Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον"

Transcript

1 1 Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον > JM COSTA Εργαστήριο Cerba Aθήνα 11 Φεβρουαρίου, 2012

2 2 Η NIPD προτείνεται στην κλινική πράξη ως διαδικασία ρουτίνας Ναι Όχι Η NIPD γίνεται με τη χρήση κυκλοφορούντων εμβρυϊκών κυττάρων Ναι Όχι Ποιες διαγνώσεις είναι διαθέσιμες το 2012: Προσδιορισμός του φύλου του εμβρύου RHD γονοτυπική τυποποίηση K1 (Kell) γονοτυπική τυποποίηση Αχονδροπλασία Σύνδρομο Down s (τρισωμία 21) Αιμορροφιλία Κυστική Ίνωση Μεσογειακή Αναιμία Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι

3 3 Επεμβατική προσέγγιση για PND (προγεννητική διάγνωση): το θέμα της απώλειας του εμβρύου. Γαλλικά δεδομένα Συνολικές ενδείξεις Αριθμός εμβρύων που ελέγχθηκαν 83,578 Χρωμοσωμιακές ανωμαλίες 74,629 Γενετικές παθήσεις 2,728 Μολυσματικές παθήσεις 4,906 Αριθμός προσβεβλημένων εμβρύων 4,725 > Απώλειες εμβρύων (1%) 835 Ειδικά για χρωμοσωμιακές ανωμαλίες: 74,629 Ηλικία μητέρας ( 38 ετών) 21,927 για 354 τρισωμίες 21 που ανιχνεύθηκαν Βιοχημικός έλεγχος (2T) 31,293 για 406 τρισωμίες 21 που ανιχνεύθηκαν > Απώλειες εμβρύων (1%) 532 για 760 τρισωμίες 21 που ανιχνεύθηκαν

4 4 Πώς μπορεί να επιλυθεί το πρόβλημα της προκαλούμενης εμβρυϊκής απώλειας? 1-Μειώνοντας τον κίνδυνο > Πιο έμπειροι χειριστές, αλλά και πάλι ο κίνδυνος παραμένει γύρω στο 1% 2-Μειώνοντας τον αριθμό των επεμβατικών προσεγγίσεων > Συνδιασμένος έλεγχος της μητέρας (2T > σε συνδυασμό 1T: 11.3% >6.3% γυναίκες σε κίνδυνο) 3-Αναπτύσσοντας μη επεμβατικές προσεγγίσεις > Γενετικός έλεγχος του εμβρύου μέσο ενός μητρικού δείγματος Σύμφωνα με το Γαλλικό δίκτυο ABA για το 2010 : Τεστ1T 37%. Μονήρεις κυήσεις, Όλες οι ηλικίες μητέρας

5 5 Ποια προσέγγιση για την NIPD? «Pubmed» ιστορία Ενδοτραχηλικά εμβρυικά κύτταρα Εμβρυικά κύτταρα στο μητρικό αίμα Εμβρυικό DNA στο μητρικό πλάσμα Εμβρυικό RNA στο μητρικό πλάσμα

6 6 NIPD με την χρήση μητρικού αίματος Κυκλοφορούντα εμβρυικά κύτταρα Prenat Diagn 2002;22: Αποτυχία ανάλυσης στο 17 % των δειγμάτων Ποσοστό ανίχνευσης για Y + κύτταρα (FISH) Ποσοστό ανίχνευσης για T21 + κύτταρα(fish) : 41.4 % (11% ψευδώς θετικά) : 74.4 % (4% ψευδώς θετικά)

7 7 NIPD με την χρήση μητρικού αίματος Κυκλοφορούντα εμβρυικά κύτταρα: όρια Περίπου 1 εμβρυικό κύτταρο ανά ml μητρικού αίματος Δυσκολίες απομόνωσης και/ή εμπλουτισμού (έλλειψη ειδικών δεικτών) Δυσκολίες στην ανάλυση μοναδικών κυττάρων «μικροχιμαιρισμός» (microchimerism, εμμονή)

8 8 Ποια προσέγγιση για την NIPD? «Pubmed» ιστορία Ενδοτραχηλικά εμβρυικά κύτταρα Εμβρυικά κύτταρα στο μητρικό αίμα Εμβρυικό DNA στο μητρικό πλάσμα Εμβρυικό RNA στο μητρικό πλάσμα

9 9 NIPD με την χρήση μητρικού αίματος Κυκλοφορούν, ελεύθερο, εμβρυικό DNA Lancet 1997;350: Ανίχνευση αλληλουχιών προερχόμενων από το χρωμόσωμα Y Εμβρυικά κύτταρα

10 10 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA: πρόσφατα δεδομένα Φυσιοπαθολογία ( -hcg) Εμβρυικό DNA Η κύρια πηγή: κυττο/συνκυτιοτροφοβλαστικά κύτταρα Δυνητικά προβλήματα: ανεμβρυϊκή (μύλη) κύηση VT Syndrome Ψευδώς θετικό Ψευδώς θετικό (εξαφαν. δίδυμου εμβρύου)

11 11 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA: πρόσφατα δεδομένα Φυσιοπαθολογία (SRY= Sex-determination region Y = Περιοχή καθορισμού του φύλου στο Υ) Κινητική εμφάνισης (ανίχνευσης) στο μητρικό αίμα (μετά από IVD) Ψευδώς αρνητικά? 5εβδ 6εβδ 7εβδ 8εβδ 9εβδ 3/10 8/10 10/10 8/8 9/9 Ανιχνεύσιμο SRY DNA/Άρρεν έμβρυο Αποτελεσματικό στην διάρκεια του πρώτου τριμήνου

12 12 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA: πρόσφατα δεδομένα Φυσιοπαθολογία Κυρίως προέρχονται από κυττο/συνκυτιοτροφοβλαστικά κύτταρα Εμφάνιση (ανίχνευση) στο μητρικό αίμα 5-6εβδ Αύξηση συγκέντρωσης με την ηλικία κύησης Γρήγορη κάθαρση (< 24 h) μετά τον τοκετό (χρόνος ημιζωής 16 λεπτά) Δεν υφίστανται μετά την εγκυμοσύνη

13 13 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Δυσκολίες και περιορισμοί της διαδικασίας Μικρή ποσότητα εμβρυικού DNA στο μητρικό πλάσμα (ειδικά στην διάρκεια του πρώτου τριμήνου): 16Geq/ml Ευαισθησία : 37-91%

14 14 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Δυσκολίες και περιορισμοί της διαδικασίας Μικρή ποσότητα εμβρυικού DNA στο μητρικό πλάσμα (ειδικά στην διάρκεια του πρώτου τριμήνου 16Geq/ml) Υπόστρωμα μητρικού DNA (χαμηλό ποσοστό ολικού DNA στο μητρικό πλάσμα: περίπου 3-6%) Η ανάλυση περιορίζεται στην ανίχνευση αλληλουχιών που δεν υπάρχουν στο μητρικό γονιδίωμα

15 15 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Τρέχουσες εφαρμογές Y X 1-Προσδιορισμός φύλου του εμβρύου: Αλληλουχίες προερχόμενες από το χρωμόσωμα Y (πχ. γονίδιοsry )

16 16 NIPD (1): προσδιορισμός του φύλου του εμβρύου Κλινική χρησιμότητα και στόχοι Προσέγγιση φυλοσύνδετων νοσημάτων (X-linked) σε εγκύους φορείς Με σκοπό να αποφευχθούν επεμβατικές προσεγγίσεις σε περίπτωση θηλυκού εμβρύου Προσέγγιση κυήσεων ζευγαριών με κίνδυνο συγγενούς υπερπλασίας των επινεφριδίων (congenital adrenal hyperplasia) Με σκοπό να αποφύγουμε την περιττή θεραπεία με στεροειδή σε περίπτωση θηλυκού εμβρύου Προσέγγιση κυήσεων με υπερηχογραφικά ευρήματα

17 17 NIPD (1): προσδιορισμός του φύλου του εμβρύου Η εμπειρία του εργαστηρίου Cerba : (n=4693) Year Test Συνολική ευαισθησία και ειδικότητα >99% Duchenne dystrophy 266 Congenital adrenal hyperplasia 173 Hemophiliia A 168 Becker dystrophy 62 Genital ambiguity on ultrasound 45 Hemophilia B 45 Fragile X syndrome 41 Alport syndrome 25 X-linked Hydrocephaly 25 Adrenoleucodystrophy 24 Hunter disease 22 Myotubular myopathy 21 Menkes disease 20 Retinitis pigmentosum 17 X-linked Mental Retardation 17 Anhydrotic ectodermic dysplasia 15 Bruton disease 14 Incontinentia pigmenti 11 X-linked Mental Retardation (unknown) 11 Other (<10) 203

18 18 18 NIPD (1): προσδιορισμός του φύλου του εμβρύου Συστάσεις στη Γαλλία

19 19 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Τρέχουσες εφαρμογές RHD+ RHD- 2- Γονοτυπική τυποποίηση Rhesus D: Αλληλουχίες οι οποίες προέρχονται από το γονίδιο RHD (το οποίο γενικά είναι απόν σε RhD-αρνητικούς ασθενείς)

20 20 NIPD (2): εμβρυική γονοτυπική τυποποίηση RHD Συγκριτικά αποτελέσματα στην Ευρώπη Sanquin IGBRL Cerba CNRHP NL GB FR FR Πλάσμα T3 Πλάσμα T3 Ορός T1 Πλάσμα T2 (εξώνια 5+7) (εξώνια 5+7) (εξώνιο 10) (εξώνια 7+10) Ασθενείς (n=) Χρόνος κύησης στην λήψη (εβδ) > RHD αρνητικό έμβρυο 915 (38.4%) 670 (35.9%) 1194 (32,9%) 193 (21,6%) Ψευδώς αρνητικά 7 (0,26%) 3 (0,16%) 1 (0,03%) 4 (0,4%) Ψευδώς θετικά 5 (0,20%) 14 (0,75%) >3 (0,10%) 5 (0,54%) Ασαφή NA 31 (1,7)% 117 (3,1%) 5.4% 30 ασθενείς με καταγωγή από την Αφρική ή την Καραϊβική

21 21 NIPD (2): εμβρυική γονοτυπική τυποποίηση RHD Κλινική χρησιμότητα και στόχοι Αντιμετώπιση της αλλοανοσοποίησης RhD εγκύων Ταυτοποίηση γυναικών με κίνδυνο για αλλοανοσοποίηση Με σκοπό να αποφευχθεί άσκοπη χορήγηση προϊόντων αίματος (anti- D ανοσοσφαιρίνες) σε περίπτωση RhD-αρνητικού εμβρύου και την εξοικονόμηση σπάνιου προϊόντος Αυξημένη αποτελεσματικότητα προφύλαξης (Jones et al, BJOG 2004;111: ): 1 περίπτωση αποφυγής αλλοαοσοποίησης για 278 γυναίκες που έλαβαν αγωγή χωρίς γονοτυπική τυποποίηση ή 166 όταν το έμβρυο είναι γνωστό RhD-θετικό

22 NIPD (2): εμβρυική γονοτυπική τυποποίηση RhD Η εμπειρία του εργαστηρίου Cerba : (n=6149) Συστηματικός έλεγχος 4920 Αλλοανοσοποιημένοι ασθενείς 280 Επεμβατική διαδικασία 837 RHD Θετικοί 4053 RHD Αρνητικοί 1910 ή 32% Ασαφή 186 ή 3% Τραύμα αιμορραγία Μη Καυκάσιοι 42% Καυκάσιοι Cde ή cde 38% Συνολική κλινική ευαισθησία και ειδικότητα >99%

23 23 NIPD (2): εμβρυική γονοτυπική τυποποίηση RhD Συστάσεις στη Γαλλία Κολλέγιο Μαιευτήρων(Δεκέμβριος 2005) : Συστηματική προφύλαξη (Rhophylac 300µg) στις εβδομάδες «Εάν είναι δυνατόν, συστήνεται μη επεμβατική γονοτυπική ταυτοποίηση RHD, με σκοπό την στοχοποίηση της προφύλαξης σε εκείνες τις γυναίκες που κυοφορούν RhD-θετικά έμβρυα»

24 24 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Τρέχουσες εφαρμογές CGG CGG CATCCTCAGCTACAGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT

25 25 Ανίχνευση χαμηλού ποσοστού μεταλλαγμένου αλληλόμορφου Ευαίσθητες μέθοδοι Allele-Specific PCR, DHPLC, Minisequencing, HRM.. 5% 2.5% 1% 0% Ποσοστό του μεταλλαγμένου αλληλόμορφου σε υπόστρωμα φυσιολογικής αλληλουχίας

26 26 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Διαταραχές μοναδικών γονιδίων: τρέχουσες εφαρμογές CGG CGG Μετάλλαξη de novo : αχονδροπλασία Ανίχνευση μετάλλαξης G>A και G>C στο γονίδιο FGFR3 Κλινική μελέτη επικύρωσης: 109 ασθενείς και δείγματα αναφοράς (μέση ηλικία κύησης: 33 εβδομάδες) CATCCTCAGCTACAGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT Ευαισθησία 100% (όλα τα προσβεβλημένα έμβρυα διαγνώστηκαν σωστά n=25) Ειδικότητα 100% (δεν υπήρξαν ψευδώς θετικά) Νέα προσέγγιση στην διάγνωση ύποπτων περιπτώσεων από υπερηχογράφημα και/ή3d scan

27 27 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Διαταραχές μοναδικών γονιδίων: τρέχουσες εφαρμογές ATG (K1) ACG (K2) Πατρικά-κληρονομούμενη SNP: KEL (K1) γονότυπος Ανίχνευση της c.578c>t (p.thr193met) στο γονίδιο KEL SNP=single nucleotide polymorphisme= Πολυμορφισμός μοναδικού νουκλεοτιδίου Αντιμετώπιση εγκύων αλλοανοσοποιημένων K1 TTTAACCGAA TGCTGAGACTT TTTAACCGAA CGCTGAGACTT TTTAACCGAA CGCTGAGACTT TTTAACCGAA CGCTGAGACTT TTTAACCGAA CGCTGAGACTT TTTAACCGAA CGCTGAGACTT

28 28 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Διαταραχές μοναδικών γονιδίων : περιορισμοί ACG ATG NIPD Δύσκολα εφικτό προς το παρόν για: TTTAACCGAA CGCTGAGACTT TTTAACCGAA TGCTGAGACTT TTTAACCGAA TGCTGAGACTT TTTAACCGAA TGCTGAGACTT TTTAACCGAA TGCTGAGACTT Αιμορροφιλία Κυστική Ίνωση Μεσογειακή Αναιμία

29 29 NIPD χρωμοσωματικών ανωμαλιών Μείζων τεχνική πρόκληση Ανευπλοειδία (τρισωμία 13, 18 και/ή 21): προσδιορισμός του αριθμού αντιγράφων του εμβρυικού χρωμοσώματος: Ειδικοί εμβρυικοί στόχοι: πλακουντιακό (εμβρυικό) ειδικό RNA ή επιγενετικοί δείκτες (μεθυλιωμένο DNA)

30 30 NIPD χρωμοσωματικών ανωμαλιών Μείζων τεχνική πρόκληση Ανευπλοειδία (τρισωμία 13, 18 και/ή 21): προσδιορισμός του αριθμού αντιγράφων του εμβρυικού χρωμοσώματος: Ειδικοί εμβρυικοί στόχοι: πλακουντιακό (εμβρυικό) ειδικό RNA ή επιγενετικοί δείκτες (μεθυλιωμένο DNA) Μη ειδικοί στόχοι: απαιτείται εξαιρετικά ακριβής μέτρηση αριθμού αντιγράφων «counting»

31 31 Κυκλοφορούν, ελεύθερο κυττάρων, εμβρυικό DNA και ανίχνευση τρισωμίας 21 Μη ειδική ποσοτικοποίηση 95 μητρικά αντίγραφα 5 εμβρυικά αντίγραφα 95 μητρικά αντίγραφα 7.5 εμβρυικά αντίγραφα 100 αντίγραφα αντίγραφα 10,000,000 αντίγραφα 10,250,000 αντίγραφα

32 32 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA και ανίχνευση τρισωμίας 21 Ποσοτικοποίηση με «massively parallel sequencing» «μαζικά παράλληλο προσδιορισμό αλληλουχίας» Αναγνώσεις (5-10 M) χρωμοσώματα Ενίσχυση απλού μορίου Μαζικά παράλληλος προσδιορισμός αλληλουχίας Ερμηνία: Zscore=%21μέσου όρου δείγματος%21αναφοράς/sd%21αναφοράς Cut-off Zscore>3 (%21>99.9centile)

33 33 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA και ανίχνευση τρισωμίας 21 Ποσοτικοποίηση με «massively parallel sequencing» 18 ασθενείς (μέση ηλικία: 18 εβδομάδες) Όλες οι περιπτώσεις (9) ταυτοποιήθηκαν σωστά 15 ασθενείς (μέση ηλικία: 14 εβδομάδες) Όλες οι περιπτώσεις (5) ταυτοποιήθηκαν σωστά

34 34 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA και ανίχνευση τρισωμίας 21 Ποσοτικοποίηση με «massively parallel sequencing» 236 δείγματα (86T μη T21) Μέση ΗΚ: 13 εβδομάδες +1 ημέρα Ευαισθησία: 100% Ειδικότητα : 97.9% (2.1% ψευδώς θετικά)

35 35 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA και ανίχνευση τρισωμίας 21 Ποσοτικοποίηση με «massively parallel sequencing» 449 δείγματα (39T μη T21) (PPV (θετική προγνωστική αξία) 1/12) Μέση ΗΚ: 16 εβδομάδες Ευαισθησία : 100% Ειδικότητα : 99.7% (0.3% false-positive)

36 36 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA ανίχνευση τρισωμιών Ποσοτικοποίηση με «massively parallel sequencing»

37 37 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA/RNA και ανίχνευση τρισωμίας 21 Ποσοτικοποίηση με «massively parallel sequencing» 1696 ασθενείς (212T μη T21) (VPP 1/7) Μέση Διάρκεια κύησης: 15 εβδομάδες Άστοχες δοκιμασίες: 13 (0.8%) Ευαισθησία: 99,5% (211/212) Ειδικότητα: 99,8% (0.2% ψευδώς αρνητικών)

38 38 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA : το μέλλον? Ολική ανάλυση του εμβρυικού γονιδιώματος NIPD Μεσογειακής Αναιμίας

39 39 Η NIPD προτείνεται στην κλινική πράξη ως διαδικασία ρουτίνας Ναι Όχι Η NIPD γίνεται με τη χρήση κυκλοφορούντων εμβρυϊκών κυττάρων Ναι Όχι Ποιες διαγνώσεις είναι διαθέσιμες το 2012: Προσδιορισμός του φύλου του εμβρύου RHD γονοτυπική τυποποίηση K1 (Kell) γονοτυπική τυποποίηση Αχονδροπλασία Σύνδρομο Down s (τρισωμία 21) Αιμορροφιλία Κυστική Ίνωση Μεσογειακή Αναιμία Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι

40 Σήμερα θα πάρουμε λίγο αίμα, για να προσδιορίσουμε το φύλο του εμβρύου! 40

Μη επεμβατικός Προγεννητικός έλεγχος

Μη επεμβατικός Προγεννητικός έλεγχος Μη επεμβατικός Προγεννητικός έλεγχος Α. Κολιαλέξη, Βιοπαθολόγος PhD Εργαστήριο Ιατρικής Γενετικής Πανεπιστημίου Αθηνών Μη επεμβατικός ΠΕ από cffdna στο πλάσμα εγκύου Ελεύθερο Εμβρυϊκό DNA στη μητρική κυκλοφορία

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης Οι ανιχνευτικές εξετάσεις (screening test) έχουν ευρεία εφαρμογή και μεγάλη πρακτική χρησιμότητα στον προγεννητικό έλεγχο. Ο προγεννητικός έλεγχος

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr. Πίνακας 1.

Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr. Πίνακας 1. Ενημερωτικό Δελτίο Τεύχος 1 Δεκέμβριος 2007 Εργαστήριο Κλινικής Βιοχημείας και Εργαστηριακής Ιατρικής Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr

Διαβάστε περισσότερα

cell-free DNA στο μητρικό αίμα

cell-free DNA στο μητρικό αίμα cell-free DNA στο μητρικό αίμα Εφαρμογή στην κλινική πράξη στην Ελλάδα Παπαϊωάννου Γεώργιος-Κων/νος, PhD Υπεύθυνος Ιατρικής Εμβρύου Maιευτική & Γυναικολογική Κλινική ΓΑΙΑ Cell free DNA / Εισαγωγή στην

Διαβάστε περισσότερα

Προγεννητικός Έλεγχος - Μαιευτικό Υπερηχογράφημα

Προγεννητικός Έλεγχος - Μαιευτικό Υπερηχογράφημα Προγεννητικός Έλεγχος - Μαιευτικό Υπερηχογράφημα upadate swfobject.embedswf('/plugins/content/avreloaded/mediaplayer.swf','avreloaded0','400','320','7. 0.14','/plugins/content/avreloaded/expressinstall.swf',

Διαβάστε περισσότερα

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008 ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ Δρ.Δ.Λάγγας Αθήνα 2008 Ορισμοί Γενετική: μελέτη της κληρονομικότητας και των παραλλαγών της Ιατρική γενετική: η γενετική του ανθρώπινου είδους Κλινική γενετική:

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΠΡΩΤΟΒΑΘΜΙΑ ΦΡΟΝΤΙ Α ΥΓΕΙΑΣ ΓΙΑΤΗ ΜΗΤΕΡΑ ΚΑΙ ΤΟ ΕΜΒΡΥΟ

ΠΡΩΤΟΒΑΘΜΙΑ ΦΡΟΝΤΙ Α ΥΓΕΙΑΣ ΓΙΑΤΗ ΜΗΤΕΡΑ ΚΑΙ ΤΟ ΕΜΒΡΥΟ ΠΡΩΤΟΒΑΘΜΙΑ ΦΡΟΝΤΙ Α ΥΓΕΙΑΣ ΓΙΑΤΗ ΜΗΤΕΡΑ ΚΑΙ ΤΟ ΕΜΒΡΥΟ Εργαστήριο Υγιεινής, Επιδημιολογίας και Ιατρικής Στατιστικής ΕΚΠΑ, σε συνεργασία με Αναπλ. Καθηγητή Ν. Παπαντωνίου, Α Μαιευτική και Γυναικολογική

Διαβάστε περισσότερα

Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις. M. Ξημέρη, ειδικ. Αιματολογίας

Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις. M. Ξημέρη, ειδικ. Αιματολογίας Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις M. Ξημέρη, ειδικ. Αιματολογίας Εισαγωγή Σύστημα RhD : - αναγνωρίστηκε το 1939 - το πιο σημαντικό κλινικά σύστημα μετά το ΑΒΟ - προκαλεί αιμολυτικές

Διαβάστε περισσότερα

Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα

Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα MAΡΙΑ ΠΑΠΑΛΟΥΚΑ Κλινική Εμβρυολόγος Μονάδα Αναπαραγωγικής Ιατρικής Περιεχόμενα Ορισμός Ιστορική Αναδρομή Γενετική

Διαβάστε περισσότερα

ΑΜΝΙΟΠΑΡΑΚΕΝΤΗΣΗ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών

ΑΜΝΙΟΠΑΡΑΚΕΝΤΗΣΗ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών ΑΜΝΙΟΠΑΡΑΚΕΝΤΗΣΗ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών ΙΠΠΟΚΡΑΤΕΙΟ ΝΟΣΟΚΟΜΕΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΕΠΙΚΟΙΝΩΝΙΑ ΤΗΛ: 2310892819 e-mail: hmesogiaki@ippokratio.gr

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη.

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. 12 Γενετικό γλωσσάριο Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. Ιανουάριος 2009 Τροποποιηµένο από το γλωσσάριο που αρχικά δηµιουργήθηκε από το Πάρκο Γενετικής Γνώσης London IDEAS (London

Διαβάστε περισσότερα

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 1) ΑΝΩΜΑΛΙΕΣ ΣΤΟΝ ΑΡΙΘΜΟ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΕΥΠΛΟΕΙΔΙΑ: ΚΑΘΕ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΑΡΙΘΜΟΥ Ν (ΑΠΛΟΕΙΔΕΣ ΓΟΝΙΔΙΩΜΑ) 3Ν ΑΥΘΟΡΜΗΤΕΣ ΑΠΟΒΟΛΕΣ 4Ν τριπλοειδία Α) Γονιμοποίηση ωαρίου

Διαβάστε περισσότερα

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ Μικροβιολογικό & Ερευνητικό Εργαστήριο Καθ έξιν Αποβολές Οι καθ 'έξιν αποβολές είναι μια ασθένεια σαφώς διακριτή από τη στειρότητα, και που ορίζεται ως δύο ή περισσότερες αποτυχημένες

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι Β Προβλήματα Φαινότυπος Β(Α): ασθενής αντίδραση με αντι-α, έντονη αντίδραση με αντι-β, και ο ορός αντιδρά με ερυθρά Α₁. Ο αντιορός Α περιέχει τον κλώνο ΜΗΟ4? Επίκτητος Β φαινότυπος: έντονη αντίδραση με

Διαβάστε περισσότερα

Χρωμοσωματικές ανωμαλίες

Χρωμοσωματικές ανωμαλίες Χρωμοσωματικές ανωμαλίες ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΕΥΘΥΝΟΝΤΑΙ ΓΙΑ: 50% ΤΩΝ ΑΥΘΟΡΜΗΤΩΝ ΑΠΟΒΟΛΩΝ ΠΕΡΙΣΣΟΤΕΡΑ ΑΠΟ 60 ΣΥΝΔΡΟΜΑ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ ~0.7% ΤΩΝ ΒΡΕΦΩΝ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ 2 % ΤΩΝ ΚΥΗΣΕΩΝ ΜΗΤΕΡΩΝ ΑΝΩ ΤΩΝ

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ

25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ Η Rh ανοσοποίηση οφείλεται σε εμβρυο-μητρική μετάγγιση (ΕΜΜ), όπου ποσότητα Rh θετικού εμβρυϊκού αίματος εισέρχεται στη μητρική κυκλοφορία Rh αρνητικής εγκύου και δημιουργούνται αντισώματα κατά του παράγοντα

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

Προεμφυτευτική Γενετική Διάγνωση. Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος

Προεμφυτευτική Γενετική Διάγνωση. Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος Προεμφυτευτική Γενετική Διάγνωση Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος Στάδια Προεμφυτευτικής Γενετικής Διάγνωσης (P.G.D) Διέγερση ωοθηκών για την ωρίμανση μεγάλου αριθμού (ει δυνατόν ) ωοθυλακίων

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα

ΑΠΟΚΌΛΛΗΣΗ ΠΛΑΚΟΎΝΤΑ

ΑΠΟΚΌΛΛΗΣΗ ΠΛΑΚΟΎΝΤΑ ΑΠΟΚΌΛΛΗΣΗ ΠΛΑΚΟΎΝΤΑ Παθοφυσιολογία, Διάγνωση και Αντιμετώπιση Alexander Kofinas, MD Director Kofinas Perinatal Associate Professor Clinical Obstetrics and Gynecology Cornell University, College of Medicine

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

Δειγματοληψία Χοριακών Λαχνών (CVS) ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών

Δειγματοληψία Χοριακών Λαχνών (CVS) ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών Δειγματοληψία Χοριακών Λαχνών (CVS) ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών ΙΠΠΟΚΡΑΤΕΙΟ ΝΟΣΟΚΟΜΕΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΕΠΙΚΟΙΝΩΝΙΑ ΤΗΛ: 2310892819

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες 12 Φυλοσύνδετη στο Χ Ή την τοπική σας κλινική γενετικής διάγνωσης: κληρονοµικότητα Εργαστήριο Ιατρικής Γενετικής Πανεπιστήµιο Αθηνών Νοσοκοµείο Παίδων " Αγία Σοφία" Αθήνα Τηλ: +210 7795553 http://iatriki-genetiki.med.uoa.gr

Διαβάστε περισσότερα

Universitäts-Frauenklinik Essen. Προγεννετικος Ελεγχος και Περιγεννητικη Ιατρικη Επιπεδο 1

Universitäts-Frauenklinik Essen. Προγεννετικος Ελεγχος και Περιγεννητικη Ιατρικη Επιπεδο 1 Universitäts-Frauenklinik Essen Προγεννετικος Ελεγχος και Περιγεννητικη Ιατρικη Επιπεδο 1 Αξιοτιμοι συναδελφοι, αγαπητοι γονεις, Τα πανεπιστημιακα μας εξωτερικα Ιατρεια Περιγεννητικης ιατρικης σας προσφερουν

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες 12 Orphanet Ιστοσελίδα ελεύθερης πρόσβασης που παρέχει πληροφορίες για τις σπάνιες παθήσεις, τα κλινικά πειράµατα, τα φάρµακα και συνδέσµους για οµάδες υποστήριξης σε ολόκληρη την Ευρώπη. Ιστοσελίδα: www.orpha.net

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ «ΣΥΜΒΟΛΗ ΣΤΗ ΜΟΡΙΑΚΗ ΠΡΟΓΕΝΝΗΤΙΚΗ ΔΙΑΓΝΩΣΗ ΑΝΕΥΠΛΟΕΙΔΙΩΝ ΚΑΙ ΦΥΛΟΥ ΜΕ ΧΡΗΣΗ

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΓΙΑ ΤΑ ΤΜΗΜΑΤΑ ΠΓΘΤ, ΓΘΤ, ΠαΘΤ Θέμα Α Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

screening πρωτου τριμηνου

screening πρωτου τριμηνου Universitäts-Frauenklinik Essen screening πρωτου τριμηνου Τι ονομαζεται screening πρωτου τριμηνου Εδω αξιολογειται ο κινδυνος υπαρξης ανωμαλιας χρωματοσωματων στο εμβρυο οπως( π.χ. (συνδρομο Down, συνδρομο

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΜΑΙΕΥΤΙΚΗ ΚΑΙ ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΕΤΑΙΡΕΙΑ ΔΕΛΤΙΟ ΤΥΠΟΥ

ΕΛΛΗΝΙΚΗ ΜΑΙΕΥΤΙΚΗ ΚΑΙ ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΕΤΑΙΡΕΙΑ ΔΕΛΤΙΟ ΤΥΠΟΥ ΕΛΛΗΝΙΚΗ ΜΑΙΕΥΤΙΚΗ ΚΑΙ ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΕΤΑΙΡΕΙΑ Αθήνα, 20/05/2015 ΔΕΛΤΙΟ ΤΥΠΟΥ 13 ο Πανελλήνιο Συνέδριο Μαιευτικής Γυναικολογίας στο Βόλο, 28-31 Μαΐου 2015 Στο πλαίσιο της συνεχιζόμενης ιατρικής εκπαίδευσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

Αιμορραγίες κατά την εγκσμοσύνη. Σωηήξεο Ν. Μήηξνπ

Αιμορραγίες κατά την εγκσμοσύνη. Σωηήξεο Ν. Μήηξνπ Αιμορραγίες κατά την εγκσμοσύνη Σωηήξεο Ν. Μήηξνπ 12/11/2012 127.000 θάνατοι κατά την κύηση και τον τοκετό λόγω αιμορραγίας παγκοσμίως Η αιμορραγία αποτελεί μία από τις κυριότερε ς αιτίες άμεσου θανάτου

Διαβάστε περισσότερα

2. Λήψη αίματος από τα ομφαλικά αγγεία

2. Λήψη αίματος από τα ομφαλικά αγγεία Xατζησεβαστού Λουκίδου Χαρίκλεια 3 κό αποτύπωμα και γνωρίζοντας την επίδραση του αποτυπώματος στη μονογονεϊκή δισωμία (uniparental disomy UPD) από αυτά τα χρωμοσώματα, οδηγηθήκαμε στην γνώση ότι μια Robertsonian

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ

ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ Dr Α. Μεντής, Ιατρός Βιοπαθολόγος, Κλινικός Μικροβιολόγος ιευθυντής ιαγνωστικού Τμήματος ιευθυντής Εργαστηρίου Ιατρικής Μικροβιολογίας ιευθυντής Εθνικού Εργαστηρίου

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Γενετικός Έλεγχος για Λόγους Υγείας

Γενετικός Έλεγχος για Λόγους Υγείας Γενετικός Έλεγχος για Λόγους Υγείας ΚΆΤΩ ΑΠΌ ΠΟΙΕΣ ΣΥΝΘΉΚΕΣ ΠΡΟΒΛΈΠΕΤΑΙ Ο ΓΕΝΕΤΙΚΌΣ ΈΛΕΓΧΟΣ; ΕΠΑΓΓΕΛΜΑΤΙΚΉ ΓΕΝΕΤΙΚΉ ΣΥΜΒΟΥΛΕΥΤΙΚΉ ΤΙ ΨΆΧΝΟΥΜΕ ΜΕ ΤΟΝ ΓΕΝΕΤΙΚΌ ΈΛΕΓΧΟ; Η ΔΙΚΉ ΣΑΣ ΑΠΌΦΑΣΗ Γενετικός Έλεγχος

Διαβάστε περισσότερα

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής?

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής? 12 εργαστήριο ίσως ελέγξει τα αποθηκευµένα δείγµατα (ιδιαίτερα εάν ο αρχικός έλεγχος δεν έδωσε αποτέλεσµα), αλλά µόνο εάν έχετε δώσει τη γραπτή σας συγκατάθεση για κάτι τέτοιο. Με αυτό τον τρόπο οι ασθενείς

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Εργαστηριακή Διάγνωση της HIV λοίμωξης Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Διάγνωση της HIV λοίμωξης Από το 1985 και μέχρι σήμερα η διαγνωστική διαδικασία

Διαβάστε περισσότερα

ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 2) ΑΝΩΜΑΛΙΕΣ ΣΤΗ ΔΟΜΗ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ Αποτέλεσμα θραύσης και ανώμαλης ανασύστασης χρωμοσωμάτων Αφορούν ή ένα χρωμόσωμα περισσότερα χρωμοσώματα Είναι ή Ισοζυγισμένες (διατηρείται

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ»

ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ» ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ» 1 η ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ ΑΣΥΜΦΩΝΙΑ ΜΕΤΑΞΥ ΟΡΟΛΟΓΙΚΟΥ ΚΑΙ ΕΡΥΘΡΟΚΥΤΤΑΡΙΚΟΥ ΠΡΟΣΔΙΟΡΙΣΜΟΥ ΤΗΣ ΑΒΟ ΟΜΑΔΑΣ Επίτοκος 36 ετών

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Εργαστήριο Ιστολογίας & Εμβρυολογίας. Α. Κοτσίνας Επικ. Καθηγητής

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Εργαστήριο Ιστολογίας & Εμβρυολογίας. Α. Κοτσίνας Επικ. Καθηγητής ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Εργαστήριο Ιστολογίας & Εμβρυολογίας Α. Κοτσίνας Επικ. Καθηγητής Τι είναι οι συγγενείς ανωμαλίες Ανατομικές ανωμαλίες οι οποίες υπάρχουν ήδη από

Διαβάστε περισσότερα

Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον

Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον 1 ο Επιμορφωτικό Σεμινάριο Γενετικής ΤΙ ΝΕΟΤΕΡΟ ΣΤΗΝ ΕΡΓΑΣΤΗΡΙΑΚΗ ΓΕΝΕΤΙΚΗ ΑΝΑΛΥΣΗ Εξελίξεις στην Προεμφυτευτική Γενετική Ανάλυσητο μέλλον Γεωργία Κάκουρου, PhD ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ,

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Ωρολόγιο Πρόγραμμα Χειμερινού Εξαμήνου Ακαδημαϊκό Έτος 2014-2015

Ωρολόγιο Πρόγραμμα Χειμερινού Εξαμήνου Ακαδημαϊκό Έτος 2014-2015 ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙ ΑΣ Τ Μ Η Μ Α Ι ΑΤ Ρ Ι ΚΗΣ Π Ρ Ο Γ Ρ ΑΜ Μ Α Μ Ε Τ Α Π Τ Υ Χ Ι ΑΚ Ω Ν Σ Π Ο Υ Δ Ω Ν «Β Ι Ο Λ Ο Γ Ι Α Τ Η Σ Α Ν Α Π Α Ρ Α Γ Ω Γ Η Σ» Βιόπολις, 41110 Λάρισα E-mail:

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ

ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ ΣΥΓΓΕΝΕΙΣ ΑΝΩΜΑΛΙΕΣ - ΥΣΜΟΡΦΟΛΟΓΙΑ ΕΛ. ΦΡΥΣΙΡΑ Επ. Καθηγήτρια Κλινικής Γενετικής ΕΡΓΑΣΤΗΡΙΟ ΙΑΤΡΙΚΗΣ ΓΕΝΕΤΙΚΗΣ ΠΑΝ/ΜΙΟΥ ΑΘΗΝΩΝ ΝΟΣΟΚΟΜΕΙΟ ΠΑΙ ΩΝ «Η ΑΓΙΑ ΣΟΦΙΑ» ΙΕΥΘΥΝΤΗΣ: ΚΑΘΗΓΗΤΗΣ κ.ε. ΚΑΝΑΒΑΚΗΣ ΣΥΓΓΕΝΕΙΣ

Διαβάστε περισσότερα

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΗΣΗΣ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΚΛΗΡΟΝΟΜΙΚΩΝ ΝΟΣΩΝ ΑΥΤΟΣΩΜΙΚΗ ΕΠΙΚΡΑΤΗΣ ΑΥΤΟΣΩΜΙΚΗ ΥΠΟΛΕΙΠΟΜΕΝΗ ΦΥΛΟΣΥΝ ΕΤΗ ΥΠΟΛΕΙΠΟΜΕΝΗ

Διαβάστε περισσότερα