Παρακολούθηση και εκτίµηση της έκθεσης σε καρκινογόνες χηµικές ουσίες, και των αντιστοίχων κινδύνων, στον εργασιακό χώρο

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Παρακολούθηση και εκτίµηση της έκθεσης σε καρκινογόνες χηµικές ουσίες, και των αντιστοίχων κινδύνων, στον εργασιακό χώρο"

Transcript

1 Παρακολούθηση και εκτίµηση της έκθεσης σε καρκινογόνες χηµικές ουσίες, και των αντιστοίχων κινδύνων, στον εργασιακό χώρο Σ. Κυρτόπουλος, Εργαστήριο Χηµικής Καρκινογένεσης και Γενετικής Τοξικολογίας, Ινστιτούτο Βιολογικών Ερευνών και Βιοτεχνολογίας, Εθνικό Ίδρυµα Ερευνών, Βασιλέως Κωνσταντίνου 48, Αθήνα Εισαγωγή Αν και η ισχύουσα νοµοθεσία ενθαρρύνει τον περιορισµό της χρήσης καρκινογόνων χηµικών παραγόντων στους χώρους εργασίας, η παρουσία τέτοιων παραγόντων, στον βαθµό που παραµένει αναπόφευκτη, επιβάλλει αυξηµένες απαιτήσεις σε ό,τι αφορά την εκτίµηση της έκθεσης σε αυτές καθώς και των κινδύνων υγείας που η έκθεση αυτή συνεπάγεται. Οι αυξηµένες αυτές απαιτήσεις οφείλονται τόσο στην σοβαρότητα των συνεπειών για την υγεία των εργαζοµένων όσο και στο γεγονός ότι οι συνέπειες αυτές συνήθως εµφανίζονται µόνο µετά από µακροχρόνια έκθεση. Για την εκτίµηση της εργασιακής έκθεσης σε καρκινογόνους παράγοντες µπορούν κατ' αρχήν να εφαρµοσθούν οι ίδιες µέθοδοι που εφαρµόζονται και για την παρακολούθηση της έκθεσης σε άλλου είδους τοξικούς παράγοντες, δηλαδή µέθοδοι ανάλυσης περιβαλλοντικών δειγµάτων προερχοµένων είτε από περιβαλλοντική είτε από προσωπική δειγµατοληψία. Στην πράξη αυτού του τύπου περιβαλλοντική παρακολούθηση µπορεί να αποδώσει αξιόπιστες πληροφορίες µόνο ως προς την έκθεση µέσω του εισπνεόµενου αέρα, ενώ η έκθεση µέσω των οδών της δερµατικής απορρόφησης και της κατάποσης δύσκολα µπορεί να εκτιµηθεί αξιόπιστα. Για τον λόγο αυτό, η βιολογική παρακολούθηση της έκθεσης σε καρκινογόνους παράγοντες µέσω της χρήσης "βιολογικών δεικτών", δηλαδή δεικτών που µετρούνται σε βιολογικά δείγµατα, θεωρείται ιδιαίτερα χρήσιµη αφού µπορεί να δώσει µιά περισσότερο ολοκληρωµένη εικόνα της έκθεσης του ατόµου µέσω όλως των δυνατών οδών. Κατά την διάρκεια των τελευταίων δύο δεκαετιών έχουν γίνει σηµαντικές προσπάθειες για την ανάπτυξη βιολογικών δεικτών έκθεσης σε καρκινογόνους χηµικούς παράγονες και έχει επιτευχθεί αξιόλογη πρόοδος ως προς την αξιοποίησή τους στην εκτίµηση της εργασιακής, αλλά και της γενικής περιβαλλοντικής, έκθεσης. Εκτός από την χρησιµότητά τους για την εκτίµηση της έκθεσης, ορισµένοι από τους βιολογικούς δείκτες που έχουν αναπτυχθεί παρουσιάζουν αξιόλογες προοπτικές αξιοποίησης και σαν δείκτες κινδύνου, δηλαδή σαν πρώϊµοι δείκτες επιβλαβών επιδράσεων στην υγεία οι οποίοι εµφανίζονται πολύ πριν από την εµφάνιση κλινικά αναγνωρίσιµων συµπτωµάτων. Τέλος, σηµαντική πρόοδος έχει σηµειωθεί ως προς την ανάπτυξη βιολογικών δεικτών ατοµικής ευαισθησίας οι οποίο ενδέχεται να επιτρέπουν τον έγκαιρο εντοπισµό ατόµων µε αυξηµένη ευαισθησία στις επιβλαβείς επιδράσεις συγκεκριµµένων ουσιών ή κατηγοριών ουσιών. Η συνδυασµένη αξιοποίηση των παραπάνω ειδών βιολογικών δεικτών µπορεί να οδηγήσει σε σηµαντικά οφέλη στον χώρο της υγειινής και ασφάλειας στον χώρο εργασίας αφού επιτρέπει - περισσότερο ακριβή και εξατοµικευµένη εκτίµηση της έκθεσης σε καρκινογόνους χηµικούς παράγοντες, - µείωση του χρόνου µεταξύ της έκθεσης και της ανίχνευσης βιολογικά σηµαντικών επιδράσεων, - αναγνώριση ατόµων ή οµάδων µε αυξηµένη ευαισθησία, κληρονιµική (γενετικά προσδιορισµένη) ή επίκτητη. Τα οφέλη αυτά προσφέρονται για αξιοποίηση σε διάφορα επίπεδα, όπως, για παράδειγµα, για την συγκριτική εκτίµηση της συνολικής έκθεσης που συνεπάγονται διαφορετικές εργασιακές πρακτικές ή συγκεκριµµένοι χώροι εργασίας, την πρώϊµη αξιολόγηση της αποτελεσµατικότητας προστατευτικών παρεµβάσεων, και προσδιορισµό ανεκτών ορίων έκθεσης µε µικρότερο βαθµό αβεβαιότητας.

2 Μηχανισµός χηµικής καρκινογένεσης και βιολογικοί δείκτες έκθεσης Η χρησιµότητα των βιολογικών δεικτών έκθεσης σε καρκινογόνες ουσίες, και των δεικτών των αντιστοίχων κινδύνων υγείας, συναρτάται µε την θέση που οι δείκτες αυτοί κατέχουν στα πλαίσια του µηχανισµού της χηµικής καρκινογένεσης. Στο Σχήµα 1 παρουσιάζονται σχηµατικά τα σηµαντικότερα βήµατα του µηχανισµού δράσης των χηµικών καρκινογόνων ουσιών (τουλάχιστο της µεγάλης πλειοψηφίας τους). Στο κείµενο που ακολουθεί διάφοροι δείκτες έχουν αναπτυχθεί θα περιγραφούν συνοπτικά σε σχέση µε την θέση τους στον µηχανισµό της καρκινογένεσης. Γενικά µπορεί κανείς να πει ότι όσο πιο κοντά βρίσκεται κάποιος δείκτης στα πρώϊµα στάδια της καρκινογένεσης όπως αυτή περιγράφεται στο Σχήµα 1 τόσο πιο πολύ λειτουργεί σαν δείκτης έκθεσης, ενώ όσο πιο κοντά βρίσκεται προς τα όψιµα στάδια τόσο λειτουργεί σαν δείκτης κινδύνου. Οπως φαίνεται στο Σχήµα 1, µετά την απορρόφησή τους στον οργανισµό οι καρκινογόνες ουσίες αρχικά υφίστανται µεταβολισµό ο οποίος οδηγεί στην αδρανοποίησή τους και/ή την αποβολή τους (αποτοξίνωση) ή την µετατροπή τους σε βιολογικά ενεργούς µεταβολίτες (µεταβολική ενεργοποίηση). Η συγκέντρωση µιάς ουσίας, ή ενός µεταβολίτη της, στο αίµα ή τα ούρα αποτελεί ένα πρώϊµο δείκτη της ποσότητας της ουσίας που εισήλθε στον οργανισµό ή, στην περίπτωση των µεταβολιτών, που υπέστη την αντίστοιχη µεταβολική µετατροπή στο συγκεκριµµένο άτοµο. Κατά συνέπεια αποτελεί ένα δείκτη της "εσωτερικής" δόσης ή έκθεσης του ατόµου που αντανακλά την συνολική έκθεση από όλες τις οδούς (αναπνοή, δερµατική απορρόφηση, κατάποση) (Σχήµα 2). Τα επίπεδα του δείκτη αυτού αυξάνονται σύντοµα µετά από την σχετική έκθεση, ενώ µειώνονται επίσης σχετικά γρήγορα (συνήθως σε διάστηµα λίγων ωρών) µετά από την µείωση ή διακοπή της. Η γρήγορη ανταπόκριση του δείκτη αυτού στα επίπεδα έκθεσης τον καθιστά ακατάλληλο για την εκτίµηση της µακροπρόθεσµης έκθεσης, ενώ αντίθετα τον καθιστά ιδιαίτερα χρήσιµο για την σύντοµη εκτίµηση των επιπτώσεων στην έκθεση που προκύπτουν από κάποια παρέµβαση (π.χ. αλλαγές στην διαδικασία παραγωγής, εισαγωγή προστατευτικών µέτρων κλπ). Ένα παράδειγµα βιολογικού δείκτη της εσωτερικής δόσης που χρησιµοποιείται µε ιδιαίτερη επιτυχία στον χώρο της εργασιακής υγειινής είναι το 1- υδροξυπυρένιο των ούρων, µεταβολίτης του πυρενίου ο οποίος χρησιµοποιείται σαν γενικός δείκτης της εσωτερικής έκθεσης στους πολυκυκλικούς αρωµατικούς υδρογονάνθρακες. Μέσω της "µεταβολικής ενεργοποίησης" τα καρκινογόνα µετατρέπονται σε χηµικά ενεργά (ηλεκτρονιόφιλα) ενδιάµεσα τα οποία είναι σε θέση να αντιδράσουν µε τα κυτταρικά συστατικά και να σχηµατίσουν µε αυτά χηµικά σταθερά σύµπλοκα. Ενώ τα σύµπλοκα µε τις πρωτεϊνες δεν φαίνονται γενικά να έχουν κάποια επιβλαβή επίδραση στην λειτουργία του κυττάρου, τα σύµπλοκα µε το DNA έχουν σαν συνέπεια την αλλοίωση της λειτουργίας του DNA (π.χ. µείωση της ακρίβειας µε την οποία αντιγράφεται κατά την διάρκεια του κυτταρικού πολλαπλασιασµού). Μεταξύ των συνεπειών τέτοιων αλλοιώσεων είναι η παραγωγή µεταλλάξεων, δηλαδή µόνιµων αλλαγών στην αλληλουχία των γονιδίων, πράγµα που, µε την σειρά του, οδηγεί στην παραγωγή πρωτεϊνών µε αλλοιωµένη λειτουργικότητα η οποία παίζει άµεσο ρόλο στην καρκινική εξαλλαγή του κυττάρου. Κατά συνέπεια τα σύµπλοκα των καρκινογόνων µε το DNA µπορούν να θεωρηθούν σαν η πρώτη, βιολογικά κρίσιµη επίδραση των καρκινογόνων. Ο βαθµός στον οποίο σχηµατίζονται σε κάποιο άτοµο εξαρτάται από τα επίπεδα έκθεσής του καθώς και από την σχετική αποτελεσµατικότητα µε την οποία λειτουργούν στο άτοµο αυτό οι διάφοροι µεταβολικοί (αποτοξινοτική και ενεργοποιητικοί) δρόµοι. Γιαυτό και τα σύµπλοκα καρκινογόνων-dna θεωρούνται σαν δείκτες της βιολογικά σηµαντικής έκθεσης" σε ατοµικό επίπεδο (Σχήµα 2). Λόγω όµως της θέσης τους στον µηχανισµό της καρκινογένεσης (άµεση εµπλοκή), παρουσιάζουν το ενδεχόµενο να λειτουργήσουν και σαν δείκτες κινδύνου. Πρόσφατα έχουν παρουσιασθεί οι πρώτες θετικές ενδείξεις για το ενδεχόµενο αυτό, από επιδηµιολογικές µελέτες οι οποίες έχουν δείξει ότι άτοµα µε αυξηµένα επίπεδα βλαβών στο DNA τους παρουσίασαν µακροπρόθεσµα αυξηµένη πιθανότητα εµφάνισης καρκίνου.

3 Κατά τα τελευταία χρόνια έχει επιτευχθεί σηµαντική πρόοδος στην ανάπτυξη ευαίσθητων αναλυτικών µεθόδων για την µέτρηση των συµπλόκων µε το DNA µεγάλου αριθµού καρκινογόνων ουσιών που απαντώνται στο εργασιακό ή το γενικό περιβάλλον. Για την παρακολούθηση της ανθρώπινης έκθεσης τα σύµπλοκα αυτά µετρώνται συνήθως σε εύκολα προσβάσιµους ιστούς όπως τα κύτταρα του αίµατος (λεµφοκύτταρα ή συνολικά λευκά αιµοσφαίρια). Μετά από έκθεση σε κάποια καρκινογόνο ουσία, τα επίπεδα των συµπλόκων µε το DNA αυξάνονται σύντοµα (ανάλογα µε τον ρυθµό µεταβολισµού της ουσίας) ενώ, λόγω της λειτουργίας των µηχανισµών επιδιόρθωσης των βλαβών του DNA, τα σύµπλοκα αυτά εξαφανίζονται µε ρυθµό που συνήθως κυµαίνεται µεταξύ λίγων ηµερών και λίγων εβδοµάδων. Κατά συνέπεια η µέτρηση των συµπλόκων του DNA δίνει πληροφορίες σχετικά µε την έκθεση του ατόµου κατά την διάρκεια της αντίστοιχης περιόδου. Όπως και τα σύµπλοκα του DNA, τα σύµπλοκα των καρκινογόνων µε τις πρωτεϊνες αποτελούν επίσης δείκτες έκθεσης, αφού και στην περίπτωσή τους τα επίπεδα σχηµατισµού τους εξαρτώνται από τα επίπεδα έκθεσης και την µεταβολική ικανότητα του ατόµου. Στην περίπτωση αυτή, όµως, η απουσία εµπλοκής τους στον µηχανισµό της καρκινογένεσης περιορίζει την χρησιµότητά τους σαν δεικτών κινδύνου (Σχήµα 2). Από την άλλη πλευρά, η απουσία ενεργού επιδιόρθωσής τους τα καθιστά περισσότερο µακρόβια, αφού η διάρκεια της ζωής του εξαρτάται από την χηµική τους σταθερότητα και τον χρόνο ζωής της αντίστοιχης πρωτεϊνης. Τα σύµπλοκα αυτά συνήθως µετρώνται στην αιµοσφαιρίνη ή την αλβουµίνη του ορρού, πρωτεϊνες εύκολα προσβάσιµες και µε χρόνο ζωής που κυµαίνεται σε επίπεδα µερικών µηνών. Συνεπώς έχουν το πλεονέκτηµα ότι προσφέρονται για την εκτίµηση της έκθεσης σε σχετικά µακροχρόνια κλίµακα. Όµως σηµειώνεται ότι, άν και έχουν αναπτυχθεί εξαιρετικά ευαίσθητες µεθοδολογίες για την µέτρησή τους για σειρά καρκινογόνων περιβαλλοντικού ή εργασιακού ενδιαφέροντος, οι αντίστοιχες τεχνικές απαιτήσεις είναι σχετικά µεγάλες αφού συνήθως βασίζονται στην χρήση φασµατογραφίας µάζας και µάλιστα ιδιαίτερα ύψηλής τεχνολογίας. Οι δείκτες που αναφέρονται παραπάνω αποτελούν χηµικούς δείκτες της παρουσίας των καρκινογόνων ή των µεταβολιτών τους σε βιολογικά υγρά ή σε βιολογικά µακροµόρια, και κατά συνέπεια µπορούν να δώσουν πληροφορίες σχετικά µε την έκθεση στις αντίστοιχες, συγκεκριµµένες χηµικές ουσίες. Στον Πίνακα 1 παρουσιάζονται παραδείγµατα δεικτών έκθεσης σε καρκινογόνους παράγοντες εργασιακού ενδιαφέροντος. Αν και η εφαρµογή σε ερευνητικό πλαίσιο των δεικτών αυτών έχει αποδείξει την χρησιµότητά τους, σηµειώνεται ότι οι σχετικά µεγάλες τεχνικές απαιτήσεις για την µέτρησή τους έχει αποτρέψει µέχρι σήµερα την εφαρµογή τους για την εκτίµηση της έκθεσης, και των αντιστοίχων κινδύνων, στον εργασιακό χώρο σε επίπεδο ρουτίνας, µε σηµαντικότερο παράδειγµα εκτεταµένης και επιτυχούς εφαρµογής το 1- υδροξυπυρένιο των ούρων.

4 Βιολογικοί δείκτες κινδύνου 'Οπως έχει ήδη αναφερθεί, τα σύµπλοκα των καρκινογόνων µε το DNA οδηγούν στην παραγωγή µεταλλάξεων οι οποίες αποτελούν µόνιµες βιολογικές αλλοιώσεις. Μετά από έκθεση σε κάποια καρκινογόνο ουσία στα επίπεδα που συνήθως απαντώνται στο εργασιακό περιβάλλον παράγονται µερικές δεκάδες χιλιάδες σύµπλοκα ανά κύτταρο τα οποία εντοπίζονται σε διάφορα σηµεία του γονιδιώµατος, δηλαδή σε διάφορα γονίδια, στα οποία και τελικά προκαλούν µεταλλάξεις. Τέτοιου είδους αλλοιώσεις εµφανίζονται µέσα σε διάστηµα ηµερών ή εβδοµάδων από την έκθεση σε κάποιο καρκινογόνο, ενώ η διάρκεια της ζωής τους εξαρτάται από την διάρκεια ζωής των κυττάρων στα οποία βρίσκονται. Τείνουν να είναι σχετικά µακρόβιες (µήνες χρόνια), και µάλιστα αν σχηµατίστηκαν σε πρωτόγονα κύτταρα τότε πρέπει να θεωρηθούν σαν µόνιµες. Άν τα γονίδια στα οποία εντοπίζονται οι µεταλλάξεις αυτές είναι κρίσιµα για τον έλεγχο του κυτταρικού πολλαπλασιασµού (π.χ. πρωτο-ογκογονίδια) τότε οι µεταλλάξεις µπορεί να παίζουν άµεσο ρόλο στην καρκινογένεση. Ακόµα όµως και δεν συµµετέχουν στον µηχανισµό της καρκινογένεσης, µπορούν να λειτουργήσουν σαν πρώϊµοι δείκτες των µόνιµων βιολογικών επιδράσεων των καρκινογόνων (Σχήµα 2). Τέτοιοι δείκτες µπορούν να ανιχνευθούν µε την µορφή γονιδιακών µεταλλάξεων σε συγκεκριµµένα γονίδια (π.χ. στο γονίδιο HPRT), ή σαν ανωµαλίες ή µετακινήσεις γενετικού υλικού σε µεταφασικά χρωµοσώµατα ή ενδοφασικούς πυρήνες (ανταλλαγές αδελφών χρωµατίδων, µικροπυρήνες, κλπ). Οι αλλοιώσεις αυτές αποτελούν γενικούς (generic) δείκτες κυτταρικής αλλοίωσης ανεξάρτητα από την ουσία που τις προκάλεσε, δηλαδή σε αντίθεση µε τους δείκτες που αναφέρθηκαν παραπάνω δεν είναι ειδικοί για συγκεκριµµένες καρκινογόνες ουσίες. Mάλιστα σε προοπτικές επιδηµιολογικές µελέτες έχει δειχθεί ότι η παρουσία αυξηµένων επιπέδων χρωµοσωµικών ανωµαλιών σε λεµφοκύτταρα αίµατος συσχετίζεται µε αυξηµένη πιθανότητα εµφάνισης καρκίνου, πράγµα που υποδηλώνει ότι ο δείκτης αυτός µπορεί να λειτουργήσει σαν δείκτης κινδύνου. είκτες ατοµικής ευαισθησίας Όπως έχει ήδη αναφερθεί, µετά από την είσοδό τους στον οργανισµό οι καρκινογόνες ουσίες συνήθως υπόκεινται σε µεταβολισµό ο οποίος οδηγεί είτε στην αδρανοποίηση/ αποβολή τους είτε στην ενεργοποίησή τους και την µετατροπή τους σε ενδιάµεσα τα οποία σχηµατίζουν σύµπλοκα µε το DNA (την πρώτη βιολογικά σηµαντική επίδραση των καρκινογόνων ουσιών). Η ικανότητα εκτέλεσης αυτών των µεταβολικών διεργασιών διαφέρει από άτοµο σε άτοµο και τα αίτιά των παρατηρουµένων διακυµάνσεων δεν είναι γενικά κατανοητά. Μιά αιτία που έχει αναγνωρισθεί σχετίζεται µε την γενετική διαφορετικότητα, δηλαδή µε την παρουσία διαφορών (συνήθως περιορισµένων σε ένα νουκλεοτίδιο) στην αλληλουχία των σχετικών γονιδίων µεταξύ διαφόρων ατόµων. Η παρουσία των γενετικών αυτών πολυµορφισµών σε γονίδια µεταβολισµού των καρκινογόνων έχει σαν συνέπεια παραγωγή διαφορετικών επιπέδων των κρίσιµων αλλοιώσεων του DNA µετά από όµοια έκθεση, πράγµα που πιστεύεται ότι συνεπάγεται διαφορετική ευαισθησία στις καρκινογόνες επιδράσεις των αντιστοίχων ουσιών. Ανάλογη διακύµανση στην ατοµική ευαισθησία στα καρκινογόνα προκαλείται και από γενετικούς πολυµορφισµούς σε άλλα γονίδια που εµπλέκονται στην καρκινογένεση, όπως είναι τα γονίδια επιδιόρθωσης του DNA, γονίδια ελέγχου του κυτταρικού πολλαπλασιασµού, της απόπτωσης κλπ. Τα κυριώτερα γονίδια των οποίων οι πολυµορφισµοί έχουν µελετηθεί ως δείκτες ατοµικής ευαισθησίας στα καρκινογόνα του εργασιακού χώρου είναι τα γονίδια µεταβολισµού φάσης Ι που ανήκουν στην οικογένεια του κυττοχρώµατος P450, όπως το CYP1A1, CYP1B1, CYP2D6, CYP2E1 κλπ, καθώς και γονίδια µεταβολισµού φάσης ΙΙ όπως η Ν-ακετυλοτρανσφεράση ΝΑΤ2 και οι τρανσφεράσες της γλουταθειόνης GSTµ,GSTπ και GSTθ, κλπ. Σε πολλές περιπτώσεις έχει παρατηρηθεί ότι άτοµα µε συγκεκριµµένους πολυµορφισµούς, ή συνδυασµούς πολυµορφισµών σε διαφορετικά γονίδια (π.χ. CYP1A1/GSTµ) παρουσιάζουν αυξηµένα επίπεδα συµπλόκων του DNA, αλλά και αυξηµένη πιθανότητα καρκινογένεσης. Ο βαθµός αύξησης του κινδύνου που έχουν µέχρι σήµερα συσχετισθεί µε τους πολυµορφισµούς αυτούς είναι σχετικά µικρός (συνήθως

5 λιγότερο από διπλασιασµός). Αν όµως ληφθεί υπόψη η µεγάλη συχνότητα παρουσίας πολυµορφισµών στο ανθρώπινο γονιδίωµα (υπολογίζεται µέση συχνότητα µιάς µετάλλαξης κάθε 1500 νουκλεοτίδια), τότε µπορεί κανείς να συµπεράνει ότι ο κατάλληλος συνδυασµός µεταλλάξεων σε σειρά γονιδίων τα οποία λειτουργούν σε συνεργασία στα πλαίσια του µηχανισµού της καρκινογένεσης µπορεί να οδηγήσει σε σηµαντική αύξηση της ατοµικής ευαισθησίας. Με δεδοµένη την ταχύτατη εξέλιξη της τεχνολογίας ανίχνευσης γενετικών διακυµάνσεων µπορεί κανείς βάσιµα να προβλέψει ότι η ανακάλυψη τέτοιων συνδυασµών πολυµορφισµών οι οποίοι σε συνέργεια οδηγούν στην διαµόρφωση σηµαντικά αυξηµένης ατοµικής ευαισθησίας είναι θέµα χρόνου, προοπτική µε µεγάλη σπουδαιότητα σε ό,τι αφορά την πρόληψη του καρκίνου, η οποία ταυτόχρονα θέτει και σηµαντικά ηθικά, πολιτικά και κοινωνικά ερωτήµατα. Συµπεράσµατα ιάφοροι βιολογικοί δείκτες επιτρέπουν την παρακολούθηση, σε ατοµικό επίπεδο, της εργασιακής έκθεσης σε καρκινογόνους παράγοντες. Ορισµένοι από του δείκτες αυτούς (βλάβες DNA) προσφέρουν την προοπτική λειτουργίας και σαν δείκτες κινδύνου µελλοντικής νόσησης. Σε επίπεδο κανονιστικό, η απουσία επαρκώς στοιχειοθετηµένων πληροφοριών για τις δοσολογικές σχέσεις µεταξύ δεικτών και επιπτώσεων υγείας δεν επιτρέπει ακόµα τον καθορισµό ορίων για τους βιολογικούς δείκτες των καρκινογών ουσιών. Όµως οι ήδη διαθέσιµοι δείκτες µπορούν να αξιοποιηθούν για την παρακολούθηση της χρονικής και τοπικής διακύµανσης της έκθεσης καθώς και της αποτελεσµατικότητας προστατευτικών και προληπτικών παρεµβάσεων. Τέλος, οι τεχνολογικές εξελίξεις προδιαγράφουν την προοπτική δυνατότητας ανίχνευσης ατόµων µε αυξηµένη γενετική ευαισθησία σε τοξικούς χηµικούς παράγοντες. Οι ηθικές, νοµικές και κοινωνικές προκτάσεις των εξελίξεων αυτών είναι σηµαντικές. Bιβλιογραφία 1. A. Mutti, Biological monitoring in occupational and enviornmental toxicology. Toxicol. Lett. 108 (1999) G. Talaska, A. Maier, S. Henn, A. Booth-Jones, Y. Tsuneoka, R. Vermeulen and B. L. Schumann, Carcinogen biomonitoring in human exposures and laboratory research: validation and application to human occupational exposures. Toxicol. Lett. 134 (2002) F.J. Jongeneelen, Benchmark guideline for urinary 1-hydroxypyrene as biomarker of occupational exposure to polycyclic aromatic hydrocarbons. Ann. Occup. Hyg. 45 (2001) 3 13.

6 Σχήµα 1: Μηχανισµός χηµικής καρκινογένεσης και βιολογικοί δείκτες αποβολή µεταβολική απενεργοποίηση / αποτοξίνωση ανενεργοί µεταβολίτες καρκινογόνο ενεργοί µεταβολίτες µεταβολική ενεργοποίηση εξωτερική δόση (περιβαλλοντική παρακολούθηση) εσωτερική δόση επιδιόρθωση DNA σύµπλοκα µε DNA σύµπλοκα µε πρωτεϊνες βιολογικά σηµαντική δόση µεταλλάξεις / µόνιµες γενετικές βλάβες σε καρκινικά γονίδια πρώϊµες βιολογικές επιδράσεις νεοπλασία

7 Σχήµα 2: Βιολογικοί δείκτες στην εκτίµηση κινδύνων από καρκινογόνους παράγοντες έκθεση δοσολογική σχέση νόσος εσωτερική δόση βιολογικά σηµανική δόστη πρώϊµες βιολογικές επιδράσεις αλλαγές δοµής/ λειτουργίας ουσίες / µεταβολίτες / µεταλλαξογόνος δραστικότητα σε ούρα σύµπλοκα µε DNA ή πρωτεϊνες σε κύτταρα (αίµατος ή ούρων) ή ούρα χρωµοσωµικές ανωµαλίες / µεταλλάξεις σε κύτταρα αίµατος γενετική έκφραση/ γενετικές αλλαγές σε προκαρκινικούς ιστούς ή κύτταρα δείκτες έκθεσης δείκτες κινδύνου ΧΡΟΝΙΚΟ ΠΑΡΑΘΥΡΟ ΕΚΘΕΣΗΣ ώρες - µέρες µέρες - εβδοµάδες εβδοµάδες - µήνες µήνες +

8 Πίνακας 1: Βιολογικοί δείκτες έκθεσης και κινδύνου για καρκινογόνους παράγοντες του εργασιακού χώρου βενζόλιο S-φαινυλοµερκαπτουρικό οξύ ούρων / σύµπλοκα αιµοσφαιρίνης αιθυλενοξείδιο 1,3-βουταδιένιο βενζιδίνη 4-αµινοδιφαινύλιο πολυκυκλικοί αρωµατικοί υδρογονάνθρακες (ΠΑΥ) (πίσσα, ατελής καύση) σύµπλοκα αιµοσφαιρίνης & DNA σύµπλοκα αιµοσφαιρίνης & DNA σύµπλοκα αιµοσφαιρίνης & DNA σύµπλοκα αιµοσφαιρίνης & DNA 1-υδροξυπυρένιο ούρων σύµπλοκα αλβουµίνης, αιµοσφαιρίνης & DNA

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Σ. Κυρτόπουλος Ινστιτούτο Βιολογικών Ερευνών & Βιοτεχνολογίας Εθνικό Ίδρυμα Ερευνών Συμβολή περιβαλλοντικών

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Αντιµεταλλαξιγόνο δράση ανίχνευση ουσιών που προστατεύουν το DNA από µεταλλαξιγόνα που προκαλούν µεταλλάξεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) 1 ΔΗΜΙΟΥΡΓΙΑ ΦΥΤΩΝ ΜΕ ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ 19 Παράγοντες που συμβάλλουν σε αύξηση των εντόμων 1. Μονοκαλλιέργειες 2. Βελτίωση με κριτήριο αποκλειστικά την

Διαβάστε περισσότερα

Κυτταρογενετική και μοριακή γενετική επίκτητων διαταραχών

Κυτταρογενετική και μοριακή γενετική επίκτητων διαταραχών ΙΠΤ-Α ΕΡΓΑΣΤΗΡΙΟ ΥΓΕΙΟΦΥΣΙΚΗΣ & ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΥΓΕΙΑΣ ΕΠΙΠΤΩΣΕΙΣ ΓΟΝΟΤΟΞΙΚΩΝ ΕΚΘΕΣΕΩΝ ΣΤΗΝ ΥΓΕΙΑ Κυτταρογενετική και μοριακή γενετική επίκτητων διαταραχών ρ Κωνσταντίνα Σαμπάνη Ερευνήτρια Α 1 ΒΙΟΛΟΓΙΚΕΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

Μια ενημέρωση για ασθενείς και παρόχους φροντίδας

Μια ενημέρωση για ασθενείς και παρόχους φροντίδας Μια ενημέρωση για ασθενείς και παρόχους φροντίδας Τι είναι το FoundationOne ; Το FoundationOne είναι μια εξέταση που ανιχνεύει γενωμικές μεταβολές (π.χ. μεταλλάξεις) που είναι γνωστό ότι σχετίζονται με

Διαβάστε περισσότερα

Κριτήρια ταξινόμησης κατά CLP: Κίνδυνοι για την ανθρώπινη υγεία Καρκινογένεση, Μεταλλαξιγένεση, Τοξικότητα στην αναπαραγωγή

Κριτήρια ταξινόμησης κατά CLP: Κίνδυνοι για την ανθρώπινη υγεία Καρκινογένεση, Μεταλλαξιγένεση, Τοξικότητα στην αναπαραγωγή ΔΙΕΥΘΥΝΣΗ ΕΝΕΡΓΕΙΑΚΩΝ ΒΙΟΜΗΧΑΝΙΚΩΝ & ΧΗΜΙΚΩΝ ΠΡΟΪΟΝΤΩΝ ΓΕΝΙΚΟΥ ΧΗΜΕΙΟΥ ΤΟΥ ΚΡΑΤΟΥΣ 11 η Ετήσια Σύσκεψη Επιθεωρητών REACH, CLP 2015 Εθνική Συνάντηση Εργασίας του PROTEAS Αθήνα, 27-2929 Απριλίου 2015 Γενικό

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη Ατυπία Υπερπλασία- Δυσπλασία Κίττυ Παυλάκη Jeanne Calment Κάπνιζε µέχρι τα 117 Πέθανε στα 122 Η σωστή λειτουργία των οργανισµών απαιτεί τη δυνατότητα προσαρµογής των κυττάρων και κατά συνέπεια και των

Διαβάστε περισσότερα

Ρύπανση του αέρα και υγεία

Ρύπανση του αέρα και υγεία Ρύπανση του αέρα και υγεία Σωτήρης Κυρτόπουλος Διευθυντής Ερευνών, Ινστιτούτο Βιολογικών Ερευνών και Βιοτεχνολογίας (ΙΒΕΒ), Εθνικό Ίδρυμα Ερευνών 1. ΕΙΣΑΓΩΓΗ ο πρόβλημα της ρύπανσης του αέρα και των επιπτώσεων

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΜΕ ΜΕΤΑΛΛΑΓΕΣ Μεταλλαγή ή Μετάλλαξη Οποιαδήποτε αλλαγή του γενετικού υλικού που δεν οφείλεται σε ανασυνδυασµό ή σε διάσχιση των γονιδίων και η οποία

Διαβάστε περισσότερα

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες 12 Orphanet Ιστοσελίδα ελεύθερης πρόσβασης που παρέχει πληροφορίες για τις σπάνιες παθήσεις, τα κλινικά πειράµατα, τα φάρµακα και συνδέσµους για οµάδες υποστήριξης σε ολόκληρη την Ευρώπη. Ιστοσελίδα: www.orpha.net

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΠΑΡΑΡΤΗΜΑ Χ ΤΥΠΙΚΕΣ ΑΠΑΙΤΗΣΕΙΣ ΠΛΗΡΟΦΟΡΙΩΝ ΓΙΑ ΟΥΣΙΕΣ ΠΟΥ ΠΑΡΑΣΚΕΥΑΖΟΝΤΑΙ Ή ΕΙΣΑΓΟΝΤΑΙ ΣΕ ΠΟΣΟΤΗΤΕΣ 1000 ΤΟΝΩΝ Ή ΑΝΩ 1

ΠΑΡΑΡΤΗΜΑ Χ ΤΥΠΙΚΕΣ ΑΠΑΙΤΗΣΕΙΣ ΠΛΗΡΟΦΟΡΙΩΝ ΓΙΑ ΟΥΣΙΕΣ ΠΟΥ ΠΑΡΑΣΚΕΥΑΖΟΝΤΑΙ Ή ΕΙΣΑΓΟΝΤΑΙ ΣΕ ΠΟΣΟΤΗΤΕΣ 1000 ΤΟΝΩΝ Ή ΑΝΩ 1 30.12.2006 EL Επίσημη Εφημερίδα της Ευρωπαϊκής Ένωσης L 396/363 ΠΑΡΑΡΤΗΜΑ Χ ΓΙΑ ΟΥΣΙΕΣ ΠΟΥ ΠΑΡΑΣΚΕΥΑΖΟΝΤΑΙ Ή ΕΙΣΑΓΟΝΤΑΙ ΣΕ ΠΟΣΟΤΗΤΕΣ 1000 ΤΟΝΩΝ Ή ΑΝΩ 1 Στο ποσοτικό επίπεδο του παρόντος Παραρτήματος, ο

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΗPV και Καρκίνος Δέρµατος. Ηλέκτρα Νικολαΐδου Επ. Καθηγήτρια Δερµατολογίας ΕΚΠΑ Νοσ. «Α. Συγγρός»

ΗPV και Καρκίνος Δέρµατος. Ηλέκτρα Νικολαΐδου Επ. Καθηγήτρια Δερµατολογίας ΕΚΠΑ Νοσ. «Α. Συγγρός» ΗPV και Καρκίνος Δέρµατος Ηλέκτρα Νικολαΐδου Επ. Καθηγήτρια Δερµατολογίας ΕΚΠΑ Νοσ. «Α. Συγγρός» ΓΕΝΗ HPV Α γένος: βλεννογόνοι αιτιολογική συσχέτιση µε καρκίνο τραχήλου µήτρας, πρωκτού, αιδοίου, πέους

Διαβάστε περισσότερα

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής?

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής? 12 εργαστήριο ίσως ελέγξει τα αποθηκευµένα δείγµατα (ιδιαίτερα εάν ο αρχικός έλεγχος δεν έδωσε αποτέλεσµα), αλλά µόνο εάν έχετε δώσει τη γραπτή σας συγκατάθεση για κάτι τέτοιο. Με αυτό τον τρόπο οι ασθενείς

Διαβάστε περισσότερα

Tοξικότητα. Αρτεμις Ντονά Επίκουρη Καθηγήτρια Εργ. Ιατροδικαστικής και Τοξικολογίας. 6/3/2008 Αρτεμις Αγησ. Ντονά

Tοξικότητα. Αρτεμις Ντονά Επίκουρη Καθηγήτρια Εργ. Ιατροδικαστικής και Τοξικολογίας. 6/3/2008 Αρτεμις Αγησ. Ντονά Tοξικότητα Αρτεμις Ντονά Επίκουρη Καθηγήτρια Εργ. Ιατροδικαστικής και Τοξικολογίας Αντικείμενα του μαθήματος Να εξοικειωθεί με την έννοια της τοξικότητας, όργανο στόχος Να μπορεί να ξεχωρίσει την οξεία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Συστήματα ελέγχου προσδιορισμού γενετικής δράσης φυσικών και χημικών παραγόντων του περιβάλλοντος

Συστήματα ελέγχου προσδιορισμού γενετικής δράσης φυσικών και χημικών παραγόντων του περιβάλλοντος ΕΡΕΥΝΑ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΕΤΑΛΛΑΞΙΓΕΝΕΣΗ Συστήματα ελέγχου προσδιορισμού γενετικής δράσης φυσικών και χημικών παραγόντων του περιβάλλοντος Οι μελέτες γενοτοξικών επιδράσεων διαφόρων περιβαλλοντικών παραγόντων

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ToxPlus. Spin-off εταιρία του Εργαστηρίου Τοξικολογίας Πανεπιστημίου Κρήτης. Επιδοτούμενη από το ΕΣΠΑ (2007 2013)

ToxPlus. Spin-off εταιρία του Εργαστηρίου Τοξικολογίας Πανεπιστημίου Κρήτης. Επιδοτούμενη από το ΕΣΠΑ (2007 2013) KENTΡΟ ΤΟΞΙΚΟΛΟΓΙΑΣ Α.Ε. Επιστημονικό και Τεχνολογικό Πάρκο Κρήτης Step C, N. Πλαστήρα 100, Βασιλικά Βουτών, Τ.Κ. 700 13 Ηράκλειο, Κρήτη www.toxplus.gr ToxPlus Spin-off εταιρία του Εργαστηρίου Τοξικολογίας

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του 1 Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του μαστού. Ο καρκίνος του μαστού είναι με μεγάλη διαφορά

Διαβάστε περισσότερα

To Σύστημα HACCP & τα Ξενοδοχεία. Δρ Ε. ΕΥΜΟΡΦΟΠΟΥΛΟΣ

To Σύστημα HACCP & τα Ξενοδοχεία. Δρ Ε. ΕΥΜΟΡΦΟΠΟΥΛΟΣ To Σύστημα HACCP & τα Ξενοδοχεία Δρ Ε. ΕΥΜΟΡΦΟΠΟΥΛΟΣ Τι είναι HACCP; Hazard = Κίνδυνος Analysis = Ανάλυση Critical = Κρίσιμο Το ΑΚΚΣΕ είναι ένα εργαλείο που προσπαθεί να διασφαλίσει την υγιεινή και την

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. Η Επιτροπή Παιδείας της ΠΕΒ

Διαβάστε περισσότερα

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη.

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. 12 Γενετικό γλωσσάριο Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. Ιανουάριος 2009 Τροποποιηµένο από το γλωσσάριο που αρχικά δηµιουργήθηκε από το Πάρκο Γενετικής Γνώσης London IDEAS (London

Διαβάστε περισσότερα

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες 12 Φυλοσύνδετη στο Χ Ή την τοπική σας κλινική γενετικής διάγνωσης: κληρονοµικότητα Εργαστήριο Ιατρικής Γενετικής Πανεπιστήµιο Αθηνών Νοσοκοµείο Παίδων " Αγία Σοφία" Αθήνα Τηλ: +210 7795553 http://iatriki-genetiki.med.uoa.gr

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

HIV & Ca τραχήλου μήτρας. Άτομα μολυσμένα με HIV έχουν αυξημένη ροπή για την ανάπτυξη καρκίνου.

HIV & Ca τραχήλου μήτρας. Άτομα μολυσμένα με HIV έχουν αυξημένη ροπή για την ανάπτυξη καρκίνου. HIV & Ca τραχήλου μήτρας Άτομα μολυσμένα με HIV έχουν αυξημένη ροπή για την ανάπτυξη καρκίνου. ΠΑΘΟΓΕΝΕΙΑ Πολλαπλοί παράγοντες μπορούν να συμβάλουν στην ανάπτυξη της κακοήθειας σε ασθενείς με AIDS. Οι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Το πιο μικρό και συμπαγές LASER μεγάλης ισχύος για την φυσικοθεραπεία και την φυσική αποκατάσταση

Το πιο μικρό και συμπαγές LASER μεγάλης ισχύος για την φυσικοθεραπεία και την φυσική αποκατάσταση Το πιο μικρό και συμπαγές LASER μεγάλης ισχύος για την φυσικοθεραπεία και την φυσική αποκατάσταση Χημικοί Μηχανισμοί Παραγωγή εξ επαγωγής, φωτο-χημικών φαινομένων φωτο-ευαισθητοποίησης και φωτο-απομάκρυνσης.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU)

Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU) Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU) μπορεί να ορισθεί ως μια σπάνια μεταβολική διαταραχή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα

Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση

Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση Ο καρκίνος είναι μια ιδιαίτερα ετερογενής νόσος, που προκύπτει από συσσώρευση μεταλλάξεων του DNA. Η αιτιολογία του καρκίνου είναι πολυπαραγοντική,

Διαβάστε περισσότερα

ΚΑΡΚΙΝΟΓΟΝΟΙ ΠΑΡΑΓΟΝΤΕΣ

ΚΑΡΚΙΝΟΓΟΝΟΙ ΠΑΡΑΓΟΝΤΕΣ ΚΑΡΚΙΝΟΓΟΝΟΙ ΠΑΡΑΓΟΝΤΕΣ ΣΤΟΥΣ ΧΩΡΟΥΣ ΕΡΓΑΣΙΑΣ Περίληψη εισήγησης σε σεµινάριο τεχνικών ασφαλείας του ΕΛΙΝΥΑΕ ΤΖΙΝΑΣ ΘΕΟ ΩΡΟΣ ΒΙΟΛΟΓΟΣ ΤΕΧΝΙΚΟΣ ΕΠΙΘΕΩΡΗΤΗΣ ΕΡΓΑΣΙΑΣ ΚΑΡΚΙΝΟΓΟΝΟΙ ΠΑΡΑΓΟΝΤΕΣ Τι είναι καρκίνος

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Ελεύθερες ρίζες και αντιοξειδωτικά

Ελεύθερες ρίζες και αντιοξειδωτικά Ελεύθερες ρίζες και αντιοξειδωτικά Κατά τη διάρκεια των φυσιολογικών ανθρώπινων διεργασιών παραγωγή ενέργειας, αποτοξίνωση από τοξικές ουσίες και ανοσολογική απόκριση, παράγονται από τον οργανισµό ελεύθερες

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

Επιδραση της αλατισης και καπνισης στα θρεπτικα συστατικά των ζωικών προιοντων Εκτός από το χλωριούχο νάτριο, για συντηρηση για τα ψαρια και το

Επιδραση της αλατισης και καπνισης στα θρεπτικα συστατικά των ζωικών προιοντων Εκτός από το χλωριούχο νάτριο, για συντηρηση για τα ψαρια και το Επιδραση της αλατισης και καπνισης στα θρεπτικα συστατικά των ζωικών προιοντων Εκτός από το χλωριούχο νάτριο, για συντηρηση για τα ψαρια και το κρεας, γίνεται και χρήση άλλων αλατων όπως νιτρικών και νιτρωδών.

Διαβάστε περισσότερα

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 1) ΑΝΩΜΑΛΙΕΣ ΣΤΟΝ ΑΡΙΘΜΟ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΕΥΠΛΟΕΙΔΙΑ: ΚΑΘΕ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΑΡΙΘΜΟΥ Ν (ΑΠΛΟΕΙΔΕΣ ΓΟΝΙΔΙΩΜΑ) 3Ν ΑΥΘΟΡΜΗΤΕΣ ΑΠΟΒΟΛΕΣ 4Ν τριπλοειδία Α) Γονιμοποίηση ωαρίου

Διαβάστε περισσότερα

Υγιεινή. Ρύπανση περιβάλλοντος. Λεοτσινίδης Μιχάλης Καθηγητής Υγιεινής Ιατρική Σχολή Πανεπιστήμιο Πατρών

Υγιεινή. Ρύπανση περιβάλλοντος. Λεοτσινίδης Μιχάλης Καθηγητής Υγιεινής Ιατρική Σχολή Πανεπιστήμιο Πατρών Υγιεινή Ρύπανση περιβάλλοντος Λεοτσινίδης Μιχάλης Καθηγητής Υγιεινής Ιατρική Σχολή Πανεπιστήμιο Πατρών ΡΥΠΑΝΣΗ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Ρύπανση: χαρακτηρίζεται η ανεπιθύμητη αλλαγή των φυσικών, χημικών, ραδιολογικών

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΑΛΛΕΡΓΙΑ: Ο ΑΟΡΑΤΟΣ ΕΧΘΡΟΣ ΠΩΣ ΓΙΝΕΤΑΙ ΚΑΠΟΙΟΣ ΑΛΛΕΡΓΙΚΟΣ;

ΑΛΛΕΡΓΙΑ: Ο ΑΟΡΑΤΟΣ ΕΧΘΡΟΣ ΠΩΣ ΓΙΝΕΤΑΙ ΚΑΠΟΙΟΣ ΑΛΛΕΡΓΙΚΟΣ; ΑΛΛΕΡΓΙΑ: Ο ΑΟΡΑΤΟΣ ΕΧΘΡΟΣ ΠΩΣ ΓΙΝΕΤΑΙ ΚΑΠΟΙΟΣ ΑΛΛΕΡΓΙΚΟΣ; Αλλεργία, όπως ορίζει και η λέξη, σημαίνει άλλο έργο. Είναι η μη αναμενόμενη αντίδραση του ανοσιακού συστήματος του οργανισμού εναντίον ακίνδυνων

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Θέμα: DNA Τμήμα: ΗΥ: Ομάδα: Β2 pc29 Μηλαθιανάκης Μιχάλης

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

Εργασία του μαθητή Θ. Σιδηρόπουλου :καρκίνος και μεταλλάξεις. Τμήμα Γ 2

Εργασία του μαθητή Θ. Σιδηρόπουλου :καρκίνος και μεταλλάξεις. Τμήμα Γ 2 ΚΑΡΚΙΝΟΣ: Ο Καρκίνος είναι ένα από τα σοβαρότερα προβλήματα υγείας που παρατηρούνται σήμερα στις αναπτυγμένες χώρες. Οι στατιστικές δείχνουν ότι αποτελεί τη δεύτερη πιο συχνή αιτία θανάτου μετά τις καρδιοπάθειες.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Γενικά. Τί είναι ο κληρονομικός καρκίνος; κληρονομικός και σποραδικός καρκίνος. Κληρονομικός καρκίνος - Site Ε.Ο.Π.Ε. - Μ.Σ.

Γενικά. Τί είναι ο κληρονομικός καρκίνος; κληρονομικός και σποραδικός καρκίνος. Κληρονομικός καρκίνος - Site Ε.Ο.Π.Ε. - Μ.Σ. 1 Γενικά Ο καρκίνος προκαλείται από αλλαγές στα υλικά του σώματος μας που ονομάζονται «γονίδια». Πρόκειται για τις μονάδες πληροφοριών σε κάθε κύτταρο του σώματός μας. Τα γονίδια υπαγορεύουν στπν οργανισμό

Διαβάστε περισσότερα

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ Μικροβιολογικό & Ερευνητικό Εργαστήριο Καθ έξιν Αποβολές Οι καθ 'έξιν αποβολές είναι μια ασθένεια σαφώς διακριτή από τη στειρότητα, και που ορίζεται ως δύο ή περισσότερες αποτυχημένες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής

ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Τμήμα Βιολογικών Επιστημών http://www.ucy.ac.cy/goto/biosci/el-gr/home.aspx ΒΙΟΛΟΓΙΑ: Η επιστήμη της ζωής Μελετά ό,τι έχει σχέση με τους ζωντανούς οργανισμούς στον πλανήτη μας, από το μικροσκοπικό επίπεδο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΚΑΙ ΒΙΟΛΟΓΙΚΗ ΔΡΑΣΗ ΣΥΣΤΑΤΙΚΩΝ ΤΩΝ ΣΤΙΓΜΑΤΩΝ ΤΟΥ ΦΥΤΟΥ ΚΡΟΚΟΣ (Crocus sativus L. )

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΚΑΙ ΒΙΟΛΟΓΙΚΗ ΔΡΑΣΗ ΣΥΣΤΑΤΙΚΩΝ ΤΩΝ ΣΤΙΓΜΑΤΩΝ ΤΟΥ ΦΥΤΟΥ ΚΡΟΚΟΣ (Crocus sativus L. ) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΚΑΙ ΒΙΟΛΟΓΙΚΗ ΔΡΑΣΗ ΣΥΣΤΑΤΙΚΩΝ ΤΩΝ ΣΤΙΓΜΑΤΩΝ ΤΟΥ ΦΥΤΟΥ ΚΡΟΚΟΣ (Crocus sativus L. ) Μόσχος Γ. Πολυσίου, Χημικός, Καθηγητής Χημείας, Εργαστήριο Γενικής Χημείας, Γεωπονικό Πανεπιστήμιο Αθηνών

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Τεχνητές πηγές ακτινοβολιών και η χρήση τους από τον άνθρωπο

Τεχνητές πηγές ακτινοβολιών και η χρήση τους από τον άνθρωπο Ιοντίζουσες ακτινοβολίες είναι οι ακτινοβολίες που μεταφέρουν ενέργεια ικανή να εισχωρήσει στην ύλη, να προκαλέσει ιοντισμό των ατόμων της, να διασπάσει βίαια χημικούς δεσμούς και να προκαλέσει βιολογικές

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος δεν υπάρχει σύγκρουση συµφερόντων Ø Ποιό HPV τεστ είναι το

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης 5/3/2013 Η κυτταρική διαίρεση είναι η διαδικασία κατά την οποία ένα αρχικό κύτταρο διαιρείται σε δύο θυγατρικά. Στους πολυκύτταρους

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα