Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον"

Transcript

1 1 Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον > JM COSTA Εργαστήριο Cerba Aθήνα 11 Φεβρουαρίου, 2012

2 2 Η NIPD προτείνεται στην κλινική πράξη ως διαδικασία ρουτίνας Ναι Όχι Η NIPD γίνεται με τη χρήση κυκλοφορούντων εμβρυϊκών κυττάρων Ναι Όχι Ποιες διαγνώσεις είναι διαθέσιμες το 2012: Προσδιορισμός του φύλου του εμβρύου RHD γονοτυπική τυποποίηση K1 (Kell) γονοτυπική τυποποίηση Αχονδροπλασία Σύνδρομο Down s (τρισωμία 21) Αιμορροφιλία Κυστική Ίνωση Μεσογειακή Αναιμία Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι

3 3 Επεμβατική προσέγγιση για PND (προγεννητική διάγνωση): το θέμα της απώλειας του εμβρύου. Γαλλικά δεδομένα Συνολικές ενδείξεις Αριθμός εμβρύων που ελέγχθηκαν 83,578 Χρωμοσωμιακές ανωμαλίες 74,629 Γενετικές παθήσεις 2,728 Μολυσματικές παθήσεις 4,906 Αριθμός προσβεβλημένων εμβρύων 4,725 > Απώλειες εμβρύων (1%) 835 Ειδικά για χρωμοσωμιακές ανωμαλίες: 74,629 Ηλικία μητέρας ( 38 ετών) 21,927 για 354 τρισωμίες 21 που ανιχνεύθηκαν Βιοχημικός έλεγχος (2T) 31,293 για 406 τρισωμίες 21 που ανιχνεύθηκαν > Απώλειες εμβρύων (1%) 532 για 760 τρισωμίες 21 που ανιχνεύθηκαν

4 4 Πώς μπορεί να επιλυθεί το πρόβλημα της προκαλούμενης εμβρυϊκής απώλειας? 1-Μειώνοντας τον κίνδυνο > Πιο έμπειροι χειριστές, αλλά και πάλι ο κίνδυνος παραμένει γύρω στο 1% 2-Μειώνοντας τον αριθμό των επεμβατικών προσεγγίσεων > Συνδιασμένος έλεγχος της μητέρας (2T > σε συνδυασμό 1T: 11.3% >6.3% γυναίκες σε κίνδυνο) 3-Αναπτύσσοντας μη επεμβατικές προσεγγίσεις > Γενετικός έλεγχος του εμβρύου μέσο ενός μητρικού δείγματος Σύμφωνα με το Γαλλικό δίκτυο ABA για το 2010 : Τεστ1T 37%. Μονήρεις κυήσεις, Όλες οι ηλικίες μητέρας

5 5 Ποια προσέγγιση για την NIPD? «Pubmed» ιστορία Ενδοτραχηλικά εμβρυικά κύτταρα Εμβρυικά κύτταρα στο μητρικό αίμα Εμβρυικό DNA στο μητρικό πλάσμα Εμβρυικό RNA στο μητρικό πλάσμα

6 6 NIPD με την χρήση μητρικού αίματος Κυκλοφορούντα εμβρυικά κύτταρα Prenat Diagn 2002;22: Αποτυχία ανάλυσης στο 17 % των δειγμάτων Ποσοστό ανίχνευσης για Y + κύτταρα (FISH) Ποσοστό ανίχνευσης για T21 + κύτταρα(fish) : 41.4 % (11% ψευδώς θετικά) : 74.4 % (4% ψευδώς θετικά)

7 7 NIPD με την χρήση μητρικού αίματος Κυκλοφορούντα εμβρυικά κύτταρα: όρια Περίπου 1 εμβρυικό κύτταρο ανά ml μητρικού αίματος Δυσκολίες απομόνωσης και/ή εμπλουτισμού (έλλειψη ειδικών δεικτών) Δυσκολίες στην ανάλυση μοναδικών κυττάρων «μικροχιμαιρισμός» (microchimerism, εμμονή)

8 8 Ποια προσέγγιση για την NIPD? «Pubmed» ιστορία Ενδοτραχηλικά εμβρυικά κύτταρα Εμβρυικά κύτταρα στο μητρικό αίμα Εμβρυικό DNA στο μητρικό πλάσμα Εμβρυικό RNA στο μητρικό πλάσμα

9 9 NIPD με την χρήση μητρικού αίματος Κυκλοφορούν, ελεύθερο, εμβρυικό DNA Lancet 1997;350: Ανίχνευση αλληλουχιών προερχόμενων από το χρωμόσωμα Y Εμβρυικά κύτταρα

10 10 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA: πρόσφατα δεδομένα Φυσιοπαθολογία ( -hcg) Εμβρυικό DNA Η κύρια πηγή: κυττο/συνκυτιοτροφοβλαστικά κύτταρα Δυνητικά προβλήματα: ανεμβρυϊκή (μύλη) κύηση VT Syndrome Ψευδώς θετικό Ψευδώς θετικό (εξαφαν. δίδυμου εμβρύου)

11 11 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA: πρόσφατα δεδομένα Φυσιοπαθολογία (SRY= Sex-determination region Y = Περιοχή καθορισμού του φύλου στο Υ) Κινητική εμφάνισης (ανίχνευσης) στο μητρικό αίμα (μετά από IVD) Ψευδώς αρνητικά? 5εβδ 6εβδ 7εβδ 8εβδ 9εβδ 3/10 8/10 10/10 8/8 9/9 Ανιχνεύσιμο SRY DNA/Άρρεν έμβρυο Αποτελεσματικό στην διάρκεια του πρώτου τριμήνου

12 12 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA: πρόσφατα δεδομένα Φυσιοπαθολογία Κυρίως προέρχονται από κυττο/συνκυτιοτροφοβλαστικά κύτταρα Εμφάνιση (ανίχνευση) στο μητρικό αίμα 5-6εβδ Αύξηση συγκέντρωσης με την ηλικία κύησης Γρήγορη κάθαρση (< 24 h) μετά τον τοκετό (χρόνος ημιζωής 16 λεπτά) Δεν υφίστανται μετά την εγκυμοσύνη

13 13 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Δυσκολίες και περιορισμοί της διαδικασίας Μικρή ποσότητα εμβρυικού DNA στο μητρικό πλάσμα (ειδικά στην διάρκεια του πρώτου τριμήνου): 16Geq/ml Ευαισθησία : 37-91%

14 14 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Δυσκολίες και περιορισμοί της διαδικασίας Μικρή ποσότητα εμβρυικού DNA στο μητρικό πλάσμα (ειδικά στην διάρκεια του πρώτου τριμήνου 16Geq/ml) Υπόστρωμα μητρικού DNA (χαμηλό ποσοστό ολικού DNA στο μητρικό πλάσμα: περίπου 3-6%) Η ανάλυση περιορίζεται στην ανίχνευση αλληλουχιών που δεν υπάρχουν στο μητρικό γονιδίωμα

15 15 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Τρέχουσες εφαρμογές Y X 1-Προσδιορισμός φύλου του εμβρύου: Αλληλουχίες προερχόμενες από το χρωμόσωμα Y (πχ. γονίδιοsry )

16 16 NIPD (1): προσδιορισμός του φύλου του εμβρύου Κλινική χρησιμότητα και στόχοι Προσέγγιση φυλοσύνδετων νοσημάτων (X-linked) σε εγκύους φορείς Με σκοπό να αποφευχθούν επεμβατικές προσεγγίσεις σε περίπτωση θηλυκού εμβρύου Προσέγγιση κυήσεων ζευγαριών με κίνδυνο συγγενούς υπερπλασίας των επινεφριδίων (congenital adrenal hyperplasia) Με σκοπό να αποφύγουμε την περιττή θεραπεία με στεροειδή σε περίπτωση θηλυκού εμβρύου Προσέγγιση κυήσεων με υπερηχογραφικά ευρήματα

17 17 NIPD (1): προσδιορισμός του φύλου του εμβρύου Η εμπειρία του εργαστηρίου Cerba : (n=4693) Year Test Συνολική ευαισθησία και ειδικότητα >99% Duchenne dystrophy 266 Congenital adrenal hyperplasia 173 Hemophiliia A 168 Becker dystrophy 62 Genital ambiguity on ultrasound 45 Hemophilia B 45 Fragile X syndrome 41 Alport syndrome 25 X-linked Hydrocephaly 25 Adrenoleucodystrophy 24 Hunter disease 22 Myotubular myopathy 21 Menkes disease 20 Retinitis pigmentosum 17 X-linked Mental Retardation 17 Anhydrotic ectodermic dysplasia 15 Bruton disease 14 Incontinentia pigmenti 11 X-linked Mental Retardation (unknown) 11 Other (<10) 203

18 18 18 NIPD (1): προσδιορισμός του φύλου του εμβρύου Συστάσεις στη Γαλλία

19 19 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Τρέχουσες εφαρμογές RHD+ RHD- 2- Γονοτυπική τυποποίηση Rhesus D: Αλληλουχίες οι οποίες προέρχονται από το γονίδιο RHD (το οποίο γενικά είναι απόν σε RhD-αρνητικούς ασθενείς)

20 20 NIPD (2): εμβρυική γονοτυπική τυποποίηση RHD Συγκριτικά αποτελέσματα στην Ευρώπη Sanquin IGBRL Cerba CNRHP NL GB FR FR Πλάσμα T3 Πλάσμα T3 Ορός T1 Πλάσμα T2 (εξώνια 5+7) (εξώνια 5+7) (εξώνιο 10) (εξώνια 7+10) Ασθενείς (n=) Χρόνος κύησης στην λήψη (εβδ) > RHD αρνητικό έμβρυο 915 (38.4%) 670 (35.9%) 1194 (32,9%) 193 (21,6%) Ψευδώς αρνητικά 7 (0,26%) 3 (0,16%) 1 (0,03%) 4 (0,4%) Ψευδώς θετικά 5 (0,20%) 14 (0,75%) >3 (0,10%) 5 (0,54%) Ασαφή NA 31 (1,7)% 117 (3,1%) 5.4% 30 ασθενείς με καταγωγή από την Αφρική ή την Καραϊβική

21 21 NIPD (2): εμβρυική γονοτυπική τυποποίηση RHD Κλινική χρησιμότητα και στόχοι Αντιμετώπιση της αλλοανοσοποίησης RhD εγκύων Ταυτοποίηση γυναικών με κίνδυνο για αλλοανοσοποίηση Με σκοπό να αποφευχθεί άσκοπη χορήγηση προϊόντων αίματος (anti- D ανοσοσφαιρίνες) σε περίπτωση RhD-αρνητικού εμβρύου και την εξοικονόμηση σπάνιου προϊόντος Αυξημένη αποτελεσματικότητα προφύλαξης (Jones et al, BJOG 2004;111: ): 1 περίπτωση αποφυγής αλλοαοσοποίησης για 278 γυναίκες που έλαβαν αγωγή χωρίς γονοτυπική τυποποίηση ή 166 όταν το έμβρυο είναι γνωστό RhD-θετικό

22 NIPD (2): εμβρυική γονοτυπική τυποποίηση RhD Η εμπειρία του εργαστηρίου Cerba : (n=6149) Συστηματικός έλεγχος 4920 Αλλοανοσοποιημένοι ασθενείς 280 Επεμβατική διαδικασία 837 RHD Θετικοί 4053 RHD Αρνητικοί 1910 ή 32% Ασαφή 186 ή 3% Τραύμα αιμορραγία Μη Καυκάσιοι 42% Καυκάσιοι Cde ή cde 38% Συνολική κλινική ευαισθησία και ειδικότητα >99%

23 23 NIPD (2): εμβρυική γονοτυπική τυποποίηση RhD Συστάσεις στη Γαλλία Κολλέγιο Μαιευτήρων(Δεκέμβριος 2005) : Συστηματική προφύλαξη (Rhophylac 300µg) στις εβδομάδες «Εάν είναι δυνατόν, συστήνεται μη επεμβατική γονοτυπική ταυτοποίηση RHD, με σκοπό την στοχοποίηση της προφύλαξης σε εκείνες τις γυναίκες που κυοφορούν RhD-θετικά έμβρυα»

24 24 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Τρέχουσες εφαρμογές CGG CGG CATCCTCAGCTACAGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT

25 25 Ανίχνευση χαμηλού ποσοστού μεταλλαγμένου αλληλόμορφου Ευαίσθητες μέθοδοι Allele-Specific PCR, DHPLC, Minisequencing, HRM.. 5% 2.5% 1% 0% Ποσοστό του μεταλλαγμένου αλληλόμορφου σε υπόστρωμα φυσιολογικής αλληλουχίας

26 26 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Διαταραχές μοναδικών γονιδίων: τρέχουσες εφαρμογές CGG CGG Μετάλλαξη de novo : αχονδροπλασία Ανίχνευση μετάλλαξης G>A και G>C στο γονίδιο FGFR3 Κλινική μελέτη επικύρωσης: 109 ασθενείς και δείγματα αναφοράς (μέση ηλικία κύησης: 33 εβδομάδες) CATCCTCAGCTACAGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT CATCCTCAGCTACGGGGTGGGCTT Ευαισθησία 100% (όλα τα προσβεβλημένα έμβρυα διαγνώστηκαν σωστά n=25) Ειδικότητα 100% (δεν υπήρξαν ψευδώς θετικά) Νέα προσέγγιση στην διάγνωση ύποπτων περιπτώσεων από υπερηχογράφημα και/ή3d scan

27 27 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Διαταραχές μοναδικών γονιδίων: τρέχουσες εφαρμογές ATG (K1) ACG (K2) Πατρικά-κληρονομούμενη SNP: KEL (K1) γονότυπος Ανίχνευση της c.578c>t (p.thr193met) στο γονίδιο KEL SNP=single nucleotide polymorphisme= Πολυμορφισμός μοναδικού νουκλεοτιδίου Αντιμετώπιση εγκύων αλλοανοσοποιημένων K1 TTTAACCGAA TGCTGAGACTT TTTAACCGAA CGCTGAGACTT TTTAACCGAA CGCTGAGACTT TTTAACCGAA CGCTGAGACTT TTTAACCGAA CGCTGAGACTT TTTAACCGAA CGCTGAGACTT

28 28 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA Διαταραχές μοναδικών γονιδίων : περιορισμοί ACG ATG NIPD Δύσκολα εφικτό προς το παρόν για: TTTAACCGAA CGCTGAGACTT TTTAACCGAA TGCTGAGACTT TTTAACCGAA TGCTGAGACTT TTTAACCGAA TGCTGAGACTT TTTAACCGAA TGCTGAGACTT Αιμορροφιλία Κυστική Ίνωση Μεσογειακή Αναιμία

29 29 NIPD χρωμοσωματικών ανωμαλιών Μείζων τεχνική πρόκληση Ανευπλοειδία (τρισωμία 13, 18 και/ή 21): προσδιορισμός του αριθμού αντιγράφων του εμβρυικού χρωμοσώματος: Ειδικοί εμβρυικοί στόχοι: πλακουντιακό (εμβρυικό) ειδικό RNA ή επιγενετικοί δείκτες (μεθυλιωμένο DNA)

30 30 NIPD χρωμοσωματικών ανωμαλιών Μείζων τεχνική πρόκληση Ανευπλοειδία (τρισωμία 13, 18 και/ή 21): προσδιορισμός του αριθμού αντιγράφων του εμβρυικού χρωμοσώματος: Ειδικοί εμβρυικοί στόχοι: πλακουντιακό (εμβρυικό) ειδικό RNA ή επιγενετικοί δείκτες (μεθυλιωμένο DNA) Μη ειδικοί στόχοι: απαιτείται εξαιρετικά ακριβής μέτρηση αριθμού αντιγράφων «counting»

31 31 Κυκλοφορούν, ελεύθερο κυττάρων, εμβρυικό DNA και ανίχνευση τρισωμίας 21 Μη ειδική ποσοτικοποίηση 95 μητρικά αντίγραφα 5 εμβρυικά αντίγραφα 95 μητρικά αντίγραφα 7.5 εμβρυικά αντίγραφα 100 αντίγραφα αντίγραφα 10,000,000 αντίγραφα 10,250,000 αντίγραφα

32 32 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA και ανίχνευση τρισωμίας 21 Ποσοτικοποίηση με «massively parallel sequencing» «μαζικά παράλληλο προσδιορισμό αλληλουχίας» Αναγνώσεις (5-10 M) χρωμοσώματα Ενίσχυση απλού μορίου Μαζικά παράλληλος προσδιορισμός αλληλουχίας Ερμηνία: Zscore=%21μέσου όρου δείγματος%21αναφοράς/sd%21αναφοράς Cut-off Zscore>3 (%21>99.9centile)

33 33 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA και ανίχνευση τρισωμίας 21 Ποσοτικοποίηση με «massively parallel sequencing» 18 ασθενείς (μέση ηλικία: 18 εβδομάδες) Όλες οι περιπτώσεις (9) ταυτοποιήθηκαν σωστά 15 ασθενείς (μέση ηλικία: 14 εβδομάδες) Όλες οι περιπτώσεις (5) ταυτοποιήθηκαν σωστά

34 34 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA και ανίχνευση τρισωμίας 21 Ποσοτικοποίηση με «massively parallel sequencing» 236 δείγματα (86T μη T21) Μέση ΗΚ: 13 εβδομάδες +1 ημέρα Ευαισθησία: 100% Ειδικότητα : 97.9% (2.1% ψευδώς θετικά)

35 35 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA και ανίχνευση τρισωμίας 21 Ποσοτικοποίηση με «massively parallel sequencing» 449 δείγματα (39T μη T21) (PPV (θετική προγνωστική αξία) 1/12) Μέση ΗΚ: 16 εβδομάδες Ευαισθησία : 100% Ειδικότητα : 99.7% (0.3% false-positive)

36 36 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA ανίχνευση τρισωμιών Ποσοτικοποίηση με «massively parallel sequencing»

37 37 Κυκλοφορούν, ελεύθερο, εμβρυικό DNA/RNA και ανίχνευση τρισωμίας 21 Ποσοτικοποίηση με «massively parallel sequencing» 1696 ασθενείς (212T μη T21) (VPP 1/7) Μέση Διάρκεια κύησης: 15 εβδομάδες Άστοχες δοκιμασίες: 13 (0.8%) Ευαισθησία: 99,5% (211/212) Ειδικότητα: 99,8% (0.2% ψευδώς αρνητικών)

38 38 NIPD με την χρήση κυκλοφορούντος, ελεύθερου, εμβρυικού DNA : το μέλλον? Ολική ανάλυση του εμβρυικού γονιδιώματος NIPD Μεσογειακής Αναιμίας

39 39 Η NIPD προτείνεται στην κλινική πράξη ως διαδικασία ρουτίνας Ναι Όχι Η NIPD γίνεται με τη χρήση κυκλοφορούντων εμβρυϊκών κυττάρων Ναι Όχι Ποιες διαγνώσεις είναι διαθέσιμες το 2012: Προσδιορισμός του φύλου του εμβρύου RHD γονοτυπική τυποποίηση K1 (Kell) γονοτυπική τυποποίηση Αχονδροπλασία Σύνδρομο Down s (τρισωμία 21) Αιμορροφιλία Κυστική Ίνωση Μεσογειακή Αναιμία Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι Ναι Όχι

40 Σήμερα θα πάρουμε λίγο αίμα, για να προσδιορίσουμε το φύλο του εμβρύου! 40

Μη επεμβατικός Προγεννητικός έλεγχος

Μη επεμβατικός Προγεννητικός έλεγχος Μη επεμβατικός Προγεννητικός έλεγχος Α. Κολιαλέξη, Βιοπαθολόγος PhD Εργαστήριο Ιατρικής Γενετικής Πανεπιστημίου Αθηνών Μη επεμβατικός ΠΕ από cffdna στο πλάσμα εγκύου Ελεύθερο Εμβρυϊκό DNA στη μητρική κυκλοφορία

Διαβάστε περισσότερα

Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση

Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση Η προγεννητική διάγνωση Ενδείξεις: -Προχωρημένη ηλικία μητέρας (πιο συχνό: σύνδρομο Down) -Προγενέστερο παιδί με de novo χρωμοσωμική ανωμαλία -Ύπαρξη

Διαβάστε περισσότερα

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης Οι ανιχνευτικές εξετάσεις (screening test) έχουν ευρεία εφαρμογή και μεγάλη πρακτική χρησιμότητα στον προγεννητικό έλεγχο. Ο προγεννητικός έλεγχος

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα

Εργασία Βιολογίας. Β Τετράμηνο. Θέμα: Προγεννητικός Έλεγχος (Κεφάλαιο 12) Ονοματεπώνυμο: Κ. Κυριακή Τμήμα: Α2 Καθηγητής: κ.

Εργασία Βιολογίας. Β Τετράμηνο. Θέμα: Προγεννητικός Έλεγχος (Κεφάλαιο 12) Ονοματεπώνυμο: Κ. Κυριακή Τμήμα: Α2 Καθηγητής: κ. Εργασία Βιολογίας Β Τετράμηνο Θέμα: Προγεννητικός Έλεγχος (Κεφάλαιο 12) Ονοματεπώνυμο: Κ. Κυριακή Τμήμα: Α2 Καθηγητής: κ.πιτσιλαδής Βασίλης Τι είναι ο προγεννητικός έλεγχος; Ο προγεννητικός έλεγχος αποτελείται

Διαβάστε περισσότερα

Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr. Πίνακας 1.

Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr. Πίνακας 1. Ενημερωτικό Δελτίο Τεύχος 1 Δεκέμβριος 2007 Εργαστήριο Κλινικής Βιοχημείας και Εργαστηριακής Ιατρικής Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

cell-free DNA στο μητρικό αίμα

cell-free DNA στο μητρικό αίμα cell-free DNA στο μητρικό αίμα Εφαρμογή στην κλινική πράξη στην Ελλάδα Παπαϊωάννου Γεώργιος-Κων/νος, PhD Υπεύθυνος Ιατρικής Εμβρύου Maιευτική & Γυναικολογική Κλινική ΓΑΙΑ Cell free DNA / Εισαγωγή στην

Διαβάστε περισσότερα

Προγεννητικός Έλεγχος - Μαιευτικό Υπερηχογράφημα

Προγεννητικός Έλεγχος - Μαιευτικό Υπερηχογράφημα Προγεννητικός Έλεγχος - Μαιευτικό Υπερηχογράφημα upadate swfobject.embedswf('/plugins/content/avreloaded/mediaplayer.swf','avreloaded0','400','320','7. 0.14','/plugins/content/avreloaded/expressinstall.swf',

Διαβάστε περισσότερα

prenatal Μη επεμβατικός προγεννητικός έλεγχος

prenatal Μη επεμβατικός προγεννητικός έλεγχος prenatal Μη επεμβατικός προγεννητικός έλεγχος 1 Είστε έγκυος. Συγχαρητήρια! 2 Αγαπητοί μελλοντικοί γονείς, Αυτή είναι μια πολύ συναρπαστική περίοδος για εσάς και είναι πολύ φυσικό να ανησυχείτε για την

Διαβάστε περισσότερα

Κεφάλαιο 6: Μεταλλάξεις

Κεφάλαιο 6: Μεταλλάξεις Κεφάλαιο 6: Μεταλλάξεις ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Τι ονομάζονται μεταλλάξεις και ποια τα κυριότερα είδη τους; 2. Ποιες οι διαφορές μεταξύ γονιδιακών και χρωμοσωμικών μεταλλάξεων; 3. Οι μεταλλάξεις στα σωματικά

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής Κεφάλαιο 6: ΜΕΤΑΛΛΑΞΕΙΣ -ΘΕΩΡΙΑ- Μεταλλάξεις είναι οι αλλαγές που συμβαίνουν στο γενετικό υλικό ενός οργανισμού, τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις) όσο και σε χρωμοσωμικό επίπεδο (χρωμοσωμικές

Διαβάστε περισσότερα

Νικόλαος Δ. Βραχνής. και Εμβρυομητρικής. Αρεταίειο Νοσοκομείο

Νικόλαος Δ. Βραχνής. και Εμβρυομητρικής. Αρεταίειο Νοσοκομείο Υπερηχογραφικά καθοδηγούμενος επεμβατικός έλεγχος στη Μαιευτική Νικόλαος Δ. Βραχνής Επίκουρος Καθηγητής Μαιευτικής Γυναικολογίας και Εμβρυομητρικής Ιατρικής Σχολής Πανεπιστημίου Αθηνών Αρεταίειο Νοσοκομείο

Διαβάστε περισσότερα

Τµήµα Υπερήχων & Εµβρυοµητρικής Ιατρικής. Το θαύµα... της ζωής!

Τµήµα Υπερήχων & Εµβρυοµητρικής Ιατρικής. Το θαύµα... της ζωής! Τµήµα Υπερήχων & Εµβρυοµητρικής Ιατρικής Το θαύµα... της ζωής! Οι Υπέρηχοι Εγκυμοσύνης... Τμήμα Υπερήχων & Εμβρυομητρικής Ιατρικής Στο Τμήμα Υπερήχων & Εμβρυομητρικής Ιατρικής της ΡΕΑ Μαιευτικής Γυναικολογικής

Διαβάστε περισσότερα

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008 ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ Δρ.Δ.Λάγγας Αθήνα 2008 Ορισμοί Γενετική: μελέτη της κληρονομικότητας και των παραλλαγών της Ιατρική γενετική: η γενετική του ανθρώπινου είδους Κλινική γενετική:

Διαβάστε περισσότερα

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6 ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: 20 / 02 / 2016 ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΕΞΕΤΑΖΟΜΕΝΟΥ:. ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ. Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου.

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ. Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου. ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. α, Α2 γ, Α3 γ, Α4 δ, Α5 β ΘΕΜΑ Β Β1. 1Γ, 2Β, 3Α, 4Α, 5Γ, 6Α Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου.»

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

ΑΜΝΙΟΠΑΡΑΚΕΝΤΗΣΗ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών

ΑΜΝΙΟΠΑΡΑΚΕΝΤΗΣΗ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών ΑΜΝΙΟΠΑΡΑΚΕΝΤΗΣΗ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών ΙΠΠΟΚΡΑΤΕΙΟ ΝΟΣΟΚΟΜΕΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΕΠΙΚΟΙΝΩΝΙΑ ΤΗΛ: 2310892819 e-mail: hmesogiaki@ippokratio.gr

Διαβάστε περισσότερα

Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις. M. Ξημέρη, ειδικ. Αιματολογίας

Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις. M. Ξημέρη, ειδικ. Αιματολογίας Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις M. Ξημέρη, ειδικ. Αιματολογίας Εισαγωγή Σύστημα RhD : - αναγνωρίστηκε το 1939 - το πιο σημαντικό κλινικά σύστημα μετά το ΑΒΟ - προκαλεί αιμολυτικές

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη.

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. 12 Γενετικό γλωσσάριο Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. Ιανουάριος 2009 Τροποποιηµένο από το γλωσσάριο που αρχικά δηµιουργήθηκε από το Πάρκο Γενετικής Γνώσης London IDEAS (London

Διαβάστε περισσότερα

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ Μικροβιολογικό & Ερευνητικό Εργαστήριο Καθ έξιν Αποβολές Οι καθ 'έξιν αποβολές είναι μια ασθένεια σαφώς διακριτή από τη στειρότητα, και που ορίζεται ως δύο ή περισσότερες αποτυχημένες

Διαβάστε περισσότερα

Υποστηρίζοντας τα παιδιά με γενετικά νοσήματα - Ο Δρόμος για την Θεραπεία Πέμπτη, 16 Ιούνιος :58

Υποστηρίζοντας τα παιδιά με γενετικά νοσήματα - Ο Δρόμος για την Θεραπεία Πέμπτη, 16 Ιούνιος :58 Από: K-Life (Καθημερινή) Τα γενετικά νοσήματα είναι ιδιαίτερα σπάνιες ασθένειες που οφείλονται σε μεταλλάξεις γονιδίων. Τα παιδιά που πάσχουν από αυτά χρειάζονται φροντίδα, ψυχολογική στήριξη αλλά και

Διαβάστε περισσότερα

ΠΡΩΤΟΒΑΘΜΙΑ ΦΡΟΝΤΙ Α ΥΓΕΙΑΣ ΓΙΑΤΗ ΜΗΤΕΡΑ ΚΑΙ ΤΟ ΕΜΒΡΥΟ

ΠΡΩΤΟΒΑΘΜΙΑ ΦΡΟΝΤΙ Α ΥΓΕΙΑΣ ΓΙΑΤΗ ΜΗΤΕΡΑ ΚΑΙ ΤΟ ΕΜΒΡΥΟ ΠΡΩΤΟΒΑΘΜΙΑ ΦΡΟΝΤΙ Α ΥΓΕΙΑΣ ΓΙΑΤΗ ΜΗΤΕΡΑ ΚΑΙ ΤΟ ΕΜΒΡΥΟ Εργαστήριο Υγιεινής, Επιδημιολογίας και Ιατρικής Στατιστικής ΕΚΠΑ, σε συνεργασία με Αναπλ. Καθηγητή Ν. Παπαντωνίου, Α Μαιευτική και Γυναικολογική

Διαβάστε περισσότερα

Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα

Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα MAΡΙΑ ΠΑΠΑΛΟΥΚΑ Κλινική Εμβρυολόγος Μονάδα Αναπαραγωγικής Ιατρικής Περιεχόμενα Ορισμός Ιστορική Αναδρομή Γενετική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 6 ο...2 I. Μεταλλάξεις...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7

ΚΕΦΑΛΑΙΟ 6 ο...2 I. Μεταλλάξεις...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΚΕΦΑΛΑΙΟ 6 ο ΚΕΦΑΛΑΙΟ 6 ο...2 I. Μεταλλάξεις...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 1 ΚΕΦΑΛΑΙΟ 6 ο I. Μεταλλάξεις Εκπαιδευτικοί στόχοι: Μετά την ολοκλήρωση της µελέτης αυτού του κεφαλαίου ο µαθητής θα πρέπει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 6 - ΜΕΤΑΛΛΑΞΕΙΣ ΑΣΚΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 6 - ΜΕΤΑΛΛΑΞΕΙΣ ΑΣΚΗΣΕΙΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 6 - ΜΕΤΑΛΛΑΞΕΙΣ ΑΣΚΗΣΕΙΣ 1. σε σωματικό κύτταρο οργανισμού που βρίσκεται στη φάση κυτταρικής διαφοροποίησης συνέβη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. β 2. β 3. α 4. α 5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. β 2. β 3. α 4. α 5. β ΘΕΜΑ 1ο 1. β 2. β 3. α 4. α 5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 21 ΣΕΠΤΕΜΒΡΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: BΙΟΛΟΓΙΑ (ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ)

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Χρωμοσωμικές ανωμαλίες Τα φυλετικά

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 1) ΑΝΩΜΑΛΙΕΣ ΣΤΟΝ ΑΡΙΘΜΟ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΕΥΠΛΟΕΙΔΙΑ: ΚΑΘΕ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΑΡΙΘΜΟΥ Ν (ΑΠΛΟΕΙΔΕΣ ΓΟΝΙΔΙΩΜΑ) 3Ν ΑΥΘΟΡΜΗΤΕΣ ΑΠΟΒΟΛΕΣ 4Ν τριπλοειδία Α) Γονιμοποίηση ωαρίου

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014

ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 9 Μαρτίου 2014

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 9 Μαρτίου 2014 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 9 Μαρτίου 2014 ΘΕΜΑ Α Α1. β, Α2. δ, Α3. γ, Α4. δ, Α5. γ. ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 90-91: «Το παράδειγμα της δρεπανοκυτταρικής

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Χρωμοσωματικές ανωμαλίες

Χρωμοσωματικές ανωμαλίες Χρωμοσωματικές ανωμαλίες ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΕΥΘΥΝΟΝΤΑΙ ΓΙΑ: 50% ΤΩΝ ΑΥΘΟΡΜΗΤΩΝ ΑΠΟΒΟΛΩΝ ΠΕΡΙΣΣΟΤΕΡΑ ΑΠΟ 60 ΣΥΝΔΡΟΜΑ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ ~0.7% ΤΩΝ ΒΡΕΦΩΝ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ 2 % ΤΩΝ ΚΥΗΣΕΩΝ ΜΗΤΕΡΩΝ ΑΝΩ ΤΩΝ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι Β Προβλήματα Φαινότυπος Β(Α): ασθενής αντίδραση με αντι-α, έντονη αντίδραση με αντι-β, και ο ορός αντιδρά με ερυθρά Α₁. Ο αντιορός Α περιέχει τον κλώνο ΜΗΟ4? Επίκτητος Β φαινότυπος: έντονη αντίδραση με

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΜΗ ΕΠΕΜΒΑΤΙΚΟΣ ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ - Αρεταίειο Νοσοκομείο

ΜΗ ΕΠΕΜΒΑΤΙΚΟΣ ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ - Αρεταίειο Νοσοκομείο ΜΗ ΕΠΕΜΒΑΤΙΚΟΣ ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ - Ελεύθερο Εμβρυικό DNA: η χρήση στη Μαιευτική Νίκος Δ. Βραχνής Αρεταίειο Νοσοκομείο Επίπτωση χρωμοσωμικών ανωμαλιών Πρόσφατα δεδομένα για χρωμοσωμικές ανωμαλίες 8

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού ΠΡΟΣΟΜΟΙΩΣΗ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΥΡΙΑΚΗ 4 ΜΑΪΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. α, Α2. β, Α3. δ, Α4. β, Α5. β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Σάββατο 7 Ιανουαρίου 2017 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

«ΕΛΕΥΘΕΡΟ ΕΜΒΡΥΪΚΟ DNA ΚΑΙ ΔΙΑΓΝΩΣΤΙΚΗ ΑΞΙΑ ΚΑΤΑ ΤΗΝ ΚΥΗΣΗ» Μεταπτυχιακή εργασία Μαρίας Πετσωτά

«ΕΛΕΥΘΕΡΟ ΕΜΒΡΥΪΚΟ DNA ΚΑΙ ΔΙΑΓΝΩΣΤΙΚΗ ΑΞΙΑ ΚΑΤΑ ΤΗΝ ΚΥΗΣΗ» Μεταπτυχιακή εργασία Μαρίας Πετσωτά ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ- ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ «ΠΑΘΟΛΟΓΙΑ ΤΗΣ ΚΥΗΣΗΣ» «ΕΛΕΥΘΕΡΟ ΕΜΒΡΥΪΚΟ DNA ΚΑΙ ΔΙΑΓΝΩΣΤΙΚΗ ΑΞΙΑ ΚΑΤΑ ΤΗΝ ΚΥΗΣΗ» Μεταπτυχιακή εργασία Μαρίας

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ Μια εργασία των: Μακρυδάκη Ελευθερία Μπούρλα Ελένη Τμήμα: Γ 3 Ημερομηνία: 27/1/2015 Γενικά με

Διαβάστε περισσότερα

ΑΛΕΞΙΑ ΜΙΧΑΛΟΠΟΥΛΟΥ Α.Μ Πτυχιακή εργασία ΤΕΙ ΗΠΕΙΡΟΥ ΤΜΗΜΑ ΛΟΓΟΘΕΡΑΠΕΙΑΣ ΙΩΑΝΝΙΝΑ 2011

ΑΛΕΞΙΑ ΜΙΧΑΛΟΠΟΥΛΟΥ Α.Μ Πτυχιακή εργασία ΤΕΙ ΗΠΕΙΡΟΥ ΤΜΗΜΑ ΛΟΓΟΘΕΡΑΠΕΙΑΣ ΙΩΑΝΝΙΝΑ 2011 ΑΛΕΞΙΑ ΜΙΧΑΛΟΠΟΥΛΟΥ Α.Μ.10159 Πτυχιακή εργασία ΤΕΙ ΗΠΕΙΡΟΥ ΤΜΗΜΑ ΛΟΓΟΘΕΡΑΠΕΙΑΣ ΙΩΑΝΝΙΝΑ 2011 Σύνδρομο Down ή αλλιώς Τρισωμία 21 ή Τρισωμία G είναι η περιγραφή μια ανωμαλίας, που περικλείει ένα σύνολο χαρακτηριστικών,

Διαβάστε περισσότερα

25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ

25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ Η Rh ανοσοποίηση οφείλεται σε εμβρυο-μητρική μετάγγιση (ΕΜΜ), όπου ποσότητα Rh θετικού εμβρυϊκού αίματος εισέρχεται στη μητρική κυκλοφορία Rh αρνητικής εγκύου και δημιουργούνται αντισώματα κατά του παράγοντα

Διαβάστε περισσότερα

Προεμφυτευτική Γενετική Διάγνωση. Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος

Προεμφυτευτική Γενετική Διάγνωση. Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος Προεμφυτευτική Γενετική Διάγνωση Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος Στάδια Προεμφυτευτικής Γενετικής Διάγνωσης (P.G.D) Διέγερση ωοθηκών για την ωρίμανση μεγάλου αριθμού (ει δυνατόν ) ωοθυλακίων

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος:

Διαβάστε περισσότερα

ΑΠΟΚΌΛΛΗΣΗ ΠΛΑΚΟΎΝΤΑ

ΑΠΟΚΌΛΛΗΣΗ ΠΛΑΚΟΎΝΤΑ ΑΠΟΚΌΛΛΗΣΗ ΠΛΑΚΟΎΝΤΑ Παθοφυσιολογία, Διάγνωση και Αντιμετώπιση Alexander Kofinas, MD Director Kofinas Perinatal Associate Professor Clinical Obstetrics and Gynecology Cornell University, College of Medicine

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Γενετικά νοσήματα του ανθρώπου

Διαβάστε περισσότερα

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B Βιολογία προσανατολισμού Α. 1. β 2. γ 3. δ 4. γ 5. δ ΘΕΜΑ Α B1. 4,1,2,6,8,3,5,7 ΘΕΜΑ B B2. Σχολικό βιβλίο σελ. 103 Η γενετική καθοδήγηση είναι.υγιών απογόνων. Σχολικό βιβλίο σελ. 103 Παρ ότι γενετική καθοδήγηση

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα

ΚΑΤΑΛΟΓΟΣ ΑΣΘΕΝΕΙΩΝ ΠΟΥ ΑΝΑΦΕΡΟΝΤΑΙ ΣΤΟ ΣΧΟΛΙΚΟ ΕΓΧΕΙΡΙΔΙΟ

ΚΑΤΑΛΟΓΟΣ ΑΣΘΕΝΕΙΩΝ ΠΟΥ ΑΝΑΦΕΡΟΝΤΑΙ ΣΤΟ ΣΧΟΛΙΚΟ ΕΓΧΕΙΡΙΔΙΟ ΑΣΘΕΝΕΙΕΣ ΚΑΤΑΛΟΓΟΣ ΑΣΘΕΝΕΙΩΝ ΠΟΥ ΑΝΑΦΕΡΟΝΤΑΙ ΣΤΟ ΣΧΟΛΙΚΟ ΕΓΧΕΙΡΙΔΙΟ ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑΣ ΣΥΝΕΠΕΙΕΣ ΕΙΔΟΣ ΜΕΤΑΛΛΑΞΗΣ Οικογενή υπερχοληστερολαιμία Αυτοσωμική επικρατής κληρονομικότητα Σχετίζεται με αυξημένο

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

Αρχές μοριακής παθολογίας. Α. Αρμακόλας Αν. Καθηγητής Ιατρική Σχολή ΕΚΠΑ

Αρχές μοριακής παθολογίας. Α. Αρμακόλας Αν. Καθηγητής Ιατρική Σχολή ΕΚΠΑ Αρχές μοριακής παθολογίας Α. Αρμακόλας Αν. Καθηγητής Ιατρική Σχολή ΕΚΠΑ Μοριακή Παθολογία Ανερχόμενος κλάδος της Παθολογίας Επικεντρώνεται στην μελέτη και τη διάγνωση νοσημάτων Στον καθορισμό και την πιστοποίηση

Διαβάστε περισσότερα

Δειγματοληψία Χοριακών Λαχνών (CVS) ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών

Δειγματοληψία Χοριακών Λαχνών (CVS) ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ. Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών Δειγματοληψία Χοριακών Λαχνών (CVS) ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΚΑΙ ΟΙΚΟΓΕΝΕΙΕΣ Μονάδα Πρόληψης Μεσογειακής Αναιμίας και άλλων Αιμοσφαιρινοπαθειών ΙΠΠΟΚΡΑΤΕΙΟ ΝΟΣΟΚΟΜΕΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΕΠΙΚΟΙΝΩΝΙΑ ΤΗΛ: 2310892819

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α: Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β: Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάση ε. RNA πολυμεράση Β3.

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ

ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 16 Ιουνίου 2017 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 δ Α.2 δ Α.3 β Α.4 γ Α.5 α ΘΕΜΑ B B.1 I. A II. E III. ΣΤ IV.

Διαβάστε περισσότερα

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής?

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής? 12 εργαστήριο ίσως ελέγξει τα αποθηκευµένα δείγµατα (ιδιαίτερα εάν ο αρχικός έλεγχος δεν έδωσε αποτέλεσµα), αλλά µόνο εάν έχετε δώσει τη γραπτή σας συγκατάθεση για κάτι τέτοιο. Με αυτό τον τρόπο οι ασθενείς

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

Ελεύθερο εμβρυϊκό DNA. Μη επεμβατικός προγεννητικός έλεγχος.

Ελεύθερο εμβρυϊκό DNA. Μη επεμβατικός προγεννητικός έλεγχος. Ελεύθερο εμβρυϊκό DNA. Μη επεμβατικός προγεννητικός έλεγχος. Παναγιώτης Μπεναρδής MD, DipFetMed(FMF) Μαιευτήρας-Γυναικολόγος Ειδικός στην Ιατρική Εμβρύου & Υπερηχογραφία Diploma in Fetal Medicine (FMF,

Διαβάστε περισσότερα

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα»

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» «Τι είναι Μετάλλαξη» Γενικά με τον όρο μετάλλαξη ονομάζουμε τις αλλαγές στο γενετικό υλικό, το DNA δηλαδή ενός ζωντανού οργανισμού και πρόκειται

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα

Universitäts-Frauenklinik Essen. Προγεννετικος Ελεγχος και Περιγεννητικη Ιατρικη Επιπεδο 1

Universitäts-Frauenklinik Essen. Προγεννετικος Ελεγχος και Περιγεννητικη Ιατρικη Επιπεδο 1 Universitäts-Frauenklinik Essen Προγεννετικος Ελεγχος και Περιγεννητικη Ιατρικη Επιπεδο 1 Αξιοτιμοι συναδελφοι, αγαπητοι γονεις, Τα πανεπιστημιακα μας εξωτερικα Ιατρεια Περιγεννητικης ιατρικης σας προσφερουν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΤΑΡΤΗ 04 ΙΟΥΝΙΟΥ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΤΑΡΤΗ 04 ΙΟΥΝΙΟΥ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΤΑΡΤΗ 04 ΙΟΥΝΙΟΥ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ www.romvos.edu.gr ΘΕΜΑ Α Α1. Η σωστή απάντηση είναι το δ. Α2. Η σωστή απάντηση είναι το γ. Α3. Η σωστή απάντηση είναι

Διαβάστε περισσότερα

screening πρωτου τριμηνου

screening πρωτου τριμηνου Universitäts-Frauenklinik Essen screening πρωτου τριμηνου Τι ονομαζεται screening πρωτου τριμηνου Εδω αξιολογειται ο κινδυνος υπαρξης ανωμαλιας χρωματοσωματων στο εμβρυο οπως( π.χ. (συνδρομο Down, συνδρομο

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΜΑΙΕΥΤΙΚΗ ΚΑΙ ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΕΤΑΙΡΕΙΑ ΔΕΛΤΙΟ ΤΥΠΟΥ

ΕΛΛΗΝΙΚΗ ΜΑΙΕΥΤΙΚΗ ΚΑΙ ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΕΤΑΙΡΕΙΑ ΔΕΛΤΙΟ ΤΥΠΟΥ ΕΛΛΗΝΙΚΗ ΜΑΙΕΥΤΙΚΗ ΚΑΙ ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΕΤΑΙΡΕΙΑ Αθήνα, 20/05/2015 ΔΕΛΤΙΟ ΤΥΠΟΥ 13 ο Πανελλήνιο Συνέδριο Μαιευτικής Γυναικολογίας στο Βόλο, 28-31 Μαΐου 2015 Στο πλαίσιο της συνεχιζόμενης ιατρικής εκπαίδευσης

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

Αιμορραγίες κατά την εγκσμοσύνη. Σωηήξεο Ν. Μήηξνπ

Αιμορραγίες κατά την εγκσμοσύνη. Σωηήξεο Ν. Μήηξνπ Αιμορραγίες κατά την εγκσμοσύνη Σωηήξεο Ν. Μήηξνπ 12/11/2012 127.000 θάνατοι κατά την κύηση και τον τοκετό λόγω αιμορραγίας παγκοσμίως Η αιμορραγία αποτελεί μία από τις κυριότερε ς αιτίες άμεσου θανάτου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέμα 1 ο : Να επιλέξετε τη σωστή απάντηση: 1. Το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης δεν περιλαμβάνει α. το mrna β. τη μεγάλη ριβοσωμική υπομονάδα γ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ,, 4, 5 και 6 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: 0 / 0 / 06 ΘΕΜΑ Ο -γ -4 3-δ 4-δ 5-β ΘΕΜΑ Ο Α. Παρατηρούμενη Φ.Α

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ «ΣΥΜΒΟΛΗ ΣΤΗ ΜΟΡΙΑΚΗ ΠΡΟΓΕΝΝΗΤΙΚΗ ΔΙΑΓΝΩΣΗ ΑΝΕΥΠΛΟΕΙΔΙΩΝ ΚΑΙ ΦΥΛΟΥ ΜΕ ΧΡΗΣΗ

Διαβάστε περισσότερα