυελαφρoύ DNA.

7 (Πείραµα τωv Meselson και Stahl) Μετάτoδεύτερo διπλασιασµό τωv κυττάρωv, η µισή πoσότητα τoυ DNA είχετηv πυκvότητα τoυ ελαφρoύ DNA πράγµα πoυ δείχvει oτι o διπλασιασµός είvαι ηµισυvτηρητικός.

8 Στηv αvτιγραφή τoυ DNA παρατηρoύvται εκ πρώτης όψεως κάπoιες δυσκoλίες, όπως: Ηδίκλωvηέλικατoυ DNA είvαιελικoειδής, µετoυς δύo κλώvoυς σε αvτιπαράλληλη διάταξη (3' 5' η µίακαι 5' 3' ηάλλη). Ηδεπoλυµεράσητoυ DNAµπoρεί vαπρoχωρεί στη σύvθεση τoυ vέoυ κλώvoυ µόvo κατά τη φoρά 5' 3'.

9 Η στρατηγική της πoρείας της αvτιγραφής είvαι η εξής: Η δίκλωvη έλικα ξετυλίγεται και σπάvε oι δεσµoί υδρoγόvoυ στα ζεύγη τωv βάσεωv, ώστε vα πρoκύψoυv δύo µovόκλωvα κoµµάτια. Αυτάταµονόκλωνα κοµµάτια απoτελoύv εκµαγείo για τov ηµισυvτηρητικό διπλασιασµό τoυ DNA. Κατάτoδιπλασιασµό στov έvανκλώvoη αvτιγραφή είvαι διακεκoµµέvη, δηλαδή γίvεται κατά τµήµατα.

10 (Στρατηγική της πoρείας της αvτιγραφής) Ηαvτιγραφήτoυ άλλoυ κλώνου είvαι συvεχής. Οµηχαvισµόςτης αvτιγραφήςτoυ DNA στα πρoκαρυωτικά κύτταρα, κατά τηv επικρατoύσα θεωρία τoυ Kornberg, είvαι ακριβής και γρήγoρoς (πoλυµερισµός 500 voυκλεoτιδίωvαvά sec σταβακτήριακαι 50 voυκλεoτίδια αvά sec σταθηλαστικά) και περιλαµβάvει τη συµµετoχή πoλλώv εvζύµωv

11 Η πλήρης πoρεία τoυ µηχαvισµoύ της αντιγραφής έχει ως εξής: Κατ'αρχήv τα σηµεία εκκίvησης της πoρείας είvαι oρισµέvεςθέσειςστo DNA, πoυ λέγovται σηµεία (ή περιοχές) έvαρξηςτης αvτιγραφής ή ρεπλικόvια και έχoυv µια ειδική ακoλoυθία voυκλεϊvικώv βάσεωv (περίπoυ 300 βάσεις). Τηv ειδική αυτή ακoλoυθία βάσεωvαvαγvωρίζειέvας πρωτεϊvικός παράγovτας έvαρξης (dnaa για τηv E.coli) καιδεσµεύεται σ'αυτή, σχηµατίζovτας έvα σύµπλoκo.

12 (Πoρεία τoυ µηχαvισµoύ της αντιγραφής) Στo σύµπλoκo αυτό εvώvεται έvα έvζυµo, η ελικάση τoυ DNAπoυ υπάρχει σε δύo µoρφές και αvoίγει τoυς δύo κλώvoυς τoυ DNA καταστρέφovτας τoυς δεσµoύς υδρoγόvoυ µεταξύ τωv βάσεωv.

13 (Πoρεία τoυ µηχαvισµoύ της αντιγραφής) Έτσι, στo σηµείo εκείvo σχηµατίζεται έvα "µάτι" ή "φυσαλίδα"ή "διακλάδωση" πoυ έχει δύo κλάδoυς µε αvτιπαράλληλη κατεύθυvση (δοµές θ). Στοσηµείοαυτόηδιπλή έλικα του DNA διπλασιάζεται µε συνεχή διαχωρισµό των δύο µητρικών κλώνων που ακολουθείται από σύνθεση των αντίστοιχων θυγατρικών συµπηρω- µατικών κλώνων, ώστε να προκύψει ένα ηµισυντηρητικό δίκλωνο θυγατρικό DNA.

14 (Πoρεία τoυ µηχαvισµoύ της αντιγραφής) Ηαντιγραφή - που ξεκινά από ένα και µοναδικό σηµείο έναρξης γιατα προκαρυωτικά και περισσότερα γιατα ευκαρυωτικά προχωρά σχεδόν πάντα διαδοχικά και προςτιςδύο κατευθύνσεις.

15 Η αντιγραφή του DNA καταλύεται από τα ένζυµα πολυµεράσες του DNA-κατευθυνόµενες από DNA (DNAκατευθυνόµενες-DNA-πολυµεράσες) ή απλά τις πολυµεράσες του DNA, µε την ακόλουθη πορεία αναλυτικά: I.Ο έvας κλάδoς είvαι o κλώvoς τoυ DNA µε κατεύθυvση 3' 5',πoυ λέγεται πρoπoρευόµεvoς κλώvoς ή κλώvoς πoυπρoηγείται, στov oπoίo δρα η µία ελικάση η οποία πρoχωρεί και αvoίγει τoυς δύoκλώvoυς.

16 (Αναλυτική πορεία αντιγραφής του DNA) Οικλώνοισταθεροποιούνται από έvα αριθµόµoρίωvµιας ειδικής πρωτεΐvης (SSB) πουδεσµεύεται σε αυτούς, ώστε vα µη σχηµατισθoύv δεσµoί υδρoγόvoυ σε τυχόvσυµπληρωµατικές βάσεις πoυ υπάρχoυvστovίδιo αυτό κλώvo, αλλά χωρίς συγχρόvως vακαλύπτoυvτις βάσεις και vα παρεµπoδίζoυvτηv αvτιγραφήτoυς.

17 (Αναλυτική πορεία αντιγραφής του DNA) Στον προπορευόµενο κλώνο συνεχίζεται αµέσως η πορεία της αντιγραφής και µάλιστα µε συvεχήτρόπo (εξ' oυκαι τo όvoµά τoυ) ως εξής: Ηπoλυµεράση IIIτoυ DNA συνθέτει ( βάσεις/min) πρoςτηv κατεύθυvση τoυ κλώvoυ (5' 3'), αφoύ όλo και µεγαλύτερo µέρoς τoυ κλώvoυ αυτoύ διατίθεται σαv εκµαγείo (καθώς η ελικάση πρoχωρεί και αvoίγει τoυς δύo κλώvoυς).

18 (Αναλυτική πορεία αντιγραφής του DNA) IΙ.Ο άλλoς κλάδoς είvαι o κλώvoςµε κατεύθυvση 5' 3', πoυ λέγεται καθυστερηµέvoς κλώvoς. Ηαvτιγραφήτoυ είvαι διακεκoµµέvη και γίvεται µε κάπoια πoλύπλoκη διαδικασία. Στονκλώνοαυτό πριν συνεχισθεί η πορεία της αντιγραφής λαµβάνονται τα ακόλουθα µέτρα για τη σταθερoπoίησή του :

19 (Αναλυτική πορεία αντιγραφής του DNA) Κατ αρχήν συνδέεται και δραηελικάση II (dna B γιατηv E.coli) καιµόλις αvoίξει µια µικρή περιoχή τoυ DNA, δεσµεύεται έvας αριθµός µoρίωvτης ειδικής πρωτεΐvης (SSB)πoυ σταθερoπoιoύv τovκλώvo.

20 Mόρια της ειδικής πρωτεΐvης (SSB) πoυ σταθερoπoιoύvτovκλώvo.

21 (Αναλυτική πορεία αντιγραφής του DNA) Ταµέτραγιατησταθερoπoίηση τoυ καθυστερηµέvoυ κλώvoυ είvαι στην περίπτωση αυτή περισσότερο απαραίτητα, γιατί η αvτιγραφή τoυ καθυστερηµέvoυ κλώvoυ είvαι διακεκoµ- µέvη και γίvεται µε κάπoια πoλύπλoκη διαδικασία, επειδή η πoλυµεράση III τoυ DNA συvθέτει πάvτα µε κατεύθυvση 5' 3 (ενώ o πρoπoρευόµεvoς κλώvoς αvτιγράφεται αµέσως και µε συvεχή τρόπo).

22 Ηπορείατηςαντιγραφήςτου DNA στov καθυστερηµέvoκλώvoέχειωςεξής: Κατ 'αρχήv συvδέεται στηv DNA ελικάση έvα έvζυµo πoυ λέγεται πριµάση (dnag για τηv E.coli) καισυvθέτει RNA (µόvo βάσεωv) µε κατεύθυvση 5' 3', πoυ λέγovται εκκιvητικά µόρια RNA.

23 Ηπορείατηςαντιγραφήςτου DNA στov καθυστερηµέvoκλώvoέχειωςεξής: Τo εvζυµικό σύµπλoκo της DNA ελικάσης και πριµάσης απoτελεί τo πριµόσωµα (dnabdnag για τηv E.coli). Τo πριµόσωµα κιvείται λoιπόv µε κατεύθυvση 5' 3' και συvθέτει εκκιvητικά µόρια RNA κάvovταςτηv 3 θέση τoυς διαθέσιµη (εvεργή) γιατηv πoλυµεράση III τoυ DNA.

24 Ηπορείατηςαντιγραφήςτου DNA στov καθυστερηµέvoκλώvoέχειωςεξής: Η πoλυµεράση III τoυ DNA συvεχίζει vα συvθέτει τµήµατα DNA (µεκατεύθυvση 5' 3', µήκoυς βάσεωv). Κατ' αυτόvτovτρόπoσχηµατίζovταικάπoιακoµµάτια DNA πoυ περιέχoυv τo καθέvα και έvα εκκιvητικό µόριo RNA και λέγovται κoµµάτια Okazaki από τo όvoµα αυτoύ πoυ τα αvακάλυψε. Κοµµάτια Okazaki

25 Ηπορείατηςαντιγραφήςτου DNA στov καθυστερηµέvoκλώvoέχειωςεξής: Στησυvέχειαεπιδράη πoλυµεράση I τoυ DNAπoυείναι µια πολυπεπτιδική αλυσίδα µε τρεις διαφορετικές δράσεις. Με τη δράση της σαv 5'-εξωvoυκλεάση (οι άλλες δράσεις της περιγράφονται στη συνέχεια) υδρoλύει τo εκκιvητικό µόριo τoυ RNA τoυ πρoηγoύµεvoυ κoµµατιoύ Okazaki. Μετηδράσητηςσανπολυµεράση, συµπληρώvειτoκεvό επιµηκύvovταςτo DNA τoυεπόµεvoυκoµµατιoύ Okazaki.

26 Ηπορείατηςαντιγραφήςτου DNA στov καθυστερηµέvoκλώvoέχειωςεξής: Ησύvδεσητων "vέων" κoµµατιών Okazaki γίvεται από έvα άλλo έvζυµo, τη λιγάση τoυ DNA πoυ µπoρεί vα ξαvασχηµατίζει τoυς φωσφoδιεστερικoύς δεσµoύς σε θέσεις όπoυ τo DNA έχεισπάσει.

27 Μίαάλληδράσητης πoλυµεράσης I τoυ DNAείvαικαι o έλεγχoς-αvτιπαραβoλήτωvκoµµατιώvπoυαvτιγράφovται. Αv λoιπόv γίvει λάθoς σε κάπoια βάση, η πoλυµεράση I τoυ DNA επιστρέφει στη βάση πoυ δεv είvαι συµπληρωµατική (δεvαvαπτύσσει τoυς δεσ- µoύς υδρoγόvoυ) και µετηδράση τoυσαv 5 ή 3' εξωvoυκλεάση υδρoλύει τo λάθoς voυκλεoτίδιo καιστηθέση τoυβάζειτo σωστό.

28 ΗδιαφοράτωνδράσεωντηςπολυµεράσηςΙείναιότιη 5 εξωνουκλεάση διασπά δεσµούς σε δίκλωνη έλικα, ενώ η 3 εξωνουκλεάση διασπά δεσµούς στο τελικό άκρο της (µονόκλωνης) αλυσίδας η οποία βιοσυντίθεται.

29 ΗδράσητηςπολυµεράσηςΙσαν 5 εξωνουκλεάση ενισχύεταιαπότηνταυτόχρονησύνθεση DNA. Η µεγάλη πιστότητα αvτιγραφής τoυ DNA (1 voυκλεoτίδιoλάθoςαvά voυκλεoτίδια) oφείλεται στηv εξειδίκευση τoυ εvζύµoυ αυτoύ και στη δυvατότητά τoυ vα κάvει αvτιπαραβoλή τωv κoµµατιώvπoυέχoυvαvτιγραφεί.

30 Οι διάφoρες πρωτεΐvες πoυσυµµετέχoυvστηv αvτιγραφή (είvαι 16) δρoυvσαvπoλυεvζυµικά συστήµαταµάλλov, παράσαvαvεξάρτητα έvζυµα. Θεωρείταιότιη πoλυµεράση III τoυ DNA (η οποία µάλιστα απότελείται από πολλές υποµονάδες) µπoρεί µαζίµετιςελικάσεςκαι τηv πριµάση vα απoτελoύvέvαπoλυεvζυµικό σύστηµα, πoυ συvθέτει ταυτόχρovα και τoυς δύo κλώvoυς.

31 Μια πρόσθετη δυσκoλία πoυέχειηαvτιγραφήτoυ DNA µετovπαραπάvω µηχαvισµό είvαι η ελικoειδής µoρφή τoυ DNA (κάθε 10 βάσεις µια περιστρoφήστηvέλικα). Γιακάθε 500 voυκλεoτίδια πoυ συvτίθεvται αvά sec σε έvα βακτήριo, τoµητρικό DNA πρέπει vα περιστρέφεται κατά 50 στρoφές αvά sec (ή στρoφές/min). Τoπρόβληµααυτό (winding problem) λύvεται µε τη δράση τωv εvζύµωv τoπoϊσoµερασώv.

32 Όταv στo DNA δεvυπάρχειη δυvατότητα για περιστρoφή τoυ εvός άκρoυ σε σχέσηµετoάλλo άκρo, δραη τoπoϊσoµεράση I, η οποία αλλάζει τον αριθµό συνδέσεων κατά µια µονάδα. Μεόµoιoτρόπo λύvεται τo ίδιo πρόβληµα και κατά τη µεταγραφή.

33 Μια άλλη µoρφή τoπoϊσo- µεράσης είvαι η τoπoϊσoµεράσητύπoυ II,γvωστήσα γυράσητoυ DNA, ηοποία αλλάζει τον αριθµό συνδέσεωνκατάδύοµονάδες. Αυτή δηµιoυργεί αρvητικές υπερελικoειδείς µoρφές (υπερσπειρώσεις)δηλαδή αρvητικέςσπείρες (-), εξoυδετερώvovτας τις θετικές σπείρες (+), πoυ σχηµατίζovται από τo άvoιγµα της δίκλωvης αλυσίδαςκαιδιατηρείτo DNA σε σταθερό τέvτωµα χωρίς τo πρόβληµα τoυ µπερδέµατoς τoυ DNA (tangling problem).

34 Στηv περίπτωση τoυ κυκλικoύ DNA, πoυ µετά τηv αvτιγραφή θα πρέπει vα σπάσoυv και oι δύo αλυσίδες για vα διαχωριστεί o έvας δακτύλιoς από τovάλλo, χρησιµoπoιείταιητύπoυ II τoπoϊσoµεράση (γυράση). Ητύπoυ II τoπoϊσoµεράσηήγυράσηυπάρχειµόvo σταβακτήρια. Εvώµιαάλλητύπoυ II τoπoϊσoµεράσηδραστα ευκαρυωτικά κύτταρα, βoηθώvτας τηv απoφυγή τoυ µπερδέµατoς τoυ DNA τωv χρωµoσωµάτωv κατά τη µίτωση. Σταευκαρυωτικά υπάρχειεπίσηςκαιητύπoυ I τoπoϊσoµεράση.

35 Τα έvζυµα πoυ απαιτoύv εvέργεια στov παραπάvω µηχαvισµόείvαι: oι ελικάσες (καταvαλώvoυv 2ΑΤΡ πρoς 2ADP+PPi αvάζεύγoςβάσεωv), ηλιγάση (ΑΤΡπρoςΑΜΡκαι PΡi ή NAD + πρoς ΑΜΡ και NMN) κα η τoπoϊσoµεράση τύπoυ II (καταναλώνοντας ATP προς ADP και Pi).

36 Εκτός από τις περιπτώσεις της επιδιόρθωσης τoυ DNA λόγω λαvθασµέvης αvτιγραφής, υπάρχoυv και µηχαvισµoί επιδιόρθωσης τoυ DNA όταv συµβoύv µεταλλάξεις. Μεταλλάξεις µπoρεί vα συµβούν κάτω από τηv επίδραση: Χηµικώv εvώσεωv π.χ. απαµίvωση, αλκυλίωση ή απόσπαση όλης της βάσης κ.λπ. Φυσικώvπαραγόvτωvπ.χ. δυvάµεωv διάτµησης τoυ εvός ή και τωv δύo κλώvωv ή τέλoς Ακτιvoβoλίας π.χ. υπεριώδoυς, oπότε πρoκαλείταιδιµερισµόςτωvδύoγειτovικώv βάσεωv θυµίvης και σχηµατισµός δακτύλιoυ κυκλoβoυταvίoυ ή ακτίvωv Χ πoυ µπoρεί vα πρoκαλέσoυvµεταβoλέςστιςβάσεις.

37 Έvζυµα πoυ συµµετέχoυv στo µηχαvισµό της επιδιόρθωσης DNA, εκτόςαπόταέvζυµατηςσύvθεσηςτoυ DNA είναικαι άλλαειδικάένζυµα: Στηv περίπτωση, για παράδειγµα, πoυ σχηµατίζεται έvα διµερές της θυµίvης από υπεριώδη ακτιvoβoλία, η επιδιόρθωσηµπoρεί vαγίvει: Μετηδράσηειδικoύ εvζύµoυ πoυ εvεργoπoιείται από τηv ακτιvoβoλία τoυ oρατoύ φωτός και διασπά τo δακτύλιo τoυ κυκλoβoυταvίoυ απότοδιµερέςτηςθυµίνης, ωςεξής: Μια εξειδικευµένη εvδovoυκλεάση (γνωστή σαν εξαγωγικήενδονουκλε-άση) διασπά κάπoυ κovτά στo διµερέςτηναλυσίδατου DNA καιαφαιρείένατµήµα 12 νουκλεοτιδίων.

38 Στησυvέχεια, ηπoλυµεράση I τoυ DNAµεεκκιvητήρατo τέλoς τoυ κλώvoυ πoυ έσπασε o φωσφoδιεστερικός δεσµός, ξαvασυvθέτειτoκoµµάτιαυτότoυ DNA. Ο φωσφoδιεστερικός δεσµός για τη σύvδεση τωv δύo κoµµατιώvτoυ DNA στovεπιδιoρθωµέvoκλώvo, γίvεται κατάταγvωστάµεµίαλιγάσητoυ DNA. Έλλειψη τέτoιωv επιδιoρθωτικώvεvζύµωvή µικρή δραστικότητα τωv εvζύµωvαυτώvπρoκαλεί ασθέvειεςστovάvθρωπo, όπωςπ.χ. µελαγχρωµατική ξηρoδερµία (όπoυ oι ασθεvείς είvαι πoλύ ευαίσθητoι στηvυπεριώδη ακτιvoβoλία).

39 Η αvτιγραφή τoυ DNA στα ευκαρυωτικά κύτταρα (αvκαιδεvυπάρχoυvτόσαπειραµατικά δεδoµέvαόσoγιαταπρoκαρυωτικά) δε φαίvεται vα έχει σηµαvτικές διαφoρές από εκείvητωvπρoκαρυωτικώv.

40 Οι κυριότερες διαφoρές (της αvτιγραφή τoυ DNA στα ευκαρυωτικά κύτταρα από τα πρoκαρυωτικά) είvαι oι εξής: Τo DNA πoυθααvτιγραφεί δε βρίσκεται σα "γυµvό" DNA, αλλά σαv ίvεςχρωµατίvης. Πρώταπρέπει vαδιασπασθoύvταπυρηvoσωµάτια. Μετάναγίνειηαvτιγραφή. Τoέvαδίκλωvo DNA vα ξαvασχηµατίσει µε τις υπάρχoυσες ιστόvες τα πυρηvoσωµάτια. Στo άλλo δίκλωvo DNA vα πρoστεθoύv vέα µόρια ιστovώv και άλλωv πρωτεϊvώv για vα σχηµατισθoύv και εδώ τα πυρηvoσώµατακαι oιίvεςχρωµατίvης.

ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα

ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα απαvτηθoύv τα εξής ερωτήµατα: 1) Πώς εξασφαλίζεται η πιστότητα

Διαβάστε περισσότερα

Ιστορική αναδροµή 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση

Ιστορική αναδροµή 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση Ιστορική αναδροµή Η µελέτη των ενζύµων, ιδιαίτερο ενδιαφέρον, ο κλάδος που ασχολείται µε αυτήν, η Ενζυµολογία, σχετίζεται µε πάρα πολλές επιστήµες, αλλά σε µεγαλύτερο βαθµό µε τη Bιοχηµεία, τημοριακήβιολογία,

Διαβάστε περισσότερα

(Ιστορική αναδροµή) 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση

(Ιστορική αναδροµή) 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση ΕΝΖΥΜΑ Ιστορική αναδροµή Η µελέτη των ενζύµων, ιδιαίτερο ενδιαφέρον, ο κλάδος που ασχολείται µε αυτήν, η Ενζυµολογία, σχετίζεται µε πάρα πολλές επιστήµες, αλλά σε µεγαλύτερο βαθµό µε τη Bιοχηµεία, τη Μοριακή

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς

ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς απoτελoύv δoµικές µovάδες τωv voυκλεϊvικώv oξέωv. Λόγω

Διαβάστε περισσότερα

" Με τov υπ' αριθµόv 12 vόµo τoυ 1937 καθoρίζovται oρισµέvα τέλη, τα oπoία δικαιoύvται vα λαµβάvoυv oι Μoυχτάρες και Αζάδες εvώ απαγoρεύεται στo εξής

 Με τov υπ' αριθµόv 12 vόµo τoυ 1937 καθoρίζovται oρισµέvα τέλη, τα oπoία δικαιoύvται vα λαµβάvoυv oι Μoυχτάρες και Αζάδες εvώ απαγoρεύεται στo εξής SXEDIO.86V 28.5.1937: Ο ΚΥΒEΡΝΗΤΗΣ ΠΑΛΜΕΡ ΕΝIΣΧΥΕI ΤΑ ΕIΣΟ ΗΜΑΤΑ ΤΩΝ ΜΟΥΚΤΑΡΕΩΝ ΚΑI ΤΟΥΣ ΑΝΑΓΚΑΖΕI ΝΑ ΣΤΡΑΦΟΥΝ ΠΕΡIΣΣΟΤΕΡΟ ΠΡΟΣ ΑΥΤΟΝ. ΠΟIΟΣ Ο ΡΟΛΟΣ ΤΩΝ ΜΟΥΚΤΑΡΕΩΝ ΣΤΗ IΟIΚΗΣΗ Με τo ίδιo ιάταγµα τoυ Κυβερvήτη

Διαβάστε περισσότερα


SXEDIO.367 17.3.1956: Η ΜΑΧΗ ΤΩΝ ΧΑΝΤΡIΩΝ ΜΕ ΤΗ ΣΥΜΜΕΤΟΧΗ 18 ΑΝΤΑΡΤΩΝ ΜΕ ΕΠIΚΕΦΑΛΗΣ ΤΟΝ ΓΡΗΓΟΡΗ ΑΥΞΕΝΤIΟΥ SXEDIO.367 17.3.1956: Η ΜΑΧΗ ΤΩΝ ΧΑΝΤΡIΩΝ ΜΕ ΤΗ ΣΥΜΜΕΤΟΧΗ 18 ΑΝΤΑΡΤΩΝ ΜΕ ΕΠIΚΕΦΑΛΗΣ ΤΟΝ ΓΡΗΓΟΡΗ ΑΥΞΕΝΤIΟΥ Η µάχη τωv Χαvτριώv έγιvε στις 17 Μαρτίoυ 1956 και ήταv η πιo µεγάλη πoυ είχε στηθεί εvαvτίov τωv

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

(Στάδια τεχνολογίας rdna)

(Στάδια τεχνολογίας rdna) (Στάδια τεχνολογίας rdna) Έτσιτακοσµίδια (σανπλασµίδια): Αφ ενόςµενπεριέχουνµιαθέσηγιατηδράση περιοριστικής ενδονουκλεάσης και συνεπώς εισαγωγής ξένου DNA (και µάλιστα µεγάλου µεγέθους), Αφ ετέρου δε,

Διαβάστε περισσότερα

σε αvαερόβιες συvθήκες, vα µετατραπεί σε ακετυλo-coa και στη συvέχεια σε CO 2 +H 2 O, εvώ

σε αvαερόβιες συvθήκες, vα µετατραπεί σε ακετυλo-coa και στη συvέχεια σε CO 2 +H 2 O, εvώ ιάµεσo ς Μεταβo λισµός IΑΜΕΣΟΣ ΜΕΤΑΒΟΛIΣΜΟΣ Υ ΑΤΑΝΘΡΑΚΩΝ Γλυκόζη: Ο κύριoς υδατάvθρακας, πoυ χρησιµoπoιείται από τoυς ζώvτες oργαvισµoύς για τηv κάλυψη τωv εvεργειακώvτoυςαvαγκώv. Η γλυκόζη µπoρεί vα απoικoδoµηθεί

Διαβάστε περισσότερα

Σαµάρας. Η έξoδoς όµως δεv κράτησε παρά µερικά λεπτά γιατί oι άγγλoι επικέvτρωσαv τα πυρά τoυς σ αυτoύς µε απoτέλεσµα vα τoυς εξoυδετερώσoυv.

Σαµάρας. Η έξoδoς όµως δεv κράτησε παρά µερικά λεπτά γιατί oι άγγλoι επικέvτρωσαv τα πυρά τoυς σ αυτoύς µε απoτέλεσµα vα τoυς εξoυδετερώσoυv. SXEDIO.327 2.9.1958: Η ΜΑΧΗ ΤΟΥ ΑΧΥΡΩΝΑ. ΟI ΦΩΤΗΣ ΠIΤΤΑΣ, ΑΝΡΕΑΣ ΚΑΡΥΟΣ, ΗΛIΑΣ ΠΑΠΑΚΥΡIΑΚΟΥ ΚΑI ΧΡIΣΤΟΣ ΣΑΜΑΡΑΣ ΣΚΟΤΩΝΟΝΤΑI ΚΑΘΩΣ ΕΠIΧΕIΡΟΥΝ ΕΞΟ Ο ΑΠΟ ΤΟΝ ΑΧΥΡΩΝΑ ΥΣΤΕΡΑ ΑΠΟ ΤΕΤΡΑΩΡΗ ΜΑΧΗ Στις αρχές τoυ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

µυoϊvιδίoυ (ηλειτoυργικήµovάδα) βρίσκεται µεταξύ δύo τέτoιωv εγκάρσιωv γραµµώσεωv (πoυ ovoµάζovταιδίσκoιζ) καιλέγεταισαρκoµερίδιo.

µυoϊvιδίoυ (ηλειτoυργικήµovάδα) βρίσκεται µεταξύ δύo τέτoιωv εγκάρσιωv γραµµώσεωv (πoυ ovoµάζovταιδίσκoιζ) καιλέγεταισαρκoµερίδιo. ΜΥIΚΕΣ ΠΡΩΤΕΪΝΕΣ (Συστήµατασυστoλήςκαικίvησης) Μovoκύτταρoι oργαvισµoύς µαστίγια και oι βλεφαρίδες Ζώα τo µυϊκό σύστηµα. Σκελετικoί µύες απoτελoύvται από µυϊκές δέσµες και αυτές από επιµηκυσµέvα κύτταρα,

Διαβάστε περισσότερα

Στις 6 εκεµβρίoυ oρίστηκε η ηµέρα της δίκης τoυ για συµµετoχή στις oχλαγωγίες. Αυτός αvτί στo σχoλείo πήρε τo δρόµo για τo

Στις 6 εκεµβρίoυ oρίστηκε η ηµέρα της δίκης τoυ για συµµετoχή στις oχλαγωγίες. Αυτός αvτί στo σχoλείo πήρε τo δρόµo για τo SXEDIO.332 13.8.1857: Ο 18ΧΡΟΝΟΣ ΕΥΑΓΟΡΑΣ ΠΑΛΛΗΚΑΡI ΗΣ ΗΛΩΝΕI ΟΤI Ο,ΤI ΕΚΑNΕ, ΤΟ ΕΚΑNΕ ΣΑΝ ΚΥΠΡIΟΣ ΠΟΥ ΖΗΤΕI ΤΗΝ ΕΛΕΥΘΕΡIΑ ΤΟΥ ΚΑI ΑΝΤIΜΕΤΩΠIΖΕI ΜΕ ΘΑΡΡΟΣ ΤΗΝ ΑΓΧΟΝΗ Ο Ευαγόρας Παλληκαρίδης, αvέβηκε στo

Διαβάστε περισσότερα



Διαβάστε περισσότερα

"Ούτoς επεκoιvώvησε πάραυτα µετά τoυ ηµάρχoυ και τoυ διoικητoύ πρoς ov oι δύo πρώτoι διεµαρτυρήθησαv διά τηv διεvέργειαv ερευvώv τη απoυσία

Ούτoς επεκoιvώvησε πάραυτα µετά τoυ ηµάρχoυ και τoυ διoικητoύ πρoς ov oι δύo πρώτoι διεµαρτυρήθησαv διά τηv διεvέργειαv ερευvώv τη απoυσία SXEDIO.349 7.7.1956: ΤΟ ΟIΚΗΜΑ ΤΟΥ ΣΩΜΑΤΕIΟΥ ΑΝΟΡΘΩΣIΣ ΑΜΜΟΧΩΣΤΟΥ ΑΝΑΤIΝΑΖΕΤΑI ΑΠΟ ΤΟΥΣ ΒΡΕΤΤΑΝΟΥΣ ΟI ΟΠΟIΟI IΣΧΥΡIΖΟΝΤΑI ΟΤI Σ' ΑΥΤΟ ΒΡΕΘΗΚΑΝ ΕΚΡΗΚΤIΚΕΣ ΥΛΕΣ Στις 9.15 τo πρωϊ της 7ης Ioυλίoυ 1958 η ΕΟΚΑ

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΚΑΤΗΓΟΡIΑ F3A GR B ΠΡΟΓΡΑΜΜΑ ΑΣΚΗΣΕΩΝ K - FACTOR ΚΑΤΗΓΟΡIΑ F3A GR B - 2008 ΠΡΟΓΡΑΜΜΑ ΑΣΚΗΣΕΩΝ K - FACTOR Take Off Sequence Reverse Cuban Eight 3 Stall Turn, ½ Roll 2 Slow Roll 3 Half Square Loop, ½ Roll 2 45 ο Down Positive Snap Roll 3 Humpty Bump w/options

Διαβάστε περισσότερα

ωρισµέvωv ειδώv και εάv δεv ψηφισθoύv αυθηµερόv, τότε θα γίvoυv γvωστά και θα απoφέρoυv µεγάλας ζηµίας εις τας πρoσόδoυς της Νήσoυ.

ωρισµέvωv ειδώv και εάv δεv ψηφισθoύv αυθηµερόv, τότε θα γίvoυv γvωστά και θα απoφέρoυv µεγάλας ζηµίας εις τας πρoσόδoυς της Νήσoυ. SXEDIO.62F 16.2.1926: ΜΕ ΕI IΚΑ ΝΟΜΟΣΧΕ IΑ ΠΟΥ ΚΑΤΑΤIΘΕΝΤΑI ΣΤΟ ΝΟΜΟΘΕΤIΚΟ ΣΥΜΒΟΥΛIΟ Η ΚΥΒΕΡΝΗΣΗ ΚΑΤΑΡΓΕI ΤΗ ΦΟΡΟΛΟΓIΑ ΤΗΣ ΕΚΑΤΗΣ ή ΕΚΑΤIΑΣ ΚΑI ΕΠIΒAΛΛΕI ΑΥΞΗΣΕIΣ ΣΕ ΦΟΡΟΥΣ ΤΣIΓΑΡΩΝ ΟIΝΟΠΝΕΥΜΑΤΩ ΩΝ ΥΓΡΩΝ

Διαβάστε περισσότερα

vα τις διακηρύττω φαvερά εκεί χωρίς φόβoυ πρoς oπoιαδήπoτε κατεύθυvση, επειδή δεv αvήκω oύτε στηv oµoταξία τωv απειράριθµωv oπαδώv της ΜΑΣΑΣ και

vα τις διακηρύττω φαvερά εκεί χωρίς φόβoυ πρoς oπoιαδήπoτε κατεύθυvση, επειδή δεv αvήκω oύτε στηv oµoταξία τωv απειράριθµωv oπαδώv της ΜΑΣΑΣ και SXEDIO.G98 4.11.1959: ΟI ΗΜΑΡΧΟI ΣΧΗΜΑΤIΖΟΥΝ ΜΕΤΩΠΟ ΕΝΑΝΤIΟΝ ΤΟΥ ΜΑΚΑΡIΟΥ. Ο ΕΡΒΗΣ ΚΑΤΗΓΟΡΕI ΤΟ ΜΑΚΑΡIΟ ΟΤI ΕΦΑΡΜΟΣΕ ΤΟ ΦΑΣIΣΜΟ ΕΝΩ Ο ΜΑΚΑΡIΟΣ ΑΠΑΝΤΑ ΟΤI ΟI ΗΜΑΡΧΟI ΑΠΟΥΣIΑΖΑΝ ΚΑΤΑ ΤΟΝ ΑΓΩΝΑ ΤΗΣ ΕΟΚΑ Οι

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός

Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός αποικοδόµησης τωναµινοξέων. Με αυξηµένο ρυθµός αποικοδόµησης αµινοξέων

Διαβάστε περισσότερα

Κατανοµή τωνστοιχείωνσταεκρηξιγενήπετρώµατα και ορυκτά Αν δεχθούµε την υπόθεση ότι τα περισσότερα εκρηξιγενή πετρώµατα σχηµατίστηκαν από ένα φαινόµενο διαφοροποίησης, είναι δυνατόν να γράψουµε "πρώιµασχηµατισθέντα

Διαβάστε περισσότερα

ακυλιώvεται σε φωσφατιδικό oξύ (αvτίδραση µη αvτιστρεπτή).

ακυλιώvεται σε φωσφατιδικό oξύ (αvτίδραση µη αvτιστρεπτή). ΒIΟΣΥΝΘΕΤIΚΟΣ ΡΟΛΟΣ ΚΑI ΜΕΤΑΒΟΛIΚΗ ΤΥΧΗ ΤΗΣ ΦΩΣΦΟ- IΥ ΡΟΞΥ-ΑΚΕΤΟΝΗΣ ΣΤΟ ΜΕΤΑΒΟΛIΣΜΟ ΤΩΝ ΤΡIΓΛΥΚΕΡI IΩΝ Η φωσφo-διυδρoξυ-ακετόvη που προέρχεται από τη γλυκολυτική πορεία, µε τo έvζυµo αφυδρoγovάση του γλυκερo-φωσφoρικού

Διαβάστε περισσότερα

Η Ορθολογική Κοσμοθεώρηση

Η Ορθολογική Κοσμοθεώρηση Χαμπής Κιατίπης Η Ορθολογική Κοσμοθεώρηση Τόμος Τέταρτος Η Αβιόσφαιρα Ειδικά Η Φάση Δημιουργίας και η Φάση Εξέλιξης του Ηλιακού-Πλανητικού μας Συστήματος και ιδιαίτερα η Φ.Δ. και η Φ.Ε. της Γης, ως στερεού

Διαβάστε περισσότερα

τεχvικoύς λόγoυς δύvαται vα πράξη τoύτo αµέσως, υπoχρεoύται όµως, όπως vα αvτικαταστήση τoύτov δι' άλλoυ αρτεργάτoυ, τη υπoδείξει της συvτεχvίας. 5.

τεχvικoύς λόγoυς δύvαται vα πράξη τoύτo αµέσως, υπoχρεoύται όµως, όπως vα αvτικαταστήση τoύτov δι' άλλoυ αρτεργάτoυ, τη υπoδείξει της συvτεχvίας. 5. SXEDIO.E90 13.12.1938: ΟI ΚΤIΣΤΕΣ ΛΕΜΕΣΟΥ ΕΞΑΣΦΑΛIΖΟΥΝ ΥΣΤΕΡΑ ΑΠΟ ΑΠΕΡΓIΑ ΤΟ ΩΦΕΛΗΜΑ ΤΗΣ "ΠΛΗΡΩΜΕΝΗΣ" ΑΠΕΡΓIΑΣ. ΟI ΕΡΓΑΖΟΜΕΝΟI ΣΤΑ ΑΡΤΟΠΟIΕIΑ ΕΠIΒΑΛΛΟΥΝ ΤΟΥΣ ΟΡΟΥΣ ΤΗΣ ΣΥΝΤΕΧΝIΑΣ ΤΟΥΣ ΣΤΟΥΣ ΕΡΓΟ ΟΤΕΣ Στα

Διαβάστε περισσότερα

Η Ορθολογική Κοσμοθεώρηση

Η Ορθολογική Κοσμοθεώρηση Χαμπής Κιατίπης Η Ορθολογική Κοσμοθεώρηση Τόμος Τρίτος Η ΑΒΙΟΣΦΑΙΡΑ ΓΕΝΙΚΑ Οι Άβιες Υλικές Μορφές και οι Πορείες Ανάπτυξης στα Επίπεδα Οργάνωσης της Άβιας Ύλης Ατελής Προέκδοση Λευκωσία 2012 Chambis Kiatipis

Διαβάστε περισσότερα

(Μεταγλώττιση) Παρόµoιoι έραvoι έγιvαv σε όλη τηv Κύπρo.


Διαβάστε περισσότερα

(Στάδια τεχνολογίας rdna)

(Στάδια τεχνολογίας rdna) (Στάδια τεχνολογίας rdna) Έτσιτακοσµίδια (σανπλασµίδια): Αφ ενόςµενπεριέχουνµιαθέσηγιατηδράση περιοριστικής ενδονουκλεάσης και συνεπώς εισαγωγής ξένου DNA (και µάλιστα µεγάλου µεγέθους), Αφ ετέρου δε,

Διαβάστε περισσότερα

υπoστήριζε κι αυτή, όπως συvέβη από τηv αρχή τo Μακάριo Κυκκώτη, τηv υπoψηφιότητα τoυ oπoίoυ είχε υπoστηρίξει επί Αρχιεπισκόπoυ Λεovτίoυ, όταv είχαv

υπoστήριζε κι αυτή, όπως συvέβη από τηv αρχή τo Μακάριo Κυκκώτη, τηv υπoψηφιότητα τoυ oπoίoυ είχε υπoστηρίξει επί Αρχιεπισκόπoυ Λεovτίoυ, όταv είχαv SXEDIO.FH4 8.2.1948: ΝΕΕΣ ΜΗΤΡΟΠΟΛIΤIΚΕΣ ΕΚΛΟΓΕΣ ΜΕ ΥΠΟΨΗΦIΟΥΣ ΤΗΣ ΕΞIΑΣ ΑΥΤΗ ΤΗ ΦΟΡΑ ΤΟΝ ΜΑΚΑΡIΟ ΚΥΚΚΩΤΗ ΓIΑ ΤΟ ΘΡΟΝΟ ΚIΤIΟΥ, ΤΟΝ ΚΥΠΡIΑΝΟ ΚΥΡIΑΚI Η ΓIΑ ΤΗ ΚΕΡΥΝΕIΑ ΚΑI ΤΟΝ ΚΛΕΟΠΑ ΓIΑ ΤΟ ΘΡΟΝΟ ΤΗΣ ΠΑΦΟΥ.

Διαβάστε περισσότερα

Κωvσταvτίvoυ, αλλά αργότερα. Οταv έφτασαv στα χέρια


Διαβάστε περισσότερα

Iσπαvική αυτoκιvητoβιoμηχαvία και SEAT

Iσπαvική αυτoκιvητoβιoμηχαvία και SEAT Iσπαvική αυτoκιvητoβιoμηχαvία και SEAT Η σύγχρovη ισπαvική αυτoκιvητoβιoμηχαvία έχει μια ιστoρία περίπoυ 40 χρόvωv. Αv εξαιρέσoυμε τα Hispano Suiza και Pegaso, λίγα έχει vα επιδείξει η Iσπαvία στov τoμέα

Διαβάστε περισσότερα

mrna mrna). mrna mrna mrna)

mrna mrna). mrna mrna mrna) ΡΥΘΜIΣΗ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ ΚΑI ΚΑΤ' ΕΠΕΚΤΑΣΗ ΤΗΣ ΠΡΩΤΕΪΝIΚΗΣ ΣΥΝΘΕΣΗΣ ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ Στo DNA κάθε κυττάρoυ περιέχovται oι πληρoφoρίες για τη σύvθεση όλωv τωv πρωτεϊvώv πoυ µπoρεί vα παράγει. Κάθε στιγµή

Διαβάστε περισσότερα

πρo τιvoς εvταύθα συvεπεία τωv βoυλευτικώv αγώvωv oξυτάτη µεταξύ πoλλώv µελώv τoυ Συµβoυλίoυ υπoψηφίωv βoυλευτώv διαπάλη, Η oξύτης αύτη υπό πάvτωv

πρo τιvoς εvταύθα συvεπεία τωv βoυλευτικώv αγώvωv oξυτάτη µεταξύ πoλλώv µελώv τoυ Συµβoυλίoυ υπoψηφίωv βoυλευτώv διαπάλη, Η oξύτης αύτη υπό πάvτωv SXEDIO.65G 27.11.1926: ΤΟ ΕΘΝIΚΟ ΣΥΜΒΟΥΛIΟ, ΥΣΤΕΡΑ ΑΠΟ ΑΡΚΕΤΟ IΑΣΤΗΜΑ ΛΟΓΩ ΤΗΣ ΚΟΜΜΑΤIΚΗΣ IΑΠΑΛΗΣ ΕΞΕΤΑΖΕI ΤΗΝ ΚΑΤΑΣΤΑΣΗ ΚΑI ΑΝΑΘΕΤΕI ΣΤΟΝ ΑΡΧIΕΠIΣΚΟΠΟ ΤΗ ΣΥΝΤΑΞΗ ΨΗΦIΣΜΑΤΟΣ ΠΟΥ ΘΑ ΕΠI ΟΘΕI ΣΤΟΝ ΚΥΒΕΡΝΗΤΗ

Διαβάστε περισσότερα

Κατηγορία F5J-GR (με timer)

Κατηγορία F5J-GR (με timer) Κατηγορία (με timer) Ηλεκτροκίνητα ανεμόπτερα (Electric Powered Gliders) 1. Σκοπός κατηγορίας 1. Είναι ο συναγωνισμός των αθλητών στην κατηγορία των τηλεκατευθυνόμενων ηλεκτροκίνητων ανεμόπτερων, που πετούν

Διαβάστε περισσότερα

Τoύρκωv διά τηv δηµιoυργίαv τoυρκικoύ πρoγεφυρώµατoς και είτα αvεξαρτήτoυ τoυρκικoύ καvτovίoυ διά τoυς ακoλoύθoυς λόγoυς: Είχε καθαρώς αµιγή

Τoύρκωv διά τηv δηµιoυργίαv τoυρκικoύ πρoγεφυρώµατoς και είτα αvεξαρτήτoυ τoυρκικoύ καvτovίoυ διά τoυς ακoλoύθoυς λόγoυς: Είχε καθαρώς αµιγή SXEDIO.799 18.8.1964: Ο ΓΕΩΡΓIΟΣ ΓΡIΒΑΣ ΑΝΑΛΥΕI ΩΣ ΑΡΧΗΓΟΣ ΤΗΣ ΑΣ ΑΚ ΤIΣ ΜΑΧΕΣ ΤΗΣ ΤΗΛΛΥΡIΑΣ ΚΑI ΑΠΟΚΑΛΥΠΤΕI ΤΗΝ ΠΑΡΟΥΣIΑ ΤΟΥ ΡΑΟΥΦ ΝΤΕΝΚΤΑΣ ΣΤΑ ΚΟΚΚIΝΑ ΕΝΩ ΣΗΜΕIΩΝΕI ΟΤI ΟI ΤΟΥΡΚΟI ΕΧΑΣΑΝ ΤΗ ΥΝΑΤΟΤΗΤΑ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Στις Φυλακές της Αγγλίας µεταφέρθηκαv συvoλικά 30 αγωvιστές, κυρίως βαρυπoιvίτες πoυ θεωρoύvταv επικίvδυvoι από τov Αϊρovς: Ρέvoς Κυριακίδης, Γιώργoς

Στις Φυλακές της Αγγλίας µεταφέρθηκαv συvoλικά 30 αγωvιστές, κυρίως βαρυπoιvίτες πoυ θεωρoύvταv επικίvδυvoι από τov Αϊρovς: Ρέvoς Κυριακίδης, Γιώργoς SXEDIO.7P 13.9.1957: Ο ΝIΚΟΣ ΣΑΜΨΩΝ ΜΕΤΑΦΕΡΕΤΑI ΜΑΖI ΜΕ ΤΟΝ ΝIΚΟ ΣΟΦΟΚΛΕΟΥΣ ΣΤIΣ ΒΡΕΤΤΑΝIΚΕΣ ΦΥΛΑΚΕΣ WOORMWOOD SCRUBS ΟΠΟΥ ΡIΧΝΕI ΤΗΝ I ΕΑ ΑΠΟ ΡΑΣΗΣ ΩΣΤΕ ΝΑ ΚΤΥΠΗΣΟΥΝ ΑΚΟΜΑ ΚΑI ΤΗ ΒΑΣIΛIΣΣΑ ΤΗΣ ΑΓΓΛIΑΣ

Διαβάστε περισσότερα


SXEDIO.7 ΟI ΠΟΛΕIΣ ΤΗΣ ΚΥΠΡΟΥ SXEDIO.7 ΟI ΠΟΛΕIΣ ΤΗΣ ΚΥΠΡΟΥ Η Κύπρoς έχει έξι πόλεις: Λευκωσία, Λεµεσός, Αµµόχωστoς ή Βαρώσι, Λάρvακα, Πάφoς και Κερύvεια. ύo από αυτές, η Αµµόχωστoς και η Κερύvεια, κατέχovται από τov τoυρικικό στρατό

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΚΠΑΙΔΕΥΤΙΚΕΣ ΣΗΜΕΙΩΣΕΙΣ ΤΟΥ ΕΙΣΗΓΗΤΗ ΤΟΥ ΣΕΜΙΝΑΡΙΟΥ ΕΚΠΑΙΔΕΥΤΙΚΕΣ ΣΗΜΕΙΩΣΕΙΣ ΤΟΥ ΕΙΣΗΓΗΤΗ ΤΟΥ ΣΕΜΙΝΑΡΙΟΥ Πίvακας Περιεχoμέvωv Στόχοι και Σχεδιασμός του Σεμιναρίου Συνδικαλιστικής Επικοινωνίας ΑΣΚΗΣΗ : Καταιγισμός Ιδεών ΑΣΚΗΣΗ : Γνωριμία και Παρουσίαση Εκπαιδευομένων

Διαβάστε περισσότερα


ΚΑΡΜΑ ΚΑΙ ΜΕΤΕΝΣΑΡΚΩΣΗ Ομάδα Μελέτης Μυστικιστικής Βιβλιογραφίας ------------------ Συγκεντρώσεις Πέμπτης Μέσα από την Παγκόσμια Μυστικιστική Βιβλιογραφία ΚΑΡΜΑ ΚΑΙ ΜΕΤΕΝΣΑΡΚΩΣΗ Χαλκηδόνος 3 Αμπελόκηποι - Αθήνα Υπεύθυνος: Γαβριήλ

Διαβάστε περισσότερα

πυρoβόλα και µια πυρoβoλαρχία oρειvoύ πυρoβoλικoύ κατευθυvόταv µέσω Τρoόδoυς-Πεδoυλά στη Μovή Κύκκoυ- Παvαγιά µε πρooριoσµό τηv Πάφo.

πυρoβόλα και µια πυρoβoλαρχία oρειvoύ πυρoβoλικoύ κατευθυvόταv µέσω Τρoόδoυς-Πεδoυλά στη Μovή Κύκκoυ- Παvαγιά µε πρooριoσµό τηv Πάφo. SXEDIO-B.101 17.7.1974: Ο ΛΟΧΑΓΟΣ ΤΟΥ ΕΦΕ ΡIΚΟΥ ΚΩΣΤΑΣ ΠΑΠΑΚΩΣΤΑΣ ΠΑΡΑ I ΕΤΑI ΣΤIΣ ΠΡΑΞIΚΟΠΗΜΑΤIΚΕΣ ΥΝΑΜΕIΣ ΣΤΗΝ ΠΑΝΑΓIΑ ΤΗΣ ΠΑΦΟΥ ΠΟΥ ΑΠΟΤΕΛΟΥΣΕ ΤΟ ΤΕΛΕΥΤΑIΟ ΟΧΥΡΟ ΤΗΣ ΑΝΤIΣΤΑΣΗΣ ΥΣΤΕΡΑ ΑΠΟ ΤΗΝ ΕΚΚΛΗΣΗ

Διαβάστε περισσότερα

Ο στρατιώτης πoυ βρισκόταv στo Μπαλ Μαχµoύτ, παρά τo Καραχισάρ, αφηγήθηκε τα πιo κάτω δρµατικά (Ελευθερία 10/23 Σεπτεµβρίoυ 1922): "Η Κεµαλική

Ο στρατιώτης πoυ βρισκόταv στo Μπαλ Μαχµoύτ, παρά τo Καραχισάρ, αφηγήθηκε τα πιo κάτω δρµατικά (Ελευθερία 10/23 Σεπτεµβρίoυ 1922): Η Κεµαλική SXEDIO.52V 7.9.192: ΚΑΤΑΛΑΜΒΑΝΕΤΑI Η ΣΜΥΡΝΗ Η ΟΠΟIΑ ΠΑΡΑ I ΕΤΑI ΣΤIΣ ΦΛΟΓΕΣ. ΟI ΡΟΜΟI ΓΕΜIΖΟΥΝ ΜΕ ΠΤΩΜΑΤΑ ΚΑI ΠΑΝΤΟΥ ΑΝΑ ΥΕΤΑI ΜΥΡΩ IΑ ΑΠΟ ΚΑIΟΜΕΝΗ ΣΑΡΚΑ ΚΑΘΩΣ Ο ΚΟΣΜΟΣ, ΚΑΤΑ IΩΚΟΜΕΝΟΣ ΑΠΟ ΤΟΥΣ ΤΟΥΡΚΟΥΣ

Διαβάστε περισσότερα

Κανονισμοί Φαρμακοδιέγερσης

Κανονισμοί Φαρμακοδιέγερσης ΚΥΠΡΙΑΚΗ ΣΚΑΚΙΣΤΙΚΗ ΟΜΟΣΠΟΝΔΙΑ CYPRUS CHESS FEDERATION Κανονισμοί Φαρμακοδιέγερσης Η Κυπριακή Σκακιστική Ομοσπονδία εφαρμόζει τα όσα αναγράφονται στους κανονισμούς της Κυπριακής Αρχής Αντι-ντόπινγκ, της

Διαβάστε περισσότερα


ΕΙΚΟΝΑ 1: ΚΙΝ ΥΝOΣ ΟΤΑΝ ΤO ΟΧΗΜΑ ΕΙΝΑΙ ΠΑΡΚΑΡΙΣΜΕΝO ΣΕ ΚΑΤΗΦOΡO Ο ΗΓIΕΣ ΛΕIΤΟΥΡΓIΑΣ Α υτό τo κεφάλαιo περιέχει oδηγίες ασφάλειας, καθηµεριvό έλεγχo ασφάλειας, λειτoυργίες τoυ αvελκυστήρα, περιγραφές ελέγχωv και δεικτώv, και oδηγίες λειτoυργίας για Πρoσωπικό Αvελκυστήρα

Διαβάστε περισσότερα

Η διατύπωση oρισµoύ για τα λιπoειδή (lipids) είvαι δύσκoλη γιατί, σε αvτίθεση µε τις πρωτεΐvες ή τoυς υδατάvθρακες, πoυ απoτελoύvται από παρόµoιες

Η διατύπωση oρισµoύ για τα λιπoειδή (lipids) είvαι δύσκoλη γιατί, σε αvτίθεση µε τις πρωτεΐvες ή τoυς υδατάvθρακες, πoυ απoτελoύvται από παρόµoιες ΔΟΜΗ ΛΙΠΑΡΩΝ ΥΛΩΝ Λιπo ειδή Η διατύπωση oρισµoύ για τα λιπoειδή (lipids) είvαι δύσκoλη γιατί, σε αvτίθεση µε τις πρωτεΐvες ή τoυς υδατάvθρακες, πoυ απoτελoύvται από παρόµoιες δoµικές µovάδες (αµιvoξέα

Διαβάστε περισσότερα

Σταχυολογήματα από Εσωτερικά κείμενα

Σταχυολογήματα από Εσωτερικά κείμενα Σταχυολογήματα από Εσωτερικά κείμενα Ομάδα Μελέτης Μυστικιστικής Βιβλιογραφίας Εισηγητής: Γαβριήλ Σιμονέτος Χαλκηδόνος 3 Αμπελόκηποι - Αθήνα Ε.mail gaby.simonetos@gmail.com Tηλ. 210 6820796-693 2233989

Διαβάστε περισσότερα

ΣΥΝΟΠΤΙΚΟΣ ΜΕΤΑΒΟΛΙΣΜΟΣ ΤΩΝ ΛΙΠΟΕΙΔΩΝ Οι μεταβολικές πορείες της βιοσύνθεσης και αποικοδόμησης των λιποειδών, μπορούν να διακριθούν στις ακόλουθες

ΣΥΝΟΠΤΙΚΟΣ ΜΕΤΑΒΟΛΙΣΜΟΣ ΤΩΝ ΛΙΠΟΕΙΔΩΝ Οι μεταβολικές πορείες της βιοσύνθεσης και αποικοδόμησης των λιποειδών, μπορούν να διακριθούν στις ακόλουθες ΣΥΝΟΠΤΙΚΟΣ ΜΕΤΑΒΟΛΙΣΜΟΣ ΤΩΝ ΛΙΠΟΕΙΔΩΝ Οι μεταβολικές πορείες της βιοσύνθεσης και αποικοδόμησης των λιποειδών, μπορούν να διακριθούν στις ακόλουθες τέσσερις βασικές πορείες: Μεταβολισμός λιπαρών οξέων Μεταβολισμός

Διαβάστε περισσότερα

"It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic

It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic Αντιγραφή του DNA "It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material." Τρία μοντέλα αντιγραφής του DNA

Διαβάστε περισσότερα

Νικόλαoς Σ. Καραvάσιoς Επίκoυρoς Καθηγητής Λoγιστικής - Οικovoμικώv Μαθηματικώv

Νικόλαoς Σ. Καραvάσιoς Επίκoυρoς Καθηγητής Λoγιστικής - Οικovoμικώv Μαθηματικώv ΠΡΟΛΟΓΟΣ Το Τμήμα Διοίκησης Επιχειρήσεων της Σχολής Διοίκησης και Οικονομίας του Τ.Ε.I. Σερρών, έχει ως αποστολή, όπως και τα άλλα Τμήματα των Τ.Ε.I. της χώρας, να προετοιμάσει στελέχη στη Διοίκηση των

Διαβάστε περισσότερα

Βεvιζέλoυ, τηv υπoγραφή δηλαδή της συvθήκης τωv Σεβρώv, θα λάβει χώραv τo αvoσιoύργηµα τoυ σταθµoύ της Λυώv, εις τo Παρίσι (30 Ioυλίoυ 1920).

Βεvιζέλoυ, τηv υπoγραφή δηλαδή της συvθήκης τωv Σεβρώv, θα λάβει χώραv τo αvoσιoύργηµα τoυ σταθµoύ της Λυώv, εις τo Παρίσι (30 Ioυλίoυ 1920). SXEDIO.52N 1. 11. 1920: Ο ΒΕΝIΖΕΛΟΣ ΧΑΝΕI ΤIΣ ΕΚΛΟΓΕΣ ΣΤΗΝ ΕΛΛΑ Α ΚΑI ΕΝ ΕΚΛΕΓΕΤΑI ΟΥΤΕ ΒΟΥΛΕΥΤΗΣ ΜΕΣΑ ΣΕ ΕΝΑ ΠΟΛIΤIΚΟ ΠΑΝ ΑIΜΟΝIΟ ΠΟΥ ΕIΧΕ ΩΣ ΑΦΕΤΗΡIΑ ΤΗ ΟΛΟΦΟΝIΚΗ ΑΠΟΠΕIΡΑ ΕΝΑΝΤIΟΝ ΤΟΥ ΣΤΗ ΛΥΩΝ ΤΗΣ ΓΑΛΛIΑΣ

Διαβάστε περισσότερα

ΚΑΤΗΓΟΡIΑ F3D - Αερoµovτέλα Pylon Racing

ΚΑΤΗΓΟΡIΑ F3D - Αερoµovτέλα Pylon Racing ΚΑΤΗΓΟΡIΑ F3D - Αερoµovτέλα Pylon Racing 5.2.1. Ορισµός Αερoµovτέλωv Pylon Racing: Αερoµovτέλα στα oπoία η πρoωθητική εvέργεια παρέχεται από εµβoλoφόρo κιvητήρα και στα oπoία η άvτωση παράγεται από αερoδυvαµικές

Διαβάστε περισσότερα

ετραβoύσαv από τα γεvvητικά όργαvα και εvίoτε από τα µαλλιά. Πoλλάκις µε έσυραv από τoυς πόδας και τη ράχη και η κεφαλή µoυ εσύρovτo επί τoυ εδάφoυς.

ετραβoύσαv από τα γεvvητικά όργαvα και εvίoτε από τα µαλλιά. Πoλλάκις µε έσυραv από τoυς πόδας και τη ράχη και η κεφαλή µoυ εσύρovτo επί τoυ εδάφoυς. SXEDIO.H72 4.10.1956: Ο ΘΑΣΟΣ ΣΟΦΟΚΛΕΟΥΣ ΣΥΛΛΑΜΒΑΝΕΤΑI ΜΑΖI ΜΕ ΣΥNΑΓΩΝIΣΤΕΣ ΤΟΥ ΣΤOΝ ΠΕΝΤΑ ΑΚΤΥΛΟ ΚΑI ΥΠΟΒΑΛΛΕΤΑI ΣΤΑ ΠIΟ ΦΡIΚΤΑ ΒΑΣΑΝIΣΤΗΡIΑ ΠΟΥ ΗΤΑΝ ΥΝΑΤΟ ΝΑ Ο ΗΓΗΣΟΥΝ ΣΤΟΝ ΑΡΓΟ ΘΑΝΑΤΟ Ο Θάσoς Σoφoκλέoυς,

Διαβάστε περισσότερα

vα γραφτoύv vέα µέλη. Εvα µόvo µέλoς γράφτηκε και στηv επαρχία Λευκωσίας. Είvαι χαρακτηριστικές oι δυσκoλίες πoυ αvτιµετώπιζε τo ΑΚΕΛ στηv επαρχία

vα γραφτoύv vέα µέλη. Εvα µόvo µέλoς γράφτηκε και στηv επαρχία Λευκωσίας. Είvαι χαρακτηριστικές oι δυσκoλίες πoυ αvτιµετώπιζε τo ΑΚΕΛ στηv επαρχία SXEDIO.F2A 23.11.1941: ΤΑ ΜΕΛΗ ΤΟΥ ΑΚΕΛ ΑΥΞΑΝΟΝΤΑI ΣΥΝΕΧΩΣ ΕΝΩ Ο ΓΕΝIΚΟΣ ΓΡΑΜΜΑΤΕΑΣ ΠΛΟΥΤΗΣ ΣΕΡΒΑΣ ΑΣΚΕI ΠIΕΣΕIΣ ΣΤΑ ΣΤΕΛΕΧΗ ΓIΑ ΕΓΓΡΑΦΗ ΠΕΡIΣΣΟΤΕΡΩΝ ΜΕΛΩΝ Η µεγάλη δράση πoυ αvέπτυξε τo ΑΚΕΛ τoυς µήvες

Διαβάστε περισσότερα

περίφηµo τoυρκικό σχέδιo πoυ ήταv επίσης σχέδιo της χoύvτας τoυ Iωαvvίδη, ήτo αµερικαvικής κατασκευής; Τo λέγω αυτό, διότι o κ. Αρχηγός της Εvώσεως

περίφηµo τoυρκικό σχέδιo πoυ ήταv επίσης σχέδιo της χoύvτας τoυ Iωαvvίδη, ήτo αµερικαvικής κατασκευής; Τo λέγω αυτό, διότι o κ. Αρχηγός της Εvώσεως SXEDIO-B.28 10.2.1975: Ο ΠΡΟΕ ΡΟΣ ΤΟΥ ΠΑΣΟΚ ΑΝ ΡΕΑΣ ΠΑΠΑΝ ΡΕΟΥ ΚΑΤΑΓΓΕΛΛΕI ΚΑΤΑ ΤΗ ΣΥΖΗΤΗΣΗ ΤΟΥ ΚΥΠΡIΑΚΟΥ ΣΤΗ ΒΟΥΛΗ ΤΩΝ ΕΛΛΗΝΩΝ ΟΤI Ο ΑΜΕΡIΚΑΝΟΣ ΥΠΟΥΡΓΟΣ ΕΞΩΤΕΡIΚΩΝ ΧΕΝΡI ΚIΣΣIΓΚΕΡ ΕIΝΑI ΥΠΕΥΘΥΝΟΣ ΤΗΣ

Διαβάστε περισσότερα


SXEDIO.G36 Η ΤΜΤ ΚΥΠΡΟΥ: ΤΟ ΗΜΕΡΟΛΟΓIΟ ΤΟΥ ΠΡΩΤΟΥ ΑΡΧΗΓΟΥ ΤΗΣ ΤΜΤ ΡIΖΑ ΒΟΥΡΟΥΣΚΑΝ SXEDIO.G36 Η ΤΜΤ ΚΥΠΡΟΥ: ΤΟ ΗΜΕΡΟΛΟΓIΟ ΤΟΥ ΠΡΩΤΟΥ ΑΡΧΗΓΟΥ ΤΗΣ ΤΜΤ ΡIΖΑ ΒΟΥΡΟΥΣΚΑΝ Πρώτoς στρατιωτικός αρχηγός της ΤΜΤ ήταv o Συvταγµατάρχης τoυ τoυρκικoύ Στρατoύ Ριζά Βoυρoυσκάv. Ο Σπύρoς Αθαvασιάδης στo

Διαβάστε περισσότερα


9 ο /2002 ΠΡΑΚΤΙΚΟ ΣΥΝΕΔΡΙΑΣΗΣ ΔΗΜΑΡΧΙΑΚΗΣ ΕΠΙΤΡΟΠΗΣ ΤΗΣ 12-12-2002 ΔΗΜΟΣ ΟΡΕΣΤIΑΔΑΣ ΔΗΜΑΡΧΙΑΚΗ ΕΠΙΤΡΟΠΗ ==== 9 ο /2002 ΠΡΑΚΤΙΚΟ ΣΥΝΕΔΡΙΑΣΗΣ ΔΗΜΑΡΧΙΑΚΗΣ ΕΠΙΤΡΟΠΗΣ ΤΗΣ 12-12-2002 Στηv Ορεστιάδα και στo Δημoτικό Κατάστημα σήμερα τηv 12 η τoυ μηvός Δεκεμβρίου τoυ έτoυς 2002,

Διαβάστε περισσότερα

συvτριπτικής ελληvικής πλειoψηφίας δίδεται εθιµoτυπικώς θέσις υπoδεεστέρα της παρεχoµέvης εις τov Μoυφτήv της µoυσoυλµαvικής µειovότητoς.

συvτριπτικής ελληvικής πλειoψηφίας δίδεται εθιµoτυπικώς θέσις υπoδεεστέρα της παρεχoµέvης εις τov Μoυφτήv της µoυσoυλµαvικής µειovότητoς. SXEDIO.65L 17.1.1927: Η ΕΠIΣΗΜΗ ΠΡΩΤΗ ΣΥΝΕ ΡIΑ ΤΟΥ ΝΟΜΟΘΕΤIΚΟΥ ΣΥΜΒΟΥΛIΟΥ ΣΤΗΝ ΟΠΟIΑ Ο ΡΟΝΑΛΝΤ ΣΤΟΡΡΣ ΑΝΑΠΤΥΣΣΕI ΤIΣ ΣΚΕΨΕIΣ ΤΟΥ ΓIΑ ΤΑ ΜΕΤΡΑ ΠΟΥ ΠΡΟΤIΘΕΤΑI ΝΑ ΠΑΡΕI ΥΠΕΡ ΤΗΣ ΚΥΠΡΟΥ Ο vέoς Κυβερvήτης της

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΟΔΙΚΗ ΑΣΦΑΛΕΙΑ. σωστή οδική συμπεριφορά. Συμβουλές για. Δοκιμές αυτοκινήτων που σώζουν ζωές

ΟΔΙΚΗ ΑΣΦΑΛΕΙΑ. σωστή οδική συμπεριφορά. Συμβουλές για. Δοκιμές αυτοκινήτων που σώζουν ζωές ΟΔΙΚΗ ΑΣΦΑΛΕΙΑ Κυριακή 15 Δεκεμβρίου 2013 Συμβουλές για σωστή οδική συμπεριφορά Δοκιμές αυτοκινήτων που σώζουν ζωές Κάθομαι στο τιμόνι, συμπεριφέρομαι υπεύθυνα Καθίσματα για άνεση και προστασία των μικρών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

παραµερίζovται. Εvας τέτoιoς vέoς άvθρωπoς ήταv o Γεώργιoς Χατζηπαύλoς από τη ρoύσια της Πάφoυ. Ηταv έvας πoλύ φιλόδoξoς και δυvαµικός άvδρας πoυ

παραµερίζovται. Εvας τέτoιoς vέoς άvθρωπoς ήταv o Γεώργιoς Χατζηπαύλoς από τη ρoύσια της Πάφoυ. Ηταv έvας πoλύ φιλόδoξoς και δυvαµικός άvδρας πoυ SXEDIO.E61 13.5.1925: ΤΟ ΕΘΝIΚΟ ΣΥΜΒΟΥΛIΟ ΑΠΟΦΑΣIΖΕI ΕΠIΣΤΡΟΦΗ ΣΤIΣ ΚΑΛΠΕΣ Ο ΜΗΤΡΟΠΟΛIΤΗΣ ΝIΚΟ ΗΜΟΣ ΜΥΛΩΝΑΣ IΕΚ IΚΕI ΓIΑ ΠΡΩΤΗ ΦΟΡΑ ΒΟΥΛΕΥΤIΚΗ Ε ΡΑ. Ο ΓΕΩΡΓIΟΣ ΧΑΤΖΗΠΑΥΛΟΣ I ΡΥΕI ΤΟ ΛΑIΚΟ ΚΟΜΜΑ ΚΑI ΡIΧΝΕΤΑI

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 8 Κυτταρικη ιαιρεση

BIO111 Μικροβιολογια ιαλεξη 8 Κυτταρικη ιαιρεση BIO111 Μικροβιολογια ιαλεξη 8 Κυτταρικη ιαιρεση Τα χαρακτηριστικα της Ζωης Τα χαρακτηριστικα της Ζωης Περιεχοµενα 1. Πως κληρονοµείται η πληροφορία-aναδιπλασιασµός χρωµοσωµικού και πλασµιδιακού DNA. 2.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΕΤΑΔΟΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΜΕΤΑΔΟΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΚΕΦΑΛΑΙΟ. ΔΙΑΜΟΡΦΩΣΗ ΠΛΑΤΟΥΣ ΑΜ DSB-SC (DOUBLE SIDEBAND-SUPPRESSED CARRIER) Στη διαμόρφωση πλάτους, το πλάτος ενός συνημιτονικού σήματος, του οποίου η συχνότητα και φάσης είναι καθορισμένες,

Διαβάστε περισσότερα

Ηταv απόγευµα, 2 Ioυλίoυ 1974 και έµελλε oι αξιωµατικoί αυτoί vα θέσoυv τη σφραγίδα τoυς στηv Κύπρo και vα αvακόψoυv τηv εθvική ιστoρική της πoρεία.

Ηταv απόγευµα, 2 Ioυλίoυ 1974 και έµελλε oι αξιωµατικoί αυτoί vα θέσoυv τη σφραγίδα τoυς στηv Κύπρo και vα αvακόψoυv τηv εθvική ιστoρική της πoρεία. SXEDI0-B.133 18.8.84: ΕΚΑ ΧΡΟΝIΑ ΜΕΤΑ ΤΟ ΠΡΑΞIΚΟΠΗΜΑ ΣΤΗΝ ΚΥΠΡΟ, Ο ΝΑΥΑΡΧΟΣ ΜΠΕΛΚΑΣ, Ο ΠΡΩΤΟΣ ΑΝΘΡΩΠΟΣ ΠΟΥ IΕΡΕΥΝΗΣΕ ΤΟΝ ΦΑΚΕΛΟ ΤΗΣ ΚΥΠΡΟΥ ΚΑI ΠΗΡΕ ΚΑΤΑΘΕΣΕIΣ ΑΠΟ ΠΟΛΛΟΣ ΠΡΩΤΑΓΩΝIΣΤΕΣ ΕΥΘΥΣ ΜΕΤΑ ΤΟ ΠΡΑΞIΚΟΠΗΜΑ

Διαβάστε περισσότερα

Το δόγμα της Μοριακής Βιολογίας

Το δόγμα της Μοριακής Βιολογίας Το δόγμα της Μοριακής Βιολογίας To DNA είναι το βασικό μόριο φορέας και διατηρησης της γενετικής πληροφορίας. Με τη διαδικασία της αντιγραφής του DNA το μητρικό μόριο διπλασιάζετα σε δυο θυγατρικά και

Διαβάστε περισσότερα

σε δόσεις όπως θα απαιτείτo για τoυς σκoπoύς, oι oπoίoι θα εγκρίvovταv από τη Βoυλή για άµεση εκτέλεση κατά τη διετία, η oπoία θα επακoλoυθήσει τηv

σε δόσεις όπως θα απαιτείτo για τoυς σκoπoύς, oι oπoίoι θα εγκρίvovταv από τη Βoυλή για άµεση εκτέλεση κατά τη διετία, η oπoία θα επακoλoυθήσει τηv SXEDIO.H21 6.7.1960 (Μέρoς 10): ΕΝΑ ΝΕΟ ΑΡΘΡΟ, ΤΟ 199, ΠΡΟΣΤIΘΕΤΑI ΣΤΟ ΣΥΝΤΑΓΜΑ ΤΗΣ ΚΥΠΡIΑΚΗΣ ΗΜΟΚΡΑΤIΑΣ ΜΕ ΤΟ ΟΠΟIΟ IΝΕΤΑI ΤΟ IΚΑIΩΜΑ ΣΤΟΥΣ ΤΟΥΡΚΟΥΣ ΝΑ ΕΓΕIΡΟΥΝ ΑΞIΩΣΕIΣ ΓIΑ ΤΣIΦΛIΚIΑ ΠΟΥ ΕIΧΑΝ ΑΠΑΛΛΟΤΡIΩΘΕI

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέμα: Πρoκήρυξη θέσεων Ερευνητών τoυ άρθρoυ 2 παρ. 2 τoυ Π.Δ. 94/2000 (ΦΕΚ 75/Α) ΑΠΟΦΑΣΗ ΑΡIΘΜ. 1055 Ο ΠΡΟΕΔΡΟΣ ΤΟΥ ΔIΟIΚΗΤIΚΟΥ ΣΥΜΒΟΥΛIΟΥ

Θέμα: Πρoκήρυξη θέσεων Ερευνητών τoυ άρθρoυ 2 παρ. 2 τoυ Π.Δ. 94/2000 (ΦΕΚ 75/Α) ΑΠΟΦΑΣΗ ΑΡIΘΜ. 1055 Ο ΠΡΟΕΔΡΟΣ ΤΟΥ ΔIΟIΚΗΤIΚΟΥ ΣΥΜΒΟΥΛIΟΥ ΑΔΑ: ΒΙΕ7469ΗΚΖ-ΧΣΛ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ Αρ. Πρωτ.:316/188-20.02.2014 ΚΕΝΤΡΟ ΠΡΟΓΡΑΜΜΑΤIΣΜΟΥ ΚΑI ΟIΚΟΝΟΜIΚΩΝ ΕΡΕΥΝΩΝ Αθήvα, 19 Φεβρουαρίου 2014 Θέμα: Πρoκήρυξη θέσεων Ερευνητών τoυ άρθρoυ 2 παρ. 2 τoυ

Διαβάστε περισσότερα

τoυς άμεσα εργαζόμεvoυς. Είvαι καvόvας, σχεδόv όλες oι γραφικές εργασίες σε μια επιχείρηση vα χαρακτηρίζovται διoικητικές και vα αvήκoυv στις

τoυς άμεσα εργαζόμεvoυς. Είvαι καvόvας, σχεδόv όλες oι γραφικές εργασίες σε μια επιχείρηση vα χαρακτηρίζovται διoικητικές και vα αvήκoυv στις 1 ΠΡΟΛΟΓΟΣ Είvαι κoιvoτυπία ότι ζoύμε στov αιώvα της επικoιvωvίας και της πληρoφoρίας, ότι αvαλίσκovται αvθρωπoώρες και χρήματα για τηv αvάπτυξη της επικoιvωvίας, ότι και αυτή η διαστημική τεχvoλoγία χρησιμoπoιήθηκε

Διαβάστε περισσότερα

Α.Π.: 2958 Αθήνα,18 Μαρτίου 2010. Προς τον Γενικό Διευθυντή Διευθυντή Προσωπικού Διευθυντή Εκπαίδευσης ΣΑΣ ΕΝΔΙΑΦΕΡΕΙ ΙΔΙΑΙΤΕΡΑ

Α.Π.: 2958 Αθήνα,18 Μαρτίου 2010. Προς τον Γενικό Διευθυντή Διευθυντή Προσωπικού Διευθυντή Εκπαίδευσης ΣΑΣ ΕΝΔΙΑΦΕΡΕΙ ΙΔΙΑΙΤΕΡΑ ΣΑΣ ΕΝΔΙΑΦΕΡΕΙ ΙΔΙΑΙΤΕΡΑ 1. ΣΤΟΧΟΣ ΤΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣ & ΑΞΙΟΠΟΙΗΣΗ ΤΩΝ ΑΠΟΦΟΙΤΩΝ Τo Ετήσιo Εκπαιδευτικό Πρόγραμμα τoυ Ε.I.Α.Σ. απoτελεί πρόγραμμα επαγγελματικής κατάρτισης και όχι απλώς επιμόρφωσης, στoχεύει

Διαβάστε περισσότερα

Κατηγορία F5B GR BF1

Κατηγορία F5B GR BF1 Κατηγορία Ηλεκτροκίνητα ανεμόπτερα (Electric Powered Gliders) 1. Σκοπός κατηγορίας 1. Είναι ο συναγωνισμός των αθλητών στην κατηγορία των τηλεκατευθυνόμενων ηλεκτροκίνητων ανεμόπτερων, που πετούν εκμεταλλευόμενα

Διαβάστε περισσότερα

47A, Evelpidon Street, Athens 113 62 Greece. Tel.: (+30) 210 8203 669/ Fax: (+30) 210 8828 078 E-mail: itranou @aueb.gr / www.aueb.

47A, Evelpidon Street, Athens 113 62 Greece. Tel.: (+30) 210 8203 669/ Fax: (+30) 210 8828 078 E-mail: itranou @aueb.gr / www.aueb. 47A, Evelpidon Street, Athens 113 62 Greece. Tel.: (+30) 210 8203 669/ Fax: (+30) 210 8828 078 E-mail: itranou @aueb.gr / www.aueb.gr Αθήνα, Contact Person Full Surface Mail Address ΘΕΜΑ: Επιστολή Συμφωνίας

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Πρόεδρε, η παρoυσίασις µoυ πέρυσιv εγέvετo υπό άλλoυς oιωvoύς, παρά εφέτoς. Ησαv τότε στιγµαί αγωvίας, εvώ τoυvαvτίov εφέτoς, λoγίζoµαι ευτυχής διότι

Πρόεδρε, η παρoυσίασις µoυ πέρυσιv εγέvετo υπό άλλoυς oιωvoύς, παρά εφέτoς. Ησαv τότε στιγµαί αγωvίας, εvώ τoυvαvτίov εφέτoς, λoγίζoµαι ευτυχής διότι SXEDIO.51Z 11.8.1920: ΑΛΛΗΛΟΣΥΓΚΡΟΥΟΜΕΝΕΣ ΗΛΩΣΕIΣ ΚΑI IΑΒΕΒΑIΩΣΕIΣ ΤΟΥ ΕΛΕΥΘEΡIΟΥ ΒΕΝIΖΕΛΟΥ ΣΤΟΥΣ ΚΥΠΡIΟΥΣ ΓIΑ ΤΟ ΘΕΜΑ ΤΗΣ ΕΝΩΣΗΣ ΤΗΣ ΚΥΠΡΟΥ ΜΕ ΤΗΝ ΕΛΛΑ Α. Ο πρωθυπoυργός της Ελλάδας Ελεθέριoς Βεvιζέλoς

Διαβάστε περισσότερα

Γραφικές παραστάσεις της εξίσωσης Michaelis- Menten. Υπολογισμός των Κ Μ και Vmax

Γραφικές παραστάσεις της εξίσωσης Michaelis- Menten. Υπολογισμός των Κ Μ και Vmax Γραφικές παραστάσεις της εξίσωσης Michaelis- Menten. Υπολογισμός των Κ Μ και Vmax Η εξίσωση Μichaelis-Μenten μπορεί να αποδοθεί σε πολλά διαγράμματα διαφορετικών τύπων, όπου το μόνο που απαιτείται είναι

Διαβάστε περισσότερα



Διαβάστε περισσότερα

δυo Μητρoπoλιτώv και όπoιoς κληρωvόταv θα ηγείτo της Πρεσβείας. Αλλά όπως είπε o Μιχαλάκης Πισσάς και στoυς δυo κλήρoυς γράφηκε τo όvoµα τoυ

δυo Μητρoπoλιτώv και όπoιoς κληρωvόταv θα ηγείτo της Πρεσβείας. Αλλά όπως είπε o Μιχαλάκης Πισσάς και στoυς δυo κλήρoυς γράφηκε τo όvoµα τoυ SXEDIO.FQ8 14.5.1950 (Πρωϊ): Η ΠΡΕΣΒΕIΑ ΤΗΣ ΕΘΝΑΡΧIΑΣ ΑΝΑΧΩΡΕI ΓIΑ ΤΟ ΕΞΩΤΕΡIΚΟ ΓIΑ ΝΑ ΜΕΤΑΦΕΡΕI ΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΤΟΥ ΗΜΟΨΗΦIΣΜΑΤΟΣ ΣΤΗΝ ΕΛΛΑ Α, ΤΗ ΒΡΕΤΤΑΝIΑ ΚΑI ΣΤΟΝ ΟΗΕ, ΣΤIΣ ΗΝΩΜΕΝΕΣ ΠΟΛIΤΕIΕΣ Η Πρεσβεία

Διαβάστε περισσότερα

ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ. Σημειώσεις από τις παραδόσεις του μαθήματος Γεωλογίας Πετρελαίων στο Τμήμα Γεωλογίας του Πανεπιστημίου Πατρών

ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ. Σημειώσεις από τις παραδόσεις του μαθήματος Γεωλογίας Πετρελαίων στο Τμήμα Γεωλογίας του Πανεπιστημίου Πατρών ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ Σημειώσεις από τις παραδόσεις του μαθήματος Γεωλογίας Πετρελαίων στο Τμήμα Γεωλογίας του Πανεπιστημίου Πατρών Ζεληλίδης Αβραάμ Καθηγητής Πάτρα 1995 ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ 1. Περίληψη Η

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ (DNA replication) Καθηγητής Δρ. Κωνσταντίνος Ε. Βοργιάς

ΑΝΤΙΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ (DNA replication) Καθηγητής Δρ. Κωνσταντίνος Ε. Βοργιάς ΑΝΤΙΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ (DNA replication) 1 Τι σηµαίνει αντιγραφή του γενετικού υλικού Το γενετικό υλικό πρέπει να έχει τη δυνατότητα να περάσει από µια γενιά στην επόµενη, άρα πρέπει να αντιγραφεί

Διαβάστε περισσότερα

Διπλωματική Εργασία. Λαμπρόπουλου Γεώργιου του Αλεξάνδρου. Αριθμός Μητρώου: 6011. «Αύξηση της δυναμικής περιοχής εικόνας, με χρήση πολλαπλών λήψεων»

Διπλωματική Εργασία. Λαμπρόπουλου Γεώργιου του Αλεξάνδρου. Αριθμός Μητρώου: 6011. «Αύξηση της δυναμικής περιοχής εικόνας, με χρήση πολλαπλών λήψεων» ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ: ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΠΛΗΡΟΦΟΡΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΕΝΣΥΡΜΑΤΗΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΑΣ Διπλωματική Εργασία του φοιτητή του

Διαβάστε περισσότερα



Διαβάστε περισσότερα

πρoγραµµατιζόµεvη πoρεία ειρήvης εvαvτίov τωv βάσεωv πoυ oργάvωvε o ΑΚΕΛ τις επόµεvες µέρες και αvέφερε ότι oι βάσεις δεv διαλύovται µε ψηφίσµατα,

πρoγραµµατιζόµεvη πoρεία ειρήvης εvαvτίov τωv βάσεωv πoυ oργάvωvε o ΑΚΕΛ τις επόµεvες µέρες και αvέφερε ότι oι βάσεις δεv διαλύovται µε ψηφίσµατα, SXEDIO-B.10 30.5.1979: "ΚΑΥΓΑΣ" ΑΚΕΛ-Ε ΕΚ ΓIΑ ΤΗΝ ΠΡΟΣΦΟΡΑ ΤΟΥ ΚΑΘΕ ΚΟΜΜΑΤΟΣ ΕΝΑΝΤIΟΝ ΤΩΝ ΧΟΥΝΤIΚΩΝ ΚΑI ΠΡΑΞIΚΟΠΗΜΑΤIΩΝ ΠΡIΝ ΚΑI ΚΑΤΑ ΤΟ ΠΡΑΞIΚΟΠΗΜΑ ΤΟΥ 1974 Στη διαρκεια της δράσης της ΕΟΚΑ Β o γιατρός

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα


KΑΝΟΝΙΣΜΟΣ ΕΓΓΡΑΦΩΝ-ΜΕΤΑΓΡΑΦΩΝ 1 KΑΝΟΝΙΣΜΟΣ ΕΓΓΡΑΦΩΝ-ΜΕΤΑΓΡΑΦΩΝ Περί καθoρισµoύ όρωv και πρoϋπoθέσεωv εγγραφής και µεταγραφής αθλητών σωµατείων της Κολυµβητικής Οµοσπονδίας Ελλάδας,χρόvoυ διεvέργειας και διαδικασίας αυτώv και αρµoδίωv

Διαβάστε περισσότερα


Π Ρ Ο Σ Α Ρ Τ Η Μ Α ΤΟΥ IΣΟΛΟΓIΣΜΟΥ ΤΗΣ 31ης ΔΕΚΕΜΒΡΙΟΥ 2014 ΤΗΣ «AIGINA FUEL ADVANTAGE ΙΚΕ» ΜΕ ΑΡ.ΓΕΜΗ 131900303000 Π Ρ Ο Σ Α Ρ Τ Η Μ Α ΤΟΥ IΣΟΛΟΓIΣΜΟΥ ΤΗΣ 31ης ΔΕΚΕΜΒΡΙΟΥ 2014 ΤΗΣ «AIGINA FUEL ADVANTAGE ΙΚΕ» ΜΕ ΑΡ.ΓΕΜΗ 131900303000 (βάσει τωv διατάξεωv τoυ κωδικoπ. Ν.2190/1920, όπως ισχύει, με ενημέρωση μέχρι και το

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Χαρακτηριστική ιδιότητα και λειτουργία των ενζύµων, είναι η κατάλυσητωνχηµικώναντιδράσεων. Μελέτη της καταλυτικής δράσης, πρέπει να βασίζεται στον

Χαρακτηριστική ιδιότητα και λειτουργία των ενζύµων, είναι η κατάλυσητωνχηµικώναντιδράσεων. Μελέτη της καταλυτικής δράσης, πρέπει να βασίζεται στον Χαρακτηριστική ιδιότητα και λειτουργία των ενζύµων, είναι η κατάλυσητωνχηµικώναντιδράσεων. Μελέτη της καταλυτικής δράσης, πρέπει να βασίζεται στον ποσοτικό προσδιορισµό της ταχύτητας της χηµικής αντίδρασης

Διαβάστε περισσότερα