Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΒΑΣΙΚΕΣ ΙΑΤΡΙΚΕΣ ΕΠΙΣΤΗΜΕΣ ΕΡΓΑΣΤΗΡΙΟ ΥΓΙΕΙΝΗΣ "Μοριακή ανάλυση μικροοργανισμών σε κοπρανώδη δείγματα από παχύσαρκους και νορμοβαρείς και η συσχέτισή τους με διατροφικούς δείκτες" ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Επιβλέπων Καθηγητής: κ. Βανταράκης Απόστολος Χατζηπέρη Χριστίνα Κλινική Διαιτολόγος Διατροφολόγος ΠΑΤΡΑ 2012

2 ΕΥΧΑΡΙΣΤΙΕΣ Η παρούσα μεταπτυχιακή διατριβή εκπονήθηκε στο Εργαστήριο Υγιεινής, στα πλαίσια του Προγράμματος Μεταπτυχιακών Σπουδών «Βασικές Ιατρικές Επιστήμες» και στην κατεύθυνση της Μοριακή Γενετικής Κυτταρογενετικής. Θα ήθελα να ευχαριστήσω τον επιβλέποντα καθηγητή μου, κ. Βανταράκη Απόστολο, που με δέχτηκε στο εργαστήριό του για να εκπονήσω τη μεταπτυχιακή μου διατριβή. Επίσης, με βοήθησε και με κατατόπιζε σε κάθε μου βήμα, δίνοντάς μου συμβουλές και κατευθυντήριες οδηγίες. Ακόμα, θα ήθελα να ευχαριστήσω θερμά όλους τους συντελεστές του Εργαστηρίου Υγιεινής και πιο συγκεκριμένα τον κ. Ζίρο Πάνο, τον κ. Κόκκινο Πέτρο και την δίδα Κούγια Έφη, οι οποίοι με βοήθησαν ιδιαίτερα, λύνοντας κάθε απορία μου και δίνοντάς μου ψυχολογική υποστήριξη ανεκτίμητης αξίας. Επιπλέον, θα ήθελα να ευχαριστήσω το Επιστημονικό Συμβούλιο του Γενικού Νοσοκομείου Πατρών «ο Άγιος Ανδρέας» που ενέκρινε ομόφωνα την πραγματοποίηση της μελέτης αυτής στο Διαιτολογικό Τμήμα του Νοσοκομείου, το οποίο ήταν και η πηγή της πλειοψηφίας των δειγμάτων της έρευνας. Και τέλος, ένα μεγάλο ευχαριστώ σε όλους τους συμμετέχοντες στην έρευνα αυτή που με εμπιστευτήκαν και δέχτηκαν να με βοηθήσουν. 2

3 ΠΕΡΙΛΗΨΗ Η ανθρώπινη εντερική χλωρίδα είναι ένα «ουσιώδες» όργανο, το οποίο συμβάλλει στη θρέψη, την ανοσία, την ανάπτυξη των εντερικών επιθηλιακών κυττάρων του ξενιστή, αλλά και συμμετέχει σε διάφορα μεταβολικά μονοπάτια αυτού. Επηρεάζεται από ποικίλους παράγοντες, όπως η ηλικία, ο γονότυπος του ξενιστή, το περιβάλλον, το στρες, η δίαιτα, καθώς και η πρόσληψη προβιοτικών, πρεβιοτικών, αντιβιοτικών. Η ανθρώπινη εντερική χλωρίδα αποτελείται κυρίως από δύο φύλα βακτηρίων: τα Bacteroidetes και τα Firmicutes. Τα τελευταία χρόνια πολλοί ερευνητές έχουν επικεντρώσει το ενδιαφέρον τους στη μελέτη της σχέσης που έχει η παχυσαρκία με την εντερική χλωρίδα. Τα αποτελέσματα είναι αντικρουόμενα. Συγκεκριμένα, έχει αποδειχθεί ότι σε παχύσαρκα άτομα υπάρχει χαμηλότερο ποσοστό Bacteroidetes και μεγαλύτερο Firmicutes, σε σχέση με άτομα φυσιολογικού βάρους. Στη συγκεκριμένη μελέτη ερευνήθηκε η επιρροή της παχυσαρκίας, της απώλειας βάρους, της διατροφής και της μεσογειακής δίαιτας στη σύσταση της εντερικής χλωρίδας. Η πειραματική πορεία που ακολουθήθηκε είναι η εξής: απομόνωση DNA, ηλεκτροφόρηση, φωτομέτρηση και Real Time PCR. Η παχυσαρκία και ο αυξημένος Δείκτης Μάζας Σώματος σχετίστηκε, σε στατιστικά σημαντικό βαθμό, με μειωμένα ποσοστά Bacteroides και Bifidobacterium στα κόπρανα. Ακόμα, η απώλεια βάρους σχετίστηκε με μειωμένη ποσότητα Lactobacillus. Η υιοθέτηση της Μεσογειακής Διατροφής δε φάνηκε να σχετίζεται με διαφορές στην εντερική χλωρίδα σε στατιστικά σημαντικό βαθμό. Ενώ, όσον αφορά τη διατροφική πρόσληψη, βρέθηκε η κατανάλωση φρέσκων φρούτων, μοσχαριού και αναψυκτικών να σχετίζεται αρνητικά με την ποσότητα Clostridium. Η κατανάλωση οσπρίων σχετίστηκε θετικά με την ποσότητα Bacteroides, ενώ την ποσότητα των Bifidobacterium φάνηκε να επηρεάζει αρνητικά η κατανάλωση φρέσκων φρούτων και θετικά η κατανάλωση λαχανικών. 3

4 SUMMARY Gut flora is an «essential» part of human life that contributes positive to nutrition, to immunity and to the growth of the epithelial gut cells of the host. Moreover, it sprigthfully participates at host s different metabolic paths. Gut flora is affected by various factors, such as the age, host s genotype, environment, stress, diet and intake of probiotics, prebiotics or antibiotics. The gut flora of human consists of two main bacterial genders: The Bacteroidetes and the Firmicutes. Last years, many scientists have focused their interest on researches which deal with the correlation between the obesity and the gut flora. But, there are conflicting results on these researches. In particular, it is proved that the humans who suffer from obesity have smaller percentage of Bacteroidetes and bigger percentage of Firmicutes concerning with humans with normal weight. This research tries to correlate the obesity, the weight loss, the nutrition and the Mediterranean diet with the gut flora. The research has the next experimental development: DNA isolation, electrophoresis, photometry and Real Time PCR. Obesity and increased Body Mass Index were related, in significant level, with reductions in Bacteroides and Bifidobacterium percentage in feces. Additionally, weight loss was related with decreased Lactobacillus percentage in feces. Adherence to Mediterranean Diet was not related with significant changes in gut microbiota. The consuming of fresh fruits, beef and soft drinks was, in significant level, related negatively with Clostridium levels in feces. The consuming of legumes was related positively with Bacteroides levels and, finally, Bifidobacterium levels in feces were affected negatively by fresh fruits consuming and positively by salads consuming. 4

5 ΠΙΝΑΚΑΣ ΠΕΡΙΕΧΟΜΕΝΩΝ Ι. ΘΕΩΡΗΤΙΚΟ ΜΕΡΟΣ... 8 ΚΕΦΑΛΑΙΟ 1: ΕΝΤΕΡΙΚΗ ΧΛΩΡΙΔΑ Γενικά Σύσταση εντερικής χλωρίδας Κύριες λειτουργίες Ευεργετικές λειτουργίες Επιβλαβείς λειτουργίες Αλληλεπίδραση με το ανοσοποιητικό σύστημα του ξενιστή Παράγοντες που επηρεάζουν την εντερική χλωρίδα Ηλικία Δίαιτα Προβιοτικά και πρεβιοτικά Γονότυπος του ξενιστή ΚΕΦΑΛΑΙΟ 2: ΠΑΧΥΣΑΡΚΙΑ Ορισμός Στατιστικά στοιχεία Αιτιολογία Διατροφή και άσκηση Γενετικό υπόβαθρο Άλλες αιτίες Επιπτώσεις ΚΕΦΑΛΑΙΟ 3: ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΕΝΤΕΡΙΚΗ ΧΛΩΡΙΔΑ Έρευνες σε πειραματόζωα Έρευνες σε ανθρώπους Μηχανισμοί αλληλεπίδρασης ΚΕΦΑΛΑΙΟ 4: ΔΙΑΤΡΟΦΗ ΚΑΙ ΕΝΤΕΡΙΚΗ ΧΛΩΡΙΔΑ Μεσογειακή Διατροφή Μεσογειακό Σκορ (MedDiet Score) Μεσογειακή διατροφή και εντερική χλωρίδα

6 4.4 Αλλαγή βάρους και εντερική χλωρίδα Έρευνες σχετικά με την αλληλεπίδραση της παχυσαρκίας και της δίαιτας με τη σύσταση της εντερικής χλωρίδας Σύσταση δίαιτας και εντερική χλωρίδα Προβιοτικά Πρεβιοτικά ΚΕΦΑΛΑΙΟ 5: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (Polymerase Chain Reaction PCR) Αλυσιδωτή αντίδραση πολυμεράσης (PCR) Η αρχή της μεθόδου Περιγραφή της μεθόδου Αλυσιδωτή αντίδραση πολυμεράσης πραγματικού χρόνου (Real Time PCR) Περιγραφή της μεθόδου Είδη της qpcr Ποσοτικοποίηση των αποτελεσμάτων της qpcr ΙΙ. ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ ΚΕΦΑΛΑΙΟ 6: ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΕΡΕΥΝΑΣ Σκοπός της έρευνας Επιδημιολογικά Στοιχεία Πληθυσμός Δειγματοληψία Μετρήσεις Ερωτηματολόγια Μικροοργανισμοί που μελετήθηκαν Πειραματική διαδικασία Υλικά Απομόνωση DNA Ηλεκτροφόρηση σε πήκτωμα αγαρόζης Φθοριομέτρηση Ποσοτική Real Time PCR (qpcr) ΙΙΙ. ΑΠΟΤΕΛΕΣΜΑΤΑ

7 ΚΕΦΑΛΑΙΟ 7: ΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΤΗΣ ΕΡΕΥΝΑΣ Αποτελέσματα από την πειραματική διαδικασία Επιδημιολογικά Στοιχεία Διατροφικά Στοιχεία Σύγκριση μικροοργανισμών ανά κατηγορία βάρους Στατιστική ανάλυση των αποτελεσμάτων ΣΥΖΗΤΗΣΗ ΠΑΡΑΡΤΗΜΑ Ι ΙV. ΒΙΒΛΙΟΓΡΑΦΙΑ


9 ΚΕΦΑΛΑΙΟ 1: ΕΝΤΕΡΙΚΗ ΧΛΩΡΙΔΑ 1.1 Γενικά Η ανθρώπινη εντερική μικροβιακή χλωρίδα είναι ένα ουσιώδες «όργανο», το οποίο συμβάλλει στη θρέψη και την ανάπτυξη των επιθηλιακών κυττάρων, καθώς και στη φυσική ανοσία του οργανισμού (Eckburg et al., 2005). Ο άνθρωπος γεννιέται χωρίς μικρόβια, και ως εκ τούτου οι μικροοργανισμοί που αποικίζουν τη γαστρεντερική οδό προέρχονται από το εξωτερικό περιβάλλον (Ley et al., 2006). Η μικροβιακή χλωρίδα αποτελείται από είδη μικροοργανισμών. Το πλήθος των μικροβιακών κυττάρων ανέρχεται σε ποσό δεκαπλάσιο των ευκαρυωτικών κυττάρων ολόκληρου του ανθρώπινου σώματος, ενώ τα γονίδια που φέρουν αυτά είναι 100 φορές περισσότερα από αυτά που περιέχονται σε ολόκληρο το ανθρώπινο γονιδίωμα (Gill et al., 2006). Εικόνα 1.1: Ανατομία γαστρεντερικού σωλήνα, τα κυριότερα βακτηριακά φύλα και οι συγκεντρώσεις τους (Marchesi et al., 2011) 9

10 Κατά μήκος του γαστρεντερικού σωλήνα, το στομάχι και το λεπτό έντερο φέρουν μόνο μερικά είδη βακτηρίων, από τα οποία κάποια βρίσκονται προσκολλημένα στα επιθηλιακά κύτταρα και κάποια είναι σε κίνηση. Αντίθετα, το παχύ έντερο περιέχει ένα πολύπλοκο και δυναμικό μικροβιακό σύστημα, με υψηλές συγκεντρώσεις βακτηρίων, οι οποίες ανέρχονται από έως κύτταρα ανά γραμμάριο ολικών συστατικών στο γαστρεντερικό σωλήνα. Τα βακτήρια αποτελούν την κύρια μικροβιακή χλωρίδα στο κόλον και φτάνουν έως και το 60% της ξηρής μάζας των κοπράνων (Guarner et al., 2003). 1.2 Σύσταση εντερικής χλωρίδας Εικόνα 1.2: Φυλογενετικό δένδρο στο οποίο φαίνονται τα κυριότερα φύλα και η επί τοις εκατό παρουσία τους στον ανθρώπινο εντερικό σωλήνα, σε υγιείς ενήλικες Ευρωπαίους (Diamant et al., 2011) 10

11 Από τις 70 διαιρέσεις Βακτηρίων και τις 13 διαιρέσεις Αρχαίων στο έντερο υπάρχουν κυρίως 2 φύλα βακτηρίων, τα Bacteroidetes και τα Firmicutes, τα οποία αποτελούν >99% των φυλοτύπων, καθώς και μια κατηγορία Αρχαίων, τα Methanobrevibacter smithii (Εικόνα 1.2). Το 95% των Firmicutes ανήκει στα Clostridia, ενώ τα Bacteroidetes αποτελούνται από 4 κύρια είδη: Β. thetaiotaomicron, B. vulgatis, B. distasonis, B. fragilis, τα οποία και αποτελούν το 30 % της ολικής εντερικής χλωρίδας (Gill et al., 2006). Σε μικρότερους πληθυσμούς υπάρχουν και άλλα φύλα βακτηρίων: τα Proteobacteria, Actinobacteria, Fusobacteria και Verrucomicrobia. Δεδομένου του αυστηρού αναερόβιου περιβάλλοντος που επικρατεί στο κόλον, αναερόβια γένη, όπως Bacteroides, Bifidobactrerium, Eubacterium, Clostridium, Peptococcus, Peptostreptococcus και Ruminococcus επικρατούν σε μεγάλο βαθμό, ενώ αερόβια γένη, όπως Escherichia (ανήκει στα Proteobacteria, τα οποία αντιπροσωπεύουν μόνο το 0,1% του πληθυσμού των εντερικών βακτηρίων), Enterobacter, Enterococcus, Klebsiella, Lactobacillus και Proteus απαντώνται σε μικρούς πληθυσμούς (Eckburg et al., 2005; Guarner et al., 2003). 11

12 Εικόνα 1.3: Ταξινομικός χαρακτηρισμός του φυλογενετικού πυρήνα (Tap et al., 2009) 12

13 1.3 Κύριες λειτουργίες Τα μικρόβια της εντερικής οδού επηρεάζουν την ομοιόσταση του ξενιστή. Είναι πιθανό, ανάλογα με το είδος του μικροοργανισμού ή με τις συνθήκες που επικρατούν, να προκαλέσουν είτε θετικές είτε αρνητικές επιδράσεις στο ξενιστή. Η αλληλεπίδραση του ξενιστή με τα μικρόβια του εντέρου αποφέρει σημαντικά οφέλη στην υγεία, τη θρέψη και την ανάπτυξη του ξενιστή. Η εντερική χλωρίδα διαδραματίζει σπουδαίο μεταβολικό ρόλο στη διάσπαση των άπεμπτων υδατανθράκων στο έντερο, ενώ επίσης συμβάλλει στην παραγωγή διαφόρων βιταμινών. Επηρεάζει την ανάπτυξη και τον πολλαπλασιασμό των εντερικών επιθηλιακών κυττάρων, ενώ, ακόμα έχει τη δυνατότητα να αλληλεπιδρά με το ανοσοποιητικό σύστημα του ξενιστή. Τέλος, έχει προστατευτική δράση, καθώς με διάφορους μηχανισμούς αποτρέπει ευκαιριακά μικρόβια να εισέλθουν στο εντερικό επιθήλιο και να μολύνουν τον ξενιστή (Guarner et al., 2003). Από την άλλη μεριά όμως, τα μικρόβια του εντέρου εμπλέκονται στη παθογένεση διαφόρων ασθενειών, όπως είναι η παχυσαρκία, οι φλεγμονώδεις νόσοι του εντέρου και ο αυτισμός. Ακόμα, κάποιοι μικροοργανισμοί είναι δυνητικά παθογόνα και μπορούν να αποτελέσουν αιτία μόλυνσης και φλεγμονής κάτω από συγκεκριμένες συνθήκες, για παράδειγμα όταν παραβιαστεί το φράγμα των επιθηλιακών κυττάρων του εντέρου. Τέλος, η εντερική χλωρίδα μπορεί να επηρεάσει το μεταβολισμό των φαρμάκων, τη βιοδιαθεσιμότητα ενέργειας από τη τροφή, το ανοσοποιητικό σύστημα, καθώς και τη μετεγχειρητική ανάρρωση (Kinross et al., 2011) Ευεργετικές λειτουργίες Μεταβολική λειτουργία Η κύρια μεταβολική λειτουργία της χλωρίδας στο κόλον είναι η ζύμωση υπολειμμάτων άπεπτων υδατανθράκων, καθώς και βλέννας, η οποία παράγεται από το επιθήλιο (Εικόνα 1.4). Οι άπεπτοι υδατάνθρακες είναι μεγάλου μήκους πολυσακχαρίτες, όπως κυτταρίνη, ημικυτταρίνη, πηκτίνη, άπεμπτο άμυλο, και η 13

14 διάσπαση αυτών έχει σαν αποτέλεσμα την παραγωγή μικρής αλύσου λιπαρών οξέων, βουτυρικού, προπιονικού και οξικού οξέος (Short Chain Fatty Acids SCFAs). Γενικότερα, η γονιδιακή ποικιλία στη μικροβιακή κοινότητα παρέχει διάφορα ένζυμα και μεταβολικά μονοπάτια, τα οποία είναι διαφορετικά από αυτά του ξενιστή. Αποτέλεσμα αυτών είναι η παροχή ενέργειας και απορροφήσιμων προϊόντων για τον ξενιστή, καθώς και η εξασφάλιση θρεπτικών συστατικών και ενέργειας για την ανάπτυξη και τον πολλαπλασιασμό των βακτηρίων (Sanz et al., 2008). Συγκεκριμένα, η διάσπαση των συμπλόκων άπεπτων υδατανθράκων καταλύεται από τη μεγαλύτερη αναλογία Firmicutes/ Bacteroides. Από την άλλη, διαλυτοί και λιγότερο πολύπλοκοι ολιγοσακχαρίτες διασπώνται από άλλα εντερικά μικρόβια, όπως Bacteroides και Bifidobacterium, μονοπάτι το οποίο ομοίως οδηγεί στη παραγωγή SCFAs (Εικόνα 1.4). Αν και τα βακτήρια που παράγουν βουτυρικό οξύ, έχουν συσχετισθεί με αυξημένη εντερική μεταβολική δραστηριότητα, η οποία οδηγεί σε παχυσαρκία, το βουτυρικό οξύ χρησιμοποιείται κατά κόρον από τα εντεροκύτταρα και γενικά θεωρείται μεταβολίτης υγείας. Ο κύριος ρόλος του βουτυρικού οξέος είναι να τροφοδοτεί τα εντεροκύτταρα με ενέργεια, και μπορεί να καλύψει έως και 70% των ενεργειακών τους αναγκών, συμβάλλοντας έτσι στην ανάπτυξη και τη διαφοροποίησή τους (Hamer et al., 2008). Αντίθετα, τα άλλα δύο λιπαρά οξέα, προπιονικό και οξικό οξύ, μπορούν από το έντερο και μέσω της πυλαίας κυκλοφορίας να μεταβούν στο ήπαρ. Το οξικό οξύ μπορεί να συμβάλει στο μεταβολισμό των λιπιδίων και της χοληστερόλης με την ενεργοποίηση της κυτταροπλασματικής συνθετάσης του ακέτυλο συνενζύμου Α. Ενώ, το προπιονικό πιθανό να αναστέλλει τη λιπογένεση που προκαλείται από το οξικό οξύ, όπως έχει φανεί από πειράματα σε ηπατικά κύτταρα ποντικών (Wolever et al., 1995). Μια άλλη μεταβολική λειτουργία είναι ο αναερόβιος μεταβολισμός πεπτιδίων και πρωτεϊνών, όπως ελαστίνη, κολλαγόνο και παγκρεατικά ένζυμα. Το μονοπάτι αυτό παράγει επίσης SCFAs, καθώς επίσης και τοξικές ουσίες, όπως αμμωνία, αμίνες, φαινόλες και θειόλες. 14

15 Εικόνα 1.4: Σχηματικό διάγραμμα με τα κύρια μεταβολικά μονοπάτια των διατροφικών πολύ- και ολιγο σακχαριτών και η επιρροή της εντερικής χλωρίδας (Sanz et al., 2008) Η διαθεσιμότητα των υποστρωμάτων είναι γραμμάρια υδατάνθρακες και 5-20 γραμμάρια πρωτεΐνες ημερησίως. Στο τυφλό και δεξιό κόλον, η ζύμωση είναι έντονη, με αποτέλεσμα την υψηλή παραγωγή SCFAs, το χαμηλό ph και τη γρήγορη βακτηριακή ανάπτυξη (Εικόνα 1.5). Αντίθετα, στο αριστερό και σιγμοειδές 15

16 παχύ έντερο, η διαθεσιμότητα υδατανθράκων μειώνεται, το ph είναι σχεδόν ουδέτερο και πραγματοποιείται κυρίως διάσπαση πρωτεϊνών, ενώ ο βακτηριακός πληθυσμός είναι σχεδόν στάσιμος (Guarner et al., 2003). Εικόνα 1.5: Ζύμωση στο παχύ έντερο (Guarner et al., 2003) Τέλος, τα μικρόβια στο παχύ έντερο συμβάλλουν σε σημαντικό βαθμό στη σύνθεση βιταμινών, όπως B1, B2, B6, Κ, βιοτίνης και φυλλικού οξέος, καθώς και στην απορρόφηση ιόντων, όπως ασβεστίου, μαγνησίου και σιδήρου (Scarpellini et al., 2010; O Hara et al., 2006). Επιρροή στα εντερικά επιθηλιακά κύτταρα Τα SCFAs επηρεάζουν τον πολλαπλασιασμό και τη διαφοροποίηση των εντερικών επιθηλιακών κυττάρων. Σε germ-free ποντίκια, έχει βρεθεί μειωμένη ανάπτυξη των εντερικών λάχνων σε σχέση με ποντίκια που έφεραν φυσιολογική χλωρίδα στο κόλον (Alam et al., 1994). Ακόμα, έχει αποδειχθεί in vivo αύξηση του πολλαπλασιασμού και της διαφοροποίησης των εντερικών επιθηλιακών κυττάρων 16

17 στο λεπτό και παχύ έντερο και από τα τρία κύρια SCFAs. Οι Siavoshian et al. το 2000, απέδειξαν ότι το βουτυρικό οξύ αναστέλλει in vitro τον πολλαπλασιασμό και διεγείρει τη διαφοροποίηση κυττάρων νεοπλαστικής προέλευσης, ενώ επίσης, ευνοεί τη μετατροπή κυττάρων από νεοπλαστικό σε μη νεοπλαστικό φαινότυπο. Το γεγονός αυτό υποδεικνύει ότι τα SCFAs παρεμποδίζουν παθολογικές καταστάσεις στον άνθρωπο, όπως είναι η χρόνια ελκώδης κολίτιδα και η καρκινογένεση στο κόλον, όμως χρειάζεται περισσότερη έρευνα σε αυτόν τον τομέα (Siavoshian et al., 2000). Επίδραση στο ανοσοποιητικό σύστημα του ξενιστή Επίσης, η εντερική χλωρίδα αλληλεπιδρά με τον ξενιστή, επηρεάζοντας το ανοσοποιητικό σύστημα του τελευταίου. Έρευνες έχουν δείξει ότι germ free ζώα φέρουν χαμηλές συγκεντρώσεις λεμφοκυττάρων στον εντερικό βλεννογόνο, καθώς και ανοσοσφαιρινών στο αίμα. Μετά, όμως, από αποίκιση της γαστρεντερικής οδού με μικρόβια, αυξάνεται η σύνθεση λεμφικού ιστού. Ενώ, μέσω των ενδοεπιθηλιακών λεμφοκυττάρων, αυξάνονται τα κύτταρα που παράγουν ανοσοσφαιρίνες και κατ επέκταση, αυξάνονται και οι ανοσοσφαιρίνες του ορού (Butler et al., 2000). Τέλος, η αλληλεπίδραση μεταξύ μικροβίων, επιθηλίου και λεμφικού ιστού στο έντερο επηρεάζει τους μηχανισμούς μνήμης του ανοσοποιητικού συστήματος του ξενιστή. Για παράδειγμα, σε ποντίκια με φυσιολογική χλωρίδα η «μνήμη» απέναντι σε ένα μικρόβιο και η καταστολή της συστηματικής ανοσολογικής απόκρισης διατηρείται μερικούς μήνες, ενώ σε germ free ποντίκια μόνο μερικές ημέρες (Moreau et al., 1996). Προστατευτική δράση Η εντερική χλωρίδα εμποδίζει την αποίκηση εξωγενών μικροβίων, τα οποία προσπαθούν να εισέλθουν στο εντερικό επιθήλιο. Επίσης, παρεμποδίζει το πολλαπλασιασμό ευκαιριακών βακτηρίων, τα οποία βρίσκονται στο έντερο αλλά η ανάπτυξή τους είναι περιορισμένη. Έρευνες έχουν αποδείξει ότι τα germ-free ποντίκια είναι πολύ ευάλωτα σε μολύνσεις (Taguchi et al., 2002). 17

18 Υπάρχουν διάφοροι μηχανισμοί με τους οποίους η εντερική χλωρίδα προστατεύει τον ξενιστή από παθογόνος μικροοργανισμούς. Έχει αποδειχθεί ότι τα βακτήρια ανταγωνίζονται μεταξύ τους για θέσεις πρόσδεσης στα εντερικά επιθηλιακά κύτταρα. Επομένως, εμποδίζεται η προσκόλληση και κατ επέκταση η είσοδος παθογόνων βακτηρίων μέσα στα επιθηλιακά κύτταρα. Ένας άλλος τρόπος προστασίας του ξενιστή από παθογόνα είναι ο έλεγχος της διαθεσιμότητας των θρεπτικών συστατικών. Η συμβιωτική σχέση μεταξύ βακτηρίων και ξενιστή έχει ως αποτέλεσμα ο δεύτερος να παρέχει o,τι ακριβώς χρειάζονται τα βακτήρια για την ανάπτυξή τους. Έτσι, δεν υπάρχει πλεονασμός συστατικών, τα οποία θα μπορούσαν να χρησιμοποιήσουν δυνητικά οι παθογόνοι μικροοργανισμοί. Τέλος, τα βακτήρια του εντέρου μπορούν και παράγουν αντιμικροβιακές ουσίες, τις βακτηριοκίνες. Αυτές περιορίζουν τους δυνητικά παθογόνους μικροοργανισμούς χωρίς να βλάπτουν τον ξενιστή, εφόσον ο ίδιος μπορεί να διασπάσει τις ουσίες αυτές με πρωτεάσες πέψης (O Hara et al., 2006) Επιβλαβείς λειτουργίες Καρκίνος παχέος εντέρου Η αλληλεπίδραση μεταξύ διατροφικών συστατικών και εντερικής χλωρίδας έχει αποδειχθεί ότι επηρεάζει μηχανισμούς που εμπλέκονται στην παθογένεση του καρκίνου στο κόλον (Εικόνα 1.6). Συγκεκριμένα, η αυξημένη κατανάλωση λιπαρών και κόκκινου κρέατος και η μειωμένη πρόσληψη φρούτων, λαχανικών, ολικής άλεσης προϊόντων, ψαριού και ασβεστίου επηρεάζει τη μεταβολική δραστηριότητα και τη σύσταση της χλωρίδας στο παχύ έντερο. Έτσι, τα μικρόβια του εντέρου μπορούν να εκκρίνουν καρκινογόνα, προ-καρκινογόνα και συν-καρκινογόνα. Σε υγιή άτομα, μια δίαιτα με τα παραπάνω χαρακτηριστικά αυξάνει την έκκριση στα κόπρανα ενώσεων αζώτου, οι οποίες έχουν γενοτοξική δυνατότητα και θεωρείται ότι συμβάλλουν στη δημιουργία και την προώθηση του καρκίνου στο παχύ έντερο. 18

19 Εικόνα 1.6: Η δυναμική σχέση μεταξύ εντερικής χλωρίδας, πρόσληψης και μεταβολισμού ενέργειας και συστατικών τροφίμων και τα εντερικά επιθηλιακά κύτταρα (Davis et al., 2009) Επίσης, συγκεκριμένα είδη βακτηρίων έχουν συσχετισθεί θετικά ή αρνητικά με την εμφάνιση καρκίνου στο παχύ έντερο. Τα γένη Bacteroides και Clostridium, και συγκεκριμένα τα Bacteroides vulgatus και Bacteroides stercoris, έχουν συσχετισθεί με αυξημένο κίνδυνο για καρκίνο στο παχύ έντερο (Moore et al., 1995). Αντίθετα, τα γένη Lactobacillus, Bifidobacterium, και συγκεκριμένα τα βακτήρια Lactobaccilus acidophlus, Lactobacillus S06, Bifidobacterium longum, και Eubacterium aerofaciens, έχουν συσχετισθεί με παρεμπόδιση της καρκινογένεσης και με μειωμένο κίνδυνο για καρκίνο στο παχύ έντερο (Davis et al., 2009). Μετατόπιση βακτηρίων Η δυσλειτουργία του φράγματος του εντερικού βλεννογόνου μπορεί να προκαλέσει τη μετατόπιση πολλών μικροοργανισμών, που συνήθως ανήκουν στα Gram αρνητικά αερόβια γένη (Escherichia, Proteus, Klebsiella). Μετά τη διάσχιση του φράγματος του επιθηλίου, το βακτήριο μπορεί να «ταξιδέψει» μέσω της λέμφου σε έξω εντερικά σημεία, όπως σε λεμφικούς μεσεντερικούς κόμβους, στο ήπαρ και στη σπλήνα. Διαδοχικά, τα εντερικά βακτήρια μπορούν να διασκορπισθούν στον 19

20 ξενιστή προκαλώντας σηψαιμία, πολυσυστημική οργανική ανεπάρκεια, ή ακόμα και το θάνατο του ξενιστή. Πολλή έρευνα έχει πραγματοποιηθεί γύρω από τη βακτηριακή μετατόπιση στα ζώα. Αυτή απαντάται σε αιμορραγικά σοκ, σε εγκαύματα, σε τραύματα, σε εντερικές ισχαιμίες, σε εντερικές διαταραχές, σε οξεία ηπατική ανεπάρκεια και κίρρωση. Οι τρεις κύριοι μηχανισμοί της προώθησης της βακτηριακής μετατόπισης στα ζώα είναι, η υπερανάπτυξη των βακτηρίων στο λεπτό έντερο, η αυξανόμενη διαπερατότητα της μεμβράνης του εντερικού βλεννογόνου και η ανεπάρκεια του ανοσοποιητικού συστήματος του ξενιστή (Berg et al., 1999). Φλεγμονώδεις νόσοι του εντέρου (Inflammatory Bowel Diseases, IBD) Στους ασθενείς που πάσχουν από τη νόσο Grohn, τα εντερικά T λεμφοκύτταρα είναι υπεραντιδραστικά ενάντια στα βακτηριακά αντιγόνα. Επιπρόσθετα, ασθενείς που πάσχουν από τη νόσο Grohn ή από ελκώδη κολίτιδα έχουν αυξημένη έκκριση αντισωμάτων τύπου IgG από το βλεννογόνο του εντέρου, ενάντια σε ένα ευρύ φάσμα παρασιτικών βακτηρίων. Ανοσολογικές αποκρίσεις, που προκαλούνται από τα IgG αντισώματα, σε αντίθεση με τις αντίστοιχες IgA αποκρίσεις, μπορούν να καταστρέψουν τον εντερικό βλεννογόνο, ενεργοποιώντας το συμπλήρωμα καθώς και φλεγμονώδη μόρια. Τέλος, οι ασθενείς με φλεγμονώδεις νόσους του εντέρου έχουν υψηλότερες ποσότητες βακτηρίων προσκολλημένες στην επιφάνεια του επιθηλίου σε σχέση με τους υγιείς. Αυτά τα βακτήρια προέρχονται από ποικίλα γένη και κάποια από αυτά, ειδικά τα Bacteroides, έχουν βρεθεί μεταξύ των στρωμάτων του επιθηλίου αλλά και μέσα σε κύτταρα αυτού (Macpherson et al., 1996; Guarner F et al., 2003). Η αρχή της φλεγμονής πιθανό να συσχετίζεται με μια ανισορροπία της εντερικής μικροχλωρίδας, και συγκεκριμένα με σχετική υπεροχή των «επιθετικών» βακτηρίων και μικρή συγκέντρωση των «προστατευτικών» ειδών. Αυτό οδηγεί σε μικρότερη βιοποικιλότητα των μικροβίων, παρόλα τα αυξημένα συνολικά επίπεδα εντερικών παθογόνων. Τα αποτελέσματα διαφόρων μελετών παραθέτουν ότι, αρκετοί παρασιτικοί οργανισμοί, όπως η Escherichia coli και τα γένη Bacteroides, Actinobacteria, Enterococcus και Klebsiella, σχετίζονται με την εντερική φλεγμονή, ενώ άλλα είδη, όπως Lactobacillus και Bifidobacterium, φαίνονται να είναι 20

21 προστατευτικά και προτείνονται για θεραπευτική χρήση ως προβιοτικά, συμβάλλοντας στην εντερική μικροβιακή ισορροπία του ξενιστή (Gentschew et al., 2012). Παχυσαρκία Στις μέρες μας το φαινόμενο της παχυσαρκίας έχει λάβει διαστάσεις πανδημίας. Ουσιαστικά, η παχυσαρκία από μόνη της αποτελεί νόσημα, αλλά συνδέεται και με άλλες σοβαρές ασθένειες, όπως το μεταβολικό σύνδρομο, ο σακχαρώδης διαβήτης τύπου ΙΙ, τα καρδιαγγειακά νοσήματα και ο καρκίνος. Πρόσφατα, η εντερική χλωρίδα έχει εμφανιστεί σαν ένας πιθανός παράγοντας που επηρεάζει το σωματικό βάρος, την αντίσταση στην ινσουλίνη, το μεταβολισμό της γλυκόζης και άλλους καρδιομεταβολικούς παράγοντες (Cani et al., 2007c). Επίσης, έχει παρατηρηθεί διαφορά στη σύσταση της εντερικής χλωρίδας ανάλογα με την ύπαρξη παχυσαρκίας ή όχι. Συγκεκριμένα, στη πλειοψηφία των ερευνών, σε παχύσαρκα άτομα και πειραματόζωα έχει βρεθεί αυξημένη ποσότητα Firmicutes και μειωμένη ποσότητα Bacteroidetes, σε σχέση με υγιή. Εικόνα 1.7: Σχηματική αναπαράσταση των πιθανών μηχανισμών που συνδέουν την παχυσαρκία με την εντερική χλωρίδα (Tsukumo et al., 2009) 21

22 Μεγαλύτερη ανάλυση σχετικά με την αλλαγή της σύστασης της εντερικής χλωρίδας σε συνάρτηση με την παχυσαρκία και σχετικά με μηχανισμούς που εμπλέκονται στη διαδικασία αυτή θα γίνει σε επόμενη ενότητα. Εικόνα 1.8: Ασθένειες που επηρεάζονται από την εντερική χλωρίδα (Kinross et al., 2011) Σακχαρώδης Διαβήτης Τύπου ΙΙ Σε πρόσφατη έρευνα βρέθηκε ότι στην εντερική χλωρίδα ατόμων με διαβήτη τύπου ΙΙ η ποσότητα των Firmicutes ήταν στατιστικώς σημαντικά μειωμένη σε σχέση με τους υγιείς, ενώ επίσης, η αναλογία Bacteroidetes προς Firmicutes σχετίστηκε 22

23 θετικά με τη συγκέντρωση γλυκόζης στο πλάσμα, αλλά όχι με το Δείκτη Μάζας Σώματος (ΔΜΣ), κάτι που θα ερχόταν σε αντιπαράθεση με τα παραπάνω αποτελέσματα σχετικά με την παχυσαρκία (Larsen et al., 2010). Ακόμα, ο Furet et al., 2010 απέδειξε ότι άτομα με διαβήτη τύπου ΙΙ είχαν μειωμένα επίπεδα Faecalibacterium prausnitzii (Firmicutes). Η μείωση αυτή σχετίστηκε με αυξημένους δείκτες φλεγμονής και αποτελεί ένα στοιχείο ότι πιθανώς το βακτήριο F. prausnitzii να δρα ως προβιοτικό και να μειώνει την αντίσταση στην ινσουλίνη. Τέλος, τα παραπάνω έχει επιβεβαιώσει σε έρευνά του και ο Cani et al. το 2007, ο οποίος βρήκε συσχέτιση του διαβήτη τύπου ΙΙ με gram-αρνητικά βακτήρια του εντέρου, όπως τα Bacteroidetes. Συγκεκριμένα η μείωση στα είδη Bacteroides- Prevotella spp σχετίστηκε με μειωμένους δείκτες φλεγμονής σε ποντίκια (Cani et al., 2007b). 23

24 1.4 Αλληλεπίδραση με το ανοσοποιητικό σύστημα του ξενιστή Η χρόνια ενεργοποίηση της φυσικής ανοσίας θεωρείται παράγοντας κινδύνου μιας και ευνοεί την ανάπτυξη διαβήτη τύπου 2, παχυσαρκίας και καρδιαγγειακών παθήσεων, τα οποία μπορούν επίσης να επηρεαστούν και από την εντερική χλωρίδα (Cani et al., 2007a). Επίσης, η εντερική μικροχλωρίδα σε μεγάλο βαθμό, ρυθμίζει τη μη ειδική και ειδική ανοσία. Η αναγνώριση συστατικών βακτηριακής προέλευσης μέσω των υποδοχέων PRRs (Pattern-Recognition Receptors), όπως οι TLRs (Toll- Like Receptors) των κυττάρων της φυσικής ανοσίας, θεωρείται πως αποτελεί εναρκτήριο σημείο της ανοσίας (Tsukumo et al., 2007; Greiner et al., 2011). Οι TLRs έχει βρεθεί ότι μπορούν να μεταβάλλουν τη σύσταση της εντερικής χλωρίδας. Συγκεκριμένα, σε ποντίκια έχει αποδειχθεί ότι η ανεπάρκεια του μορίου MyD88, που δρα ως αντάπτορας των TLRs, συνδέεται με τροποποιημένη εντερική χλωρίδα κι επιπρόσθετα με προστασία ενάντια στην ανάπτυξη διαβήτη τύπου 1 (Wen et al., 2008). Επίσης, πρόσφατα ευρήματα παρουσιάζουν ότι σε ποντίκια η ανεπάρκεια TLR5, οι οποίοι δίνουν σήμα μέσω του μορίου MyD88, σχετίζεται με τροποποιημένη εντερική μικροβιακή σύσταση, η οποία σχετίστηκε με παχυσαρκία, υπερφαγία και κάποια χαρακτηριστικά του μεταβολικού συνδρόμου όπως η υπερλιπιδαιμία, η υπέρταση και η αντίσταση στην ινσουλίνη (Vijay-Kumar et al., 2010). Οι λιποπολυσακχαρίτες (LPS) που προέρχονται από τα Gram αρνητικά βακτήρια στο κόλον διαδραματίζουν σημαντικό ρόλο στη χρόνια συστηματική φλεγμονή, καθώς και στην αντίσταση στην ινσουλίνη και την παχυσαρκία (Εικόνα 1.9). Συγκεκριμένα, οι LPS και τα κορεσμένα λιπαρά οξέα συνδέονται στον TLR4, ο οποίος βρίσκεται στην επιφάνεια αμυντικών και εντερικών επιθηλιακών κυττάρων, και προκαλούν την έκκριση προφλεγμοννωδών κυτταροκινών και ενεργοποιούν μονοπάτια που συνήθως εμπλέκουν το μόριο MyD88 (Myeloid differentiation primary response), τον παράγοντα NFκB (Nuclear Factor κβ) και της πρωτεΐνης AP 1 (Activator Protein 1) (Wolowczuk et al., 2008; Neal et al., 2006). Η πεπτιδογλυκάνη (Peptidoglycan PGL) και το λιποτεχοϊκό οξύ από τα Gram-θετικά 24

25 βακτήρια αναγνωρίζονται από τον TLR 2 διεγείροντας την ενεργοποίηση του μονοπατιού του MyD88. Εικόνα 1.9: Σχηματικό διάγραμμα των μονοπατιών τα οποία ενεργοποιούνται από βακτήρια και συστατικά βακτηρίων (LPS: λιποπολυσακχαρίτες, SFA: κορεσμένα λιπαρά οξέα, MyD88: Myeloid differentiation primary response, ROS: ενεργές μορφές οξυγόνου, OBR: υποδοχέας λεπτίνης, ER: ενδοπλασματικό δίκτυο, STAT: Signal Transducer and Activator of Transcription, AP-1: Activator Protein 1, PGL: πεπτιδογλυκάνη) (Sanz et al., 2008) Κάποια βακτήρια και ορισμένα προβιοτικά ίσως καταστέλλουν την ενεργοποίηση του NF κb μονοπατιού με την προώθηση της πυρηνικής εξαγωγής της υπομονάδας του NF κb σε σύμπλοκο με τον PPAR-γ, με την αναστολή της 25

26 ουβικουιτινιλίωσης και της αποδόμησης του IκB, καθώς και με την πρόκληση παραγωγής της αντιφλεγμονώδους κυττοκίνης IL10. Η λεπτίνη αλληλεπιδρά με τους υποδοχείς της (OBR), ενεργοποιώντας την πρωτεΐνη STAT (Signal Transducer and Activator of Transcription), η οποία προκαλεί την παραγωγή προφλεγμοννωδών κυτταροκινών (CCL2) και ενεργές μορφές οξυγόνου (Reactive Oxygen Species ROS), προκαλώντας στρες στο ενδοπλασματικό δίκτυο (Sanz et al., 2008). 26

27 1.5 Παράγοντες που επηρεάζουν την εντερική χλωρίδα Είναι πολλοί οι παράγοντες που επηρεάζουν την εντερική χλωρίδα (Εικόνα 1.10). Κάποιοι από αυτούς είναι οι εξής: η δίαιτα, η ηλικία, το στρες, ο γονότυπος του ξενιστή, το περιβάλλον και η έκθεση σε διάφορα μικρόβια, οι κλινικές παρεμβάσεις, όπως τα αντιβιοτικά (Dethlefsen et al., 2006), η λήψη προβιοτικών ή πρεβιοτικών, καθώς και οι χειρουργικές επεμβάσεις (Zhang et al., 2009). Οι περισσότεροι από αυτούς τους παράγοντες αναλύονται παρακάτω.3 Εικόνα 1.10: Παράγοντες που επηρεάζουν τη σύσταση και τη λειτουργία της εντερικής χλωρίδας (Cedgard L., 1998) Ηλικία Αν και η εντερική χλωρίδα των ενηλίκων έχει μελετηθεί σε μεγάλο βαθμό, λίγα έχουν ανακαλυφθεί σχετικά με τις αλλαγές που συμβαίνουν κατά την πάροδο της 27

28 ηλικίας (Εικόνα 1.11). Η χλωρίδα στο κόλον δίχρονων νεογνών μοιάζει κατά πολύ με αυτή των ενηλίκων, με τη διαφορά ότι τα υποχρεωτικά αναερόβια βακτήρια βρίσκονται σε μεγαλύτερη αναλογία στα νεογνά (Cummings et al., 1997). Εικόνα 1.11: Αλλαγές στη σύσταση της εντερική χλωρίδας με την πάροδο της ηλικίας (Hooper et al., 2004) Υπάρχουν, ωστόσο, έρευνες που υποστηρίζουν ότι τα ηλικιωμένα άτομα φέρουν μικρότερες ποσότητες bifidobacteria και μεγαλύτερες ποσότητες enterobacteria, κάτι που υποδεικνύει ότι με την πάροδο του χρόνου συμβαίνουν αλλαγές στην εντερική χλωρίδα (Hopkins et al., 2001). Τέλος, σε ηλικιωμένους ανθρώπους έχει βρεθεί μεγαλύτερη ποσότητα Clostridium difficile, όμως, κάτι τέτοιο σχετίζεται και με την αυξημένη συχνότητα νοσηλείας και χορήγησης αντιβιοτικών (Ljunberg et al., 1990). Επίσης, μια άλλη έρευνα μελέτησε στον ορό αντισώματα εναντίον μικροβίων του στόματος και του εντέρου σε άτομα τεσσάρων ηλικιακών ομάδων: πρώτη ομάδα: ετών, δεύτερη ομάδα: ετών, τρίτη ομάδα: 60 79, τέταρτη ομάδα: 80 ετών. Στατιστικά σημαντικές διαφορές σε αντισώματα του ορού παρατηρήθηκαν στις δύο μεγαλύτερες ηλικιακές ομάδες (Percival et al., 1996). 28

29 Τέλος, μια άλλη έρευνα μελέτησε την εντερική χλωρίδα 26 ατόμων, τα οποία χωρίστηκαν στις εξής τέσσερις ηλικιακές ομάδες: πρώτη ομάδα: παιδιά (16 μηνών 7 ετών), δεύτερη ομάδα: ενήλικες (21 34 ετών), τρίτη ομάδα: υγιή ηλικιωμένα άτομα (67 88 ετών), τέταρτη ομάδα: γηριατρικοί ασθενείς (68 73 ετών) με διάρροια από Clostridium difficile. Βρέθηκαν στατιστικά σημαντικές αλλαγές στη σύσταση της εντερικής χλωρίδας σε σχέση με την ηλικία, σημαντικότερες από τις οποίες είναι οι εξής: η ποσότητα των υποχρεωτικών αναερόβιων ήταν μεγαλύτερη στην ομάδα των παιδιών σε σχέση με τους ενήλικες, ενώ επίσης, με την πάροδο της ηλικίας μειωνόταν η ποσότητα των bifidobacteria. Τα αποτελέσματα αυτά είχαν αποδειχθεί και από προηγούμενες έρευνες, που αναφέρθηκαν παραπάνω. Τέλος, στην ομάδα των παιδιών, βρέθηκαν κυρίως τα βακτήρια enterobacteria, bifidobacteria και bacteroides porphyromonas prevotella, γεγονός το οποίο δείχνει η εντερική τους μικροχλωρίδα είναι λιγότερο πολύπλοκη σε σχέση με αυτή των ενηλίκων (Hopkins et al., 2001) Δίαιτα Αρκετές έρευνες έχουν μελετήσει το πώς επιδρά η απώλεια βάρους, ακολουθώντας μια υποθερμιδική δίαιτα, στην αλλαγή της σύστασης της εντερικής χλωρίδας. Σε γενικά πλαίσια, οι έρευνες δείχνουν ότι με την απώλεια βάρους η χλωρίδα των παχύσαρκων ατόμων αλλάζει και προσεγγίζει τη χλωρίδα που έχουν τα αδύνατα άτομα (Ley et al., 2006; Santacruz et al., 2009). Ωστόσο, σε κάποιες έρευνες έχουν βρεθεί και αντίθετα αποτελέσματα (Duncan et al., 2008). Μελέτες έχουν επίσης διεξαχθεί σχετικά με τη σχέση μεταξύ της διατροφής και της σύστασης της εντερικής χλωρίδας. Οι έρευνες αυτές έχουν επικεντρωθεί σε συγκεκριμένα μακροθρεπτικά συστατικά και κυριότερα στην αναλογία λίπους και υδατανθράκων που προσλαμβάνονται από τη διατροφή (Turnbaugh et al., 2008 Cani et al., 2007a; Mai et al., 2009; Duncan et al., 2007). Οι μελέτες αυτές θα αναφερθούν αναλυτικά σε επόμενη ενότητα. 29

30 1.5.3 Προβιοτικά και πρεβιοτικά Τα προβιοτικά είναι μη παθογόνοι μικροοργανισμοί, ενώ τα πρεβιοτικά είναι συστατικά τροφίμων, τα οποία δεν πέπτονται από τον ξενιστή. Και τα δύο είναι ευεργετικά για την υγεία του ξενιστή κι έχουν κινήσει το ενδιαφέρον πολλών ερευνητών. Ο τρόπος με τον οποίο τα προβιοτικά και τα πρεβιοτικά συμβάλλουν στην υγεία του ξενιστή είναι με το να μεταβάλλουν τη σύσταση της εντερικής χλωρίδας (Εικόνα 1.12). Πολλές έρευνες έχουν πραγματοποιηθεί κατά τις οποίες χορήγηση προβιοτικών ή πρεβιοτικών οδήγησαν σε αύξηση του πληθυσμού συγκεκριμένων βακτηριακών ειδών ή/ και μείωση του πληθυσμού κάποιων άλλων (DiBaise et al., 2008; Roberfroid 2007). Αναλυτική αναφορά στις μελέτες αυτές θα γίνει σε επόμενη ενότητα. Εικόνα 1.12: Επίδραση των προβιοτικών στον οργανισμό (www.healthyfellow.com) 30

31 1.5.4 Γονότυπος του ξενιστή Οι αλληλεπιδράσεις μεταξύ των μικροοργανισμών της εντερικής χλωρίδας είναι κάτι πολύ φυσικό και ουσιώδες. Σε υγιή άτομα, οι αλληλεπιδράσεις αυτές δεν καθορίζουν την αλλαγή της μικροχλωρίδας, αλλά οδηγούν σε ενεργοποίηση του ανοσοποιητικού συστήματος. Γονίδια του ξενιστή που σχετίζονται με το σύστημα ανοσίας του φέρουν ποικιλία πολυμορφισμών, γεγονός που επηρεάζει τη σύσταση της εντερικής χλωρίδας και την κάνει διαφορετική για κάθε οργανισμό (Macpherson et al., 2005). Για παράδειγμα, σε τρωκτικά έχει αποδειχθεί ότι ο γονότυπος του κυρίου συμπλόκου ιστοσυμβατότητας (Major Histocompatibility Complex MHC) επηρεάζει τα μικρόβια στα κόπρανά τους (Toivannen et al., 2001). Ο γονότυπος του ξενιστή μπορεί, επίσης, να επηρεάσει την εντερική χλωρίδα μέσω της διαθεσιμότητας των σημείων προσκόλλησης και μέσω των συστατικών που προέρχονται από τον ξενιστή. Για παράδειγμα, το βακτήριο Bacteroides thetaiotaomicron, ρυθμίζει την παραγωγή γλυκοζυλιωμένων γλυκανών από το εντερικό επιθήλιο τρωκτικών για να καλυφθούν οι ανάγκες των βακτηρίων και να πολλαπλασιαστούν. Με την προϋπόθεση ότι το ίδιο συμβαίνει και στους ανθρώπους, πιθανό τη δραστηριότητα αυτή να επηρεάζουν πολυμορφισμοί στα γονίδια των ενζύμων που εμπλέκονται στη γλυκοζυλίωση (Becker et al., 2003). Τα παραπάνω αποτελούν παραδείγματα με τα οποία ο γονότυπος του ξενιστή μπορεί να επηρεάζει τη χλωρίδα του εντέρου. 31

32 ΚΕΦΑΛΑΙΟ 2: ΠΑΧΥΣΑΡΚΙΑ 2.1 Ορισμός Η παχυσαρκία είναι μια κλινική κατάσταση κατά την οποία υπάρχει αυξημένο ολικό λίπος στο σώμα, αναλογικά με το ύψος, το φύλο, την ηλικία. Ένας δείκτης που έχει ορισθεί προκειμένου να διαγιγνώσκεται η παχυσαρκία είναι ο Δείκτης Μάζας Σώματος ΔΜΣ (ΒΜΙ: Body Mass Index), οποίος ισούται με το πηλίκο του βάρους προς το τετράγωνο του ύψους σε μέτρα. Επομένως, μονάδα μέτρησής του είναι τα Kg/ m 2. Ανάλογα με τις τιμές της διαχωρίζει τα άτομα σε ελλιποβαρή, φυσιολογικού βάρους, υπέρβαρους και παχύσαρκους (Βαθμοί Ι ΙΙΙ) (Haslam et al., 2005). Κατηγορία βάρους ΒΜΙ (Kg/ m 2 ) Ελλιποβαρής < 18,5 Φυσιολογικός 18,5 24,9 Υπέρβαρος 25,0 29,9 1ος Βαθμός Παχυσαρκίας 30,0 34,9 2ος Βαθμός Παχυσαρκίας 35,0 39,9 3ος Βαθμός Παχυσαρκίας > 40 Πίνακας 2.1: Διαχωρισμός της κατάστασης του βάρους ανάλογα με τις τιμές του Δείκτη Μάζας Σώματος 2.2 Στατιστικά στοιχεία Περισσότεροι από 60% των ενηλίκων Αμερικανών είναι υπέρβαροι ή παχύσαρκοι (WHO 2003). Στην Ελλάδα, ο επιπολασμός της παχυσαρκίας στο γενικό 32

33 πληθυσμό βρίσκεται πλέον στα υψηλότερα επίπεδα μεταξύ των χωρών της Δυτικής Ευρώπης. Στους άνδρες άνω των 15 ετών φθάνει το 26% και αποτελεί την υψηλότερη τιμή, ενώ στις γυναίκες το 18,2%, η οποία είναι η δεύτερη υψηλότερη μεταξύ των γυναικών (WHO 2008). Εικόνα 2.1: Ποσοστά παχύσαρκων (ΒΜΙ> 30) σε ενήλικες στις ΗΠΑ (Centers for Disease Control and Prevention, 2008) 2.2 Αιτιολογία Η μεταβολή του λίπους στο σώμα εξηγείται από το ενεργειακό ισοζύγιο, το οποίο αποτελείται από την ενεργειακή πρόσληψη, δηλαδή από τις θερμίδες που προσλαμβάνονται ημερησίως, και από την ενεργειακή κατανάλωση (Εικόνα 2.2). Η ενεργειακή κατανάλωση έχει να κάνει με τις βασικές ενεργειακές ανάγκες ενός οργανισμού (Βασικός Μεταβολικός Ρυθμός), καθώς και με τη φυσική δραστηριότητα που εξασκεί. 33

34 2.2.1 Διατροφή και άσκηση Όταν η ενεργειακή πρόσληψη είναι μεγαλύτερη από την ενεργειακή κατανάλωση, τότε υπάρχει περίσσεια θερμίδων οι οποίες μετατρέπονται σε λίπος στο σώμα. Αντίθετα, όταν η ενεργειακή κατανάλωση είναι μεγαλύτερη από την ενεργειακή πρόσληψη υπάρχει έλλειμμα θερμίδων, το οποίο καλύπτεται από το ήδη αποθηκευμένο λίπος στο σώμα, με αποτέλεσμα αυτό να μειώνεται (Εικόνα 2.2). Επομένως, δυο πολύ σημαντικές αιτίες για την παχυσαρκία είναι η υπερβολική κατανάλωση θερμίδων, η οποία μπορεί να προκληθεί από αυξημένη ποσότητα ή λανθασμένη ποιότητα φαγητού, καθώς και η μειωμένη φυσική δραστηριότητα, η οποία τα τελευταία χρόνια εμφανίζεται ολοένα και πιο έντονα (Caballero et al., 2007). Εικόνα 2.2: Ενεργειακό ισοζύγιο (www.synergytrainingsolutions.com) 34

35 2.2.2 Γενετικό υπόβαθρο Όπως και άλλες κλινικές καταστάσεις, έτσι και η παχυσαρκία προκαλείται από αλληλεπίδραση γενετικών και περιβαλλοντικών παραγόντων (Εικόνα 2.3). Η επιρροή του γενετικού υποβάθρου στην εμφάνιση παχυσαρκίας μπορεί να κυμαίνεται από 6% - 85% (Yang et al., 2007). Πολυμορφισμοί σε διάφορα γονίδια, μπορούν να προκαλέσουν αλλαγές στην όρεξη και το μεταβολισμό και έχουν συσχετισθεί με την παχυσαρκία, όταν το ενεργειακό ισοζύγιο παραμένει σταθερό. Μέχρι το 2006, είχαν βρεθεί περισσότεροι από 41 γενετικοί τόποι, οι οποίοι σχετίζονται με την παθοφυσιολογία της παχυσαρκίας, ακόμα και όταν οι περιβαλλοντικοί παράγοντες είναι ευνοϊκοί (Poirier et al., 2006). Εικόνα 2.3: Παράγοντες που επηρεάζουν την εμφάνιση παχυσαρκίας Άτομα με δύο αντίγραφα του γονιδίου FTO (fat mass and obesity associated gene) έχουν αυξημένο βάρος κατά 3-4 κιλά και παρουσιάζουν 1,67 φορές μεγαλύτερο κίνδυνο για εμφάνιση παχυσαρκίας, σε σχέση με αυτούς που δεν φέρουν το αλληλόμορφο (Loos et al., 2008). 35

36 2.2.3 Άλλες αιτίες Ακόμη, υπάρχουν και άλλες αιτίες οι οποίες μπορούν να οδηγήσουν στην εμφάνιση της παχυσαρκίας. Αυτές είναι ορμονικές διαταραχές, όπως διαταραχές στη λειτουργία του αδένα του θυροειδούς (υποθυρεοειδισμός) ή διαταραχές στην αυξητική ορμόνη. Τέλος, πολλά ψυχολογικά προβλήματα είναι πολύ πιθανό να συμβάλουν στη παχυσαρκία. Κάποια από αυτά είναι η κατάθλιψη και οι διαταραχές πρόσληψης τροφής, όπως η Διαταραχή Επεισοδιακής Πολυφαγίας (Binge Eating Disorder) (Haslam et al., 2005). 2.3 Επιπτώσεις Οι επιπτώσεις της παχυσαρκίας είναι ποικίλες και μπορούν να επηρεάζουν πολλά όργανα και συστήματα του ανθρώπινου σώματος (Εικόνα 2.4 και Πίνακας 2.2). Έχει αποδειχθεί ότι η παχυσαρκία, η οποία αποτελεί παράγοντα του μεταβολικού συνδρόμου, μειώνει το προσδόκιμο επιβίωσης κατά 7 χρόνια (Peeters et al., 2003). Εικόνα 2.4: Επιπτώσεις της παχυσαρκίας σε κάθε σύστημα του ανθρώπινου οργανισμού 36

37 Επίσης, έρευνες έχουν δείξει ότι η εμφάνιση καρδιαγγειακών νοσημάτων, διαβήτη, υπέρτασης και χρόνιων αναπνευστικών ασθενειών είναι μεγαλύτερη σε παχύσαρκα άτομα απ ότι σε άτομα με φυσιολογικό βάρος, σε ηλικίες κάτω των 45 ετών (Calza et al., 2008). Η παχυσαρκία, και ιδιαίτερα η κεντρικού τύπου παχυσαρκία, όπου το λίπος συσσωρεύεται στην κοιλιακή χώρα (Εικόνα 2.5), σχετίζεται με χρόνια φλεγμονή και προδιάθεση για καρκίνο. Αυτό συμβαίνει επειδή, ο ίδιος ο λιπώδης ιστός δρα σαν εκκριτικό όργανο εκκρίνοντας προφλεγμονώδεις κυττοκίνες (Ιντερλευκίνη 1 και 6, TNF-a) και πυροδοτώντας μονοπάτια που συμβάλλουν στην παθοφυσιολογία του καρκίνου (Calee et al., 2003). Ακόμα, ο λιπώδης ιστός μπορεί να προκαλέσει παρακρινή καταστολή της έκκρισης αδινονεκτίνης, μειώνοντας έτσι την αντίσταση στην ινσουλίνη και συμβάλλοντας στην εμφάνιση σακχαρώδους διαβήτη τύπου ΙΙ (Ryo et al., 2004). Πίνακας 2.2: Σημαντικότερες επιπτώσεις της παχυσαρκίας Ψυχολογικά Προβλήματα Καρδιαγγειακά Νοσήματα Νευρολογικά Νοσήματα Ενδοκρινολογικά Νοσήματα Μυοσκελετικά Προβλήματα Γαστρεντερικά Νοσήματα Αναπνευστικά Προβλήματα Χαμηλή αυτό εκτίμηση Διαταραχές πρόσληψης τροφής Κατάθλιψη Υπέρταση Δυσλιπιδαιμία Χρόνια φλεγμονή Στεφανιαία νόσος Ενδοκρανιακή υπέρταση Αντίσταση στην ινσουλίνη Διαβήτη τύπου ΙΙ Σύνδρομο πολυκυστικών ωοθηκών Οστεοαρθρίτιδα Λιπώδες ήπαρ Χολολιθίαση Άπνοια του ύπνου Άσθμα Αδυναμία φυσικής δραστηριότητας 37

38 Τέλος, το υπερβάλλον λίπος στο ανθρώπινο σώμα μπορεί να προκαλέσει στο ήπαρ μη αλκοολική ηπατοστεάτωση, κίρρωση και ηπατοκυτταρικό καρκίνωμα (Khedr et al., 2003), ενώ επίσης, θα ήταν παράλειψη να μην αναφερθούν οι ψυχολογικές επιπτώσεις που συνοδεύουν την παχυσαρκία, όπως η κατάθλιψη, το ποσοστό της οποίας έχει βρεθεί ότι αυξάνεται κατά 37% στις παχύσαρκες Αμερικανίδες γυναίκες και η χαμηλή αυτό εκτίμηση (Puhl et al., 2005). Εικόνα 2.5: Είδη παχυσαρκίας: κεντρικού (Σχήμα μήλου) και περιφερικού τύπου (Σχήμα αχλαδιού) 38

39 ΚΕΦΑΛΑΙΟ 3: ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΕΝΤΕΡΙΚΗ ΧΛΩΡΙΔΑ Τα τελευταία χρόνια έχουν γίνει μεγάλες προσπάθειες σε ερευνητικό επίπεδο προκειμένου να βρεθούν οι μηχανισμοί με τους οποίους επηρεάζει η εντερική χλωρίδα την εμφάνιση παχυσαρκίας ή ακόμα κι άλλων ασθενειών, όπως ο διαβήτης τύπου ΙΙ και το μεταβολικό σύνδρομο (Hotamisligil et al., 2006; Harris et al., 2012). 3.1 Έρευνες σε πειραματόζωα Σε έρευνες που έχουν γίνει, παρατηρήθηκε ότι τα germ-free ποντίκια έπρεπε να αυξήσουν τη θερμιδική τους πρόσληψη προκειμένου να διατηρήσουν το βάρος τους σταθερό σε σχέση με τα φυσιολογικά ποντίκια, ενώ όταν προσλάμβαναν ίδιες θερμίδες με αυτά παρουσίαζαν χαμηλότερο σωματικό λίπος. Επίσης, μετά την αποίκισή τους από μικροοργανισμούς, παρατηρήθηκε αύξηση της έκλυσης ενέργειας από την τροφή, αύξηση της ικανότητας αποθήκευσης λίπους και αύξηση κατά 60% του συνολικού σωματικού λίπους μέσα σε ημέρες (Backhed et al., 2004). Ο Ley και οι συνεργάτες του έδειξαν διαφορά στη σύσταση της εντερικής χλωρίδας μεταξύ οb/ob ποντικών και ποντικών φυσιολογικού βάρους (Eικόνα 3.1): στα οb/ob ποντίκια τα Bacteroidetes ήταν 50% λιγότερα, ενώ τα Firmicutes 50% περισσότερα (Ley et al., 2005). Εικόνα 3.1: Σύγκριση σύστασης εντερικής χλωρίδας σε παχύσαρκα και φυσιολογικού βάρους ποντίκια (Ley et al., 2005) 39

40 Όταν germ-free ποντίκια αποικήθηκαν από τη «χλωρίδα αδύνατων ποντικιών» αύξησαν λιγότερο το λίπος τους σε σχέση με άλλα που αποικήθηκαν από τη «χλωρίδα παχύσαρκων ποντικιών», ενώ στα κόπρανα των τελευταίων βρέθηκαν περισσότερα SCFAs (Turnbaugh et al., 2006). 3.2 Έρευνες σε ανθρώπους Σε αρκετές έρευνες έχει βρεθεί ότι στα παχύσαρκα άτομα υπάρχει διαφορετική σύσταση στην εντερική τους χλωρίδα συγκριτικά με φυσιολογικού βάρους άτομα, και συγκεκριμένα έχει παρατηρηθεί μειωμένος αριθμός των Bacteroidetes (Turnbaugh et l., 2009; Furet et al., 2010; Ley et al., 2006). Παρόλα αυτά υπάρχουν και αντίθετα αποτελέσματα. Συγκεκριμένα, ο Duncan και οι συνεργάτες του δεν απέδειξαν κάποια στατιστικώς σημαντική διαφορά στην εντερική χλωρίδα παχύσαρκων και νορμοβαρών, όπως ούτε και ο Mai με τους συνεργάτες του, ο οποίος δεν βρήκε συσχέτιση των Bacteroides με το Δείκτη Μάζας Σώματος (Duncan et al., 2008; Mai et al., 2008). Επίσης, ο Schwiertz και οι συνεργάτες του απέδειξαν ότι σε παχύσαρκα και υπέρβαρα άτομα υπάρχει μεγαλύτερος αριθμός Bacteroidetes, συγκριτικά με αδύνατα άτομα (Schwiertz et al., 2010). Τέλος, η σύσταση της εντερικής χλωρίδας έχει συσχετισθεί και με την απώλεια βάρους. Συγκεκριμένα, όταν παχύσαρκα άτομα μείωσαν το βάρος τους μετά από δίαιτα διάρκειας ενός χρόνου, η σύσταση της εντερικής χλωρίδας έγινε παρόμοια με αυτή των αδύνατων ατόμων. Συγκεκριμένα, αυξήθηκαν τα Bacteroidetes (από 3% σε 15%) και μειώθηκαν τα Firmicutes, και η αλλαγή αυτή σχετίστηκε με τη μείωση του βάρους και όχι με το θερμιδικό περιεχόμενο της δίαιτας (Ley et al., 2006). Ωστόσο, σε άλλες έρευνες δεν έχει βρεθεί κάποια συσχέτιση ανάμεσα στη σύσταση της εντερικής χλωρίδας και στην απώλεια βάρους (Duncan et al., 2008). Από τα παραπάνω γίνεται αντιληπτό ότι χρειάζεται περισσότερη έρευνα και μελέτη προκειμένου να υπάρξει μια ολοκληρωμένη άποψη σχετικά με τις διαφορές της εντερικής χλωρίδας και πως αυτές σχετίζονται ή όχι με την παχυσαρκία. Σε 40

41 επόμενο κεφάλαιο θα γίνει εκτενέστερη αναφορά σε σχετικές έρευνες που έχουν πραγματοποιηθεί σε ανθρώπους. 3.3 Μηχανισμοί αλληλεπίδρασης Η εντερική χλωρίδα επηρεάζει την εμφάνιση παχυσαρκίας σε τέσσερις κυρίως διαδικασίες: 1. ζύμωση διάσπαση των άπεπτων υδατανθράκων σε απορροφήσιμες μορφές 2. εντερική απορρόφηση των μονοσακχαριτών και των SCFAs και η μετατροπή τους σε λίπος στο συκώτι 3. ρύθμιση γονιδίων του ξενιστή που επηρεάζουν την εναπόθεση λίπους στα λιποκύτταρα 4. συμβολή στη φλεγμονή μέσω διαφόρων μονοπατιών που προκαλούνται από τους πολυσακχαρίτες βακτηρίων. Τα παραπάνω γίνονται από τους εξής μηχανισμούς: Όπως αναφέρθηκε και παραπάνω, η χλωρίδα στο κόλον, μέσω της σύνθεσης υδρολασών, συμβάλλει ώστε να διασπαστούν οι άπεπτοι υδατάνθρακες και να παραχθούν SCFAs (κυρίως οξικό, προπιονικό και βουτυρικό οξύ). Με αυτή τη διαδικασία αποδίδονται περισσότερες θερμίδες στον ξενιστή και συγκεκριμένα σε σαρκοφάγους οργανισμούς μπορεί να αποδίδεται περίπου 10% περισσότερη ενέργεια από την καθημερινή προσληφθείσα, ενώ σε φυτοφάγους οργανισμούς το ποσό αυτό μπορεί να φτάσει έως και το 70% (Flint et al., 2008). Τα SCFAs που παράγονται επηρεάζουν την έκφραση εντερικών ορμονών, όπως του παγκρεατικού πεπτιδίου ΡΥΥ (Peptide tyrosine tyrosine). Συγκεκριμένα, τα SCFAs συνδέονται στους υποδοχείς GPCRs (G protein coupled receptors), Gpr41 και Gpr43, εντεροενδοκρινών L κυττάρων και ενισχύουν την έκφραση ορμονών, όπως των πεπτιδίων GLP 1 (Glucagon Like Peptide 1) και PYY (Εικόνα 3.2). Οι ορμόνες αυτές μπορούν να επηρεά 41

42 Εικόνα 3.2: Πιθανοί μηχανισμοί με τους οποίους η εντερική χλωρίδα επηρεάζει τον καρδιομεταβολικό φαινότυπο του ξενιστή (SCFA: Short Chain Fatty Acids, AMPK: Adenosine Monophosphate Activated Protein Kinase, LPL: Lipoprotein Lipase, ChREBP: Hepatic Carbohydrate Responsive Element Binding Protein, SREBP 1: Sterol Response Element-Binding Protein Type 1, FIAF: Fasting Induced Adipose Factor, GLP 1: Glucagon Like Peptide-1) (Diamant et al., 2011) σουν την έκκριση ινσουλίνης και γλυκαγόνης, είτε μέσω του Αυτόνομου Νευρικού Συστήματος είτε δρώντας κατευθείαν στα παγκρεατικά νησίδια, ενώ επίσης μπορούν να επηρεάσουν την όρεξη και την πρόσληψη τροφής επιδρώντας στον εγκέφαλο (Cani et al., 2009). Έλλειψη του υποδοχέα Gpr41 σχετίστηκε με μείωση της έκφρασης του ΡΥΥ, με μειωμένη έκλυση ενέργειας από τη δίαιτα, καθώς και με ελαττωμένη ηπατική λιπογένεση (Brown et al., 2003; Samuel et al., 2008). 42

43 Οι μονοσακχαρίτες που παράγονται από τη ζύμωση, μέσω της πυλαίας κυκλοφορίας μεταφέρονται στο ήπαρ και ενεργοποιούν τις πρωτεΐνες ChREBP (Hepatic Carbohydrate Responsive Element Binding Protein) και SREBP-1 (Sterol Response Element-Binding Protein Type 1), οι οποίες μπορούν να ενεργοποιήσουν τη λιπογένεση στο ήπαρ, με τη μετανάστευσή τους από το κυτταρόπλασμα στον πυρήνα (Diamant et al., 2011). Εικόνα 3.3: Η εντερική χλωρίδα επηρεάζει μεταβολικές λειτουργίες του ξενιστή (SCFA: Short Chain Fatty Acids, AMPK: Adenosine Monophosphate-Activated Protein Kinase, LPL: Lipoprotein Lipase, FIAF: Fasting Induced Adipose Factor, GLP 2: Glucagon Like Peptide 2) (Tilg H et al., 2011) Τα βακτήρια μειώνουν την εντερική έκφραση του παράγοντα FIAF (Fasting Induced Adipose Factor), αναστολέα της λιποπρωτεϊνικής λιπάσης (Lipoprotein Lipase LPL), με αποτέλεσμα να ελευθερώνονται λιπαρά οξέα από τα χυλομικρά και την VLDL και να αποθηκεύονται ως τριγλυκερίδια στο λιπώδη ιστό. Έρευνες σε germ free Fiaf -/- ποντίκια έχουν επιβεβαιώσει ότι 43

44 ο Fiaf είναι ένας πολύ σημαντικός παράγοντας ρύθμισης της αποθήκευσης λίπους, επηρεαζόμενος από τα μικρόβια του εντέρου. Συγκεκριμένα, έχει βρεθεί ότι στα ποντίκια αυτά τα αυξημένα επίπεδα Fiaf οδηγούν σε παραγωγή PPARγ (Peroxisome Proliferator activated receptor gamma), μεταγραφικός παράγοντας που οδηγεί σε αυξημένη έκφραση γονιδίων που ρυθμίζουν τη μιτοχονδριακή οξείδωση λιπαρών οξέων (Backhed et al., 2004). Τα βακτήρια μειώνουν την ενεργοποίηση του ενζύμου AMPK (Adenosine Monophosphate Activated Protein Kinase), το οποίο συναντάται στους μυς και στο ήπαρ (Εικόνα 3.3). Αυτό έχει ως αποτέλεσμα τη μείωση της β οξείδωσης των λιπαρών οξέων (Backhed et al., 2007). Εικόνα 3.4: Πιθανοί μηχανισμοί σύνδεσης της εντερικής χλωρίδας με την παχυσαρκία (LPL: Lipoprotein Lipase, FIAF: Fasting Induced Adipose Factor, LPS: Lipopolysaccharide) (Tsumuko et al., 2009) 44

45 Οι λιποπολυσακχαρίτες (LPS) που προέρχονται από τα Gram αρνητικά βακτήρια στο κόλον διαδραματίζουν σημαντικό ρόλο στη χρόνια συστηματική φλεγμονή, καθώς και στην αντίσταση στην ινσουλίνη και την παχυσαρκία. Έρευνα έδειξε ότι όταν ποντίκια ακολούθησαν δίαιτα υψηλή σε λίπος αύξησαν την αναλογία Gram-αρνητικά/ Gram θετικά, σε συνδυασμό με αυξημένα επίπεδα LPS στο πλάσμα, αυξημένο βάρος, λίπος, διαβήτη και προφλεγμονώδεις δείκτες (Cani et al., 2007a). Όπως γίνεται αντιληπτό οι μηχανισμοί με τους οποίους η εντερική χλωρίδα συμβάλλει στην παθογένεση της παχυσαρκίας είναι ποικίλοι. Έχει γίνει μεγάλη ερευνητική προσπάθεια να γίνουν κατανοητά όλα τα μονοπάτια που εμπλέκονται σε αυτή. Παρόλα αυτά, περισσότερη μελέτη χρειάζεται προκειμένου να διαλευκανθούν όλοι οι παράγοντες και τα μόρια που εμπλέκονται στη διαδικασία αυτή. 45

46 ΚΕΦΑΛΑΙΟ 4: ΔΙΑΤΡΟΦΗ ΚΑΙ ΕΝΤΕΡΙΚΗ ΧΛΩΡΙΔΑ 4.1 Μεσογειακή Διατροφή Η παραδοσιακή Μεσογειακή Διατροφή (ΜΔ) χαρακτηρίζεται από αυξημένη πρόσληψη λαχανικών, οσπρίων, φρούτων, ξηρών καρπών και δημητριακών (στο παρελθόν ήταν κυρίως μη επεξεργασμένα) και από μία αυξημένη πρόσληψη ελαιολάδου (Εικόνα 4.1). Χαμηλή είναι η πρόσληψη κρέατος, μέτρια η κατανάλωση ψαριών και πουλερικών και χαμηλή έως μέτρια η πρόσληψη γαλακτοκομικών προϊόντων. Τακτική αλλά μέτρια είναι και η κατανάλωση αιθανόλης, κυρίως με τη μορφή κρασιού και συνήθως κατά τη διάρκεια των γευμάτων (Ζαμπέλας Α, 2007; Kok FJ et al., 2004). Οι ευεργετικές επιδράσεις της ΜΔ έχουν αποτελέσει αντικείμενο έρευνας για πάρα πολλά χρόνια. Το ενδιαφέρον έχει περισσότερο εστιαστεί στην επίδραση της Μεσογειακής διατροφής στο λιπιδαιμικό προφίλ καθώς και στη στεφανιαία νόσο. Τα αποτελέσματα είναι ιδιαίτερα ενθαρρυντικά κι έτσι η Μεσογειακή διατροφή κατέχει τον τίτλο της καρδιοπροστατευτικής δίαιτας (Ζαμπέλας Α, 2007; Stampfer MJ et al., 2000; Trichopoulou A et al., 2003). Εικόνα 4.1: Η πυραμίδα της Μεσογειακή Διατροφής (www.usda.gov) 46

47 4.2 Μεσογειακό Σκορ (MedDiet Score) Η αξιολόγηση της συμμόρφωσης των συμμετεχόντων στο πρότυπο της ΜΔ έγινε με τη χρήση σκορ που αναπτύχθηκε από τους Panagiotakos et al., Σύμφωνα με τις μεσογειακές διαιτητικές συνήθειες, το σκορ συμπεριλαμβάνει την εβδομαδιαία κατανάλωση των ακόλουθων 9 ομάδων τροφίμων: μη επεξεργασμένα δημητριακά (ολικής αλέσεως ψωμί και ζυμαρικά, καστανό ρύζι, κτλ), φρούτα, λαχανικά, όσπρια, πατάτες, ψάρια, κρέας και προϊόντα κρέατος, πουλερικά, πλήρη γαλακτοκομικά προϊόντα (τυρί, γιαούρτι, γάλα), ελαιόλαδο και αλκοόλ Έπειτα, με βάση την προτεινόμενη πρόσληψη χρησιμοποιήθηκαν από τους ερευνητές μονοτονικές συναρτήσεις (εκτός από το αλκοόλ) έτσι ώστε να μπορεί να αξιολογηθεί η συχνότητα κατανάλωσης αυτών των τροφίμων. Συγκεκριμένα, για κάθε ομάδα τροφίμων δίνεται ένας βαθμός (από 0 έως 5 ή αντίστροφα) σύμφωνα με τη θέση τους στη μεσογειακή διατροφική πυραμίδα. Για την κατανάλωση τροφίμων που θεωρούνται «κοντά» στο μεσογειακό πρότυπο (π.χ. αυτά που συστήνονται καθημερινά ή σε ποσότητες μεγαλύτερες των τριών μερίδων την εβδομάδα) δίνεται σκορ μεταξύ 1 και 5 για σπάνια έως καθημερινή κατανάλωση, ενώ 0 για απουσία κατανάλωσης. Οι πατάτες, αν και δεν βρίσκονται στη βάση της πυραμίδας, συμπεριλήφθηκαν σε αυτή την ομάδα τροφίμων, καθώς αποτελούν καλή πηγή βιταμινών C, B1, B2, νιασίνης, υδατανθράκων, ινών, καλίου και μαγνησίου, συστατικά τα οποία έχουν συσχετιστεί με καρδιαγγειακούς δείκτες κινδύνου. Παρόλα αυτά πρέπει να λαμβάνεται υπόψη ότι η κατανάλωση πατάτας έχει συσχετιστεί με το σακχαρώδη διαβήτη λόγω του υψηλού γλυκαιμικού της δείκτη. Από την άλλη, για την κατανάλωση φαγητών που θεωρούνται «μακριά» από τα πρότυπα της ΜΔ (σπάνια ή μηνιαία κατανάλωση, π.χ. κόκκινο κρέας) τα σκορ δίνονται με αντίστροφη διαβάθμιση (από 5 όταν αναφέρεται μηδενική κατανάλωση έως 0 όταν η κατανάλωση είναι καθημερινή). Ειδικά για το αλκοόλ, δεν χρησιμοποιήθηκε μονοτονική συνάρτηση, αλλά αποδίδεται το σκορ 5 για κατανάλωση μικρότερη των 300 ml ανά ημέρα, σκορ 0 για μηδενική κατανάλωση ή μεγαλύτερη των 700ml ανά ημέρα, και σκορ από 4 έως 1 για κατανάλωση , , και ml ανά ημέρα. Έτσι το σκορ έχει εύρος από 0 έως 47

48 55. Υψηλότερες τιμές του σκορ υποδεικνύουν μεγαλύτερη συμμόρφωση στο μεσογειακό πρότυπο (Panagiotakos et al., 2007). Το Μεσογειακό Διατροφικό Σκορ βρίσκεται στο Παράρτημα Ι. 4.3 Μεσογειακή διατροφή και εντερική χλωρίδα Λίγες έρευνες έχουν πραγματοποιηθεί σχετικά με την επίδραση της ΜΔ στη σύσταση της εντερικής χλωρίδας, με αποτέλεσμα να μην υπάρχουν ξεκάθαρα αποτελέσματα. Οι Michalsen et al. μελέτησαν την επίδραση της ΜΔ και της νηστείας στη σύσταση της εντερικής χλωρίδας σε ασθενείς με ρευματοειδή αρθρίτιδα και ινομυαλγία. Τα άτομα της έρευνας χωρίστηκαν σε δύο ομάδες: η μια ακολούθησε τη ΜΔ για 2 μήνες και η άλλη ακολούθησε νηστεία (πολύ χαμηλή σε θερμίδες δίαιτα, της τάξης των 300 kcal ημερησίως) για 8 ημέρες. Δείγματα κοπράνων συλλέχθηκαν στην αρχή και στο τέλος της παρέμβασης και έγινε ποσοτικοποίηση των μικροοργανισμών. Καμία στατιστικά σημαντική αλλαγή δε βρέθηκε να έχει προκληθεί μετά την παρέμβαση σε καμία από τις δύο ομάδες διαιτών και σε καμία από τις δύο ομάδες ασθενών (Michalsen et al., 2005). Η ίδια σχεδόν ερευνητική ομάδα με το ίδιο δείγμα και πρωτόκολλο προσπάθησε να μελετήσει τις μεταβολές που προκαλούν οι παραπάνω δύο δίαιτες στην ενζυμική δραστηριότητα και το μεταβολισμό των βακτηρίων. Οι μεταβολές αυτές μπορούν να ανιχνευθούν μετρώντας τις αλλαγές στη ποσότητα και την αναλογία των SCFAs στα κόπρανα (Peltonen et al., 1992). Δεν βρέθηκε καμία στατιστικά σημαντική διαφορά στο βουτυρικό και προπιονικό οξύ μεταξύ των δύο ομάδων διαιτών. Όμως, βρέθηκε στατιστικά σημαντική αύξηση του οξικού οξέος στην ομάδα που ακολούθησε τη νηστεία. Παρ όλα αυτά περισσότερη έρευνα απαιτείται προκειμένου να βρεθεί κάποια ισχυρή σχέση μεταξύ ΜΔ και εντερικής χλωρίδας (Abendroth et al., 2010). Τέλος, έρευνα έχει πραγματοποιηθεί μελετώντας την in vitro ζύμωση φυτικών ινών και διαφορές σε αυτή ανάλογα με τη δίαιτα από την οποία προέρχονται οι 48

49 φυτικές ίνες: Μεσογειακού τύπου (Ισπανία) ή Σκανδιναβικού τύπου (Δανία). Συγκεκριμένα, από τις δύο αυτές δίαιτες απομονώθηκαν οι ολικές φυτικές ίνες, οι φυτικές ίνες που προέρχονταν από δημητριακά και αυτές που προέρχονταν από φρούτα και λαχανικά. Η ΜΔ, και συγκεκριμένα οι ολικές φυτικές ίνες της, σχετίστηκε με υψηλότερες συγκεντρώσεις βουτυρικού οξέος στα κόπρανα, ενώ η Σκανδιναβική δίαιτα σχετίστηκε με υψηλότερες συγκεντρώσεις προπιονικού οξέος (Tabernero et al., 2011). Όπως γίνεται αντιληπτό η ερευνητική δραστηριότητα για το θέμα της επίδρασης της ΜΔ στην εντερική χλωρίδα είναι πολύ μικρή, ενώ τα αποτελέσματα που έχουν βρεθεί δεν είναι ιδιαίτερα ενθαρρυντικά. Επομένως, περισσότερη μελέτη χρειάζεται σε αυτόν τον τομέα προκειμένου να βρεθεί μια ξεκάθαρη συσχέτιση, στατιστικά σημαντική. 4.4 Αλλαγή βάρους και εντερική χλωρίδα Αρκετές έρευνες έχουν μελετήσει το πώς επιδρά η απώλεια βάρους, ακολουθώντας μια υποθερμιδική δίαιτα, στην αλλαγή της σύστασης της εντερικής χλωρίδας. Σε γενικά πλαίσια, οι έρευνες δείχνουν ότι με την απώλεια βάρους η χλωρίδα των παχύσαρκων ατόμων αλλάζει και προσεγγίζει τη χλωρίδα που έχουν τα αδύνατα άτομα. Ωστόσο, σε κάποιες έρευνες έχουν βρεθεί και αντίθετα αποτελέσματα. Ο Ley και οι συνεργάτες του το 2006 μελέτησαν την επίδραση στη σύσταση της εντερικής χλωρίδας, μιας χαμηλής σε λίπος και μιας χαμηλής σε υδατάνθρακες υποθερμιδικής δίαιτας. Αρχικά, όπως αναφέρθηκε και παραπάνω, είχε βρεθεί ότι τα παχύσαρκα άτομα είχαν χαμηλότερα ποσά Bacteroidetes και περισσότερα Firmicutes, σε σχέση με τα αδύνατα άτομα. Αργότερα, καθώς σημειωνόταν απώλεια βάρους, και στις δύο ομάδες διαιτών, παρατηρήθηκε αύξηση των Bacteroidetes (Ley et al., 2006). Σε μια άλλη έρευνα μελετήθηκαν έφηβοι, οι οποίοι ακολούθησαν μια υποθερμιδική δίαιτα και ταυτόχρονα αύξησαν τη φυσική τους δραστηριότητα για 10 εβδομάδες. Σε όλους τους έφηβους μετά την παρέμβαση παρατηρήθηκε αύξηση του 49

50 Bacteroides fragilis και των Lactobacillus, καθώς και μείωση του Clostridium coccoides, Bifidobacterium longum και Bifidobacterium adolescentis (Santacruz et al., 2009). Αντίθετα, ο Duncan και οι συνεργάτες του δεν παρατήρησαν στατιστικά σημαντικές αλλαγές στην αναλογία Bacteroidetes στα κόπρανα παχύσαρκων ατόμων, τα οποία ακολούθησαν για 4 εβδομάδες υποθερμιδική και χαμηλή σε υδατάνθρακες δίαιτα. Όμως, στην ομάδα αυτή παρατηρήθηκε στατιστικά σημαντική μείωση, εξαρτώμενη από τη δίαιτα, στην αναλογία των Firmicutes μετά από την απώλεια βάρους (Duncan et al., 2008). Έρευνες έχουν γίνει και σε άτομα τα οποία βρίσκονταν στο επίπεδο της νοσογόνου παχυσαρκίας και υπέστησαν γαστρικό bypass. Έρευνα έδειξε ότι τα Firmicutes ήταν σε μεγαλύτερη αφθονία στους αδύνατους συμμετέχοντες και σε μικρότερη μετά από γαστρικό bypass. Σημαντικό είναι να αναφερθεί ότι συνολικά, η εντερική χλωρίδα των ατόμων με γαστρικό bypass έχει περισσότερες ομοιότητες με αυτή των παχύσαρκων παρά με αυτή των αδύνατων ατόμων (Zhang et al., 2009). Οι Furet et al. μελέτησε 30 παχύσαρκους πριν, 3 μήνες και 6 μήνες μετά από γαστρικό by-pass. Απέδειξε ότι τα βακτήρια Bacteroides/ Prevotella και Escherichia coli σχετίστηκαν αρνητικά με την παχυσαρκία, ενώ τα βακτήρια Lactobacillus, Leuconostoc, Pediococcus και Bifidobacterium μειώθηκαν 3 μήνες μετά από το γαστρικό by pass (Furet et al., 2010). 4.5 Έρευνες σχετικά με την αλληλεπίδραση της παχυσαρκίας και της δίαιτας με τη σύσταση της εντερικής χλωρίδας Στον πίνακα 4.1 φαίνονται αναλυτικά οι έρευνες που έχουν μελετήσει τη σχέση παχυσαρκίας ή/ και δίαιτας με τη σύσταση της εντερικής χλωρίδας σε διάφορους πληθυσμούς. Πίνακας 4.1: Έρευνες σχετικά με την αλληλεπίδραση της παχυσαρκίας και της δίαιτας με τη σύσταση της εντερικής χλωρίδας 50

51 ΕΡΕΥΝΗΤΕΣ ΣΥΜΜΕΤΕΧΟΝΤΕΣ ΜΕΘΟΔΟΣ ΑΠΟΤΕΛΕΣΜΑΤΑ Ley et al., παχύσαρκοι συμμετείχαν σε 2 διαφορετικές δίαιτες, υδατανθράκων ή χαμηλού λίπους, για 1 χρόνο, 2 controls 16S rrna έρευνες με Sanger sequencing (κόπρανα) Η αναλογία των Bacteroidetes αυξανόταν με την απώλεια βάρους. Καμία διαφορά μεταξύ των δύο διαίτων. Turnbaugh et 154 συμμετέχοντες, 16S με την Μειωμένη ποικιλία και μειωμένα επίπεδα al., 2009b μονοζυγωτικά και ακολουθία των Bacteroidetes στους παχύσαρκους διζυγωτικά δίδυμα και Sanger και 454 συμμετέχοντες. οι μητέρες τους, pyrosequencing, Καμία στατιστικά σημαντική διαφορά σε παχύσαρκοι ή αδύνατοι metagenomics Firmicutes. (κόπρανα) Το γονιδίωμα των παχύσαρκων συμμετεχόντων είναι εμπλουτισμένο με γονίδια που ρυθμίζουν την έκλυση ενέργειας. Duncan et al., Συμμετέχοντες που FISH Καμία διαφορά στα επίπεδα Bacteroidetes 2008 ακολουθούσαν δίαιτα (κόπρανα) και Firmicutes μεταξύ των ομάδων. απώλειας βάρους Καμία διαφορά στα επίπεδα Bacteroidetes για>4 εβδομάδες, και κατά την απώλεια βάρους. άτομα που Η απώλεια βάρους σχετίστηκε με μειωμένα ακολουθούσαν επίπεδα Firmicutes. διατροφή συντήρησης Aυξημένα επίπεδα Clostridium spp., του βάρους τους συσχετίστηκαν και με τη μειωμένη πρόσληψη υδατανθράκων. 51

52 ΕΡΕΥΝΗΤΕΣ ΣΥΜΜΕΤΕΧΟΝΤΕΣ ΜΕΘΟΔΟΣ ΑΠΟΤΕΛΕΣΜΑΤΑ Sotos et al., 8 παχύσαρκοι και FISH Τα enterobacteriaceae και τα sulfate 2008 υπέρβαροι έφηβοι, (κόπρανα) reducing βακτήρια μειώνονται σε ομάδες με μείωση βάρους μεγαλύτερη απώλεια βάρους. Μειωμένα επίπεδα Roseburia Eubacterium στα άτομα με μικρότερη απώλεια βάρους. Schwiertz et 30 αδύνατοι, 35 qpcr για Περισσότερα Bacteroidetes στους al., 2010 υπέρβαροι και 33 Bacteroidetes, υπέρβαρους και παχύσαρκους έναντι των παχύσαρκοι Actinobacteria, αδύνατων συμμετεχόντων και περισσότερα συμμετέχοντες Archaea Bifidobacterium και Methanobrevibacter (κόπρανα) στους αδύνατους συμμετέχοντες (αρνητική συσχέτιση με BMI). Kallionaki et Παχύσαρκα & qrt-pcr και Τα παιδιά που παρέμεναν αδύνατα στην al., 2008 υπέρβαρα παιδιά FISH/ ηλικία των 7 είχαν υψηλότερα επίπεδα (n=25) και νορμοβαρή κυτταρομετρία Bifidobacteria και χαμηλότερα επίπεδα S. παιδιά (n=24), ροής (κόπρανα) Aureus, σαν βρέφη. προοπτική μελέτη Collado et al., Γυναίκες πριν και κατά FISH/ Υψηλότερα επίπεδα Bacteroidetes και S τη διάρκεια της κυτταρομετρία aureus σε υπέρβαρους, θετικός συσχετισμός εγκυμοσύνης, 18 ροής και qpcr μεταξύ επιπέδων Bacteroidetes και βάρους υπέρβαρες και 36 (κόπρανα) που προσλήφθηκε κατά την περίοδο της controls εγκυμοσύνης. 52

53 ΕΡΕΥΝΗΤΕΣ ΣΥΜΜΕΤΕΧΟΝΤΕΣ ΜΕΘΟΔΟΣ ΑΠΟΤΕΛΕΣΜΑΤΑ Santacruz et 36 έφηβοι σε δίαιτα qpcr Η ποσότητα του Bacteroides fragilis al., 2009 και φυσική (κόπρανα) συσχετίζεται με την πρόσληψη δραστηριότητα για 10 υδατανθράκων. εβδομάδες Τα επίπεδα του Bacteroides και του Lactobacillus αυξάνονται με την απώλεια βάρους. Nadal et al., 39 έφηβοι σε δίαιτα qpcr Το Clostridium histolyticum και το 2009 και φυσική (κόπρανα) E.rectacle C.coccoides μειώνονται με την δραστηριότητα για 10 αύξηση του βάρους. εβδομάδες Αύξηση σε Bacteroides Prevotella στην ομάδα με μεγάλη απώλεια βάρους. Sabate et al., 137 παχύσαρκοι Τεστ αναπνοής Βακτηριακή υπερανάπτυξη στο λεπτό 2008 ασθενείς, 40 υγιείς γλυκόζης- έντερο παρατηρήθηκε πιο πολύ σε φυσιολογικού βάρους υδρογόνου (για παχύσαρκους παρά σε αδύνατους Η2) και βιοψία συμμετέχοντες. ήπατος Mai et al., 46 Καυκάσιοι Real Time Η πρόσληψη φυτικών ινών και 2009 Αμερικάνοι και 52 PCR για την πολυακόρεστων λιπαρών οξέων σχετίστηκε Αφρικανοί Αμερικάνοι ακολουθία του θετικά με την ποσότητα Lactobacillus. μετρήθηκαν στα 16S rrna και Η αυξημένη πρόσληψη λίπους σχετίστηκε κόπρανα τα μικρόβια FISH με μειωμένη ποσόητα Clostridium. και εκτιμήθηκαν οι (κόπρανα) Το ΒΜΙ δε συσχετίστηκε με την αναλογία διατροφικές συνήθειες των Bacteroides. 53

54 ΕΡΕΥΝΗΤΕΣ ΣΥΜΜΕΤΕΧΟΝΤΕΣ ΜΕΘΟΔΟΣ ΑΠΟΤΕΛΕΣΜΑΤΑ Zhang et al., 3 αδύνατοι, 3 Sanger και 454 Τα Firmicutes σε μεγαλύτερη αφθονία 2009 παχύσαρκοι και 3 μετά ακολουθία του στους αδύνατους συμμετέχοντες, μικρότερη από γαστρικό bypass 16S rrna, μετά από γαστρικό bypass. qpcr Τα GammaProteobacteria, Verrucomicrobia (κόπρανα) αυξήθηκαν μετά από το bypass. Περισσότερα Archaea σε παχύσαρκους. Συνολικά, η εντερική χλωρίδα των ατόμων με γαστρικό bypass έχει περισσότερες ομοιότητες με αυτή των παχύσαρκων παρά με αυτή των αδύνατων ατόμων. Furet et al., 13 φυσιολογικού Real Time Η ομάδα Bacteroides/ Prevotella σχετίστηκε 2010 βάρους άτομα και 30 PCR (κόπρανα) αρνητικά με την παχυσαρκία, και η σχέση παχύσαρκοι (οι 7 με αυτή είχε εξάρτηση από την υψηλή διαβήτη τύπου ΙΙ), πρόσληψη θερμίδων. έγινε εξέταση Η Escherichia coli αυξήθηκε 3 μήνες μετά κοπράνων πριν, 3 και σχετίστηκε αντίστροφα με τη λιπώδη μήνες και 6 μήνες μετά μάζα και τα επίπεδα λεπτίνης, ανεξάρτητα από γαστρικό by-pass από τη διατροφική πρόσληψη. Τα βακτήρια που παράγουν γαλακτικό οξύ (Lactobacillus, Leuconostoc, Pediococcus, Bifidobacterium) μειώθηκαν στους 3 μήνες. Τα είδη Faecalibacterium prausnitzii ήταν λιγότερα στα άτομα με διαβήτη και σχετίστηκαν αρνητικά με δείκτες φλεγμονής, ανεξάρτητα από τη διατροφική πρόσληψη. 54

55 Παρακάτω αναφέρονται αναλυτικά τα κυριότερα βακτήρια, τα οποία μελετήθηκαν και στην έρευνά μας, καθώς και σχετικές μελέτες: PROTEOBACTERIA Enterobacter Τα βακτήρια αυτά είναι Gram-αρνητικά και περιλαμβάνουν πολλά παθογόνα βακτήρια, όπως η Escherichia coli. Οι Sotos et al. μελέτησαν 8 υπέρβαρα και παχύσαρκα άτομα, στα οποία προκάλεσαν απώλεια βάρους με υποθερμιδική δίαιτα. Στην ομάδα με τη μεγαλύτερη απώλεια βάρους παρατηρήθηκε μείωση των Enterobacteriaceae (Sotos et al., 2008). FIRMICUTES Η ποσότητα των Firmicutes μειώθηκε στατιστικά σημαντικά σε άτομα μετά από γαστρικό by-pass, σε σχέση με αδύνατα και παχύσαρκα άτομα που δεν υπέστησαν χειρουργείο (Zhang et al., 2009). Clostridium Είναι Gram-θετικά βακτήρια, υποχρεωτικά αναερόβια και ανήκουν στην οικογένεια των Clostridiaceae. Έρευνα των Santacruz et al. μελέτησε την επιρροή της δίαιτας και της άσκησης σε εφήβους και απέδειξε ότι η μείωση του βάρους σχετίζεται με μείωση στην ποσότητα των Clostridium coccoides (Santacruz et al., 2009). Ακόμα, η αναλογία των Clostridium σχετίστηκε και με μειωμένη πρόσληψη υδατανθράκων (Duncan et al., 2008). Lactobacillus Είναι Gram-θετικά βακτήρια και ανήκουν στην οικογένεια των Lactobacillaceae και στο φύλο των Firmicutes. Σε έρευνα που πραγματοποιήθηκε σε 36 εφήβους, στους οποίους εφαρμόστηκε δίαιτα και άσκηση για δέκα εβδομάδες, παρατηρήθηκε αύξηση της ποσότητας των Lactobacillus, η οποία σχετίστηκε στατιστικώς σημαντικά με τη μείωση του βάρους (Santacruz et al., 2009). 55

56 BACTEROIDETES Οι Ley et al. εφάρμοσαν δύο διαφορετικές υποθερμιδικές δίαιτες σε 12 παχύσαρκα άτομα για ένα χρόνο και βρήκαν ότι αυξήθηκε η αναλογία των Bacteroidetes με την απώλεια βάρους. Δε βρέθηκε συσχέτιση εντερικής χλωρίδας και δίαιτας (Ley et al., 2005). Οι Turnbaugh et al. μελέτησαν 154 άτομα, μονοζυγωτικά, διζυγωτικά δίδυμα και τις μητέρες τους και βρήκαν μειωμένα επίπεδα Bacteroidetes στα παχύσαρκα άτομα (Turnbaugh et al., 2009). Οι Schwiertz et al. μελέτησαν 30 αδύνατα, 35 υπέρβαρα και 33 παχύσαρκα άτομα και βρήκαν διαφορετικά αποτελέσματα από τα παραπάνω. Δηλαδή, μεγαλύτερη αναλογία Bacteroidetes στα υπέρβαρα και παχύσαρκα άτομα σε σχέση με τα νορμοβαρή (Schwiertz et al., 2010). Οι Duncan et al. εφάρμοσαν δίαιτα σε παχύσαρκα άτομα για 8 εβδομάδες και σύγκριναν τα αποτελέσματα από τη μέτρηση κοπράνων με μετρήσεις από παχύσαρκα άτομα που διατηρούσαν το βάρος τους καθώς και από αδύνατα άτομα. Ωστόσο, δεν βρήκαν συσχέτιση των Bacteroidetes με την παχυσαρκία, αλλά και ούτε με την απώλεια βάρους (Duncan et al., 2008). Σε έρευνα που πραγματοποιήθηκε σε έγκυες γυναίκες βρέθηκε ότι η αναλογία των Bacteroidetes ήταν μεγαλύτερη σε γυναίκες που ήταν υπέρβαρες πριν μείνουν έγκυες, ενώ επίσης, η ποσότητά τους συσχετίστηκε θετικά με την αύξηση βάρους κατά την εγκυμοσύνη (Collado et al., 2008). Bacteroides Τα Bacteroides είναι Gram-αρνητικοί βάκιλοι, οι οποίοι ανήκουν στην ευρύτερη οικογένεια των Bacteroidaceae και στο φύλο των Bacteroidetes. Η ποσότητα των Bacteroides σχετίστηκε σε άλλη έρευνα με την απώλεια βάρους και το βακτήριο Bacteroides fragilis σχετίστηκε με την κατανάλωση υδατανθράκων (Santacruz et al., 2009). Τέλος, όταν σε 39 έφηβους, οι οποίοι ακολούθησαν άσκηση και δίαιτα για δέκα εβδομάδες, μετρήθηκε η εντερική χλωρίδα βρέθηκε αυξημένη ποσότητα Bacteroides στην ομάδα που είχε χάσει το περισσότερο βάρος (Nadal et al., 2009). 56

57 4.6 Σύσταση δίαιτας και εντερική χλωρίδα Η μελέτη της σχέσης μεταξύ της διατροφής και της σύστασης της εντερικής χλωρίδας έχει επικεντρωθεί και σε συγκεκριμένα μακροθρεπτικά και μικροθρεπτικά συστατικά. Έχουν γίνει κάποιες έρευνες σε πειραματόζωα και σε ανθρώπους, τα αποτελέσματα των οποίων παρατίθενται παρακάτω. Στην έρευνα του Turnbaugh και συνεργατών του, δύο ομάδες ποντικιών ακολούθησαν δύο διαφορετικές δίαιτες: μια υψηλή σε υδατάνθρακες και μια δυτικού τύπου δίαιτα, δηλαδή υψηλή σε λίπος και σάκχαρα. Στη δεύτερη ομάδα αυξήθηκε περισσότερο το σωματικό βάρος και το υποδόριο λίπος, ενώ επίσης παρατηρήθηκε στατιστικά σημαντική μεγαλύτερη ποσότητα Firmicutes και μικρότερη αναλογία Bacteroidetes. Με επιπλέον ανάλυση των κοπράνων βρέθηκε ότι τα ποντίκια που ακολουθούσαν τη δυτικού τύπου δίαιτα έφεραν στα κόπρανα υψηλότερες συγκεντρώσεις τελικών προϊόντων από τη βακτηριακή ζύμωση, όπως οξικό και βουτυρικό οξύ (Turnbaugh et al., 2008). Όπως αναφέρθηκε και παραπάνω, έρευνα σε ποντίκια έδειξε ότι όταν αυτά ακολούθησαν δίαιτα υψηλή σε λίπος αύξησαν την αναλογία Gram-αρνητικά/ Gramθετικά, σε συνδυασμό με αυξημένα επίπεδα LPS στο πλάσμα, αυξημένο βάρος, λίπος, διαβήτη και προφλεγμονώδεις δείκτες (Cani et al., 2007a). Άλλη έρευνα απέδειξε ότι άτομα τα οποία προσλάμβαναν περισσότερες θερμίδες από λίπος είχαν λιγότερα Clostridia. Ακόμη, η κατανάλωση διαιτητικών ινών, και συγκεκριμένα όταν αυτές προέρχονταν από δημητριακά, φρούτα, λαχανικά και όχι από όσπρια σχετίστηκε θετικά με τα ποσά των Lactic Acid Bacteria, τα οποία θεωρούνται ευεργετικά για την υγεία. Τέλος, άτομα τα οποία προσλάμβαναν περισσότερες ετεροκυκλικές αμίνες (ενώσεις που παράγονται από την επεξεργασία του κρέατος σε υψηλή θερμοκρασία και θεωρούνται καρκινογόνες) είχαν μεγαλύτερα ποσοστά από Clostridia (Mai et al., 2009). Μια άλλη έρευνα μελέτησε σε 19 εθελοντές την παρουσία συγκεκριμένων ειδών Firmicutes και πώς αυτή εξαρτάται από την υψηλή ή χαμηλή κατανάλωση υδατανθράκων. Συγκεκριμένα είδη, όπως τα Roseburia και Eubacterium, μειώθηκαν με τη χαμηλή πρόσληψη υδατανθράκων, καθώς μειώθηκε και η συγκέντρωση 57

58 βουτυρικού οξέος στα κόπρανα. Τα αποτελέσματα αυτά επιβεβαιώνουν τη συμμετοχή της εντερικής χλωρίδας στη ζύμωση των υδατανθράκων, όπως αναφέρθηκε και παραπάνω (Duncan et al., 2007). Τέλος, έρευνες έχουν γίνει και σε νεογνά, όπου μελετήθηκε η αλλαγή στην εντερική χλωρίδα νεογνών, ανάλογα με το γάλα που κατανάλωναν: γάλα αγελάδος ή παιδική φόρμουλα, με ή χωρίς συμπλήρωμα ιχθυελαίων. Παρατηρήθηκαν αλλαγές στην εντερική χλωρίδα, οι οποίες εικάζεται ότι σχετίζονται με τη πρόσληψη σιδήρου και ω-3 πολυακόρεστων λιπαρών οξέων (Nielsen et al., 2007). 4.7 Προβιοτικά Τα προβιοτικά είναι μη παθογόνοι μικροοργανισμοί, οι οποίοι συνεισφέρουν στην υγεία του ξενιστή. Τα προβιοτικά έχουν δημιουργήσει αξιοσημείωτο ενδιαφέρον τα τελευταία χρόνια και διάφορες μελέτες ερευνούν την χρησιμότητα τους σε διάφορες κλινικές συνθήκες (Πίνακας 4.2) (DiBaise et al., 2008). Ένας δυνητικός ρόλος των προβιοτικών στη θεραπεία κατά της παχυσαρκίας προτείνεται από δύο πρόσφατες έρευνες. Οι Lee et al ερευνούν το αποτέλεσμα ενάντια στη παχυσαρκία του Lactobacillus Rhamnosus PL60, ενός βακτηρίου με ανθρώπινες ρίζες, το οποίο παράγει συζευγμένο λινολεϊκό οξύ σε παχύσαρκα ποντίκια. Το συζευγμένο λινολεϊκό οξύ θεωρείται ότι παρέχει πολλά οφέλη στην υγεία των πειραματόζωων, ένα από τα οποία είναι η ικανότητα μείωσης του σωματικού λίπους. Στην παραπάνω έρευνα βρέθηκε ότι τα ποντίκια σε διάστημα οκτώ εβδομάδων, κατά το οποίο προσλάμβαναν από το στόμα Lactobacillus Rhamnosus PL60, έχασαν βάρος χωρίς να μειωθεί η ενεργειακή τους πρόσληψη (Lee at al., 2006a). Σε έρευνα, κατά την οποία χορηγήθηκε σε ποντίκια αποβουτυρωμένο γάλα, το οποίο είχε ζυμωθεί από Lactobacillus gasseri SBT2055, παρουσιάστηκε μείωση στο μέγεθος των λιποκυττάρων και αύξηση του αριθμού των μικρών λιποκυττάρων, καθώς και μείωση της συγκέντρωσης λεπτίνης του ορού. Επομένως, το βακτήριο αυτό έδρασε θετικά ρυθμίζοντας την ανάπτυξη του λιπώδους ιστού (Sato et al., 2008). 58

59 Ακόμα, σε έρευνα όπου χρησιμοποιήθηκαν Lactobacillus acidophilus NCDC14 και Lactobacillus casei NCDC19 παρουσιάστηκε βελτίωση σε βιοδείκτες του μεταβολισμού της γλυκόζης και των λιπιδίων, καθώς και μείωση της αντίστασης στην ινσουλίνη, της υπεργλυκαιμίας, της υπερινσουλιναιμίας, της δυσλιπιδαιμίας και του οξειδωτικού στρες (Yadav et al., 2007, 2008). Πίνακας: 4.2: Επιδράσεις των προβιοτικών, πρεβιοτικών σε βιοδείκτες ρύθμισης βάρους και μεταβολικών δυσλειτουργιών σε πειραματόζωα (Sanz Y et al., 2010) 59

60 Παρόμοια θετικά αποτελέσματα παρατηρήθηκαν και σε έρευνες σε ανθρώπους. Συγκεκριμένα, η χορήγηση Lactobacillus plantarum 299v σε υπερχοληστερολαιμικούς ασθενείς μείωσε στατιστικώς σημαντικά τη συγκέντρωση LDL χοληστερόλης και ινωδογόνου στον ορό, ενώ επίσης, ελάττωσε βιοδείκτες καρδιαγγειακού κινδύνου σε βαριά καπνίζοντες (Bukoswka et al., 1998). 4.8 Πρεβιοτικά Τα πρεβιοτικά είναι συστατικά τροφίμων, τα οποία δεν πέπτονται και είναι ευεργετικά για την υγεία του ξενιστή. Συγκεκριμένα, τα πρεβιοτικά πρέπει να πληρούν τα εξής κριτήρια: να αντιστέκονται στην οξύτητα του στομάχου και στα πεπτικά ένζυμα του οργανισμού, να μπορούν να χρησιμοποιηθούν και να ζυμωθούν από την εντερική χλωρίδα και τέλος, να μπορούν να διεγείρουν το πολλαπλασιασμό ή τη δραστηριότητα ευεργετικών για την υγεία βακτηρίων. Αν και η επίδρασή τους στους ανθρώπους είναι κατά κάποιο τρόπο αμφιλεγόμενη, σε γενικές γραμμές έχουν συσχετισθεί με μείωση της αθηροσκλήρωσης, της οστεοπόρωσης, του διαβήτη, των αλλεργιών, της παχυσαρκίας και των μολύνσεων (Πίνακας 4.3) (Roberfroid et al., 2007). Γαλακτοολιγοσακχαρίτες και φρουκτοολιγοσακχαρίτες Τα πιο κοινά χρησιμοποιούμενα στην Ευρώπη πρεβιοτικά είναι οι γαλακτοολιγοσακχαρίτες (GOS) και τα παράγωγα ινουλίνης, όπως οι φρουκτοολιγοσακχαρίτες (FOS). Οι GOS προέρχονται από τη λακτόζη και περιέχονται στο ανθρώπινο και αγελαδινό γάλα, αλλά απαντώνται και σε πολλά άλλα τρόφιμα σαν πρόσθετα, όπως σε δημητριακά και γαλακτοκομικά προϊόντα. Οι GOS ευνοούν τον πολλαπλασιασμό Bifidobacterium και Lactobacillus, τα οποία είναι ιδιαίτερα ευεργετικά για την υγεία του ξενιστή. Ακόμη, τα πρεβιοτικά αυτά μπορούν να αποτρέψουν μολύνσεις από παθογόνους μικροοργανισμούς, καθώς δομικά μπορούν να μιμηθούν τις θέσεις πρόσδεσής τους και να αποτρέψουν την προσκόλληση αυτών στα επιθηλιακά κύτταρα (Shoaf et al., 2006). Οι FOS είναι φρουκτάνες, υδρολυτικά 60

61 παράγωγα της ινουλίνης, με μικρό αριθμό μονομερών φρουκτόζης. Απαντώνται σε υψηλές συγκεντρώσεις σε φυτικά τρόφιμα, όπως το κρεμμύδι, το σπαράγγι, το σιτάρι, η αγκινάρα και δρουν μεταβάλλοντας την εντερική χλωρίδα, εμποδίζοντας την αποίκιση παθογόνων μικροοργανισμών και μειώνοντας την πρόσληψη τροφής, ενώ επίσης βελτιώνουν τα επίπεδα της φλεγμονής και του μεταβολισμού των λιπιδίων και της γλυκόζης (Laparra et al., 2010). Χορήγηση GOS σε ποντίκια έδειξε αντιδιαβητική επίδραση, αύξηση του πεπτιδίου GLΡ 1, βελτίωση της ινσουλινοευαισθησίας και της γλυκόζης νηστείας (Cani et al., 2006; Cani et al., 2005a). Θετικά αποτελέσματα βρήκε και πάλι ο ίδιος ερευνητής σε ποντίκια, που ακολουθούσαν δίαιτα υψηλής περιεκτικότητας σε λίπος. Η χορήγηση GOS σε αυτά οδήγησε στην αύξηση του πληθυσμού των Bifidobacterium στο έντερο και ομαλοποίησε την ενδοτοξαιμία και τη φλεγμονή (Cani et al., 2007a). Παρόμοια αποτελέσματα έχουν βρεθεί και σε ανθρώπους, όπου η χορήγηση ολιγοφρουκτόζης μείωσε τη συγκέντρωση λιπιδίων και αύξησε την GLP 1 στο πλάσμα, ενώ επίσης βελτίωσε τα επίπεδα φλεγμονής και ενίσχυσε τον κορεσμό (Delzenne et al., 2002; Cani et al., 2005b). Χορήγηση ινουλίνης σε άτομα που ακολουθούσαν δίαιτα μέτρια σε υδατάνθρακες και χαμηλή σε λίπος οδήγησε σε ελάττωση της ηπατικής λιπογένεσης, καθώς και της συγκέντρωσης τριγκυκεριδίων στο πλάσμα, μειώνοντας έτσι κάποιους παράγοντες αθηροσκλήρωσης (Letexier et al., 2003). Ομοίως, θετικά αποτελέσματα προέκυψαν και από έρευνες σε πειραματόζωα, όπου η χορήγηση ινουλίνης μείωσε την πρόσληψη τροφής και τα επίπεδα γκρελίνης, ενώ αύξησε τα επίπεδα GLP 1 (Cani et al., 2004; Delmee et al., 2006). Διαιτητικές ίνες Οι διαιτητικές ίνες είναι μη αμυλούχοι πολυσακχαρίτες που δεν πέπτονται. Η κυτταρίνη, οι δεξτρίνες, οι πηκτίνες, οι β-γλυκάνες αποτελούν χαρακτηριστικά παραδείγματα διαιτητικών ινών. Οι διαλυτές διαιτητικές ίνες απαντώνται κυρίως σε όσπρια, λαχανικά, φρούτα και ξηρούς καρπούς και έχουν συσχετισθεί με αύξηση του πληθυσμού των Bifidobacterium και Lactobacillus (Napolitano et al., 2009). 61

62 Φυτοχημικά Τα φυτοχημικά είναι βιοενεργές φυτικές ενώσεις που βρίσκονται σε φρούτα, λαχανικά και δημητριακά και των οποίων η πέψη σχετίζεται με μείωση του κινδύνου για πολλές χρόνιες ασθένειες, ενώ επίσης, έχει βρεθεί ότι επηρεάζουν την ποσότητα των εντερικών μικροβίων ή ακόμα ότι ενισχύουν ή καταστέλλουν την ανάπτυξη συγκεκριμένων βακτηριακών ειδών. Οι ενώσεις αυτές ανάλογα με τη δομή τους μπορούν να διαχωριστούν ως εξής: φαινόλες, καροτενοειδή, αλκαλοειδή, φλαβονοειδή, φυτοοιστρογόνα κ.ά. (Liu et al., 2004). Φαινολικές ενώσεις από ελιές, κρασί, τσάι και μούρα φαίνεται να έχουν αντιμικροβιακή δράση, ενώ επίσης, σχετίζονται και με την απώλεια βάρους. Οι πολυφαινόλες μπορούν να αλλάξουν την ισορροπία των εντερικών μικροβίων, αυξάνοντας την αναλογία Bacteroides/ Firmicutes. Έχει αποδειχθεί ότι οι φαινόλες από τσάι καταστέλλουν την ανάπτυξη συγκεκριμένων βακτηριακών ειδών, όπως τα Clostridium perfingens, Clostridium difficile και Bacteroides σε διαφορετικούς βαθμούς και με εύνοια προς τα Bacteroides (Lee et al., 2006b). Οι κατεχίνες, ανήκουν στην κατηγορία των φλαβονοειδών, και έχουν συσχετισθεί με αύξηση των Clostridium coccoides, Eubacterium rectal και Escherichia coli, καθώς και με μείωση του Clostridium histolyticum (Tzonuis et al., 2008). Ομοίως, και οι ανθοκυανίνες ανήκουν στην κατηγορία των φλαβονοειδών και έχει βρεθεί ότι ανθοκυανίνες από μούρα αναστέλλουν την ανάπτυξη του παθογόνων Staphylococcus spp., Salmonella spp., Helicobacter pylori και Bacillus cereus (Puupponen-Pimia et al., 2005; Nohynek et al., 2006). Πολυακόρεστα λιπαρά οξέα Έρευνες έχουν, επίσης, διεξαχθεί και γύρω από την επίδραση των πολυακόρεστων λιπαρών οξέων (PUFAs) στην εντερική χλωρίδα. Τα PUFAs περιλαμβάνουν το λινολεϊκό, το γ λινολενικό, το αραχιδονικό, το α λινολενικό και το δοκοσαεξανοϊκό οξύ και απαντώνται κυρίως στα ψάρια, τους ξηρούς καρπούς και τις φυτικές λιπαρές ύλες. Τα μικρόβια του εντέρου δεν έχουν πολλά γονίδια που να εμπλέκονται στο μεταβολισμό των PUFAs. Παρόλα αυτά, έχουν βρεθεί κάποιες αλληλεπιδράσεις μεταξύ των PUFAs, της εντερικής χλωρίδας και κάποιων 62

63 προβιοτικών. Υψηλή πρόσληψη PUFAs σχετίστηκε με αναστολή της ανάπτυξης και της προσκόλλησης στο εντερικό επιθήλιο όλων των ειδών Lactobacillus. Τέλος, μειωμένη πρόσληψη γ λινολενικού και αραχιδονικού οξέος ευνόησε την ανάπτυξη του L. Casei Shirota (Kankaanpaa et al., 2001). Πίνακας 4.3: Επιδράσεις των προβιοτικών, πρεβιοτικών σε βιοδείκτες ρύθμισης βάρους και μεταβολικών δυσλειτουργιών σε ανθρώπους (Sanz Y at al., 2010) 63

64 ΚΕΦΑΛΑΙΟ 5: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (Polymerase Chain Reaction PCR) 5.1. Αλυσιδωτή αντίδραση πολυμεράσης (PCR) Η αρχή της μεθόδου Η PCR είναι μια τεχνική, η οποία καθιστά δυνατή την αντιγραφή νουκλεοτιδικών αλληλουχιών σε μεγάλες ποσότητες και εκλεκτικά από οποιοδήποτε δείγμα DNA. Η τεχνική βασίζεται στη χρήση της DNA πολυμεράσης για τον πολλαπλασιασμό της επιθυμητής αλληλουχίας DNA σε επαναλαμβανόμενους κύκλους αντιγραφής. Το ένζυμο καθηγείται στην αλληλουχία που επιδιώκεται να αντιγραφεί από ολιγονουκλεοτίδια που ονομάζονται εκκινητές (primers). Οι εκκινητές υποβοηθούν την εκκίνηση της αντιγραφής του DNA και παρασκευάζονται με χημική σύνθεση. Για το λόγο αυτό, πρέπει να είναι γνωστά τα άκρα της προς αντιγραφή αλληλουχίας. Η μέθοδος PCR είναι εξαιρετικά ευαίσθητη. Επιτρέπει τη γρήγορη ενίσχυση περιοχών DNA χρησιμοποιώντας ένα πολύ μικρό δείγμα. Συγκεκριμένα, έχει τη δυνατότητα να ανιχνεύσει έστω και ένα μόνο αντίγραφο μιας αλληλουχίας σε ένα δείγμα DNA, ενισχύοντάς το τόσο πολύ ώστε να είναι ανιχνεύσιμο με κατάλληλη χρώση μετά από ηλεκτροφόρηση σε πηκτή. Σαν τεχνική χρησιμοποιείται ως διαγνωστική μέθοδος στη γενετική του ανθρώπου, για ανίχνευση γενετικών ασθενειών, μεταλλάξεων και λοιμώξεων, σε πρώιμο στάδιο, καθώς και στην εγκληματολογία. Στη βασική έρευνα αξίζει να αναφερθεί η χρησιμότητα της μεθόδου στην απομόνωση και κλωνοποίηση γονιδίων, στην ανάλυση πολυμορφισμών και αλλού. 64

65 5.1.2 Περιγραφή της μεθόδου Σε μια τυπική PCR χρειάζονται τα εξής: δείγμα DNA, εκκινητές (primers), DNA πολυμεράση, Buffer πολυμεράσης, MgCl2, αραιώσουμε σε τελικό όγκο. νουκλεοτίδια, Η20 για να Η PCR ξεκινά με ένα δίκλωνο μόριο DNA και κάθε κύκλος της αντίδρασης αρχίζει με θέρμανση (95 ο C), ώστε να αποδιαταχθούν οι δύο αυτοί κλώνοι (Βήμα 1). Μετά το διαχωρισμό των κλώνων η θερμοκρασία ελαττώνεται (50 65 ο C) και οι εκκινητές μπορούν να υβριδοποιηθούν με τις συμπληρωματικές τους αλληλουχίες στους κλώνους του DNA (Βήμα 2). Στη συνέχεια, η DNA πολυμεράση συνθέτει το συμπληρωματικό κλώνο (Βήμα 3). Έτσι, ολοκληρώνεται ο πρώτος κύκλος και ξεκινά δεύτερος με θέρμανση, ώστε να διαχωριστούν οι νεοσυντιθέμενοι κλώνοι, οι οποίοι λειτουργούν ως εκμαγεία για τη σύνθεση νέων μορίων DNA. Για μια επιτυχή ποσοτική αύξηση του DNA απαιτούνται κύκλοι, καθένας από τους οποίους διαρκεί περίπου 5 min. Η DNA πολυμεράση που χρησιμοποιείται στην τεχνική της PCR είναι ανθεκτική στη θερμότητα, καθώς έχει απομονωθεί από ένα θερμόφιλο βακτήριο. Έτσι, δεν μετουσιώνεται από την υψηλή θερμοκρασία του βήματος 1 και δεν χρειάζεται να προστίθεται μετά από κάθε κύκλο. Εικόνα 5.1: Η καμπύλη φθορισμού της PCR 65

66 Η τεχνική της PCR και η καμπύλη που προκύπτει από αυτή αποτελείται από τρεις φάσεις: την εκθετική φάση (Exponential Phase), τη γραμμική φάση (Linear Phase) και τη φάση του κορεσμού (Plateau Phase). Κατά την πρώτη φάση, το προϊόν πολλαπλασιάζεται ραγδαία καθώς σε κάθε κύκλο διπλασιάζεται ακριβώς. Κατά τη γραμμική φάση, τα αντιδραστήρια αρχίζουν να εξαντλούνται, ενώ επίσης συσσωρεύονται στο μείγμα και αναστολείς. Δηλαδή στη φάση αυτή το DNA πολλαπλασιάζεται με μικρότερο ρυθμό απ ότι στην προηγούμενη φάση. Τέλος, έρχεται η φάση του κορεσμού, κατά την οποία μειώνεται πολύ η αποδοτικότητα της αντίδρασης μέχρι που σταματάει εντελώς. Εικόνα 5.2: Αλυσιδωτή αντίδραση πολυμεράσης (PCR) 66

67 5.2 Αλυσιδωτή αντίδραση πολυμεράσης πραγματικού χρόνου (Real Time PCR) Περιγραφή της μεθόδου Η ποσοτική PCR (quantitative PCR, qpcr) είναι μια γρήγορη, αξιόπιστη και ευαίσθητη μέθοδος, η οποία επιτρέπει την ποσοτικοποίηση συγκεκριμένων αλληλουχιών στόχων DNA. Υπάρχουν δύο είδη ποσοτικής PCR: η απλή qpcr ή αλλιώς τελικού σημείου (End point qpcr) και η πραγματικού χρόνου qpcr (Real Time PCR). Στην πρώτη, ο υπολογισμός του προϊόντος πραγματοποιείται στο τέλος της αντίδρασης. Αντίθετα, στη qpcr, η μέτρηση της ποσότητας του προϊόντος πραγματοποιείται καθ όλη τη διάρκεια της αντίδρασης στο τέλος κάθε κύκλου, μέσω της παρακολούθησης της αύξησης του φθορισμού κάποιας φθορίζουσας ουσίας. Στη τελικού σημείου PCR, καθίσταται δύσκολη η ποσοτικοποίηση του προϊόντος, καθώς αυτή πραγματοποιείται στο τέλος της τεχνικής, όπου στο μείγμα έχουν συσσωρευτεί αναστολείς Είδη της qpcr Υπάρχουν δύο είδη qpcr για την ανίχνευση της προς ενίσχυση αλληλουχίας DNA: τα μη ειδικά και τα ειδικά συστήματα. Στο πρώτο είδος χημείας ανιχνεύονται όλα τα δίκλωνα μόρια DNA, τα οποία ενισχύονται κατά την αντίδραση. Αντίθετα, στο δεύτερο είδος χημείας επιτυγχάνεται διαχωρισμός της αλληλουχίας στόχου από τυχόν μη ειδικά προϊόντα, που ενισχύονται παράλληλα, καθώς και από διμερή εκκινητών που πιθανό να σχηματιστούν. Στα μη ειδικά συστήματα μια φθορίζουσα ουσία προσδένεται στο δίκλωνο DNA. Μια ευρέως χρησιμοποιούμενη χρωστική είναι η SYBR Green I. Είναι μια φθορίζουσα χρωστική, ευρέως χρησιμοποιούμενη στην τεχνική της qpcr, η οποία συνδέεται στο δίκλωνο DNA και φθορίζει ανάλογα με την ποσότητα του DNA. Η διέγερση και η μέγιστη εκπομπή της είναι στα 494 nm και 521 nm αντίστοιχα, τα οποία είναι συμβατά με οποιαδήποτε μηχανή PCR. Πρόκειται για μία ασύμμετρη κυανίνη, η οποία εμφανίζει 100 φορές μεγαλύτερη συγγένεια με το δίκλωνο DNA συγκριτικά με το βρωμιούχο αιθίδιο, το οποίο χρησιμοποιήθηκε σε προηγούμενο 67

68 ερευνητικό στάδιο, στην ηλεκτροφόρηση, για τον ποιοτικό έλεγχο του DNA μετά την απομόνωσή του. Όταν η SYBR Green I συνδέεται με το δίκλωνο DNA, το μέγεθος της εκπομπής της πολλαπλασιάζεται έως και 1000 φορές, γεγονός που την καθιστά πολύ ευαίσθητο δείκτη για τη ποσότητα του DNA. Kατά τη διαδικασία της αλυσιδωτής αντίδρασης η χρωστική SYBR Green Ι δεσμεύεται στο συνεχώς πολλαπλασιαζόμενο DNA με αποτέλεσμα το σήμα φθορισμού που λαμβάνεται από το μηχάνημα να αυξάνεται. Πλεονέκτημα της SYBR Green I είναι η μεγάλη συγγένεια με το DNA, καθώς και το γεγονός ότι μπορεί να χρησιμοποιηθεί για οποιοδήποτε μόριο DNA και με οποιουσδήποτε εκκινητές. Παρ όλα αυτά, δεν είναι ειδική για την εκάστοτε αλληλουχία που πολλαπλασιάζεται. Αντίθετα, δεσμεύεται σε οποιοδήποτε δίκλωνο DNA υπάρχει στο διάλυμα. Συνεπώς, είναι αναγκαία η διαφοροποίηση του φθορισμού που εκπέμπεται από το μόριο στόχο από τον φθορισμό άλλων δίκλωνων τμημάτων DNA που είναι δυνατόν να υπάρχουν στο διάλυμα, όπως τα διμερή των εκκινητών. Για το λόγο αυτό μετά την ολοκλήρωση της ενίσχυσης είναι απαραίτητη η ανάλυση καμπύλης τήξεως. Εικόνα 5.3: Η λειτουργία της SYBR green I κατά την qpcr Μετά από την ολοκλήρωση της qpcr, ακολουθεί η καμπύλη αποδιάταξης (Melting Curve Analysis), προκειμένου να ανιχνευθεί εάν υπάρχουν διμερή εκκινητών (primer dimers) ή άλλα προϊόντα εκτός του DNA στόχου. Η θερμοκρασία τήξεως (Melting Temperature) των προϊόντων εξαρτάται από το μήκος της αλυσίδας του δίκλωνου DNA και από το ποσοστό γουανίνης/κυτοσίνης που περιέχει. 68

69 Συνεπώς, τα διμερή των εκκινητών τήκονται σε χαμηλότερες θερμοκρασίες από το προϊόν της αντίδρασης οπότε και μπορεί να γίνει ο διαχωρισμός αυτών. Πιο συγκεκριμένα, η γραφική παράσταση της παραγώγου της καμπύλης τήξης, παρουσιάζει κορυφές κάθε μία από τις οποίες αντιστοιχεί σε θερμοκρασία τήξης κάποιου μορίου δίκλωνου DNA. Το επιθυμητό είναι η θερμοκρασία αποδιάταξης να είναι μια για τα προϊόντα, δηλαδή να εμφανίζεται μια κορυφή. Περισσότερες κορυφές σημαίνει σχηματισμός περισσότερων προϊόντων πέραν του επιθυμητού. Για την κατασκευή της καμπύλης η θερμοκρασία ξεκινά από τους 60 o C, με σταδιακή αύξηση της τάξης του 0,5 o C Ποσοτικοποίηση των αποτελεσμάτων της qpcr Υπάρχουν δύο μέθοδοι ποσοτικοποίησης των προϊόντων της qpcr: η σχετική και η απόλυτη μέθοδος, η οποία και χρησιμοποιήθηκε στην έρευνά μας. Εικόνα 5.4: Πρότυπη καμπύλη κατά την απόλυτη ποσοτικοποίηση στην qpcr 69

70 Κατά την απόλυτη ποσοτικοποίηση κατασκευάζεται μια πρότυπη καμπύλη με διαδοχικές αραιώσεις δειγμάτων DNA ή RNA γνωστής συγκέντρωσης. Για την κατασκευή πρότυπων καμπύλων μπορεί να χρησιμοποιηθεί πλασμιδιακό δίκλωνο DNA, in vitro συντιθέμενο μονόκλωνο DNA ή cdna για το γονίδιο στόχος. Σε καθεμία από τις παραπάνω περιπτώσεις, η συγκέντρωση (ng/μl) των δειγμάτων DNA υπολογίζεται με φωτομέτρηση στα 260 nm και από αυτή έπειτα υπολογίζεται η συγκέντρωση σε copies/ μl, με τύπους που περιλαμβάνουν τη σταθερά Avogadro και το μέγεθος του γονιδίου στόχου. Στη συνέχεια πραγματοποιούνται διαδοχικές αραιώσεις, γίνεται qpcr στα νέα δείγματα και κατασκευάζεται η πρότυπη καμπύλη (Εικόνα 5.4). 70


72 ΚΕΦΑΛΑΙΟ 6: ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΕΡΕΥΝΑΣ 6.1 Σκοπός της έρευνας Ο σκοπός της μελέτης αυτής ήταν να ερευνηθεί η επιρροή που δέχεται η σύσταση της εντερικής χλωρίδας, η οποία προκύπτει από τον υπολογισμό του πλήθους των βακτηρίων στα κόπρανα, από τους εξής παράγοντες: (1) την παχυσαρκία: Ένας σημαντικός δείκτης διάγνωσης της παχυσαρκίας είναι ο ΔΜΣ. Στόχος της έρευνας ήταν να μελετήσει εάν υπάρχουν σημαντικές αλλαγές στην εντερική χλωρίδα μεταξύ παχύσαρκων ατόμων και ατόμων με φυσιολογικό βάρος. (2) την απώλεια βάρους: σημαντική απώλεια βάρους θεωρήθηκε η μείωση του βάρους τουλάχιστον κατά 4 κιλά τους τελευταίους 2 μήνες. Δεν εφαρμόστηκε κάποια διαιτητική παρέμβαση, αλλά έγινε σύγκριση μεταξύ ατόμων που είχαν μειώσει το βάρος τους και ατόμων που διατηρούσαν σταθερό βάρος. Πρακτικά, αυτό θα μπορούσε να βοηθήσει σε περιπτώσεις ατόμων στα οποία η διατροφική πρόσληψη δεν προκαλεί τις αναμενόμενες αλλαγές στο βάρος. (3) τη διατροφική πρόσληψη. Για να εκτιμηθεί η διατροφική πρόσληψη χρησιμοποιήθηκε το ΕΣΚΤ. Τα άτομα απάντησαν πόσο συχνά καταναλώνουν κάποια τρόφιμα τους τελευταίους δύο μήνες, με σκοπό να βρεθεί κάποια συσχέτιση της διατροφικής πρόσληψης με την εντερική χλωρίδα. (4) την υιοθέτηση της ΜΔ. Ένας σημαντικός δείκτης για την υιοθέτηση της ΜΔ είναι το MedDiet Score. Με τη χρήση του σκορ αυτού κρίθηκε εάν και κατά πόσο οι συμμετέχοντες υιοθετούσαν τη ΜΔ, και εάν η υιοθέτηση αυτή επηρεάζει την εντερική χλωρίδα. Η ΜΔ θεωρείται μια ευεργετική και καρδιοπροστατευτική δίαιτα. Στην έρευνα αυτή, σκοπός ήταν να ερευνηθεί εάν η ΜΔ μπορεί να προκαλέσει αλλαγές στην εντερική χλωρίδα που να ευνοούν τον ξενιστή ως προς την παχυσαρκία. Στην πράξη, όλα τα παραπάνω θα μπορούσαν μελλοντικά να ενισχύσουν την έννοια της εξατομικευμένης διατροφής. Δηλαδή, η σύσταση της εντερικής χλωρίδας 72

73 να είναι ένας ακόμα παράγοντας που να λαμβάνει υπόψη του ένας ειδικός σε θέματα διατροφής, προκειμένου να σχεδιάσει ένα διαιτολόγιο και ένα γενικότερο διαιτολογικό πλάνο για το εκάστοτε άτομο. 6.2 Επιδημιολογικά Στοιχεία Πληθυσμός Τα άτομα της έρευνας προήλθαν κατά κύριο λόγο από τα τακτικά και έκτακτα περιστατικά του Διαιτολογικού Τμήματος του Γενικού Νοσοκομείου Πατρών «ο Άγιος Ανδρέας». Αξίζει να σημειωθεί ότι το Επιστημονικό Συμβούλιο του Νοσοκομείου, μετά από συνεδρίαση του, ενέκρινε ομόφωνα τη διεξαγωγή της έρευνας με αριθμό πρωτοκόλλου, 195/ (Παράρτημα Ι). Το δείγμα αποτελείται από 50 άτομα, 11 άνδρες και 39 γυναίκες, ηλικίας από 25 έως και 68 ετών. Ο διαχωρισμός των ατόμων στις διάφορες ομάδες έγινε με βάση το ΔΜΣ, και συγκεκριμένα, φυσιολογικού βάρους χαρακτηρίστηκαν τα άτομα με ΔΜΣ = 18,5 25 kg/ m 2 και παχύσαρκα τα άτομα με ΔΜΣ> 30 kg/ m 2. Από τη δεύτερη κατηγορία διαφοροποιήθηκαν τα άτομα τα οποία είχαν σημειώσει απώλεια βάρους πάνω από 4 κιλά τους τελευταίους 2 μήνες. Τα άτομα αυτά θα μελετηθούν και ξεχωριστά, βασιζόμενοι στη βιβλιογραφία ότι η απώλεια βάρους μεταβάλλει τη σύσταση της εντερικής χλωρίδας. Τα κριτήρια που χρησιμοποιήθηκαν για το διαχωρισμό αυτό επιλέχθηκαν μετά από ενδελεχή μελέτη της βιβλιογραφίας κατά την οποία ο χρόνος απώλειας βάρους οριζόταν από 8 έως 10 εβδομάδες, ενώ το μέγεθος της απώλειας βάρους ήταν 4 κιλά (Duncan et al., 2008; Santacruz et al., 2009; Nadal et al., 2009). Στη διεξαγωγή της έρευνας λήφθηκε σοβαρά υπόψη ο εξής περιορισμός: τα άτομα δεν έπρεπε να έχουν πάρει αντιβιοτικά, καθώς και να μη λαμβάνουν προβιοτικά ή πρεβιοτικά τους τελευταίους 2 μήνες. Τα παραπάνω άτομα χωρίστηκαν σε 3 κατηγορίες: 73

74 ΚΑΤΗΓΟΡΙΑ Φυσιολογικού Βάρους (NW Normal Weight) Παχύσαρκους (OB Obese) Παχύσαρκους μετά από δίαιτα (OD Obese Diet) ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ Άτομα με Δείκτη Μάζας Σώματος (ΔΜΣ) = 18,5 25 kg/ m 2 Άτομα με ΔΜΣ> 30 kg/ m 2, τα οποία δεν έχουν σημειώσει απώλεια βάρους, δεν ακολουθούσαν κάποια δίαιτα Άτομα με ΔΜΣ> 30 kg /m 2, τα οποία έχουν σημειώσει απώλεια βάρους >4 κιλά τους τελευταίους 2 μήνες, ακολουθώντας κάποια δίαιτα Πίνακας: 6.1: Διαχωρισμός των ατόμων ανάλογα με το ΔΜΣ Δειγματοληψία Από τα άτομα συλλέχθηκε δείγμα κοπράνων σε αποστειρωμένο δοχείο. Το δείγμα μεταφέρθηκε το συντομότερο δυνατό σε συνθήκες κατάψυξης (-20 o C). Αυτό έγινε προκειμένου να διατηρηθεί όσο το δυνατό καλύτερα ο βακτηριακός πληθυσμός και να μην υπάρξουν απώλειες κι επομένως αλλοιώσεις των αποτελεσμάτων Μετρήσεις Ερωτηματολόγια Μετρήθηκαν σωματομετρικά χαρακτηριστικά και συγκεκριμένα το ύψος και το βάρος των συμμετεχόντων. Τα άτομα που συμμετείχαν στην έρευνα κλήθηκαν να συμπληρώσουν 3 ερωτηματολόγια. Το πρώτο περιελάμβανε ερωτήσεις με δημογραφικά, κοινωνικοοικονομικά χαρακτηριστικά, καθώς και ιατρικό ιστορικό και ιστορικό λήψης φαρμάκων. Τα άλλα δυο ερωτηματολόγια ήταν με διατροφικές ερωτήσεις, και συγκεκριμένα σχετικά με τη διατροφική πρόσληψη των ασθενών τους τελευταίους 2 74

75 μήνες. Το πρώτο ήταν ένα Ερωτηματολόγιο Συχνότητας Κατανάλωσης Τροφίμων (ΕΣΚΤ) με 36 ερωτήσεις πολλαπλής επιλογής (Bountziouka et al., 2011) και το δεύτερο ήταν το ερωτηματολόγιο εκτίμησης της υιοθέτησης της Μεσογειακής διατροφής MedDiet Score (Panagiotakos et al., 2007). Όλα τα ερωτηματολόγια βρίσκονται στο Παράρτημα Ι. Το ΕΣΚΤ αποτελείται από 30 ερωτήσεις αναφορικά με την κατανάλωση συγκεκριμένων τροφίμων σύμφωνα με τις κύριες ομάδες τροφίμων (γαλακτοκομικά, αμυλούχα, φρούτα, λαχανικά, κρέας/ψάρι) και από 6 ερωτήσεις που αφορούσαν τη διατροφική συμπεριφορά των ατόμων. Οι συμμετέχοντες ανέφεραν τη συχνότητα κατανάλωσης των επιλεγμένων τροφίμων κατά μέσο όρο μέσα στους τελευταίους 2 μήνες. Οι επιλογές στις απαντήσεις ήταν ποτέ/σπάνια, 1-3 φορές/ μήνα, 1-2 φορές/ εβδομάδα, 3-6 φορές/ εβδομάδα, 1 φορά/ ημέρα και >/2 φορές/ ημέρα. Στις απαντήσεις αυτές δόθηκε ένας αριθμός από το 1 έως το 6 αντίστοιχα, ο οποίος αντιπροσώπευε τη συχνότητα της διατροφικής πρόσληψης για το εκάστοτε τρόφιμο. Επομένως, υψηλότερες τιμές σήμαιναν μεγαλύτερη διατροφική κατανάλωση. Οι σχετικές ερωτήσεις περί διατροφικής συμπεριφοράς ήταν οι ακόλουθες: Πόσες φορές χρησιμοποιείς ελαιόλαδο (οπουδήποτε); Πόσες φορές χρησιμοποιείς άλλου είδους λίπος ή έλαιο (οπουδήποτε); Πόσο συχνά καταναλώνεις προϊόντα ολικής αλέσεως; Πόσο συχνά παραγγέλνεις απ έξω ή τρως εκτός σπιτιού; Πόσο συχνά καταναλώνεις πρωινό; Οι συμμετέχοντες απάντησαν σε αυτές τις ερωτήσεις έχοντας ως επιλογή: ποτέ/σπάνια, 1-3 φορές/μήνα, 1-2 φορές/εβδομάδα, 3-6 φορές/εβδομάδα, 1 φορά/ημέρα και >/2 φορές/ημέρα. Ενώ, στην τελευταία ερώτηση: Πόσα γεύματα έχεις συνολικά την ημέρα μαζί με τα σνακ; Οι επιλογές ήταν 1-3, 4-5, >6 γεύματα και σνακ ανά ημέρα. Το MedDiet Score (Panagiotakos et al., 2007) αναλύθηκε παραπάνω στην ενότητα της Μεσογειακής Διατροφής (Ενότητα 4.2). 75

76 6.2.4 Μικροοργανισμοί που μελετήθηκαν Όπως αναφέρθηκε και αρχικά η εντερική χλωρίδα αποτελείται κυρίως από δύο φύλα, αυτά των Bacteroidetes και των Firmicutes. Από τα φύλα αυτά ερευνήθηκαν τρία γένη. Ακόμα, αναφέρθηκε ότι άλλα δύο φύλα βρίσκονται σε σημαντική ποσότητα στην εντερική χλωρίδα, αυτά των Proteobacteria και των Actinobacteria. Συγκεκριμένα, τα γένη των βακτηρίων που μελετήθηκαν είναι τα εξής: 1. Enterobacter, το οποίο ανήκει στο φύλο των Proteobacteria. 2. Clostridium, το οποίο ανήκει στο φύλο των Firmicutes. 3. Lactobacillus, το οποίο ανήκει στο φύλο των Firmicutes. 4. Bacteroides, το οποίο ανήκει στο φύλο των Bacteroidetes. 5. Bifidobacterium, το οποίο ανήκει στο φύλο των Actinobacteria. 6.3 Πειραματική διαδικασία Υλικά Για απομόνωση DNA: 1. QIAamp DNA Stool Mini Kit, QIAGEN, Cat# Αιθανόλη 100 % Για ηλεκτροφόρηση: 1. Agarose for routine use, Sigma, A TBE buffer 10x, Molecular Biology Grade, Cat# Βρωμιούχο αιθίδιο EtBr 4. 10X BlueJuice Gel Loading Buffer, Invitrogen, Cat# Για φθοριομέτρηση: 1. Qubit dsdna HS Assay Kit, Invitrogen, Cat# Q Water for injection 76

77 Για qpcr: 1. KAPA SYBR FAST qpcr Kit Master Mix (2X) Universal, KapaBiosystems, KK4602: 2. Primers για το 3 άκρο 3. Primers για το 5 άκρο 4. PCR grade water 5. DNA (αραίωση 1/10) Για καλλιέργεια πρότυπων στελεχών: 1. Escherichia coli 2. Bacteroides fragilis NCTC Clostridium clostridiiforme NCTC Lactobacillus delbrueckii subsp. Bulgaricus NCTC TSB (Tryptic Soy Broth), MERCK, Chromocult TBX (Tryptore Bile X-glucuronide Agar), MERCK, ROGOSA Agar, MERCK, BBL (Blood Agar Base), Becton Dickinson, Defibrinated Horse Blood, E&O Laboratories, DHB100 Όργανα Qiacube, της εταιρείας QIAGEN Τράπεζα UV Φθοριόμετρο: Qubit 2.0 Fluorometer, της εταιρείας Invitrogen MX3005P, της εταιρείας Stratagene και το αντίστοιχο λογισμικό Απομόνωση DNA Για την απομόνωση του DNA χρησιμοποιήθηκε το μηχάνημα QIACUBE, της εταιρείας QIAGEN και ακολουθήθηκε το αντίστοιχο πρωτόκολλο, κάτω από αποστειρωμένες συνθήκες: 77

78 1. Ζυγίζεται ποσότητα κοπράνων περίπου 200 mg: Η ποσότητα αυτή εισάγεται σε eppendorf χωρητικότητας 2 ml, το οποίο τοποθετείται στον πάγο. Αυτό το πρωτόκολλο βελτιστοποιείται με τη χρήση 200 mg κοπράνων αλλά μπορούν να χρησιμοποιηθούν και μικρότερες ποσότητες. Δεν υπάρχει λόγος μείωσης της ποσότητας των buffers και των άλλων αντιδραστηρίων όταν χρησιμοποιούνται μικρότερες ποσότητες κοπράνων. Επειδή το δείγμα είναι παγωμένο, χρησιμοπείται μια σπάτουλα ώστε να αποκοπούν κομματάκια κοπράνων και να τα εισαχθούν στα eppendorfs. 2. Προστίθονται 1,4 ml Buffer ASL σε κάθε δείγμα κοπράνων. Γίνεται Vortex στο δείγμα για 1 min ή μέχρι το δείγμα κοπράνων να ομογενοποιηθεί εμφανώς. 3. Θερμαίνεται στους 95 C για 5 min. Η θέρμανση αυτή αυξάνει τη συνολική απόδοση του DNA και συγκεκριμένα μπορεί να την τριπλασιάσει έως και να την πενταπλασιάσει και βοηθάει να διαλυθούν τα βακτήρια και άλλα παράσιτα. 4. Γίνεται Vortex για δεκαπέντε δευτερόλεπτα και φυγοκεντρούμε το δείγμα σε ταχύτητα rpm για 1 min. 5. Από το υπερκείμενο λαμβάνονται 1,2 ml και τα τοποθετούνται σε ένα eppendorf 2ml. 6. Προστίθεται ένα χάπι αποδέσμευσης αναστολέων (Inhibitex Tablet) σε κάθε δείγμα και γίνεται άμεσα vortex για ένα λεπτό ή έως ότου η ταμπλέτα να διαλυθεί πλήρως. Το δείγμα παραμένει για ένα λεπτό σε θερμοκρασία δωματίου ώστε οι αναστολείς να απορροφηθούν πλήρως από το υλικό της ταμπλέτας. 7. Γίνεται φυγοκέντρηση του δείγματος σε ταχύτητα rpm για 3 min. 8. Από το υπερκείμενο λαμβάνονται 350 μl και τα τοποθετούνται σε νέο eppendorf (1,5 ml) το οποίο θα μπει στο QIACUBE. Tο υπόλοιπο φυλάσσεται για πιθανή μελλοντική χρήση. 9. Προστίθενται στο QIACUBE τα απαραίτητα αντιδραστήρια: 15 μl πρωτεϊνάση Κ, 200 μl Buffer AL 78

79 10. Προστίθενται 200 μl του υπερκειμένου από το Βήμα 8 στο eppendorf που περιέχει την πρωτεϊνάση Κ. 11. Προστίθενται 200 μl Buffer AL και γίνεται vortex για δεκαπέντε δευτερόλεπτα. 12. Επώαση στους 70 C για 10 min. 13. Προστίθενται 200 μl αιθανόλης (100%) στο διάλυμα και αναμιγνύονται με vortex. 14. Το διάλυμα του Βήματος 13 μεταφέρεται προσεκτικά στη φυγόκεντρο, κλείνει το καπάκι και γίνεται φυγοκέντρηση σε μέγιστη ταχύτητα για 1 min. Το περιεχόμενο της στήλης μεταφέρεται σε νέα eppendorf (2 ml). 15. Ανοίγει προσεκτικά η QIAmp στήλη και προστίθενται 500 μl Buffer AW1. Κλείνει και γίνεται πάλι φυγοκέντρηση σε μέγιστη ταχύτητα για 1 min. Το περιεχόμενο της στήλης μεταφέρεται σε νέα eppendorf (2 ml). 16. Ανοίγει προσεκτικά η QIAmp στήλη και προστίθενται 500 μl Buffer AW2. Κλείνει και γίνεται πάλι φυγοκέντρηση σε μέγιστη ταχύτητα για 3 min. 17. Προτεινόμενο: το δείγμα τοποθετείται σε νέο eppendorf (2 ml) και γίνεται πάλι φυγοκέντρηση σε μέγιστη ταχύτητα για 1 min. 18. Γίνεται μεταφορά του δείγματος σε νέο eppendorf (1,5 ml), προστίθενται 200 μl Buffer AE κατευθείαν πάνω στην QIAmp μεμβράνη. Αφήνεται για 1 λεπτό σε θερμοκρασία δωματίου και μετά ακολουθεί φυγοκέντρηση σε μέγιστη ταχύτητα για 1 min για να γίνει έκλουση του DNA (QIAamp DNA Stool Handbook) Ηλεκτροφόρηση σε πήκτωμα αγαρόζης Tα μόρια του DNA παρουσιάζουν ηλεκτροφορητική ικανότητα αντιστρόφως ανάλογη του λογαρίθμου (log10) του μοριακού τους βάρους. Το DNA, το οποίο έχει ουδέτερο ph, φορτίζεται αρνητικά και κατευθύνεται προς την άνοδο όταν βρεθεί σε ηλεκτρικό πεδίο. Η ικανότητα διαχωρισμού του πηκτώματος εξαρτάται από τη συγκέντρωση της αγαρόζης, δηλαδή από το μέγεθος των πόρων που φέρει το πήκτωμα. 79

80 Η τεχνική αυτή χρησιμοποιήθηκε για τον ποιοτικό έλεγχο του DNA μετά από την απομόνωση. Συγκεκριμένα, η ηλεκτροφόρηση παρέχει μια εικόνα για την ποσότητα του DNA, δηλαδή το πόσο πυκνό είναι το δείγμα, ανάλογα με την ένταση της ζώνης. Επίσης, μας δίνει μια εικόνα για το αν υπάρχουν θραύσματα DNA, ανάλογα με τις ζώνες που παίρνουμε. Κατασκευή πηκτώματος αγαρόζης 1% 1. Αγαρόζη σε ποσότητα 1,6 g διαλύθηκε σε 160 ml TBE 0,5x (κατασκευάστηκε από ΤΒΕ 10x) και θερμάνθηκαν σε φούρνο μικροκυμάτων, ώστε το διάλυμα να γίνει διαυγές. 2. Η πήξη του διαλύματος έγινε σε θερμοκρασία δωματίου και προστέθηκαν σε αυτό 3 μl βρωμιούχο αιθίδιο EtBr. Το EtBr (Ethidium Bromide) είναι μία αρωματική ένωση, ιδιαιτέρως τοξική και μεταλλαξιγόννος, η οποία απορροφά στην περιοχή του υπεριώδους κι επανεκπέμπει στο ορατό. Χρησιμοποιείται για την ανίχνευση του DNA γιατί έχει την ιδιότητα να παρεμβάλλεται ανάμεσα στις βάσεις του DNA και να καθιστά ορατά τα νουκλεϊνικά οξέα. Έτσι, τα σημεία της πηκτής στα οποία έχουν μετακινηθεί τα μόρια του DNA φθορίζουν όταν εκτεθούν σε υπεριώδη ακτινοβολία. 3. Τοποθετούμε το μίγμα σε καλούπι όγκου 160 ml και το αφήνουμε για περίπου 30 λεπτά σε θερμοκρασία δωματίου να σταθεροποιηθεί. 4. Τα δείγματα DNA σε ποσότητα 10 μl αναμείχθηκαν με 2 μl ποσότητα ρυθμιστικού διαλύματος φόρτωσης (BlueJuice loading buffer). 5. Προστέθηκε 6x ρυθμιστικό διάλυμα τελικής συγκέντρωσης 1/10 (2% SDS) και τα δείγματα ηλεκτροφορήθηκαν απευθείας. Η ηλεκτροφόρηση έγινε στα 80V και τα ηλεκτροφορήματα παρατηρήθηκαν με τράπεζα UV Φθοριομέτρηση Το DNA θεωρείται καθαρό όταν δεν έχει προσμίξεις πρωτεϊνών ή RNA. Πειραματικά η καθαρότητα του DNA για προσμίξεις μπορεί να προσδιοριστεί φωτομετρικά. Κριτήριο της καθαρότητας αποτελεί ο λόγος Α260/ Α280. Για καθαρά 80

81 διαλύματα ο λόγος αυτός είναι κοντά στο 1,8. Τιμές μεγαλύτερες από 1,8 σημαίνουν προσμίξεις με RNA, ενώ τιμές μικρότερες από 1,8 σημαίνουν προσμίξεις με πρωτεΐνες. Στη συγκεκριμένη έρευνα χρησιμοποιήθηκε φθοριόμετρο και υπολογίσθηκε η συγκέντρωση DNA (ng/ ml), προκειμένου να γίνει ποσοτικός έλεγχος των δειγμάτων. Κατασκευάσθηκαν νέα δείγματα με 2 αραιώσεις: αραίωση 1/10 (10 μl δείγματος σε 90 μl water for injection) και αραίωση 1/100 (10 μl αραιωμένου δείγματος σε 90 μl water for injection). Πρωτόκολλο 1. Τα αρχικά μας δείγματα βρίσκονται σε θερμοκρασία -20 ο C. Βγαίνουν από την κατάψυξη και τοποθετούνται σε δοχείο, το οποίο περιέχει πάγο, ώστε να αποψυχθούν στο ελάχιστο και να μη γίνουν αλλοιώσεις, αλλά να είναι και εφικτό να ληφθεί η απαιτούμενη ποσότητα. 2. Χρησιμοποιήθηκαν 102 tubes, χωρητικότητας 0,5 ml: 50 για τα δείγματα με αραίωση 1/10, 50 για τα δείγματα με αραίωση 1/100 και 2 για τα πρότυπα δείγματα (Standards St1 & St2). 3. Γίνεται αραίωση 1/200 του Qubit dsdna HS Reagent με το Qubit dsdna HS Buffer. Για κάθε δείγμα χρειάζονται 190 μl. Επομένως, κατασκευάζεται επαρκής ποσότητα για 102 δείγματα (20 ml). Αναμιγνύονται 100 μl Qubit dsdna HS Reagent με 20 ml Qubit dsdna HS Buffer. 4. Κατασκευή των πρότυπων δειγμάτων: προσθέτονται 190 μl από το παραπάνω δείγμα ξεχωριστά σε 2 tubes και 10 μl από το κάθε πρότυπο δείγμα. Γίνεται vortex για 2 3 sec. 5. Επαναλαμβάνεται η ίδια διαδικασία για όλα τα δείγματα. 6. Παραμένουν σε θερμοκρασία δωματίου για 2 min. Αυτό γίνεται προκειμένου το δείγμα να φτάσει στον καταλληλότερο φθορισμό, με αποτέλεσμα το σήμα του φθορισμού να μένει σταθερό για 3 ώρες σε θερμοκρασία δωματίου. 7. Ρύθμιση του φθοριόμετρου: Επιλογή για δίκλωνο DNA. 8. Βαθμονόμηση: Τοποθετούνατι πρώτα το δείγμα St1 και μετά το St2, τα οποία χρησιμοποιούνται για τυφλά. 81

82 9. Φθοριομέτρηση των δειγμάτων (αραίωση 1/10). Για όσα δείγματα το φθοριόμετρο δε μπορούσε να δώσει τιμή, λόγω πολύ χαμηλής συγκέντρωσης DNA, χρησιμοποιήθηκε το αρχικό συμπυκνωμένο δείγμα. Αξίζει να σημειωθεί ότι το Qubit dsdna HS Assay Kit έχει κατάσκευασθεί ώστε να λειτουργεί βέλτιστα σε θερμοκρασία δωματίου. Για το λόγο αυτό, όλες οι ενέργειες πρέπει να γίνονται σε θερμοκρασία ο C. Ακόμα, σημαντικό είναι να αποφευχθούν τυχόν διακυμάνσεις στη θερμοκρασία. Για το λόγο αυτό δεν πρέπει να μένουν πολλή ώρα τα tubes στο χέρι του ερευνητή. Επίσης, πρέπει να μένουν στο φθοριόμετρο μόνο όση ώρα είναι απαραίτητη για τη φωτομέτρηση (Qubit dsdna HS Assay Manual, 2010) Ποσοτική Real Time PCR (qpcr) H qpcr γίνεται με σκοπό να προσδιορισθεί το γονίδιο που κωδικοποιεί το 16S ριβοσωμικό RNA (16S rrna). Το 16S rrna είναι συστατικό της 30S μικρής υπομονάδας των προκαρυωτικών ριβοσωμάτων και είναι περίπου μήκους 1,5 kb. Είναι λειτουργικά σταθερό και αποτελεί μωσαϊκό από συντηρημένες και μεταβλητές περιοχές. Για το λόγο αυτό χρησιμοποιείται για να ανιχνευθούν φυλογενετικά γένη βακτηρίων (Coenye et al., 2003). Συγκεκριμένα, για τον προσδιορισμό των ολικών βακτηρίων χρησιμοποιήθηκαν «universal primers», οι οποίοι αντιστοιχούν στις συντηρημένες περιοχές του γονιδίου του 16S rrna. Για να ανιχνευθούν τα διαφορετικά γένη βακτηρίων χρησιμοποιήθηκαν εκκινητές για τις μεταβλητές περιοχές του γονιδίου αυτού, δηλαδή περιοχές οι οποίες είναι διαφορετικές ανάμεσα σε γένη βακτηρίων και επιτρέπουν τον διαχωρισμό τους. Στη συγκεκριμένη έρευνα χρησιμοποιήθηκε μη ειδικό σύστημα ανίχνευσης. Ο ποσοτικός προσδιορισμός των βακτηρίων στα κόπρανα έγινε σε επίπεδο «Τάξης». Οι εκκινητές που χρησιμοποιήθηκαν στην qpcr φαίνονται στον παρακάτω πίνακα (Hartman et al., 2009). Στην qpcr χρησιμοποιήθηκε η χρωστική SYBR Green I και ακολουθήθηκε το πρωτόκολλο ΚΑΡΑ SYBR FAST qpcr. 82

83 Order Τάξη Total bacteria Enterobacteriales Lactobacillales Clostridialles Bacteroidales Bifidobacteriales Αλληλουχία εκκινητή ACTCCTACGGGAGGCAGCAGT ATTACCGCGGCTGCTGGC ATGGCTGTCGTCAGCTCGT CCTACTTCTTTTGCAACCCACTC GGAAACRRRWGCTAATACCG GAAGATTCCCTACTGCT CGGTACCTGACTAAGAAGC AGTTTYATTCTTGCGAACG GGTGTCGGCTTAAGTGCCAT CGGAYGTAAGGGCCGTGC CTCCTGGAAACGGGTGG GGTGTTCTTCCCGATATCTACA Τm qpcr Ονομασία εκκινητή Uni_F Uni R Ent_F Ent_R Lact_F Lact_R Clost_F Clost_R Bdes_F Bdes_R Bifid_F Bifid_R Πίνακας 6.2: Οι εκκινητές που χρησιμοποιήθηκαν στην qpcr Βήμα 1 Ετοιμασία αντιδραστηρίων: Υπολογισμός των συγκεντρώσεων των αντιδραστηρίων: KAPA SYBR qpcr Master Mix (2X), ROX Reference Dye Low, DNA (αραίωση 1/100), primers. Τελική συγκέντρωση 20 μl rxn PCR grade water 1 μl KAPA SYBR qpcr Master Mix (2X) 1Χ 12,5 μl Primer για το 3 άκρο 0,2 μm 0,5 μl Primer για το 5 άκρο 0,2 μm 0,5 μl DNA Αραιωμένο δείγμα 1/100 5 μl ROX Reference Dye Low 50Χ 0,5 μl Πίνακας 6.3: Οι ποσότητες και οι συγκεντρώσεις των αντιδραστηρίων που χρησιμοποιηθήκαν για την qpcr 83

84 Βήμα 2 Ανάμειξη αντιδραστηρίων και προετοιμασία πλάκας: Τα αντιδραστήρια μεταφέρονται στην πλάκα PCR, προστίθεται το κάλυμμα και αναδεύεται σύντομα. Βήμα 3 Τρέξιμο της qpcr: Η DNA πολυμεράση που χρησιμοποιήσαμε είναι «hot start», δηλαδή ενεργοποιείται στους 95 o C. Στη συνέχεια ακολουθεί στην ίδια θερμοκρασία η αποδιάταξη του δίκλωνου DNA και αργότερα σε χαμηλότερη θερμοκρασία (60 65 o C, ανάλογα με τους εκκινητές που χρησιμοποιούνται) το στάδιο της υβριδοποίησης επιμήκυνσης. Αναλυτικά τα στάδια της qpcr φαίνονται στον πίνακα που ακολουθεί: Στάδιο Θερμοκρασία Διάρκεια Κύκλοι Ενεργοποίηση ενζύμου (Enzyme activation) 95 o C 20 sec έως 3 min - Αποδιάταξη (Denature) 95 o C 10 sec - Υβριδοποίηση/ Επιμήκυνση (Anneal/ extend) o C 60 sec 40 Διαχωρισμός (Dissociation) Έναρξη 60 o C Πίνακάς 6.4: Τα στάδια της qpcr Βήμα 4 Απόλυτη Ποσοτικοποίηση: Για την ποσοτικοποίηση, από κάθε τάξη βακτηρίων χρησιμοποιηθήκαν πρότυπα στελέχη, ο αριθμός των οποίων υπολογίστηκε βακτηριολογικά με διαδοχικές αραιώσεις και στη συνέχεια έγινε απομόνωση DNA από γνωστή ποσότητα βακτηρίων. Η πρότυπη καμπύλη αναφοράς κατασκευάστηκε αυτόματα από το λογισμικό του μηχανήματος σε διαδοχικές αραιώσεις του δείγματος DNA (10-1 cfu ως 10-6 cfu ) και εκφράζει τoν αριθμό των βακτηρίων της κάθε αραίωσης και τις τιμές Ct. Παρακάτω αναλύονται όλα τα βήματα που ακολουθήθηκαν για την ποσοτικοποίηση. 84

85 Βελτιστοποίηση των συνθηκών της qpcr: Προκειμένου οι συνθήκες για την qpcr να είναι οι ιδανικές, μεγάλη σημασία πρέπει να δοθεί στη συγκέντρωση της SYBR Green I, των εκκινητών, του χλωριούχου μαγνησίου (MgCl2) και του δείγματος DNA, καθώς στις θερμοκρασίες του κάθε βήματος. Συγκεκριμένα, πολύ υψηλή συγκέντρωση SYBR Green I μπορεί να προκαλέσει αναστολή της αντίδρασης κατά την qpcr, ενώ η πολύ χαμηλή συγκέντρωση μπορεί να μην επαρκεί για τη σήμανση των προϊόντων. Το KAPA SYBR FAST qpcr Kit που χρησιμοποιήθηκε στην έρευνά μας περιέχει αυξημένη συγκέντρωση SYBR Green I, όμως αυτό δεν δημιουργεί πρόβλημα στην αποδοτικότητα της αντίδρασης, διότι η DNA πολυμεράση που εμπεριέχεται στο kit είναι ανθεκτική στις υψηλές συγκεντρώσεις της χρωστικής. Επίσης, μεγάλη ποσότητα DNA πιθανό να μειώσει το μέγιστο σήμα φθορισμού και τη γραμμικότητα των καμπύλων αναφοράς. Για το λόγο αυτό, στην έρευνα μας χρησιμοποιήθηκε το απομονωμένο DNA με αραίωση 1/10. Όσον αφορά τους εκκινητές, οι αποδεκτές συγκεντρώσεις έχουν εύρος 50 nμ 300 nμ. Το χλωριούχο μαγνήσιο παρέχει τα ιόντα μαγνησίου τα οποία είναι απαραίτητα για την RT PCR. Όπως αναφέρθηκε η SYBR Green I είναι μη ειδική, με αποτέλεσμα να παράγονται και μόρια DNA πέρα από την αλληλουχία στόχο. Το MgCl2 επιδρά στην ενεργότητα της DNA πολυμεράσης και την καθιστά πιο ειδική για την προς ενίσχυση αλληλουχία. Χαμηλή συγκέντρωση MgCl2 μειώνει την απόδοση της qpcr, γιατί το Mg++, ως συνένζυμο της πολυμεράσης, είναι απαραίτητο για την λειτουργία της, ενώ αντίθετα, η υψηλή συγκέντρωση Mg++ οδηγεί στο σχηματισμό προϊόντων που δεν αντιστοιχούν στην αλληλουχία του στόχου DNA. Το αποδεκτό εύρος συγκέντρωσης για το MgCl2 είναι από 1,5 έως 5 mm. Εκτός από τη SYBR Green I, στην qpcr χρησιμοποιήθηκε και η χρωστική ROX. Είναι μια χρωστική αναφοράς (Reference Dye), της οποίας ο φθορισμός δε μεταβάλλεται κατά την εξέλιξη της qpcr, αλλά παραμένει βασικός σταθερός. Η παρουσία της ROX στο kit δεν επηρεάζει την qpcr, εφόσον το φάσμα εκπομπής της είναι διαφορετικό από αυτό της SYBR Green I. Η χρωστική αναφοράς ROX έχει σαν στόχο να «ισοβαθμίζει» το φθορισμό ουσιών που δε σχετίζονται με την qpcr, καθώς και να ελαχιστοποιήσει επιρροές που μπορεί να προκληθούν από μικρές διαφορές 85

86 στον όγκο του διαλύματος της qpcr ή από τη διαφάνεια του πλαστικού της πλάκας που χρησιμοποιείται. Η αποδιάταξη γίνεται στη θερμοκρασία των 95 o C. Η DNA πολυμεράση που χρησιμοποιείται είναι «hot start», δηλαδή σε θερμοκρασία δωματίου είναι αδρανής κι ενεργοποιείται σε υψηλή θερμοκρασία (95 o C). Αυτό γίνεται διότι η DNA πολυμεράση, βρίσκεται ως σύμπλοκο με κάποια άλλη πρωτεΐνη αντίσωμα, η οποία μετουσιώνεται από την υψηλή θερμοκρασία της αποδιάταξης, ελευθερώνοντάς την. Συγκεκριμένα, η DNA πολυμεράση ενεργοποιείται όταν βρεθεί σε θερμοκρασία 95 o C για χρόνο από 20 sec έως 3 min. Αυτό έχει ως αποτέλεσμα να παρεμποδίζεται ο σχηματισμός λανθασμένων προϊόντων, καθώς και διμερών, των εκκινητών, κατά την προετοιμασία της αντίδρασης, αυξάνοντας έτσι την ακρίβεια και την ειδικότητα της PCR. Τέλος, η υβριδοποίηση και η επιμήκυνση έχουν κοινή θερμοκρασία και είναι αυτή των 65 o C. Αρχικά καλλιεργήθηκαν τα εξής πρότυπα στελέχη βακτηρίων: Escherichia coli Bacteroides fragilis NCTC Clostridium clostridiiforme NCTC 7155 Lactobacillus delbrueckii subsp. Bulgaricus NCTC Σε μη εκλεκτικό θρεπτικό υλικό ( 40 ml) έγινε εμβολιασμός από καθαρή καλλιέργεια πρότυπων στελεχών. Η E.coli επωάστηκε στους 37 ο C για 24 ώρες, ενώ τα άλλα πρότυπα στελέχη, ως υποχρεωτικά αναερόβια, επωάστηκαν στους 37 ο C για 48 ώρες και κάτω από αναερόβιες συνθήκες. Από την αρχική καλλιέργεια έγιναν διαδοχικές αραιώσεις (1/10, 1/100 κ.ο.κ.) και για τα 4 πρότυπα στελέχη. Από τις τελευταίες αραιώσεις του κάθε στελέχους πήραμε 100 μl και με εκλεκτικό θρεπτικό υλικό καλλιεργήσαμε εκ νέου τα βακτήρια σε τρυβλία: Escherichia coli: θρεπτικό υλικό Chromocult TBX, επώαση 44 ο C για 24 ώρες Lactobacillus delbrueckii subsp. Bulgaricus: θρεπτικό υλικό ROGOSA Agar, επώαση 37 ο C για 48 ώρες σε αναερόβιες συνθήκες 86

87 Bacteroides fragilis και Clostridium clostridiiforme: θρεπτικό υλικό Blood Agar Base, στο οποίο προστέθηκε 5% Befibrinated Horse Blood, επώαση 37 ο C για 48 ώρες σε αναερόβιες συνθήκες. Από το πλήθος των καλλιεργειών που θα αναπτυχθούν στο τρυβλίο και λαμβάνοντας υπόψη τις αραιώσεις που πραγματοποιήθηκαν υπολογίζεται η συγκέντρωση των πρότυπων στελεχών σε cfu/ ml (colony forming units/ ml) στην αρχική καλλιέργεια, με το TSB θρεπτικό υλικό. Απομόνωση DNA, φθοριομέτρηση και υπολογισμός συγκέντρωσης Από την αρχική, γνωστής πλέον συγκέντρωσης, καλλιέργεια γίνεται απομόνωση DNA (χρησιμοποιήθηκε το QIAamp DNA Stool Mini Kit της εταιρείας Qiagen) και στη συνέχεια έγινε φθοριομέτρηση προκειμένου να υπολογισθεί η συγκέντρωση των δειγμάτων (ng/ μl). Χρησιμοποιήθηκε το φθοριόμετρο Qubit 2.0 Fluorometer, της εταιρείας Invitrogen, και ακολουθήθηκε το ίδιο πρωτόκολλο με αυτό της φθοριομέτρησης που είχε γίνει αρχικά για τον έλεγχο του DNA (Βλ. Ενότητα 6.3.4, Φθοριομέτρηση). Στη συνέχεια, από την παραπάνω συγκέντρωση υπολογίζεται η συγκέντρωση σε copies/ μl, η οποία προκύπτει από τύπους που περιέχουν τη σταθερά Avogadro καθώς και το μέγεθος του γονιδιώματος του κάθε βακτηρίου. Τέλος, λαμβάνοντας υπόψη τον αριθμό των αντιγράφων του γονιδίου που κωδικοποιεί το 16S rrna που φέρει κάθε βακτήριο, υπολογίζεται η συγκέντρωση σε cfu/ μl. qpcr και κατασκευή πρότυπης καμπύλης Έπειτα, γίνονται διαδοχικές αραιώσεις και πραγματοποιείται qpcr. Στη συνέχεια, κατασκευάζεται η πρότυπη καμπύλη και υπολογίζεται η ποσότητα ολικών βακτηρίων καθώς και κάθε γένους βακτηρίων για κάθε δείγμα κοπράνων που έχει ληφθεί [Log (ποσότητα βακτηρίων)/ g κοπράνων]. 87


89 ΚΕΦΑΛΑΙΟ 7: ΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΤΗΣ ΕΡΕΥΝΑΣ 7.1 Αποτελέσματα από την πειραματική διαδικασία Ηλεκτροφόρηση Όπως αναφέρθηκε πραγματοποιήθηκε ηλεκτροφόρηση σε πήκτωμα αγαρόζης 1%, προκειμένου να ελεγχθεί ποιοτικά το DNA που απομονώθηκε από τα κόπρανα. Τα ηλεκτροφορήματα παρατηρήθηκαν σε λάμπα UV (Εικόνα 6.1). Εικόνα 7.1: Ηλεκτροφόρηση βακτηριακού DNA σε πήκτωμα αγαρόζης 1%. Φωτογραφία μετά από έκθεση σε τράπεζα UV qpcr Η qpcr γίνεται με σκοπό να ενισχυθεί το γονίδιο για το 16S rrna. Ακολουθήθηκε μη ειδικό σύστημα ανίχνευσης, χρησιμοποιώντας τη χρωστική SYBR Green I και έγινε απόλυτη ποσοτικοποίηση. 89

90 Εικόνα 7.2: Τα αποτελέσματα της qpcr με τους universal primers Εικόνα 7.3: Τα αποτελέσματα της qpcr για το γένος Lactobacillus 90

91 Εικόνα 7.4: Τα αποτελέσματα της qpcr για το γένος Enterobacter Εικόνα 7.5: Τα αποτελέσματα της qpcr για το γένος Clostridium 91

92 Εικόνα 7.6: Τα αποτελέσματα της qpcr για το γένος Bifidobacterium Εικόνα 7.7: Τα αποτελέσματα της qpcr για το γένος Bacteroides 92

93 Εικόνα 7.8: Πρότυπη καμπύλη ποσοτικοποίησης για τα ολικά βακτήρια Εικόνα 7.9: Πρότυπη καμπύλη ποσοτικοποίησης για το γένος Lactobacillus 93

94 Εικόνα 7.10: Πρότυπη καμπύλη ποσοτικοποίησης για το γένος Enterobacter Εικόνα 7.11: Πρότυπη καμπύλη ποσοτικοποίησης για το γένος Clostridium 94

95 Εικόνα 7.12: Πρότυπη καμπύλη ποσοτικοποίησης για το γένος Bifidobacterium Εικόνα 7.13: Πρότυπη καμπύλη ποσοτικοποίησης για το γένος Bacteroides Στη συνέχεια, ακολουθεί ο πίνακας με την ποσότητα των βακτηρίων, εκφρασμένα σε λογάριθμο του πλήθους τους ανά γραμμάριο κοπράνων (πίνακας 6.2), καθώς και πίνακας με τα περιγραφικά στατιστικά των αποτελεσμάτων αυτών (πίνακας 6.3). 95

96 Πίνακας 7.1: Εικόνα από το αρχείο excel που χρησιμοποιήθηκε στην έρευνα 96

Μεσογειακή Διατροφή Τι γνωρίζουμε για αυτή;

Μεσογειακή Διατροφή Τι γνωρίζουμε για αυτή; Μεσογειακή Διατροφή Τι γνωρίζουμε για αυτή; Στις αρχές της δεκαετίας του 1950 ξεκίνησε μία μεγάλη έρευνα, γνωστή ως η μελέτη των 7 χωρών, όπου μελετήθηκαν οι διατροφικές συνήθειες ανθρώπων από τις εξής

Διαβάστε περισσότερα

Στέργιος Ι. Τραπότσης Χειρουργός Ορθοπαιδικός Διδάκτωρ Ιατρικής Σχολής ΑΠΘ Διδάσκων ΤΕΦAΑ-ΠΘ

Στέργιος Ι. Τραπότσης Χειρουργός Ορθοπαιδικός Διδάκτωρ Ιατρικής Σχολής ΑΠΘ Διδάσκων ΤΕΦAΑ-ΠΘ Άσκηση, διατροφή & υγεία Στέργιος Ι. Τραπότσης Χειρουργός Ορθοπαιδικός Διδάκτωρ Ιατρικής Σχολής ΑΠΘ Διδάσκων ΤΕΦAΑ-ΠΘ Άσκηση, διατροφή & υγεία Μακροχρόνια επιστημονική έρευνα έχει αποδείξει ότι πολλά από

Διαβάστε περισσότερα

(dietary fiber, nonnutritive fiber)

(dietary fiber, nonnutritive fiber) KΥΤΤΑΡΙΝΗ - ΦΥΤΙΚΕΣ ΙΝΕΣ Στα τρόφιμα, παράλληλα με τους υδατάνθρακες που πέπτονται στον ανθρώπινο οργανισμό (δηλαδή που υδρολύονται, απορροφώνται και μεταβολίζονται κατά τα γνωστά), υπάρχουν και υδατάνθρακες

Διαβάστε περισσότερα

«Μεσογειακή δίαιτα και υγεία»

«Μεσογειακή δίαιτα και υγεία» «Μεσογειακή δίαιτα και υγεία» «Μεσογειακή δίαιτα και υγεία» Μερόπη Κοντογιάννη Επίκουρη Καθηγήτρια Επίκουρη Καθηγήτρια Τμήμα Επιστήμης Διαιτολογίας Διατροφής ρ ήμ Χαροκόπειο Πανεπιστήμιο Μεσογειακή δίαιτα

Διαβάστε περισσότερα

ΥΔΑΤΑΝΘΡΑΚΕΣ. Τι είναι οι υδατάνθρακες;

ΥΔΑΤΑΝΘΡΑΚΕΣ. Τι είναι οι υδατάνθρακες; ΥΔΑΤΑΝΘΡΑΚΕΣ Τι είναι οι υδατάνθρακες; Οι υδατάνθρακες είναι τα νομίσματα ενέργειας του σώματός μας. Τα περισσότερα τρόφιμα που τρώμε καθημερινά αποτελούνται από υδατάνθρακες. Ο οργανισμός μας, σπα τους

Διαβάστε περισσότερα


ΠΕΨΗ ΚΑΙ ΑΠΟΡΡΟΦΗΣΗ ΤΩΝ ΘΡΕΠΤΙΚΩΝ ΟΥΣΙΩΝ 8. Σημειώστε με ποιους από τους παρακάτω τρόπους δρα το σάλιο: α. συμβάλλει στην πέψη των πρωτεϊνών β. συμμετέχει στη δημιουργία βλωμού (μπουκιάς) γ. συμβάλλει στην καθαριότητα των δοντιών δ. λειαίνει

Διαβάστε περισσότερα

Εισαγωγή στη Διατροφή

Εισαγωγή στη Διατροφή Εισαγωγή στη Διατροφή Ενότητα 6 η ΥΔΑΤΑΝΘΡΑΚΕΣ Όνομα καθηγητή: Μ. ΚΑΨΟΚΕΦΑΛΟΥ Όνομα καθηγητή: Α. ΖΑΜΠΕΛΑΣ Τμήμα: Επιστήμης τροφίμων και διατροφής του ανθρώπου ΣΤΟΧΟΙ ΤΟΥ ΜΑΘΗΜΑΤΟΣ Η δομή των υδατανθράκων

Διαβάστε περισσότερα


ΔΙΑΤΡΟΦΗ ΚΑΙ ΕΦΗΒΕΙΑ ΔΙΑΤΡΟΦΗ ΚΑΙ ΕΦΗΒΕΙΑ ΕΦΗΒΕΙΑ- ΑΝΑΓΚΕΣ v Επιτάχυνση ρυθμού ανάπτυξης v Ωρίμανση και αύξηση ιστών v Αποκτά το 20% του ύψους και το 50% του βάρους του ενήλικα, ενώ οι μύες, ο όγκος του αίματος και γενικά

Διαβάστε περισσότερα

Αρχικά θα πρέπει να προσδιορίσουμε τι είναι η παχυσαρκία.

Αρχικά θα πρέπει να προσδιορίσουμε τι είναι η παχυσαρκία. Αρχικά θα πρέπει να προσδιορίσουμε τι είναι η παχυσαρκία. Παχυσαρκία είναι η παθολογική αύξηση του βάρους του σώματος, που οφείλεται σε υπερβολική συσσώρευση λίπους στον οργανισμό. Παρατηρείται γενικά

Διαβάστε περισσότερα

Από τον Κώστα κουραβανα

Από τον Κώστα κουραβανα Από τον Κώστα κουραβανα Περιεχόμενα Γενικός ορισμός παχυσαρκίας Ορμονικοί-Γονιδιακοί-παράγοντες Επιπτώσεις στην υγεία Θεραπεία-Δίαιτα Γενικός ορισμός παχυσαρκίας Παχυσαρκία είναι κλινική κατάσταση στην

Διαβάστε περισσότερα

Ποια η χρησιμότητα των πρωτεϊνών;

Ποια η χρησιμότητα των πρωτεϊνών; ΠΡΩΤΕΪΝΕΣ Τι είναι οι πρωτεϊνες; Η ονομασία πρωτεϊνες προέρχεται από το ρήμα πρωτεύω και σημαίνει την εξαιρετική σημασία που έχουν οι πρωτεϊνες για την υγεία του ανθρώπινου σώματος. Από την εποχή των Ολυμπιακών

Διαβάστε περισσότερα

Η ΔΙΑΤΟΦΗ ΤΟΥ ΣΗΜΕΡΑ. Μαθητές: Τάτσιου Ελενη,ΖάχουΚατερίνα,Κοκκινίδου Αθανασία,Καρπόζηλος Κωνσταντίνος. Καθηγητής: κ. Παπαμήτσος

Η ΔΙΑΤΟΦΗ ΤΟΥ ΣΗΜΕΡΑ. Μαθητές: Τάτσιου Ελενη,ΖάχουΚατερίνα,Κοκκινίδου Αθανασία,Καρπόζηλος Κωνσταντίνος. Καθηγητής: κ. Παπαμήτσος Η ΔΙΑΤΟΦΗ ΤΟΥ ΣΗΜΕΡΑ Μαθητές: Τάτσιου Ελενη,ΖάχουΚατερίνα,Κοκκινίδου Αθανασία,Καρπόζηλος Κωνσταντίνος Καθηγητής: κ. Παπαμήτσος ΔΙΑΤΡΟΦH Η διατροφή στην ζωή του ανθρώπου παίζει τον μεγαλύτερο ρόλο. Για

Διαβάστε περισσότερα

ΔΥΣΛΙΠΙΔΑΙΜΙΑ. Νικολούδη Μαρία. Ειδικ. Παθολόγος, Γ.Ν.Θ.Π. «Η Παμμακάριστος»

ΔΥΣΛΙΠΙΔΑΙΜΙΑ. Νικολούδη Μαρία. Ειδικ. Παθολόγος, Γ.Ν.Θ.Π. «Η Παμμακάριστος» ΔΥΣΛΙΠΙΔΑΙΜΙΑ Νικολούδη Μαρία Ειδικ. Παθολόγος, Γ.Ν.Θ.Π. «Η Παμμακάριστος» Ο όρος δυσλιπιδαιμία εκφράζει τις ποσοτικές και ποιοτικές διαταραχές των λιπιδίων του αίματος. Τα λιπίδια όπως η χοληστερόλη και

Διαβάστε περισσότερα

Η παχυσαρκία ορίζεται ως η περίσσεια λιπώδους ιστού στον ανθρώπινο οργανισµό µε αποτέλεσµα τη συσσώρευση αυξηµένου λίπους κάτω από το δέρµα (υποδόριο) αλλά και σε διάφορα όργανα του σώµατος (σπλαχνικό)

Διαβάστε περισσότερα

ΜΑΘΗΜΑ 1 ο. Οι διατροφικές ανάγκες των παιδιών ΓΕΩΠΟΝΙΚΟΠΑΝΕΠΙΣΤΗΜΙΟΑΘΗΝΩΝ ΕΡΕΥΝΗΤΙΚΟ ΠΡΟΓΡΑΜΜΑ. 1.1 Ανακαλύπτοντας τις διατροφικές ανάγκες


Διαβάστε περισσότερα

Ιδέες για ένα σωστό πρωινό

Ιδέες για ένα σωστό πρωινό Ιδέες για ένα σωστό πρωινό Υγιεινή Διατροφή Ισορροπία Ποικιλία Μέτρο Ομάδες τροφίμων Γάλα-γαλακτοκομικά προϊόντα (γιαούρτι) Φρούτα-απλοί υδατάνθρακες Λαχανικά (κυρίως πράσινα φυλλώδη) Ψωμί-αμυλώδη τρόφιμα

Διαβάστε περισσότερα

Επίπεδα λεπτίνης και γκρελίνης σε ασθενείς με διαβήτη τύπου 2 πριν και 6 μήνες μετά την έναρξη ινσουλινοθεραπείας

Επίπεδα λεπτίνης και γκρελίνης σε ασθενείς με διαβήτη τύπου 2 πριν και 6 μήνες μετά την έναρξη ινσουλινοθεραπείας Επίπεδα λεπτίνης και γκρελίνης σε ασθενείς με διαβήτη τύπου 2 πριν και 6 μήνες μετά την έναρξη ινσουλινοθεραπείας Ν. Κατσίκη[1], Α. Γκοτζαμάνη-Ψαρράκου[2], Φ. Ηλιάδης[1], Τρ. Διδάγγελος[1], Ι. Γιώβος[3],

Διαβάστε περισσότερα

H επίδραση του οικογενειακού περιβάλλοντος στην σύσταση της εντερικής μικροβιακής χλωρίδας

H επίδραση του οικογενειακού περιβάλλοντος στην σύσταση της εντερικής μικροβιακής χλωρίδας Πανεπιστήμιο Πατρών, Σχολή Επιστημών Υγείας, Τμήμα Ιατρικής ΠΜΣ Βασικές Ιατρικές Επιστήμες Εργαστήριο Υγιεινής Διπλωματική Εργασία H επίδραση του οικογενειακού περιβάλλοντος στην σύσταση της εντερικής

Διαβάστε περισσότερα

προϊόντων του Δρ Κωσταρέλλη Βασιλική Λέκτορας Χαροκοπείου Πανεπιστημίου

προϊόντων του Δρ Κωσταρέλλη Βασιλική Λέκτορας Χαροκοπείου Πανεπιστημίου Η διατροφική αξία του σταφυλιού και των προϊόντων του Δρ Κωσταρέλλη Βασιλική Λέκτορας Χαροκοπείου Πανεπιστημίου Η καλλιέργεια του αμπελιού στην στην αρχαιότητα Δίαιτα στην Αρχαία Ελλάδα Το Μεσογειακή πρότυπο

Διαβάστε περισσότερα

Πρωτεΐνες (proteins) Υδατάνθρακες (carbohydrates) 13/7/2015. Ομάδες Τροφίμων (food groups) Θρεπτικά συστατικά (nutrients)

Πρωτεΐνες (proteins) Υδατάνθρακες (carbohydrates) 13/7/2015. Ομάδες Τροφίμων (food groups) Θρεπτικά συστατικά (nutrients) Ομάδες Τροφίμων (food groups) Προληπτική Ιατρική και Δημόσια Υγεία 8 η Υποχρεωτική Άσκηση Επιλογής Διατροφή στη Δημόσια Υγεία Ανδρονίκη Νάσκα, Αναπλ. Καθηγήτρια Υγιεινής και Επιδημιολογίας Δημητριακά και

Διαβάστε περισσότερα

Γνωρίστε τα νηστίσιμα - Ο Δρόμος για την Θεραπεία Τρίτη, 14 Φεβρουάριος :44

Γνωρίστε τα νηστίσιμα - Ο Δρόμος για την Θεραπεία Τρίτη, 14 Φεβρουάριος :44 Γράφει: Κωνσταντίνου Κρήνη, Κλινικός Διαιτολόγος Διατροφολόγος Τα λαχανικά, τα όσπρια, οι πατάτες, τα δημητριακά, τα ζυμαρικά, οι ξηροί καρποί, οι ελιές, τα φρούτα, τα θαλασσινά, ο ταραμάς, τα τουρσί ανήκουν

Διαβάστε περισσότερα

ρ. Αλεξάνδρα Μαρία Μιχαηλίδου Επίκ. Καθηγήτρια Επιστήµης Τροφίµων & ιατροφής Τοµέας Επιστήµης και Τεχνολογίας Τροφίµων Γεωπονική Σχολή Αριστοτέλειο

ρ. Αλεξάνδρα Μαρία Μιχαηλίδου Επίκ. Καθηγήτρια Επιστήµης Τροφίµων & ιατροφής Τοµέας Επιστήµης και Τεχνολογίας Τροφίµων Γεωπονική Σχολή Αριστοτέλειο ρ. Αλεξάνδρα Μαρία Μιχαηλίδου Επίκ. Καθηγήτρια Επιστήµης Τροφίµων & ιατροφής Τοµέας Επιστήµης και Τεχνολογίας Τροφίµων Γεωπονική Σχολή Αριστοτέλειο Πανεπιστήµιο Θεσσαλονίκης Συµβολή του γάλακτος και των

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η νηστεία κάνει θαύματα

Η νηστεία κάνει θαύματα Η νηστεία κάνει θαύματα Έρευνα του Πανεπιστημίου Κρήτης δείχνει ότι οι διατροφικές επιταγές της Ορθόδοξης Εκκλησίας είναι άκρως ευεργετικές για την υγεία των παιδιών Οι ειδικοί λένε ότι η αποχή από τις

Διαβάστε περισσότερα

Μέχρι σήµερα γνωρίζατε ότι η κατανάλωση ψωµιού είναι µία απολαυστική και θρεπτική συνήθεια. Από σήµερα η αγαπηµένη σας αυτή καθηµερινή συνήθεια µπορεί να παρέχει στον οργανισµό ακόµη περισσότερα θρεπτικά

Διαβάστε περισσότερα

Δ. Επίσης, κατά τη διάρκεια ασθένειας, φλεγμονής, χειρουργίου ή τραύματος οι ανάγκες μας σε ενέργεια αυξάνονται ανάλογα με την περίπτωση.

Δ. Επίσης, κατά τη διάρκεια ασθένειας, φλεγμονής, χειρουργίου ή τραύματος οι ανάγκες μας σε ενέργεια αυξάνονται ανάλογα με την περίπτωση. μεταβολισμός Μεταβολισμός είναι το σύνολο των χημικών και φυσικών αλλαγών που επιτρέπουν τη σωστή λειτουργία και ανάπτυξη του σώματος μας. Ο μεταβολισμός μας καθορίζει τις συνολικές ανάγκες μας σε ενέργεια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Επίδραση της Μεσογειακής Δίαιτας στη ρύθμιση του Σακχαρώδη Διαβήτη Τύπου 1 σε παιδιά και εφήβους.

Επίδραση της Μεσογειακής Δίαιτας στη ρύθμιση του Σακχαρώδη Διαβήτη Τύπου 1 σε παιδιά και εφήβους. Επίδραση της Μεσογειακής Δίαιτας στη ρύθμιση του Σακχαρώδη Διαβήτη Τύπου 1 σε παιδιά και εφήβους. Θεοφανεία Τσαχαλίνα1, Ιωάννης Κύργιος2, Ευθυμία Ευστρατίου2, Μιχαήλ Μελισσινός1, Κυριάκος Καζάκος1, Ασημίνα

Διαβάστε περισσότερα

Μεταβολικό Σύνδρομο και Άσκηση στην παιδική ηλικία: Ο Ρόλος των Αδικοπινών. Θανάσης Τζιαμούρτας ΤΕΦΑΑ Παν. Θεσσαλίας

Μεταβολικό Σύνδρομο και Άσκηση στην παιδική ηλικία: Ο Ρόλος των Αδικοπινών. Θανάσης Τζιαμούρτας ΤΕΦΑΑ Παν. Θεσσαλίας Μεταβολικό Σύνδρομο και Άσκηση στην παιδική ηλικία: Ο Ρόλος των Αδικοπινών Θανάσης Τζιαμούρτας ΤΕΦΑΑ Παν. Θεσσαλίας Μεταβολικό Σύνδρομο Δεν είναι ασθένεια αλλά ένα σύμπλεγμα από ιατρικές διαταραχές που

Διαβάστε περισσότερα

Ισορροπημένη διατροφή. της αναλογίας της μέσης προς τους. Κλασσική Πυραμίδα τροφών. Πυραμίδες Τροφών. Κατανομή λίπους και χρόνιες παθήσεις

Ισορροπημένη διατροφή. της αναλογίας της μέσης προς τους. Κλασσική Πυραμίδα τροφών. Πυραμίδες Τροφών. Κατανομή λίπους και χρόνιες παθήσεις Άσκηση και διατροφή στην πρόληψη και αντιμετώπιση ασθενειών Ισορροπημένη διατροφή Κατανομή λίπους και χρόνιες παθήσεις Ο τρόπος εναπόθεσης του σωματικού λίπους έχει αποδειχτεί τελευταία πως αποτελεί ένα

Διαβάστε περισσότερα

Ν. Κατσίκη[1], Α. Γκοτζαμάνη-Ψαρράκου[2], Φ. Ηλιάδης[1], Τρ. Διδάγγελος[1], Ι. Γιώβος[3], Δ. Καραμήτσος[1]

Ν. Κατσίκη[1], Α. Γκοτζαμάνη-Ψαρράκου[2], Φ. Ηλιάδης[1], Τρ. Διδάγγελος[1], Ι. Γιώβος[3], Δ. Καραμήτσος[1] Ολόγοςλεπτίνης/αδιπονεκτίνης ως ανεξάρτητος προγνωστικός παράγοντας 10ετούς καρδιαγγειακού κινδύνου σε ινσουλινοθεραπευόμενους ασθενείς με διαβήτη τύπου 2 Ν. Κατσίκη[1], Α. Γκοτζαμάνη-Ψαρράκου[2], Φ. Ηλιάδης[1],

Διαβάστε περισσότερα

ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ. Οι ρυθμιστές του οργανισμού

ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ. Οι ρυθμιστές του οργανισμού ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ Οι ρυθμιστές του οργανισμού Είδη αδένων στον άνθρωπο o Εξωκρινείς αδένες: εκκρίνουν το προϊόν τους μέσω εκφορητικού πόρου είτε στην επιφάνεια του σώματος (π.χ. ιδρωτοποιοί και σμηγματογόνοι

Διαβάστε περισσότερα

Τελικό κείμενο της Μελέτης. Σύνδρομο Πολυκυστικών Ωοθηκών: Διατροφή και Υγεία

Τελικό κείμενο της Μελέτης. Σύνδρομο Πολυκυστικών Ωοθηκών: Διατροφή και Υγεία Τελικό κείμενο της Μελέτης Σύνδρομο Πολυκυστικών Ωοθηκών: Διατροφή και Υγεία Τα τελικά προϊόντα προχωρημένης γλυκοζυλίωσης (Advanced Glycation End products, ) είναι μόρια υψηλής δραστικότητας, τα οποία

Διαβάστε περισσότερα

Μηδενική Δίαιτα: Η πιο αυστηρή Δεν γίνεται πρόσληψη ενέργειας Οργανισμός καταφεύγει σε αποθήκες του: Λίπος Πρωτεΐνες Γλυκογόνο

Μηδενική Δίαιτα: Η πιο αυστηρή Δεν γίνεται πρόσληψη ενέργειας Οργανισμός καταφεύγει σε αποθήκες του: Λίπος Πρωτεΐνες Γλυκογόνο Μηδενική Δίαιτα: Η πιο αυστηρή Δεν γίνεται πρόσληψη ενέργειας Οργανισμός καταφεύγει σε αποθήκες του: Λίπος Πρωτεΐνες Γλυκογόνο 1 Γλυκογόνο: επαρκεί για μια ημέρα για ανάγκες εγκεφάλου -> Πρωτεΐνη: για

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εισαγωγή στη Διατροφή

Εισαγωγή στη Διατροφή Εισαγωγή στη Διατροφή Ενότητα 6 η ΥΔΑΤΑΝΘΡΑΚΕΣ Όνομα καθηγητή: Μ. ΚΑΨΟΚΕΦΑΛΟΥ Όνομα καθηγητή: Α. ΖΑΜΠΕΛΑΣ Τμήμα: Επιστήμης τροφίμων και διατροφής του ανθρώπου ΣΤΟΧΟΙ ΤΟΥ ΜΑΘΗΜΑΤΟΣ Η δομή των υδατανθράκων

Διαβάστε περισσότερα

Ελαιόλαδο: Το πολύτιμο όπλο έναντι πολλών ασθενειών. Το ελαιόλαδο, "υγρό χρυσάφι" κατά τον Όμηρο αποτελεί θαυματουργή πηγή

Ελαιόλαδο: Το πολύτιμο όπλο έναντι πολλών ασθενειών. Το ελαιόλαδο, υγρό χρυσάφι κατά τον Όμηρο αποτελεί θαυματουργή πηγή ΔΗΜΗΤΡΗΣ ΓΡΗΓΟΡΑΚΗΣ, ΜSc Κλινικός Διαιτολόγος Διατροφολόγος Ελαιόλαδο: Το πολύτιμο όπλο έναντι πολλών ασθενειών Το ελαιόλαδο, "υγρό χρυσάφι" κατά τον Όμηρο αποτελεί θαυματουργή πηγή θρεπτικών συστατικών

Διαβάστε περισσότερα

Παχυσαρκία και Σακχαρώδης Διαβήτης

Παχυσαρκία και Σακχαρώδης Διαβήτης Παχυσαρκία και Σακχαρώδης Διαβήτης Τι είναι ο Σακχαρώδης Διαβήτης τύπου 2 (ΣΔ2) Ο Σακχαρώδης Διαβήτης γενικά είναι μια πάθηση κατά την οποία ο οργανισμός και συγκεκριμένα το πάγκρεας δεν παράγει ή δεν

Διαβάστε περισσότερα


ΟΙ ΠΥΡΑΜΙΔΕΣ ΔΙΑΤΡΟΦΗΣ ΟΙ ΠΥΡΑΜΙΔΕΣ ΔΙΑΤΡΟΦΗΣ Ο σύγχρονος ΟΔΗΓΟΣ ΔΙΑΤΡΟΦΗΣ συμπεριλαμβάνει τα ακόλουθα στοιχεία: Ψωμιά, Δημητριακά, Ρύζι και Μακαρόνια (6 με 11 μερίδες): Οι υδατάνθρακες παίζουν βασικό ρόλο σε όλα τα διαιτολόγια.

Διαβάστε περισσότερα

3. Το σχεδιάγραμμα παρουσιάζει τομή ανθρώπινου πεπτικού συστήματος.

3. Το σχεδιάγραμμα παρουσιάζει τομή ανθρώπινου πεπτικού συστήματος. ΠΕΠΤΙΚΟ 1. Α. Να γράψετε τα είδη των δοντιών Α, Β, Γ, Δ και τα μέρη του δοντιού Ε Μ. Β. Πόσα δόντια έχει ένα παιδί 3 χρόνων; Γ. Ποιοι αδένες αφήνουν το έκκριμά τους στη στοματική κοιλότητα και ποιο το

Διαβάστε περισσότερα

Ανίχνευση Λιπών Πρωτεϊνών Αμύλου στα τρόφιμα

Ανίχνευση Λιπών Πρωτεϊνών Αμύλου στα τρόφιμα Ανίχνευση Λιπών Πρωτεϊνών Αμύλου στα τρόφιμα Τρόφιμα με λιπίδια Τρόφιμα με πρωτεΐνες Τρόφιμα με υδατάνθρακες Α Γυμνασίου Κεφάλαιο 2 Ενότητα 2.4 Σελ. 45-47 1 Εισαγωγή Πρωτεΐνες Η ονομασία πρωτεΐνες προέρχεται

Διαβάστε περισσότερα

Αλληλεπιδράσεις θρεπτικών συστατικών των τροφίμων

Αλληλεπιδράσεις θρεπτικών συστατικών των τροφίμων Αλληλεπιδράσεις θρεπτικών συστατικών των τροφίμων Τα τρόφιμα είναι σύνθετοι συνδυασμοί που προέρχονται από πολλές πηγες. Όλα τα τρόφιμα έχουν τη δυνατότητα αλλεπίδρασης (χημικής) σε διαφορετικό βαθμό.

Διαβάστε περισσότερα

Σχέση Διατροφής-Ιώσεων-Ανοσοποιητικού Συστήματος - Ο Δρόμος για την Θεραπεία Σάββατο, 08 Οκτώβριος :40

Σχέση Διατροφής-Ιώσεων-Ανοσοποιητικού Συστήματος - Ο Δρόμος για την Θεραπεία Σάββατο, 08 Οκτώβριος :40 Γράφει: Κωνσταντίνου Κρήνη, Κλινικός Διαιτολόγος-Διατροφολόγος Οι ιώσεις ανεξάρτητα από το εάν είναι ήπιες ή όχι έχουν αρνητικές επιδράσεις στη διατροφική κατάσταση του ατόμου. Οι σπουδαιότητα των επιδράσεων

Διαβάστε περισσότερα

Μικροοργανισμοί. Οι μικροοργανισμοί διακρίνονται σε: Μύκητες Πρωτόζωα Βακτήρια Ιούς

Μικροοργανισμοί. Οι μικροοργανισμοί διακρίνονται σε: Μύκητες Πρωτόζωα Βακτήρια Ιούς Μικροοργανισμοί Οι μικροοργανισμοί διακρίνονται σε: Μύκητες Πρωτόζωα Βακτήρια Ιούς Παθογόνοι μικροοργανισμοί Παθογόνοι μικροοργανισμοί ονομάζονται οι μικροοργανισμοί που χρησιμοποιούν τον άνθρωπο ως ξενιστή

Διαβάστε περισσότερα


ΜΙΑ ΣΥΓΧΡΟΝΗ ΜΑΤΙΑ ΣΤΗ ΠΑΧΥΣΑΡΚΙΑ ΜΙΑ ΣΥΓΧΡΟΝΗ ΜΑΤΙΑ ΣΤΗ ΠΑΧΥΣΑΡΚΙΑ Επιβλέπων καθηγητής: Μαρράς Σωτήρης Τάξη: Α Λυκείου Έτος: 2013-2014 Περίγραμμα παρουσίασης: Τα βασικά αίτια της παχυσαρκίας. Oι συνέπειες της παχυσαρκίας. Oι τρόποι αντιμετώπισης

Διαβάστε περισσότερα

microbiota microbiome

microbiota microbiome Αριθμός άρθρων στη βάση Pubmed 7000 6000 microbiota 6208 5000 microbiome 5254 4000 3000 2000 1000 1149 1269 0 286 296 152 171 35 36 1 2 3 4 5 1990 2000 2005 2010 2015 A microbe s view of us Skin

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΥΓΙΕΙΝΗΣ ΙΑΤΡΟΦΗΣ Νούς υγιής εν σώµατι υγιή ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΥΓΙΕΙΝΗΣ ΙΑΤΡΟΦΗΣ ιατροφή και Υγεία Η υγεία αλλά και η νόσος είναι καταστάσεις που δεν οφείλονται ποτέ σε ένα µόνο παράγοντα. Οι κύριες οµάδες παραγόντων

Διαβάστε περισσότερα


ΛΙΠΩΔΗΣ ΙΣΤΟΣ ΚΑΙ ΕΝΔΟΘΗΛΙΟ: ΜΙΑ ΔΥΝΑΜΙΚΗ ΣΧΕΣΗ. Κ. ΜΑΚΕΔΟΥ, Ιατρός Βιοπαθολόγος ΛΙΠΩΔΗΣ ΙΣΤΟΣ ΚΑΙ ΕΝΔΟΘΗΛΙΟ: ΜΙΑ ΔΥΝΑΜΙΚΗ ΣΧΕΣΗ Κ. ΜΑΚΕΔΟΥ, Ιατρός Βιοπαθολόγος ΛΙΠΩΔΗΣ ΙΣΤΟΣ Απόδοση λιπαρών οξέων μετά από υδρόλυση των τριγλυκεριδίων, σε περίοδο νηστείας, με σκοπό: Την παραγωγή ενέργειας

Διαβάστε περισσότερα

ΣΥΝΟΠΤΙΚΗ ΠΕΡΙΓΡΑΦΗ ΤΩΝ ΔΙΑΤΡΟΦΙΚΩΝ ΑΝΑΓΚΩΝ ΤΟΥ ΟΡΓΑΝΙΣΝΟΥ Τόσο η εμπειρία όσο και τα επιστημονικά δεδομένα συνεχώς επιβεβαιώνουν την άποψη ότι η

ΣΥΝΟΠΤΙΚΗ ΠΕΡΙΓΡΑΦΗ ΤΩΝ ΔΙΑΤΡΟΦΙΚΩΝ ΑΝΑΓΚΩΝ ΤΟΥ ΟΡΓΑΝΙΣΝΟΥ Τόσο η εμπειρία όσο και τα επιστημονικά δεδομένα συνεχώς επιβεβαιώνουν την άποψη ότι η ΣΥΝΟΠΤΙΚΗ ΠΕΡΙΓΡΑΦΗ ΤΩΝ ΔΙΑΤΡΟΦΙΚΩΝ ΑΝΑΓΚΩΝ ΤΟΥ ΟΡΓΑΝΙΣΝΟΥ Τόσο η εμπειρία όσο και τα επιστημονικά δεδομένα συνεχώς επιβεβαιώνουν την άποψη ότι η διατροφή σχετίζεται άμεσα ή έμμεσα με την εμφάνιση ή/και

Διαβάστε περισσότερα

Καρκίνος του παχέος εντέρου

Καρκίνος του παχέος εντέρου Καρκίνος τι Πρ έπ ει να ''ξέρω... του Π. Πετρίδη* Παχύ έντερο Το παχύ έντερο είναι το τελευταίο τμήμα του πεπτικού συστήματος και αποτελεί τη συνέχεια του λεπτού εντέρου. Αποτελείται από 6 τμήματα που

Διαβάστε περισσότερα

Γράφει η Ράνια Σαμαρά, Διαιτολόγος - Διατροφολόγος

Γράφει η Ράνια Σαμαρά, Διαιτολόγος - Διατροφολόγος Γράφει η Ράνια Σαμαρά, Διαιτολόγος - Διατροφολόγος Σε προηγούμενα άρθρα μιλήσαμε για τη σχέση σωστής διατροφής και αθλητισμού, διακρίναμε τη σημαντικότητα του ρόλου που διαδραματίζει και επικεντρωθήκαμε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μεταβολικές ανάγκες ανοσοκυττάρων

Μεταβολικές ανάγκες ανοσοκυττάρων Μεταβολικές ανάγκες ανοσοκυττάρων Στέργιος Κατσιουγιάννης PhD Μεταδιδακτορικός συνεργάτης Χαροκόπειο Πανεπιστήµιο Τµήµα Επιστήµης ιαιτολογίας και ιατροφής Μεταβολισµός και Ανοσολογία Ιστορικά το καλύτερο

Διαβάστε περισσότερα

Αριάδνη Γκατζού Διαιτολόγος-Διατροφολόγος, M.Sc.

Αριάδνη Γκατζού Διαιτολόγος-Διατροφολόγος, M.Sc. Διαβητολογική Εταιρεία Βορείου Ελλάδος «Σακχαρώδης Διαβήτης: Ένα σύγχρονο πρόβλημα υγ Θεσσαλονίκη, 30 Ιανουαρίου 2016 Μικρογεύματα (snacks snacks)) και Διαβήτης: Απαίτηση ή επιλογή; Αριάδνη Γκατζού Διαιτολόγος-Διατροφολόγος,

Διαβάστε περισσότερα


ΡΥΘΜΙΣΗ ΤΟΥ ΜΕΤΑΒΟΛΙΣΜΟΥ ΤΩΝ ΛΙΠΟΕΙ ΩΝ ΡΥΘΜΙΣΗ ΤΟΥ ΜΕΤΑΒΟΛΙΣΜΟΥ ΤΩΝ ΛΙΠΟΕΙ ΩΝ Η επιβίωση των ζώντων οργανισµών οφείλεται εκτός των άλλων και στην ικανότητά τους να ρυθµίζουν την αποθήκευση και την κινητοποίηση της ενέργειας για το µεταβολισµότους.

Διαβάστε περισσότερα

Ερευνητική Εργασία Β Λυκείου Από την αρχαία Ελλάδα στη σύγχρονη εποχή, ο αθλητισμός και τα φαινόμενα της βίας και του ντόπινγκ ΔΙΑΤΡΟΦΗ

Ερευνητική Εργασία Β Λυκείου Από την αρχαία Ελλάδα στη σύγχρονη εποχή, ο αθλητισμός και τα φαινόμενα της βίας και του ντόπινγκ ΔΙΑΤΡΟΦΗ Φιλεκπαιδευτική Εταιρεία Αρσάκειο Γενικό Λύκειο Ψυχικού Ερευνητική Εργασία Β Λυκείου Σχολικό έτος: 2013-2014 Από την αρχαία Ελλάδα στη σύγχρονη εποχή, ο αθλητισμός και τα φαινόμενα της βίας και του ντόπινγκ

Διαβάστε περισσότερα

Τα προβιοτικά στην καθημερινή κλινική πράξη

Τα προβιοτικά στην καθημερινή κλινική πράξη Τα προβιοτικά στην καθημερινή κλινική πράξη Ανδρέας Θ. Τσουρουκτσόγλου, Ιατρός Ξάνθη, 22.ΙΟΥΝ.2003 ΕΙΣΑΓΩΓΗ Μέσα στον καθένα μας κατοικεί ένας τεράστιος αριθμός από βακτηρίδια, χωρίς τα οποία δεν θα μπορούσαμε

Διαβάστε περισσότερα

Βρέφη 0-12 μηνών. Παιδιά 4-8 ετών. Παιδιά και έφηβοι 9-18 ετών. Ενήλικες > 50 ετών. Γυναίκες έγκυες και θηλάζουσες

Βρέφη 0-12 μηνών. Παιδιά 4-8 ετών. Παιδιά και έφηβοι 9-18 ετών. Ενήλικες > 50 ετών. Γυναίκες έγκυες και θηλάζουσες ΙΧΝΟΣΤΟΙΧΕΙΑ Ασβέστιο Συνιστώμενη ημερήσια πρόσληψη ασβεστίου Βρέφη 0-12 μηνών Παιδιά 1-3 ετών Παιδιά 4-8 ετών Παιδιά και έφηβοι 9-18 ετών Ενήλικες 19-50 ετών Ενήλικες > 50 ετών Γυναίκες έγκυες και θηλάζουσες

Διαβάστε περισσότερα

σύνδρομο ευερέθιστου εντέρου επί τουλάχιστον 3

σύνδρομο ευερέθιστου εντέρου επί τουλάχιστον 3 Το σύνδρομο ευερέθιστου εντέρου (ΣΕΕ) ανήκει σε μια ομάδα λειτουργικών διαταραχών του πεπτικού σωλήνα. Το κοιλιακό άλγος, ο μετεωρισμός και η εναλλαγή των συνηθειών του εντέρου αποτελούν τυπικά συμπτώματα.

Διαβάστε περισσότερα

Έλεγχος της λειτουργίας της εξωκρινούς μοίρας του παγκρέατος

Έλεγχος της λειτουργίας της εξωκρινούς μοίρας του παγκρέατος Έλεγχος της λειτουργίας της εξωκρινούς μοίρας του παγκρέατος Φλεγμονή Ανεπάρκεια ΠΑΘΟΛΟΓΙΚΕΣ ΚΑΤΑΣΤΑΣΕΙΣ ΠΑΓΚΡΕΑΤΟΣ ΦΛΕΓΜΟΝΗ ΤΟΥ ΠΑΓΚΡΕΑΤΟΣ Φλεγμονή που συνοδεύεται από διάφορα συμπτώματα στο σκύλο και

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 1 ου ΚΕΦΑΛΑΙΟΥ ΕΡΩΤΗΣΕΙΣ 1 ου ΚΕΦΑΛΑΙΟΥ Επιλέξτε τη σωστή απάντηση: Το τρυπανόσωμα προκαλεί α. δυσεντερία β. ελονοσία γ. ασθένεια του ύπνου δ. χολέρα Τα ενδοσπόρια σχηματίζονται από β. φυτά γ. ιούς δ. πρωτόζωα Η σύφιλη

Διαβάστε περισσότερα

Μειώστε τον κίνδυνο για πρόωρο θάνατο µε τα Ωµέγα-3

Μειώστε τον κίνδυνο για πρόωρο θάνατο µε τα Ωµέγα-3 Μειώστε τον κίνδυνο για πρόωρο θάνατο µε τα Ωµέγα-3 Για χρόνια, οι καταναλωτές µαθαίνουν για τα οφέλη της µείωσης των καρδιαγγειακών παθήσεων µε τη λήψη ωµέγα-3 λιπαρών οξέων. Αυτή η άποψη έχει επικρατήσει,

Διαβάστε περισσότερα


ΦΥΣΙΟΛΟΓΙΚΗ ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ - ΒΙΤΑΜΙΝΕΣ. Εμμ. Μ. Καραβιτάκης Παιδίατρος ΦΥΣΙΟΛΟΓΙΚΗ ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ - ΒΙΤΑΜΙΝΕΣ Εμμ. Μ. Καραβιτάκης Παιδίατρος ΜΕΤΑΒΟΛΙΣΜΟΣ οι χημικές αντιδράσεις που συμβαίνουν στον οργανισμό για την παραγωγή ενέργειας και τη διατήρηση της ζωής αναβολισμός

Διαβάστε περισσότερα


ΔΙΑΤΡΟΦΗ & ΔΗΜΟΣΙΑ ΥΓΕΙΑ Αθηνά Λινού, MD, PhD, MPH Καθηγήτρια Ιατρικής Σχολής Πανεπιστημίου Αθηνών Διευθύντρια του Εργαστηρίου Υγιεινής, Επιδημιολογίας και Ιατρικής Στατιστικής Ιατρικής Σχολής Πανεπιστημίου Αθηνών Πρόεδρος Ινστιτούτου

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ο ρόλος του λιπώδους ιστού

Ο ρόλος του λιπώδους ιστού Ο ρόλος του λιπώδους ιστού Γιώργος Βαλσαμάκης Ενδοκρινολόγος Eπιστημονικός συνεργάτης Ενδοκρινολογικήs Μονάδαs Β Μαιευτικής και Γυναικολογικής κλινικής Αρεταίειο Νοσοκομείο Θέματα συζήτησης Α. Ο λιπώδης

Διαβάστε περισσότερα

Είδη Γιαουρτιού. Ανάλογα με την παρασκευή του διακρίνεται σε: Κανονικό : Παράγεται με όλα του τα συστατικά

Είδη Γιαουρτιού. Ανάλογα με την παρασκευή του διακρίνεται σε: Κανονικό : Παράγεται με όλα του τα συστατικά ΓΕΝΙΚΑ Το γιαούρτι προέρχεται από το αγελαδινό, κατσικίσιο ή πρόβειο γάλα, το οποίο βράζεται και αργότερα, όταν η θερμοκρασία του κατέβει στους 40 50 ο C προστίθεται η μαγιά και αφήνεται να πήξει. Αποτελεί

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: Α1. Η φαγοκυττάρωση

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

ΙΣΤΟΡΙΑ Η χοληστερίνη εντοπίστηκε για πρώτη φορά σε πέτρες της χολής το 1784.Η σχέση της με τα καρδιαγγειακά νοσήματα ανακαλύφθηκε στις τελευταίες

ΙΣΤΟΡΙΑ Η χοληστερίνη εντοπίστηκε για πρώτη φορά σε πέτρες της χολής το 1784.Η σχέση της με τα καρδιαγγειακά νοσήματα ανακαλύφθηκε στις τελευταίες ΧΟΛΗΣΤΕΡΙΝΗ Η χοληστερίνη ή η χοληστερόλη είναι κηρώδης στερόλης που βρίσκεται στη μεμβράνη των κυττάρων όλων των ιστών του σώματος, και στο πλάσμα του αίματος όλων των ζώων. Μικρότερες ποσότητες χοληστερίνης

Διαβάστε περισσότερα

Από βιολογικής άποψης, μας ενδιαφέρουν τα σάκχαρα που χωρίζονται στους:

Από βιολογικής άποψης, μας ενδιαφέρουν τα σάκχαρα που χωρίζονται στους: Από βιολογικής άποψης, μας ενδιαφέρουν τα σάκχαρα που χωρίζονται στους: Μονοσακχαρίτες γλυκόζη, φρουκτόζη Δισακχαρίτες σακχαρόζη, μαλτόζη, λακτόζη Ολιγοσακχαρίτες καλαμοσάκχαρο Πολυσακχαρίτες άμυλο, κυτταρίνη,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Διαιτητικές οδηγίες για το ΣΔ. Κατευθυντήριες οδηγίες για τη Διαχείριση του Διαβητικού Ασθενούς


Διαβάστε περισσότερα


«ΓΕΝΙΚΗ ΕΠΙΔΗΜΙΟΛΟΓΙΑ ΚΑΙ ΜΕΘΟΔΟΛΟΓΙΑ ΕΡΕΥΝΑΣ» Εργαστήριο Υγιεινής, Επιδημιολογίας και Ιατρικής Στατιστικής Ιατρική Σχολή ΕΚΠΑ «ΓΕΝΙΚΗ ΕΠΙΔΗΜΙΟΛΟΓΙΑ ΚΑΙ ΜΕΘΟΔΟΛΟΓΙΑ ΕΡΕΥΝΑΣ» Yποχρεωτική άσκηση επιλογής Διατροφική επιδημιολογία Σχετικά θεωρητικά θέματα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μεσογειακής Διατροφής

Μεσογειακής Διατροφής mini Οδηγός Μεσογειακής Διατροφής Γιατί Μεσογειακή Διατροφή; Η μεσογειακή διατροφή αναφέρεται στον τρόπο διατροφής των λαών που ζουν σε περιοχές που αναπτύσσονται γύρω από τη Μεσόγειο. Οι επιστημονικές

Διαβάστε περισσότερα

Κλαίρη Μ. Εργασία στη Βιολογία Α'2 Λυκείου

Κλαίρη Μ. Εργασία στη Βιολογία Α'2 Λυκείου Κλαίρη Μ. Εργασία στη Βιολογία Α'2 Λυκείου Διαβήτης. Ακούμε καθημερίνα γύρω μας πως εκατομμύρια άνθρωποι στον κόσμο πάσχουν από διαβήτη ή παχυσαρκία. Όμως, τι πραγματικά είναι αυτό; Τι ειναι ο σακχαρώδης

Διαβάστε περισσότερα


ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΦΑΡΜΟΓΗ HACCP ΣΤΗΝ ΚΟΥΖΙΝΑ ΝΟΣΟΚΟΜΕΙΟΥ ΕΙΔΙΚΕΣ ΔΙΑΙΤΕΣ. Ελπίδα Παπαδοπούλου Διαιτολόγος, Ε. Α. Ν. Πειραιά «ΜΕΤΑΞΑ» ΕΦΑΡΜΟΓΗ HACCP ΣΤΗΝ ΚΟΥΖΙΝΑ ΝΟΣΟΚΟΜΕΙΟΥ ΕΙΔΙΚΕΣ ΔΙΑΙΤΕΣ Ελπίδα Παπαδοπούλου Διαιτολόγος, Ε. Α. Ν. Πειραιά «ΜΕΤΑΞΑ» ΣΧΕΣΗ ΔΙΑΤΡΟΦΗΣ ΚΑΙ ΥΓΕΙΑΣ Πρόληψη εμφάνισης νοσημάτων Θεραπεία ασθενών στο χώρο του νοσοκομείου

Διαβάστε περισσότερα

PROJECT. Ελαιόλαδο το χρυσάφι στο πιάτο μας. Ελαιόλαδο και υγεία

PROJECT. Ελαιόλαδο το χρυσάφι στο πιάτο μας. Ελαιόλαδο και υγεία ΜΕΛΗ ΟΜΑΔΑΣ: Γιώργος Δερμιτζάκης Δημήτρης Δημητρουλόπουλος Έλενα Ξενάκη Μαργαρίτα Χατζοπούλου PROJECT Ελαιόλαδο το χρυσάφι στο πιάτο μας Ελαιόλαδο και υγεία ΥΠΕΥΘΥΝΕΣ ΚΑΘΗΓΗΤΡΙΕΣ: Λαγουτάρη Ελένη Σούσου

Διαβάστε περισσότερα

διαιτητικές συνήθειες εμβρυϊκή εφηβείας ψυχογενής ανορεξία

διαιτητικές συνήθειες εμβρυϊκή εφηβείας ψυχογενής ανορεξία ΔΙΑΤΡΟΦΗ ΚΑΙ ΥΓΕΙΑ Οι σωστές διατροφικές συνήθειες συμβάλλουν σημαντικά στην προαγωγή της υγείας και στην πρόληψη χρόνιων νοσημάτων. Όσο πιο νωρίς αποκτάμε συνήθειες που προάγουν την υγεία μας τόσο λιγότερα

Διαβάστε περισσότερα

Καρδιολογική Εταιρεία Κύπρου

Καρδιολογική Εταιρεία Κύπρου Προστάτεψε την καρδία σου Καρδιολογική Εταιρεία Κύπρου Καρδιοαγγειακές παθήσεις και γυναικείο φύλο Εισαγωγή Οι καρδιαγγειακές παθήσεις αποτελούν σε παγκόσμιο επίπεδο την κυριότερη αιτία θανάτου στο γυναικείο

Διαβάστε περισσότερα

είναι τα αυτοάνοσα νοσήματα

είναι τα αυτοάνοσα νοσήματα είναι τα αυτοάνοσα νοσήματα Χ.Μ. Μουτσόπουλος Καθηγητής Ιατρικής Σχολής Πανεπιστημίου Αθηνών ο ανοσολογικό (αμυντικό) σύστημα έχει σκοπό την προστασία του οργανισμού από ξένους εισβολείς, όπως είναι τα

Διαβάστε περισσότερα

Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα

Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα φυσική ή μη ειδική ανοσία δεν απαιτεί προηγούμενη έκθεση στο παθογόνο και δεν διαθέτει μνήμη. σε επίκτητη ή ειδική ανοσία χυμική ανοσία με παραγωγή

Διαβάστε περισσότερα


ΕΠΙΝΕΦΡΙΔΙΑ ΚΟΡΤΙΖΟΛΗ ΕΠΙΝΕΦΡΙΔΙΑ ΚΟΡΤΙΖΟΛΗ Μεταβολισμός της κορτιζόλης Η κορτιζόλη μεταβολίζεται στο ήπαρ. Στην συνέχεια οι μεταβολίτες συζευγνύνται με γλυκουρονιδικές και θειικές ομάδες, γίνονται υδατοδιαλυτά, εισέρχονται

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ. Βιολογία

Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ. Βιολογία Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ Βιολογία ΘΕΜΑ 1 Στις ερωτήσεις 1 5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ποιο

Διαβάστε περισσότερα

επιδόρπια γιαουρτιού & γιαούρτι ροφήματα κεφίρ η καλή ζωή έχει ωραίες γεύσεις! Μπανάνα, Φοινίκι & Γαρίφαλο Μήλο, Σταφίδες & Κανέλα

επιδόρπια γιαουρτιού & γιαούρτι ροφήματα κεφίρ η καλή ζωή έχει ωραίες γεύσεις! Μπανάνα, Φοινίκι & Γαρίφαλο Μήλο, Σταφίδες & Κανέλα επιδόρπια γιαουρτιού & γιαούρτι Μπανάνα, Φοινίκι & Γαρίφαλο Μήλο, Σταφίδες & Κανέλα Στραγγιστό γιαούρτι functionalitie that naturallys ροφήματα κεφίρ Ανανάς, Παπάγια, & Μάνγκο Mπανάνα, Βανίλια & Μέλι N.Θ.

Διαβάστε περισσότερα


ΓΑΛΑΚΤΟΚΟΜΕΙΟ Ν. Θ. ΚΟΥΡΟΥΣΙΗ ΛΤΔ ΤΗΛ:+357 24 322336 ΦΑΧ: +357 24 3227807735 ΚΟΦΙΝΟΥ ΛΑΡΝΑΚΑ ΚΥΠΡΟΣ Κεφίρ 28/4/10 Η προέλευση του κεφίρ επισημαίνεται στα καυκάσια βουνά, πολλούς αιώνες πριν, όπου είναι ιδιαίτερα διαδεδομένο για τα οφέλη στην υγεία. Το κεφίρ έχει παραμείνει ένα αγαπημένο ποτό στον Πόντο,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

16 ΟΚΤΩΒΡΙΟΥ : Παγκόσμια Ημέρα Διατροφής. 24 ΟΚΤΩΒΡΙΟΥ Παγκόσμια Ημέρα Παχυσαρκίας

16 ΟΚΤΩΒΡΙΟΥ : Παγκόσμια Ημέρα Διατροφής. 24 ΟΚΤΩΒΡΙΟΥ Παγκόσμια Ημέρα Παχυσαρκίας 16 ΟΚΤΩΒΡΙΟΥ : Παγκόσμια Ημέρα Διατροφής 24 ΟΚΤΩΒΡΙΟΥ Παγκόσμια Ημέρα Παχυσαρκίας Η διατροφή σημαντικός παράγοντας υγείας!! ΔΙΑΤΡΟΦΗ ΚΛΗΡΟΝΟ ΜΙΚΟΤΗΤΑ ΥΓΕΙΑ ΠΕΡΙΒΑΛΛΟΝ ΑΝΘΥΓΕΙΝΕΣ ΣΥΝΗΘΕΙΕΣ Ποιά είναι η

Διαβάστε περισσότερα

Ελεύθερες ρίζες και αντιοξειδωτικά

Ελεύθερες ρίζες και αντιοξειδωτικά Ελεύθερες ρίζες και αντιοξειδωτικά Κατά τη διάρκεια των φυσιολογικών ανθρώπινων διεργασιών παραγωγή ενέργειας, αποτοξίνωση από τοξικές ουσίες και ανοσολογική απόκριση, παράγονται από τον οργανισµό ελεύθερες

Διαβάστε περισσότερα

BITAMINEΣ Ένας σημαντικός σταθμός στη διαιτολογία ήταν η ανακάλυψη, στις πρώτες δεκαετίες του εικοστού αιώνα, των βιταμινών και του σημαντικού ρόλου

BITAMINEΣ Ένας σημαντικός σταθμός στη διαιτολογία ήταν η ανακάλυψη, στις πρώτες δεκαετίες του εικοστού αιώνα, των βιταμινών και του σημαντικού ρόλου BITAMINEΣ Ένας σημαντικός σταθμός στη διαιτολογία ήταν η ανακάλυψη, στις πρώτες δεκαετίες του εικοστού αιώνα, των βιταμινών και του σημαντικού ρόλου αυτών στον οργανισμό. Οι βιταμίνες κατατάσσονται στην

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γράφει: Φανή Πρεβέντη, MSc, Κλινική Διαιτολόγος - Διατροφολόγος

Γράφει: Φανή Πρεβέντη, MSc, Κλινική Διαιτολόγος - Διατροφολόγος Γράφει: Φανή Πρεβέντη, MSc, Κλινική Διαιτολόγος - Διατροφολόγος Η υπέρταση είναι μια «ύπουλη» νόσος η οποία συχνά δεν εμφανίζει συμπτώματα, ωστόσο αποτελεί τον τρίτο κατά σειρά παράγοντα κινδύνου στην

Διαβάστε περισσότερα

Μαρία Καράντζα- Χαρώνη, MD, FAAP Διευθύντρια Ενδοκρινολογικής Κλινικής- Ιατρείου Ελέγχου Βάρους «Παίδων Μητέρα»

Μαρία Καράντζα- Χαρώνη, MD, FAAP Διευθύντρια Ενδοκρινολογικής Κλινικής- Ιατρείου Ελέγχου Βάρους «Παίδων Μητέρα» Μαρία Καράντζα- Χαρώνη, MD, FAAP Διευθύντρια Ενδοκρινολογικής Κλινικής- Ιατρείου Ελέγχου Βάρους «Παίδων Μητέρα» Πως υπολογίζουµε εάν ένα παιδί έχει φυσιολογικό βάρος ; ΒΜΙ = Βάρος/Ύψος² (σε kg/m²) Χρησιμοποιείται

Διαβάστε περισσότερα



Διαβάστε περισσότερα