Αλάπηπμε λέσλ δηαγλσζηηθώλ κεζόδσλ γηα ηε Βαξηά Μπαζζέλεηα

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Αλάπηπμε λέσλ δηαγλσζηηθώλ κεζόδσλ γηα ηε Βαξηά Μπαζζέλεηα"

Transcript

1 ΓΗΓΑΚΣΟΡΗΚΖ ΓΗΑΣΡΗΒΖ ΝΗΚΟΛΑΟ ΣΡΑΚΑ ΒΗΟΛΟΓΟ Αλάπηπμε λέσλ δηαγλσζηηθώλ κεζόδσλ γηα ηε Βαξηά Μπαζζέλεηα Δξγαζηήξην Μνξηαθήο Βηνινγίαο θαη Αλνζνινγίαο (ΔΜΒΗΑ) Σκήκα Φαξκαθεπηηθήο Παλεπηζηήκην Παηξώλ 2012

2 ΔΙΔΑΚΣΟΡΙΚΗ ΔΙΑΣΡΙΒΗ ΣΡΙΜΕΛΗ ΤΜΒΟΤΛΕΤΣΙΚΗ ΕΠΙΣΡΟΠΗ Καεδβδηήξ ςηνάηδξ Σγάνημξ (επζαθέπςκ) Ακαπθδνςηήξ Καεδβδηήξ Γνδβυνδξ ζαμθαπέκημ Δπίημονμξ Καεδβδηήξ Κςκζηακηίκμξ Πμοθάξ ΕΠΣΑΜΕΛΗ ΕΞΕΣΑΣΙΚΗ ΕΠΙΣΡΟΠΗ Καεδβδηήξ. Σγάνημξ Καεδβδηήξ Α. Παπαπεηνυπμοθμξ Ακαπθδνςηήξ Καεδβδηήξ Γ. ζαμθαπέκημ Ακαπθδνςηήξ Καεδβήηνζα Δ. Παπαδδµδηνίμο Ακαπθδνςηήξ Καεδβδηήξ Γ. πονμφθζαξ Δπίημονμξ Καεδβδηήξ Κ. Πμοθάξ Δπίημονμξ Καεδβδηήξ Γ. Παηνζκυξ 2

3 ΔΙΔΑΚΣΟΡΙΚΗ ΔΙΑΣΡΙΒΗ 3

4 ΠΡΟΛΟΓΟ ΠΡΟΛΟΓΟ Ζ πανμφζα δζαηνζαή πναβιαημπμζήεδηε ζημ ενβαζηήνζμ Μμνζαηήξ Νεονμαζμθμβίαξ ηαζ Ακμζμθμβίαξ ημο Δθθδκζημφ Ηκζηζημφημο Παζηέν, ζε ζοκενβαζία ιε ημ ενβαζηήνζμ Μμνζαηήξ Βζμθμβίαξ ηαζ Ακμζμθμβίαξ ημο ηιήιαημξ Φανιαηεοηζηήξ ημο Πακεπζζηδιίμο Παηνχκ, οπυ ηδκ επίαθερδ ημο Καεδβδηή ςηνάηδ Σγάνημο. Ζ δζαηνζαή αοηή απμηεθεί έκα πμθφ ζδιακηζηυ αήια πνμξ ηδκ εηπθήνςζδ εκυξ μκείνμο ηαζ ηδκ πναβιαημπμίδζδ εκυξ ζηυπμο ζηδκ επζζηδιμκζηή ιμο δζαδνμιή. Δίκαζ πνμσυκ ζοκεπμφξ ηαζ εζθζηνζκμφξ πνμζπάεεζαξ ζηα δφζααηα αθθά ηαοηυπνμκα πμθφ ζοκανπαζηζηά ιμκμπάηζα ηδξ επζζηήιδξ. Δίκαζ πμθθμί αοημί πμο εα ήεεθα κα εοπανζζηήζς δζαπνμκζηά, αθθά δεκ ιπμνχ κα ακαθενεχ μκμιαζηζηά ζε υθμοξ, βζαηί θμαάιαζ ιήπςξ αδζηήζς ή λεπάζς ηάπμζμοξ. Πανυθα αοηά είκαζ αδφκαημκ κα ιδκ ακαθενεχ ζε ηάπμζμοξ πμθφ ζδιακηζημφξ ακενχπμοξ πμο ζηάεδηακ δίπθα ιμο, ιε πίζηερακ, ιε εκεάνοκακ ηαζ ιε χεδζακ ζηδκ μθμηθήνςζδ ηδξ δζαηνζαήξ. Απυ ηδκ εέζδ αοηή εα ήεεθα κα εοπανζζηήζς ζδζαίηενα ημκ Καεδβδηή ςηνάηδ Σγάνημ ηαζ κα ημο εηθνάζς ηδκ εοβκςιμζφκδ ιμο, βζα ηδκ εοηαζνία ηδκ μπμία ιμο έδςζε βζα ηδκ πναβιαημπμίδζδ ηδξ δζαηνζαήξ αοηήξ ηαζ βζα ηδκ αιένζζηδ ζοιπανάζηαζδ ημο ζε υθα ηα ζηάδζα εηπυκδζδξ ηδξ. Ήηακ ηαζ είκαζ πάκηα δίπθα ιμο, - αημφναζημξ ηαεμδδβδηήξ, δάζηαθμξ ηαζ ζοκενβάηδξ, πάκηα δζαεέζζιμξ ιε έιπκεοζδ ηαζ ακελάκηθδηδ ενεοκδηζηή δζάεεζδ, - ζε ηάεε επζζηδιμκζηή, ενβαζζαηή ηαζ πνμζςπζηή ιμο ζηζβιή. Θα ήεεθα επίζδξ κα εοπανζζηήζς εενιά ημκ Δπίημονμ Καεδβδηή Κςκζηακηίκμ Πμοθά ιε ημκ μπμίμ ζοκδευιαζηε ιε ιαηνυπνμκδ ζοκενβαζία, μ μπμίμξ ζοκέααθε ηαεμνζζηζηά ζηδκ πναβιαημπμίδζδ ηδξ πανμφζαξ δζαηνζαήξ. Σμκ Ακαπθδνςηή Καεδβδηή Γνδβυνζμ ζαμθαπέκημ εοπανζζηχ εενιά βζα ηδκ ζοιαμθή ημο ζηδ ζοββναθή ηδξ ενβαζίαξ ηαζ ηδκ μθμηθήνςζδ ηδξ δζαηνζαήξ. Ηδζαίηενεξ εοπανζζηίεξ ζηδκ ζοκάδεθθμ ηαζ θίθδ Βμφθα Εδζζιμπμφθμο βζα ηδκ οπένμπδ ζοκενβαζία, ηδκ επζζηδιμκζηή ζοιαμθή ηαεχξ ηαζ ηδκ δεζηή ηδξ οπμζηήνζλδ, ηαε υθδ ηδκ δζάνηεζα ηδξ δζαηνζαήξ αοηήξ. Ξεπςνζζηέξ εοπανζζηίεξ ζηδκ ζδακζηή ζοκάδεθθμ ηαζ θίθδ Άκκα Κυηθα βζα ηδκ ιμκαδζηή ηαζ άρμβδ ζοκενβαζία υθα ηα πνυκζα πμο δμοθέραιε ιαγί ζημ Ηκζηζημφημ Παζηέν ηαεχξ ηαζ υθα ηα οπυθμζπα παζδζά ημο ενβαζηδνίμο δζαπνμκζηά. Άπεζνα εοπανζζηχ ζηδκ ζφγοβμ ιμο Βμφθα βζα ηδκ ακμπή, ηδκ ακημπή, ηδκ οπμζηήνζλδ ηαζ ηδκ εκεάννοκζδ ηδξ υθα αοηά ηα πνυκζα. Σέθμξ, αθζενχκς ηδκ δζαηνζαή ιμο αοηή ζηδκ ικήιδ ημο παηένα ιμο, ζηδκ ιδηένα ιμο ηαζ ηδκ μζημβέκεζα ιμο, δ μπμία ιε ζηήνζλε ηαζ οπήνλε βκχιμκαξ ζηδκ γςή ιμο έςξ ηχνα ηαζ ζδζαίηενα ζηα παζδζά ιμο Βαζίθδ ηαζ Θμδςνή, ιε ηδκ πνμηνμπή κα αβαπμφκ αοηυ πμο ηάκμοκ, κα έπμοκ ζδακζηά ηαζ αλζμπνέπεζα ηαζ κα βίκμοκ ηαθφηενμζ απυ ειάξ.

5 ΠΙΝΑΚΑ ΠΕΡΙΕΦΟΜΕΝΨΝ ΠΡΟΛΟΓΟ 4 ΠΗΝΑΚΑ ΠΔΡΗΔΥΟΜΔΝΧΝ 5 ΠΗΝΑΚΑ ΤΝΣΟΜΟΓΡΑΦΗΧΝ ΘΔΧΡΖΣΗΚΟ ΜΔΡΟ 14 ΔΗΑΓΧΓΖ 1.2 Απηνάλνζεο Αζζέλεηεο ηεο Νεπξνκπτθήο ύλαςεο Βανζά ιοαζεέκεζα (Μyasthenia Gravis, MG) Ηζημνζηή ακαδνμιή Ονμανκδηζηή αανζά ιοαζεέκεζα (Seronegative Myasthenia Gravis, 19 SNMG) Μοαζεεκζηά ζφκδνμια κεονμιοσηήξ ζφκαρδξ Μπαζζεληθό ζύλδξνκν (ύλδξνκν Lambert-Eaton, LEMS) Επίθηεηε Nεπξνκπνηνλία (ύλδξνκν Isaac ) ύλδξνκν Guillain-Barre (GBS) Δπηδεκηνινγηθέο Μειέηεο ηεο MG Γελεηηθή ηεο MG Απυδεζλδ ηδξ ηθδνμκμιζηυηδηαξ Τπμρήθζα βμκίδζα Κιηληθά Υαξαθηεξηζηηθά ηεο Νόζνπ Δηεξνγέλεηα ηεο Μπαζζέλεηαο Αλαηνκία θαη Φπζηνινγία ηεο Νεπξνκπτθήο ύλαςεο (NMJ) Ο οπμδμπέαξ αηεηοθμπμθίκδξ (AChR) πδιαηζζιυξ ηδξ κεονμιοσηήξ ζφκαρδξ ηαζ δ εζδζηή βζα ημκ ιο 35 ηζκάζδ (MuSK) Δνκή ηεο MuSK Φπζηνινγία ηεο Νεπξνκπτθήο ύλαςεο - Παζνθπζηoινγία ηεο MG Παζνγέλεηα ηεο MG Αοημακμζία - Ακμζμηνμπμπμζδηζημί ιδπακζζιμί Ο νυθμξ ημο εφιμο ζηδκ παεμβέκεζα ηδξ ιοαζεέκεζαξ Κιηληθέο Δθδειώζεηο ηεο MG Θεξαπεπηηθέο Πξνζεγγίζεηο 51 5

6 ΠΙΝΑΚΑ ΠΕΡΙΕΦΟΜΕΝΨΝ Ακηζπμθζκεζηεναζζηά (πμθζκενβζηά) θάνιαηα Θοιεηημιή Κμνηζημζηενμεζδή Μδ-ζηενμεζδή ακμζμηαηαζηαθηζηά Πθαζιαθαίνεζδ Δκδμθθέαζεξ ακμζμζθαζνίκεξ (ΗVIG) Δζδζηέξ ακμζμηνμπμπμζδηζηέξ εεναπείεξ ζε ηθζκζηυ ζηάδζμ Πεζναιαηζηέξ εεναπεοηζηέξ πνμζεββίζεζξ Γηάγλσζε ηεο MG οιπηχιαηα Φανιαημθμβζηέξ- δμηζιαζίεξ Ζθεηηνμθοζζμθμβζηέξ-δμηζιαζίεξ Νεονμαηηζκμθμβζηυξ έθεβπμξ Ακμζμθμβζηέξ δμηζιαζίεξ - Ονμθμβζηή δζάβκςζδ Πνμζδζμνζζιυξ ηςκ δεζιεοηζηχκ (binding) ακηζζςιάηςκ 69 έκακηζ ημο AChR Πνμζδζμνζζιυξ ηςκ ακαζηαθηζηχκ (blocking) ακηζζςιάηςκ 71 έκακηζ ημο AChR Ακηζβμκζηή ηνμπμπμίδζδ (antigenic modulation): Βαζζζιέκδ 72 ζε ηοηηανμηαθθζένβεζεξ ναδζμακμζμθμβζηή δμηζιαζία Ακηζζχιαηα εκακηίμκ ηδξ πνςηεΐκδξ MuSK Ακηί-Tζηίκδ ακηζζχιαηα Νέεξ ακαδουιεκεξ ακμζμθμβζηέξ δμηζιαζίεξ βζα ηδ αεθηίςζδ 74 ηδξ δζάβκςζδξ Δνθηκαζία αλνζνθαηαθξίκλεζεο θζνξηζκνύ (FIPA) Δνθηκαζία κε ηε ρξήζε κε-κπτθήο θπηηαξηθήο ζεηξάο 75 (Cell Based Assay-CBA) Έκκεζνο αλνζνθζνξηζκόο (IFA) ηόρνη ηεο Παξνύζαο Γηαηξηβήο 77 6

7 ΠΙΝΑΚΑ ΠΕΡΙΕΦΟΜΕΝΨΝ 2. ΤΛΗΚΑ-ΜΔΘΟΓΟΗ Τιηθά Δνβαζηδνζαηυξ ελμπθζζιυξ Ακαθχζζια Ακηζδναζηήνζα 82 Πξν-ζπζθεπαζκέλα αληηδξαζηήξηα 83 Ραδηελεξγά αληηδξαζηήξηα Ακηζζχιαηα 83 Μνλνθισληθά αληηζώκαηα 83 πδεπγκέλα κε ην έλδπκν ππεξνδεηδάζε ηεο ξαπαλίδνο αληηζώκαηα Γζαθφιαηα Θνεπηζηά οθζηά Ροειζζηζηά δζαθφιαηα Άθθα δζαθφιαηα Μέζνδνη Ραδζμακμζμθμβζηυξ πνμζδζμνζζιυξ (RIPA) ηςκ ακηί-achr ακηζζςιάηςκ Ραδζμακμζμθμβζηή δμηζιαζία δφμ-ζηαδίςκ βζα ηδκ ακίπκεοζδ 89 ηαζ ημκ πνμζδζμνζζιυ ακηί-achr ακηζζςιάηςκ RIPA δφμ-ζηαδίςκ ιε ηδκ πνήζδ ηοηηάνςκ πμο θένμοκ AChRs RIPA δφμ-ζηαδίςκ ααζζζιέκδ ζε αηζκδημπμζδιέκμ AChR ζε ζηενευ 91 οπυζηνςια Παναβςβή ακαζοκδοαζιέκςκ ηιδιάηςκ ηδξ ακενχπζκδξ ιοσηήξ ηζκάζδξ 92 (MuSK) Αιπζηδσηή αληίδξαζε ηεο πνιπκεξάζεο (PCR) 92 γηα ηελ ελίζρπζε αιιεινπρηώλ DNA Παξαζθεπή πιαζκηδηαθνύ DNA ζε κεγάιε θιίκαθα (maxi-preps) Παξαζθεπή πιαζκηδηαθνύ DNA ζε κηθξή θιίκαθα 95 κε ηε κέζνδν ηεο αιθαιηθήο ιύζεο (mini preps) 7

8 ΠΙΝΑΚΑ ΠΕΡΙΕΦΟΜΕΝΨΝ Πνηνηηθή αλάιπζε δείγκαηνο DNA Καζαξηζκόο πιαζκηδηαθνύ DNA Καηαθξήκληζε ηνπ DNΑ Πνζνηηθή αλάιπζε δηαιύκαηνο DNA Πέςε DNA κε πεξηνξηζηηθέο ελδνλνπθιεάζεο Απνθσζθνξπιίσζε γξακκηθνύ πιαζκηδηαθνύ DNA Αληίδξαζε ζύλδεζεο κε ηε ρξήζε Σ4 DNA ιηγάζεο Τγξέο θαη ζηεξεέο θαιιηέξγεηεο βαθηεξηαθώλ θπηηάξσλ Μεηαζρεκαηηζκόο βαθηεξίσλ Έθθξαζε ηεο αλαζπλδπαζκέλεο πξσηεΐλεο ζε βαθηήξηα ζε Ε. Coli Καζαξηζκόο πξσηετλώλ κε ρξσκαηνγξαθία ζπγγέλεηαο από ζηήιε Ni 2+ -NTA αγαξόδεο Ηιεθηξνθόξεζε πξσηετλώλ ζε πήθησκα Πνιπαθξπιακηδίνπ-Γιπθίλεο παξνπζία SDS (SDS-PAGE) Αλνζναπνηύπσζε πξσηετλώλ (Western blotting θαη Dot blotting) Πνζνηηθή αλάιπζε πξσηετλώλ Έθθξαζε ησλ αλαζπλδπαζκέλσλ ηκεκάησλ ηεο MuSK-ECD ζηελ δύκε P. Pastoris Τγξέο θαη ζηεξεέο θαιιηέξγεηεο θπηηάξσλ ηνπ δπκνκύθεηα P. Pastoris Μεηαζρεκαηηζκόο θπηηάξσλ ηνπ δπκνκύθεηα P. pastoris γηα ηνλ νκόινγν αλαζπλδπαζκό ηνπ πιαζκηδηαθνύ DNA ζην ρξσκόζσκα ηνπ P. Pastoris Έθθξαζε ησλ αλαζπλδπαζκέλσλ εθθξηλόκελσλ πξσηετλώλ από θύηηαξα δπκνκύθεηα πνπ πεξηέρνπλ κεηαζρεκαηηζκέλα πιαζκίδηα ηεο ζεηξάο ppiczα πκπύθλσζε θαη δηαπίδπζε ησλ αλαζπλδπαζκέλσλ πξσηετλώλ πνπ εθθξίλνληαη ζην ππεξθείκελν θαιιηέξγεηαο ηνπ δπκνκύθεηα P. pastoris κε ππέξ-δηήζεζε ηνπ ππεξθεηκέλνπ ηεο θαιιηέξγεηαο Καζαξηζκόο αλαζπλδπαζκέλσλ πξσηετλώλ Aπνγιπθνδπιίσζε αλαζπλδπαζκέλσλ ΜuSK πξσηετλώλ 118 8

9 ΠΙΝΑΚΑ ΠΕΡΙΕΦΟΜΕΝΨΝ ήκαλζε ΜuSK κε 125 Ι κε ηε κέζνδν ηεο ρισξίλεο-σ Παξαζθεπή ζηειώλ ζεθαξόδεο κε αλαζπλδπαζκέλε ΜuSK θαη αλνζνπξνζξόθεζε αληί-musk αληηζσκάησλ από νξνύο κπαζζελώλ Πεηξάκαηα αληαγσληζκνύ κεηαμύ ηνπ MuSK θαη ηνπ εκπνξηθνύ ΜuSK Ραδηναλνζνινγηθόο πξνζδηνξηζκόο αληί-musk αληηζσκάησλ RIPA δύν-ζηαδίσλ γηα ηνλ πξνζδηνξηζκό αληί-musk αληηζσκάησλ ύζηεκα ηαπηόρξνλεο επεμεξγαζίαο πνιιαπιώλ δεηγκάησλ ΑΠΟΣΔΛΔΜΑΣΑ Αλάπηπμε Τςειήο Δπαηζζεζίαο Δηδηθώλ Γηαγλσζηηθώλ Γνθηκαζηώλ γηα ηνλ Πξνζδηνξηζκό Απηναληηζσκάησλ Έλαληη ηνπ (AChR) RIPA δφμ-ζηαδίςκ ιε αάζδ ηδκ πνυζδεζδ ακηζζςιάηςκ ζε αηζκδημπμζδιέκμοξ οπμδμπείξ ηαζ ακάηηδζδ ημο ζοιπθυημο ακηζβυκμο- ακηζζχιαημξ Καηαζθεπή πξόηππεο θακπύιεο ηηηινδόηεζεο Έιεγρνο δηαθόξσλ νκάδσλ αλζξώπηλσλ νξώλ σο πξνο ηελ 128 ηθαλόηεηα πξόζδεζεο ηνπο ζηνλ AChR ζηελ επηθάλεηα αθέξαησλ θπηηάξσλ ύγθξηζε ζπζηεκάησλ ξαδηναλνζνινγηθήο δηάγλσζεο σο πξνο ηελ επαηζζεζία ηνπο Υξήζε ηδηαίηεξα κεγάισλ πνζνηήησλ νξνύ (>1ml) 131 α. Απεπζείαο ρξήζε ησλ νξώλ 132 β. Εκπινπηηζκόο νξνύ ζε αληηζώκαηα Ραδηναλνζνινγηθόο πξνζδηνξηζκόο δύν-ζηαδίσλ κε ρξήζε απνκνλσκέλσλ θπηηαξηθώλ κεκβξαλώλ αληί αθέξαησλ θπηηάξσλ RIPA δφμ-ζηαδίςκ ιε αάζδ ηδκ πνυζδεζδ ακηζζςιάηςκ ζε αηζκδημπμζδιέκμοξ οπμδμπείξ ηαζ απμιυκςζδ- ακηζζςιάηςκ Απνκόλσζε-αλίρλεπζε ησλ απηναληηζσκάησλ κεηά από ηελ δέζκεπζε ηνπο ζηνπο επηθαλεηαθνύο ππνδνρείο αθέξαησλ θπηηάξσλ θαη αλίρλεπζή ηνπο 137 9

10 ΠΙΝΑΚΑ ΠΕΡΙΕΦΟΜΕΝΨΝ Απνκόλσζε απηναληηζσκάησλ κεηά από δέζκεπζε ηνπο ζε νκνηνπνιηθά αθηλεηνπνηεκέλνπο AChR ζε ζηεξεό ππόζηξσκα θαη αλίρλεπζή ηνπο 139 α) Πξνζζήθε ECDs 141 β) Πξόζδεζε AChR κέζσ κνλνθισληθώλ φβηνζζδ δζαθυνςκ ζοζηδιάηςκ ηδξ RIPA δφμ-ζηαδίςκ βζα ηδκ ακίπκεοζδ ακηί-achr ακηζζςιάηςκ Αλάπηπμε Τςειήο Δπαηζζεζίαο Δηδηθώλ Γηαγλσζηηθώλ Γνθηκαζηώλ γηα ηνλ Πξνζδηνξηζκό Απηναληηζσκάησλ Έλαληη ηεο MuSK Έηθναζδ ηδξ ακενχπζκδξ MuSK ζε E. coli Έθεβπμξ ηδξ δοκαηυηδηαξ ηδξ εηθναζιέκδξ ζε E. coli MuSK κα δεζιεφζεζ ακηί-musk ακηζζχιαηα Έηθναζδ ηδξ ακενχπζκδξ MuSK ζηδκ P. Pastoris Ραδζμζήιακζδ ηδξ εηθναζιέκδξ ζηδκ P. pastoris MuSK ηαζ πνήζδ ηδξ ςξ ακηζβυκμ ζηδκ RIPA Έθεβπμξ ηδξ δοκαηυηδηαξ ηδξ εηθναζιέκδξ ζε γφιδ MuSK κα δεζιεφζεζ ακηί-musk ακηζζχιαηα Δπίδναζδ απμιμκςιέκςκ ακηί-musk ακηζζςιάηςκ ζε γχα - πνμηαηανηζηυ πείναια Δοαζζεδζία ημο πνμζδζμνζζιμφ δφμ-ζηαδίςκ Ζ εζδζηυηδηα ηδξ RIPA δφμ-ζηαδίςκ Υνήζδ ηδξ ακάθοζδξ ηςκ δφμ-ζηαδίςκ βζα ημκ εκημπζζιυ κέςκ πενζπηχζεςκ μνμεεηζηχκ MuSK MG αζεεκχκ ΤΕΖΣΖΖ Αλάπηπμε Τςειήο Δπαηζζεζίαο Δηδηθώλ Γηαγλσζηηθώλ Γνθηκαζηώλ γηα ηνλ Πξνζδηνξηζκό Απηναληηζσκάησλ Έλαληη ηνπ AChR RIPA δφμ-ζηαδίςκ ιε αάζδ ηδκ πνυζδεζδ ακηζζςιάηςκ ζε αηζκδημπμζδιέκμοξ οπμδμπείξ ηαζ ακάηηδζδ ημο ζοιπθυημο ακηζβυκμο-ακηζζχιαημξ

11 ΠΙΝΑΚΑ ΠΕΡΙΕΦΟΜΕΝΨΝ RIPA δφμ-ζηαδίςκ ιε αάζδ ηδκ απμιυκςζδ ηςκ ακηζζςιάηςκ ιε πνςιαημβναθία ζοββέκεζαξ Αλάπηπμε Τςειήο Δπαηζζεζίαο Δηδηθώλ Γηαγλσζηηθώλ Γνθηκαζηώλ πξνο Αλίρλεπζε Αληηζσκάησλ Έλαληη ηεο MuSK ΠΔΡΗΛΖΦΖ ABSTRACT ΒΗΒΛΗΟΓΡΑΦΗΑ ΓΖΜΟΗΔΤΔΗ ΠΑΣΔΝΣΔ ΠΑΡΟΤΗΑΔΗ ΚΤΡΗΑ ΓΖΜΟΗΔΤΖ

12 ΠΙΝΑΚΑ ΤΝΣΟΜΟΓΡΑΥΙΨΝ ΠΗΝΑΚΑ ΤΝΣΟΜΟΓΡΑΦΗΧΝ αβσυ: a-bungarotoxin: α-ιπμοκβηανμημλίκδ ACh: acetylcholine: αηεηοθμπμθίκδ AChR: acetylcholine receptor: κζημηζκζηυξ οπμδμπέαξ ηδξ αηεηοθμπμθίκδξ ECD: extracellular domain: ελςηοηηανζηυ ηιήια ηδξ ιειανακζηχκ πνςηεΐκςκ BSA: Bovine Serum Albumin: Βυεζμξ μνμ-αθαμοιίκδ cdna: complementary DΝΑ: ζοιπθδνςιαηζηυ δεμλονζαμκμοηθεσηυ μλφ cpm: counts per minute: ηνμφζεζξ ακά πνχημ θεπηυ Clq: Complement protein Clq : ζοζηαηζηυ ημο ζοιπθδνχιαημξ Clq CNBr:cyanogen bromide: ηοακμανμιίδζμ CNS: Central Nervous System DEAE: DiethylAminoEthyl: δζαζεοθαιζκμαζεοθμ μιάδα EAMG: Experimental Autoimmune Myasthenia Gravis: Πεζναιαηζηή Αοημάκμζδ Βανζά Μοαζεέκεζα ECD: extracellular domain: ελςηοηηανζηυ ηιήια ELISA: Enzyme-Linked Immunosorbent Assay: εκγοιζηυξ ακμζμπνμζνμθδηζηυξ πνμζδζμνζζιυξ Fab: Fragment Antigen Binding: ηιήια ακηζζχιαημξ πμο ζοκδέεηαζ ιε ημ ακηζβυκμ FBS: Foetal Bovine Serum: μνυξ απυ έιανομ αμυξ Fc: Fragment: ζηαεενή πενζμπή ακηζζχιαημξ FITC: fluorescein isothiocynate: ζζμεεζμηοακζηή θεμνζζεΐκδ Fv: Fragment Variable: ιεηααθδηυ ηιήια ακηζζχιαημξ HLA: Human Lymphocyte Antigens: ακενχπζκα θεοημηοηηανζηά ακηζβυκα HRP: horseradish peroxidase: οπενμλεζδάζδ ηδξ ναπακίδμξ His: histidine: Ηζηζδίκδ 125 I-αBTX: 125 I-labeled αβσυ : α-ιπμοβηανμημλίκδ ζδιαζιέκδ ιε 125 Η Ig: immunoglobulin: ακμζμζθαζνίκδ IL-2: Ηκηενθεοηίκδ 2

13 ΠΙΝΑΚΑ ΤΝΣΟΜΟΓΡΑΥΙΨΝ IPTG: Isopropyl-l-thio-α-D-galactosidase: Ηζμπνμποθ-α-εεζμ-δ-βαθαηημζίδζμ mab: monoclonal antibody: ιμκμηθςκηυ ακηίζςια MG: Myasthenia Gravis: αανζά ιοαζεέκεζα MHC: Major Histocompatibility Complex: Μείγμκ ζφιπθεβια ζζημζοιααηυηδηαξ MIR: Main Immunogenic Region: Κφνζα Ακμζμβυκμξ Πενζμπή mrna: messenger RNA: αββεθζμθυνμ νζαμκμοηθεΐηυ μλφ MuSK: Muscle Specific Kinase: εζδζηή Μοσηή Κζκάζδ MuSK-ECD: MuSK NMJ: Neuromuscular Junction: Νεονμιοσηή φκαρδ Νi-NTA: ζθαζνίδζα Nζηεθίμο αβανυγδξ O.D: Optical Density: μπηζηή ποηκυηδηα PBS: Phosphate Buffer Saline: νοειζζηζηυ δζάθοια θςζθμνζηχκ PCR: polymerase chain reaction: αθοζζδςηή ακηίδναζδ πμθοιενάζδξ PEG: polyethylene glycol: πμθοαζεοθεκζηή βθοηυθδ rpm: ζ.α.θ.: ζηνμθέξ ακά θεπηυ Protein A or G: πνςηεΐκδ Α ή G SNMG: seronegative myasthenia gravis: μνμανκδηζηή αανζά ιοαζεέκεζα 13

14 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ 1. ΘΔΧΡΖΣΗΚΟ ΜΔΡΟ 1.1 ΔΗΑΓΧΓΉ Ζ αανζά ιοαζεέκεζα (Myasthenia Gravis, MG) είκαζ έκα εηενμβεκέξ, επίηηδημ, αοημάκμζμ κυζδια ημ μπμίμ παναηηδνίγεηαζ απυ δζαηαναπή ζηδ κεονμδζααίααζδ ζημ επίπεδμ ηδξ κεονμιοσηήξ ζφκαρδξ (ΝΜJ). Κονίςξ πνμηαθείηαζ απυ αοημακηζζχιαηα έκακηζ ημο ιοσημφ οπμδμπέα ηδξ αηεηοθμπμθίκδξ (Acetylcholine Receptor, AChR) ζημ 80-90% πενίπμο ηςκ ιοαζεεκχκ ιε βεκζηεοιέκδ ιοαζεέκεζα ηαζ ζημ 50% ιε μθεαθιζηή ηαζ δεοηενεουκηςξ έκακηζ άθθςκ δμιζηχκ ζημζπείςκ ηδξ κεονμιοσηήξ ζφκαρδξ, υπςξ ηδξ εζδζηήξ ιοσηήξ ηζκάζδξ (MuSK) ζημ οπυθμζπμ 5% πενίπμο, ηαεχξ ηαζ άθθςκ ζημζπείςκ ζε ιζηνυηενμ πμζμζηυ. Ζ δέζιεοζδ ηςκ αοημακηζζςιάηςκ πνμηαθεί δοζθεζημονβία ηδξ ηεθζηήξ ηζκδηζηήξ πθάηαξ. Ζ αηνζαήξ αζηία ηδξ αοημάκμζδξ αοηήξ ακςιαθίαξ δεκ είκαζ βκςζηή αθθά είκαζ ζπεδυκ αέααζμ υηζ ζπεηίγεηαζ ιε ακςιαθίεξ ημο εφιμο αδέκα (Roxanis et al., 2001) ηαζ υηζ οπάνπεζ πζεακή βεκεηζηή πνμδζάεεζδ βζα ηδκ ειθάκζζδ ηδξ ιοαζεέκεζαξ (Giraud et al., 2008). Σα ααζζηά παναηηδνζζηζηά ηδξ αζεέκεζαξ είκαζ δ αδοκαιία ηαζ ηυπςζδ ηςκ ζηεθεηζηχκ ιοχκ. Ζ ιοσηή αδοκαιία αολάκεηαζ ιε ηδκ ηυπςζδ ηαζ ηεθζηά ηαηαθήβεζ ζε ηαηάζηαζδ ρεοδυ-πανάθοζδξ. Μεηά απυ ιοσηή παθάνςζδ δ ηζκδηζηυηδηα απμηαείζηαηαζ. Οζ ιφεξ πμο πθήηημκηαζ πενζζζυηενμ είκαζ αοημί πμο απαζημφκηαζ βζα ηδκ ζηάζδ ημο ζχιαημξ, ζοιπενζθαιαακμιέκςκ ηςκ ιοχκ ημο πνμζχπμο ηαζ ηςκ ιοχκ ημο αοπέκα, ηαεχξ ηαζ μθεαθιζηχκ ιοχκ ηαζ ηςκ ιοχκ πμο πνεζάγμκηαζ βζα ηδκ μιζθία ηαζ ηδκ ηαηάπμζδ. Σα ηθζκζηά ζοιπηχιαηα ιπμνεί κα πενζμνίγμκηαζ ζε ιία μιάδα ιοχκ, ζδζαίηενα ζημοξ ιοξ ηςκ ιαηζχκ (μθεαθιζηή ιοαζεέκεζα) ή κα βεκζηεφμκηαζ (βεκζηεοιέκδ ιοαζεέκεζα). Ζ MG ιπμνεί κα πνμηφρεζ απυ ηδκ πνχζιδ παζδζηή δθζηία ιέπνζ ηα βδναηεζά ηαζ δ ζοπκυηδηα ειθάκζζδξ ηδξ είκαζ πενίπμο 20 ακά (Phillips, 2003). Ζ ιοαζεέκεζα πθδνμί ηα αοζηδνά ηνζηήνζα χζηε κα ιπμνεί κα παναηηδνζζεεί ςξ αοημάκμζδ δζαηαναπή: (α) πανμοζία αοημακηζζςιάηςκ ζημκ πχνμ ηδξ κεονμιοσηήξ ζφκαρδξ, (α) ακμζμζθανίκεξ απυ MG αζεεκείξ ή ακηί-οπμδμπέα ακηζζχιαηα ηα μπμία πανάβμκηαζ ζε πεζναιαηυγςα πνμηαθμφκ ζοιπηχιαηα ιοαζεέκεζαξ υηακ εβπέμκηαζ ζε

15 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ηνςηηζηά, (β) δ ακμζμπμίδζδ ηςκ γχςκ ιε AChR ακαπανάβεζ ηδκ αζεέκεζα (πεζναιαηζηή ιοαζεέκεζα) ηαζ (δ) εεναπείεξ πμο αθαζνμφκ ακηζζχιαηα πνμηαθμφκ ιείςζδ ηδξ ζμαανυηδηαξ ηςκ ζοιπηςιάηςκ MG (Drachman, 1994). Ζ δζάβκςζδ ααζίγεηαζ ζηα ζοιπηχιαηα ηαζ ζημ εφνδια ηδξ ακαδουιεκδξ ιε ηδκ ηυπςζδ ιοσηήξ αδοκαιίαξ ηαηά ηδκ ακηζηεζιεκζηή ελέηαζδ ηαζ ιπμνεί κα οπμζηδνζπεεί απυ μνμθμβζηέξ δζαβκςζηζηέξ ελεηάζεζξ, υπςξ δ ακίπκεοζδ ακηζζςιάηςκ έκακηζ ηςκ οπμδμπέςκ αηεηοθμπμθίκδξ ή έκακηζ ηςκ εζδζηχκ ςξ πνμξ ημοξ ιφεξ οπμδμπέςκ ηδξ ηζκάζδξ ηδξ ηονμζίκδξ (MuSK), ηαζ παεμθοζζμθμβζηέξ ελεηάζεζξ υπςξ δ εεηζηή δμηζιαζία Δδνμθςκίμο, δ ιείςζδ ημο φρμοξ ημο δοκαιζημφ εκένβεζαξ ζημ αναδφ επακαθδπηζηυ ενεεζζιυ ηςκ κεφνςκ ηαζ δ παεμθμβζηή αζηάεεζα ηαηά ηδκ δθεηηνμιομβναθία ιμκήνμοξ ιοσηήξ ίκαξ (Meriggioli and Sanders, 2009). Πανά ημ βεβμκυξ υηζ δ ηαηακυδζδ ηςκ ιδπακζζιχκ ηδξ ιοαζεέκεζαξ έπεζ αολδεεί δναιαηζηά ηζξ ηεθεοηαίεξ 4 δεηαεηίεξ, δ δζάβκςζδ είκαζ αηνζαέζηενδ, μζ εεναπεοηζηέξ πνμζεββίζεζξ είκαζ πενζζζυηενμ επζηοπείξ ηαζ δ εκδζζιυηδηα είκαζ πθέμκ ζπεδυκ ιδδεκζηή, ςζηυζμ οπάνπμοκ αηυια ζδιακηζηά ηεκά ςξ πνμξ ηδκ πθήνδ βκχζδ βζα ηα παεμβεκεηζηά αίηζα, ηδκ ελέθζλδ, ηδκ δζάβκςζδ ηαζ ηδκ ίαζδ ηδξ κυζμο. 1.2 Απηνάλνζεο Αζζέλεηεο ηεο Νεπξνκπτθήο ύλαςεο Βαξηά Μπαζζέλεηα (Μyasthenia Gravis, MG) - Ηζηνξηθή αλαδξνκή Ζ παθαζυηενδ ακαθμνά ηδξ κυζμο ηαζ πζεακυκ δ πνχηδ πενζβναθή κα έβζκε απυ ημκ Marsteller ημ 1664, υπμο πενζβνάθεηαζ ζε ηείιεκμ αθθδθμβναθίαξ ζηαθιέκμ απυ ηδκ πυθδ Jamestown ηδξ Βζνηγίκζα, δ πενίπηςζδ εκυξ αζεεκμφξ ιε ηθζκζηή ζοιπηςιαημθμβία ηδξ παεήζεςξ δ μπμία πθδνμφζε ηδκ εζηυκα ηδξ ιοαζεέκεζαξ. Ζ MG πενζβνάθδηε βζα πνχηδ θμνά ημ 1672 απυ ημκ Άββθμ ακαηυιμ ζαηνυ Thomas Willis, μ μπμίμξ παναηήνδζε ζηδκ πενίπηςζδ ιζαξ αζεεκμφξ ιζα ηαηάζηαζδ αδοκαιίαξ ζημοξ ζηεθεηζημφξ ιφεξ ηςκ άηνςκ, ιε αολμιεζχζεζξ ζηδκ έκηαζδ ηςκ ζοιπηςιάηςκ ηαζ ζηαδζαηή αδοκαιία ζημοξ ιφεξ ηδξ βθχζζαξ, ιε ζοκέπεζεξ ζηδκ μιζθία. Πενζέβναρε ιζα βοκαίηα δ μπμία ιζθμφζε εφημθα ηαζ ααίαζηα βζα θίβμ, αθθά ιεηά απυ ιεβάθμ δζάζηδια μιζθίαξ, δεκ ιπμνμφζε κα ανενχζεζ θέλδ βζα 1-2 χνεξ (Pascuzzi, 1994). 15

16 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Αημθμφεςξ, ζηα ηέθδ ημο 1800, οπήνλακ μζ πνχηεξ δδιμζζεφζεζξ πμο πενζέβναθακ αζεεκείξ ιε αδοκαιία ζημοξ ιφεξ ηςκ αμθαχκ ηαζ ηςκ άηνςκ ιε εκδζζιυηδηα απυ ακαπκεοζηζηή ακεπάνηεζα ηαζ δυεδηε ημ υκμια ζηδ κυζμ αοηή Myasthenia Gravis (MG), ιε ζοβπχκεοζδ ηςκ Δθθδκζηχκ υνςκ βζα ηδκ αδοκαιία ημο ιουξ ηαζ ( Jolly, 1895) ηαζ ιε ηδκ πνμζεήηδ ημο Λαηζκζημφ επζεέημο Gravis ημ μπμίμ ζδιαίκεζ αανζά (Keesey, 2002). Ζ ακαηάθορδ ηδξ αηεηοθμπμθίκδξ ςξ κεονμδζααζααζηή ζηδκ ηεθζηή ηζκδηζηή πθάηα άκμζλε ημ δνυιμ βζα ηδκ ηαηακυδζδ ηδξ παεμβέκεζδξ, ηδξ δζάβκςζδξ ηαζ ηδξ εεναπείαξ ηδξ ιοαζεέκεζαξ. To 1935 πμνδβήεδηε βζα πνχηδ θμνά μ ακαζημθέαξ ηδξ αηεηοθμπμθζκεζηενάζδξ (θοζμζηζβιίκδ) (Walker, 1935). Γζα πνχηδ θμνά ημ 1960 απυ ημκ Simpson πνμηάεδηε δ εεςνία υηζ δ ιοαζεέκεζα ακήηεζ ζηδκ ηαηδβμνία ηςκ αοημάκμζςκ κμζδιάηςκ, ιε αάζδ ηδ ζπέζδ ηδξ ιε άθθεξ αοημάκμζεξ κυζμοξ (Simpson, 1963). ηδ ζοκέπεζα, παναηδνήεδηε υηζ ηα ημνηζημζηενμεζδή ηαζ ηα ακμζμηαηαζηαθηζηά θάνιαηα είπακ εεηζηή επίδναζδ ζηα ζοιπηχιαηα ηδξ κυζμο ηαζ υηζ οπάνπεζ αεθηίςζδ ηδξ ηαηάζηαζδξ ημο αζεεκμφξ ιε ηδκ ακηαθθαβή πθάζιαημξ (πθαζιαθαίνεζδ) (Mertens et al., 1969). Έπεζηα, δζαπζζηχεδηακ μζ ακςιαθίεξ πμο παναηδνμφκηακ ζημ εφιμ αδέκα ηςκ ιοαζεεκχκ, ηαεχξ ηαζ μζ αολμιεζχζεζξ ζηδκ πμνεία ηδξ αζεέκεζαξ ηαζ ηα εοενβεηζηά απμηεθέζιαηα ηδξ εοιεηημιήξ ζε αζεεκείξ ιε ιοαζεέκεζα (Thanvi and Lo, 2004). Ονυζδιμ ζηδκ ένεοκα βζα ηδ ιοαζεέκεζα απμηέθεζε δ ακαηάθορδ αοημακηζζςιάηςκ πμο ηαηεοεφκμκηαζ ζημ ιοσηυ οπμδμπέα ηδξ αηεηοθμπμθίκδξ, ζηδκ πθεζμρδθία ηςκ ιοαζεεκχκ (Lindstrom et al., 1976b). Σδκ πνμκζηή αοηή πενίμδμ έβζκακ δφμ ακαηαθφρεζξ μζ μπμίεξ αμήεδζακ ζηδκ ακαβκχνζζδ ηςκ κζημηζκζηχκ οπμδμπέςκ ηδξ αηεηοθμπμθίκδξ. Σμ πνχημ ήηακ δ ηαοημπμίδζδ ηδξ α-ιπμοκβηανμημλίκδξ (α-bungarotoxin), πμο απμιμκχεδηε απυ ηα θίδζα (Bungarus multicinctus) ηαζ δζαπζζηχεδηε υηζ πανειπμδίγεζ ηδκ θεζημονβία ηδξ κεονμιοσηήξ ζφκαρδξ (Drachman et al., 1973) ηαζ ημ δεφηενμ ήηακ δ ακαηάθορδ υηζ ηα δθεηηνζηά υνβακα ημο πεθζμφ Electrophorus Electricus ηαζ ηδξ ιμοδζάζηναξ Torpedo marmorata είκαζ πθμφζζα ζε απμεέιαηα οπμδμπέςκ αηεηοθμπμθίκδξ (Cohen and Changeux, 1975). Σμ 1973 μζ Patrick ηαζ Lindstrom ιεηά απυ έκεζδ ζε ημοκέθζα οπμδμπέςκ αηεηοθμπμθίκδξ, ημοξ μπμίμοξ απμιυκςζακ απυ ηα δθεηηνζηά υνβακα ηςκ πεθζχκ, 16

17 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ηαηάθενακ κα πανάβμοκ ακηζζχιαηα έκακηζ ηςκ οπμδμπέςκ ηδξ αηεηοθμπμθίκδξ ηα μπμία ηεθζηά πανειπυδζζακ ημοξ οπμδμπείξ ηαζ πνμηάθεζακ ζοιπηχιαηα αανζάξ ιοαζεέκεζαξ (Lindstrom et al., 1976a). Ζ ακάπηολδ εκυξ πεζναιαηζημφ ιμκηέθμο ιοαζεέκεζαξ, ημ μπμίμ πνμηαθείηαζ ιε ακμζμπμίδζδ πεζναιαηυγςςκ ιε ημ ιοσηυ οπμδμπέα, ημ βεβμκυξ υηζ δ ιμνζαηή δμιή ημο ιοσημφ οπμδμπέα είκαζ πθέμκ ηαθά παναηηδνζζιέκδ, ηαεχξ επίζδξ ηαζ ημ βεβμκυξ υηζ οπάνπεζ δ δοκαηυηδηα απμιυκςζδξ ιοσημφ ηφπμο οπμδμπέα ζε ιεβάθεξ πμζυηδηεξ απυ θοζζηέξ πδβέξ υπςξ ακενχπζκμ νααδμιομζάνηςια (ΣΔ671) (Voltz et al., 1991), έπμοκ ζοιαάθθεζ ζηδκ ηαηακυδζδ ηςκ ιδπακζζιχκ ηδξ ιοαζεέκεζαξ. Μεηαβεκέζηενα, πενζβνάθηδηακ αοημακηζζχιαηα έκακηζ ιζαξ άθθδξ πνςηεΐκδξ ηδξ MuSK (Μuscle Specific Σyrosine Κinase), δ μπμία παίγεζ ζδιακηζηυ νυθμ ζηδ ζοζζχνεοζδ ηςκ ιοσηχκ οπμδμπέςκ ζηδ ιεηαζοκαπηζηή ιειανάκδ, ηα μπμία ειθακίγμκηαζ ζε έκα πμζμζηυ ηςκ ιοαζεεκχκ πμο δε θένμοκ ακηζζχιαηα ηαηά ημο ιοσημφ οπμδμπέα (Hoch et al., 2001). Σα απμηεθέζιαηα ενεοκχκ δδθχκμοκ ηδκ πανμοζία εκυξ IgG ακηζζχιαημξ πμο δεζιεφεηαζ ζε ιειανακζηυ οπμδμπέα, άθθμκ απυ ημκ AChR. Έκαξ πζεακυξ οπμρήθζμξ ήηακ δ MuSK. Αοηυξ μ οπμδμπέαξ ιε δνάζδ ηζκάζδξ Σονμζίκδξ, έπεζ 4 πανυιμζεξ ιε ακμζμζθαζνίκδ (immunoglobulin-like, Ig-like) πενζμπέξ, ιζα πθμφζζα ζε Cys πενζμπή ελςηοηηανζηά, ιζα δζαιειανακζηή πενζμπή ηαζ ιζα εκδμηοηηάνζα πενζμπή ηζκάζδξ. Ζ MuSK είκαζ εζδζηή βζα ημοξ ιφεξ ηαζ εκημπίγεηαζ ζηδ κεονμιοσηή ζφκαρδ. ηδ δζάνηεζα ηδξ ακάπηολδξ, δ αβνίκδ πμο εθεοεενχκεηαζ απυ ηα ηζκδηζηά κεφνα αθθδθεπζδνά ιε ηδ MuSK, πνμηαθχκηαξ ηδκ αοηυ-θςζθμνοθίςζδ ηδξ ηεθεοηαίαξ. Ζ ακηίδναζδ αοηή μδδβεί ζηδ θςζθμνοθίςζδ ιζαξ άθθδξ ηοηηανμζηεθεηζηήξ πνςηεΐκδξ, ηδξ ναρίκδξ, δ μπμία, ζηδ ζοκέπεζα, ζοκαενμίγεζ ημοξ AChRs ηαζ ημοξ ΔrbB οπμδμπείξ ζηδκ επζθάκεζα ημο ιεηαζοκαπηζημφ ιουξ. ε πμκηίηζα πμο ζηενμφκηαζ θεζημονβζηήξ MuSK ή ναρίκδξ, μζ AChRs δε ζοκαενμίγμκηαζ ζηδ δζάνηεζα ηδξ ακάπηολδξ ηαζ ηα πμκηίηζα δεκ επζαζχκμοκ πενζζζυηενμ απυ ιενζηέξ χνεξ ιεηά ηδ βέκκδζδ. Έηζζ, δ MuSK πνεζάγεηαζ βζα ηδκ ακάπηολδ ηδξ κεονμιοσηήξ ζφκαρδξ, αθθά μ νυθμξ ηδξ ζημκ χνζιμ ιο είκαζ θζβυηενμ ζαθήξ. Σα MuSK ακηζζχιαηα ακζπκεφηδηακ ιε ELISA ζημ 40-70% πενίπμο ηςκ αζεεκχκ ιε μνμανκδηζηή Μοαζεέκεζα (SNMG) (Hoch et al., 2001). Σα ακηζζχιαηα ήηακ πμθφ εζδζηά βζα ηδκ μνμανκδηζηή ιμνθή ηαζ δεκ ακζπκεφηδηακ ζε αζεεκείξ ιε μνμεεηζηή MG. Έκαξ πζεακυξ ιδπακζζιυξ βζα ηδ δνάζδ ηςκ ακηί-musk ακηζζςιάηςκ in vivo, εα ιπμνμφζε κα είκαζ υηζ 17

18 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ δεζιεφμοκ ημ ζοιπθήνςια ηαζ πνμηαθμφκ ιζα δζαιεζμθααμφιεκδ απυ ημ ζοιπθήνςια ηαηαζηνμθή ηδξ ηεθζηήξ ηζκδηζηήξ πθάηαξ, πανυιμζα ιε αοηή ζηδκ μνμεεηζηή MG. Χζηυζμ, ημ εηπθδηηζηυ εφνδια ήηακ υηζ ηα MuSK ακηζζχιαηα θαίκεηαζ κα είκαζ ζπεδυκ απμηθεζζηζηά IgG4 ηαζ δε δεζιεφμοκ ζζπονά ημ ζοιπθήνςια (Tsiamalos et al., 2009). Οζ αζεεκείξ πμο ειθακίγμοκ ακηζζχιαηα ηα μπμία ζηνέθμκηαζ εκακηίμκ ηδξ MuSK ειθακίγμοκ ηαζ παναηηδνζζηζηυ θαζκυηοπμ. Οζ αζεεκείξ ιε MuSK ακηζζχιαηα θαίκεηαζ υηζ απμηνίκμκηαζ θζβυηενμ ζηακμπμζδηζηά ζηδκ παναδμζζαηή ακμζμηαηαζηαθηζηή εεναπεία ιε πνεδκζγμθυκδ ηαζ αγαεεζμπνίκδ (McConville et al., 2004). Πζμ ζοβηεηνζιέκα, ακηί-musk ακηζζχιαηα έπμοκ ακαθενεεί ζε 38-71% ηςκ αζεεκχκ ιε βεκζηεοιέκδ μνμανκδηζηή ιοαζεέκεζα (Hoch et al., 2001; Sanders et al., 2003), αθθά δεκ έπμοκ ακζπκεοεεί ζε μθεαθιζηή ιοαζεέκεζα ή βεκζηεοιέκδ ιοαζεέκεζα ιε εεηζηά ακηζζχιαηα εκακηίμκ ηςκ AChR. Πζμ πνυζθαηεξ ιεθέηεξ δείπκμοκ υηζ ακηί-musk ακηζζχιαηα οπάνπμοκ ζε πμζμζηυ πενίπμο 30-40% ηςκ αζεεκχκ ιε βεκζηεοιέκδ ιοαζεέκεζα μζ μπμίμζ δεκ έπμοκ ακηζζχιαηα εκακηίμκ ηςκ AChR (Evoli et al., 2003; Vincent et al., 2003a). Αζεεκείξ ιε ηέημζα ακηζζχιαηα είκαζ πζμ ζοπκά κεανέξ βοκαίηεξ (<40 εηχκ) ηαζ ηθζκζηά ειθακίγμοκ ζοκήεςξ έηδδθδ αδοκαιία ζε πνμιδηζημφξ ιφεξ εκχ ζοπκά οπάνπεζ ηαζ αδοκαιία ακαπκεοζηζηχκ ιοχκ. Ζ ακηαπυηνζζδ ζε πμνήβδζδ ακαζημθέςκ πμθζκεζηενάζδξ ιπμνεί κα ιδκ είκαζ ζηακμπμζδηζηή, αθθά ζοκήεςξ οπάνπεζ αεθηίςζδ ιε πθαζιαθαίνεζδ ηαεχξ ηαζ ιε επζθεβιέκδ ακμζμηαηαζηαθηζηή εεναπεία. Σέθμξ μζ αζεεκείξ αοημί έπμοκ θοζζμθμβζηή ζζημθμβία εφιμο ηαζ δεκ θαίκεηαζ, ημοθάπζζημκ ιε ηα οπάνπμκηα ζήιενα ζημζπεία, υηζ δ εοιεηημιή ζε αοημφξ αεθηζχκεζ ηδκ έηααζδ (Romi et al., 2004; Vincent et al., 2004). Ζ ακίπκεοζδ ηςκ ακηί-musk ακηζζςιάηςκ εεςνείηαζ πθέμκ ζαθήξ έκδεζλδ φπανλδξ ιοαζεέκεζαξ. πςξ ακαθένεδηε, μζ μνμεεηζημί αζεεκείξ βζα ακηζζχιαηα εκακηίμκ ηςκ AChR δεκ έπμοκ ακηί-musk ακηζζχιαηα ηαζ είκαζ ζπάκζα είκαζ ηα πενζζηαηζηά ηα μπμία έπμοκ ακαθενεεί ιε εεηζηά ακηζζχιαηα ηαοηυπνμκα έκακηζ ημο AChR ηαζ ηδξ MuSK (Meriggioli and Sanders, 2009). Δπμιέκςξ μ ακηί-musk έθεβπμξ ζοκζζηάηαζ κα βίκεηαζ ιυκμ υηακ δεκ ακζπκεφμκηαζ ακηζζχιαηα εκακηίμκ ημο AChR (Meriggioli and Sanders, 2009). Ζ ακαδουιεκδ ιε ηδκ ηυπςζδ ιοσηή αδοκαιία είκαζ ζφιπηςια ηαζ ζδιείμ ηυζμ ζηδ ζμαανή ιοαζεέκεζα (ΜG) υζμ ηαζ ζημ ιοαζεεκζηυ ζφκδνμιμ (Lambert-Eaton). Ακ ηαζ μζ αζεεκείξ ιε ιοαζεεκζηυ ζφκδνμιμ ιπμνεί κα ειθακίγμοκ πανμδζηή αεθηίςζδ ηδξ ιοσηήξ 18

19 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ζζπφμξ ημοξ ιεηά απυ ζφκημιδξ δζάνηεζαξ άζηδζδ, ελαημθμοεμφκ κα ακαθένμοκ ακαδουιεκδ ιε ηδκ ηυπςζδ ιοσηή αδοκαιία. Σα ζοιπηχιαηα απυ ημ αοηυκμιμ κεονζηυ ζφζηδια (λδνμθεαθιία, λδνμζημιία ηαζ μνεμζηαηζηή οπυηαζδ) είκαζ πμθφ ζοπκά (πενίπμο 60%) ηαηά ημ ιοαζεεκζηυ ζφκδνμιμ Lambert-Eaton ηαζ δ πανμοζία ημοξ πανέπεζ πνήζζιεξ εκδείλεζξ βζα ηδ δζάβκςζδ, ζε αζεεκείξ ιε οπμρία δζαηαναπήξ ηδξ κεονμιοσηήξ ζφκαρδξ. Σα ακηζζχιαηα έκακηζ ηςκ βναιιςηχκ ιοχκ δεκ απμηεθμφκ ηφπμ ακηζζςιάηςκ έκακηζ ηςκ οπμδμπέςκ αηεηοθμπμθίκδξ ηαζ δ ακίπκεοζδ ακηζζςιάηςκ ζπεηζγμιέκςκ ιε ηα ακηζβυκα αοηά ηα μπμία είκαζ δ Σζηίκδ ηαζ μ οπμδμπέαξ ηδξ Ροακμδίκδξ, δεκ αθμνά ηδκ πζεακυηδηα πανμοζίαξ ηδξ ίδζαξ ηδξ ιοαζεέκεζαξ, αθθά εβείνεζ ηδκ πζεακυηδηα εκυξ οπμηείιεκμο εοιχιαημξ (ζδίςξ ζε κευηενμοξ αζεεκείξ) (Vincent, 2008a). Δηθόλα 1. Αζζέλεηεο ηεο Νεπξνκπτθήο ύλαςεο Οζ βκςζηέξ έςξ ζήιενα αοημάκμζεξ αζεέκεζεξ ηδξ Νεονμιοσηήξ φκαρδξ, ηα ακηζβυκα ζηυπμζ ηςκ ακηζζςιάηςκ ηαζ μζ δζαεέζζιεξ δζαβκςζηζηέξ δμηζιαζίεξ πνμξ ακίπκεοζδ αοηχκ: RIPA (Ραδζμακμζμηαηαηνήικζζδ), ΔLISA (εκγοιζηή ακμζμπνμζνμθδηζηή δμηζιαζία), FIPA (ακμζμθεμνζγμιεηνζηυξ πνμζδζμνζζιυξ), CBA (ααζζζιέκδ ζηα ηφηηανα δμηζιαζία). Πνμζανιμζιέκμ απυ Autoimmunity, August September 2010; 43(5 6): , Leite et al. 19

20 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Οξναξλεηηθή βαξηά κπαζζέλεηα (Seronegative Myasthenia Gravis, SNMG) ημ οπυθμζπμ 5-10% ηςκ αζεεκχκ ιε βεκζηεοιέκδ ηαζ ζημ 50% πενίπμο ηςκ αζεεκχκ ιε μθεαθιζηή MG δεκ ακζπκεφμκηαζ ακηζζχιαηα. Ζ οπμρία βζα ιοαζεέκεζα πνμζδζμνίγεηαζ απυ ηα ζοιπηχιαηα ηαζ άθθεξ θζβυηενμ ζοβηεηνζιέκεξ δζαβκςζηζηέξ πνμζεββίζεζξ, αθθά θείπεζ δ ηαεμνζζιέκδ απυδεζλδ ηδξ αζεέκεζαξ. Σμ πάζια αοηυ ζηδ δζάβκςζδ MG πνμηαθεί έκα ζδιακηζηυ πνυαθδια ζηζξ πενζζζυηενεξ ελεηαγυιεκεξ πενζπηχζεζξ επεζδή έκα ανκδηζηυ απμηέθεζια (πμο είκαζ ημ ζοπκυηενμ απμηέθεζια ζηδ ζηενευηοπδ πεζναιαηζηή δζάβκςζδ ηδξ MG), αθήκεζ ιζα αζάθεζα ςξ πνμξ ημ εάκ οπάνπεζ MG ή υπζ. Οζ οπυθμζπμζ ιοαζεεκζημί ιπμνεί κα έπμοκ ζηδκ ηοηθμθμνία πάνα πμθφ παιδθά πμζά ακηί-αchr ή ακηί-musk ακηζζςιάηςκ, ηα μπμία δεκ είκαζ δοκαηυκ κα πνμζδζμνζζεμφκ ιε ηζξ έςξ ζήιενα δζαεέζζιεξ δμηζιέξ βζα ηδκ ακίπκεοζδ ακηζζςιάηςκ. Πνάβιαηζ, έκαξ πμθφ παιδθυξ ηίηθμξ ακηί-αchr ή ακηί-musk ακηζζςιάηςκ εα ιπμνμφζε κα είκαζ επανηήξ βζα κα ελδβήζεζ ηδκ πανμοζία ηδξ MG, δεδμιέκμο υηζ δεκ οπάνπεζ ηακέκαξ ζδιακηζηυξ ζοζπεηζζιυξ ιεηαλφ ημο ηίηθμο ακηζζςιάηςκ ηαζ ηδξ δνζιφηδηαξ ηδξ αζεεκείαξ. Δπζπθέμκ, μζ αζεεκείξ ιε παιδθή πενζεηηζηυηδηα ζε ακηί-αchr ή ακηί-musk ακηζζχιαηα ζημ αίια ημοξ, εα ιπμνμφζακ κα έπμοκ ηα πενζζζυηενα απυ ηα ακηζζχιαηά ημοξ δεζιεοιέκα ζημ ιο ζημοξ AChR ή MuSK οπμδμπείξ, βεβμκυξ ημ μπμίμ αθήκεζ ιυκμ εθάπζζηα πμζά εθεφεενςκ ακηζζςιάηςκ ζηδκ ηοηθμθμνία. Χξ εη ημφημο, οπάνπεζ επείβμοζα ακάβηδ βζα ορδθυηενδξ εοαζζεδζίαξ ακαθφζεζξ βζα ηδκ ακίπκεοζδ ιμνίςκ πμο ζπεηίγμκηαζ ιε ηδ κυζμ, δεδμιέκμο υηζ μζ έςξ ζήιενα δζαεέζζιεξ ιέεμδμζ, δεκ είκαζ πάκηα ζηακέξ βζα κα ακζπκεφζμοκ ηδκ πανμοζία ηςκ ιμνίςκ αοηχκ. Δπζπθέμκ, ζε πμθθέξ πενζπηχζεζξ, μζ ηίηθμζ ηςκ ακηζζςιάηςκ είκαζ πμθφ ημκηά ζηζξ ηζιέξ οπυααενμο (background) χζηε κα είκαζ αλζυπζζημζ ηαζ εεςνμφκηαζ αιθίαμθμζ, υκηαξ ηάης απυ ημ υνζμ ημο εεηζημφ ηίηθμο. Ο Lindstrom ηαζ ζοκ. (Lindstrom, 2004) παναηήνδζακ υηζ ηα ακηί-achr ακηζζχιαηα δεκ ήηακ ακζπκεφζζια ζημ 13% ηςκ αζεεκχκ ηαζ πνυηεζκακ υηζ μζ αζεεκείξ αοημί, ίζςξ κα είπακ ακηζζχιαηα εκακηίμκ ηάπμζαξ άθθδξ πνςηεΐκδξ ή υηζ οπάνπεζ ιζα δζαθμνεηζηή ιμνθή ηδξ κυζμο. Ζ SNMG μνίγεηαζ ςξ δ βεκζηεοιέκδ MG, ζηδκ μπμία δ δζάβκςζδ έπεζ δζαπζζηςεεί ιε ηθζκζηέξ, δθεηηνμθοζζμθμβζηέξ ηαζ θανιαημθμβζηέξ δμηζιαζίεξ, αθθά ζηδκ μπμία δεκ ακζπκεφμκηαζ ακηί-achr ακηζζχιαηα. Ο υνμξ μνμανκδηζηή MG είκαζ παναπθακδηζηυξ. Πανά ημ βεβμκυξ 20

21 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ υηζ μζ αζεεκείξ αοημί δεκ έπμοκ AChR ακηζζχιαηα, ηθζκζηέξ ηαζ πεζναιαηζηέξ εκδείλεζξ επζζδιαίκμοκ υηζ δ κυζμξ πνμηαθείηαζ απυ πανάβμκηεξ ημο μνμφ (ποιζημφξ). Ζ ακαθμβία ηέημζςκ μνμανκδηζηχκ ιοαζεεκζηχκ πμζηίθθεζ ζηζξ δζάθμνεξ ιεθέηεξ, απυ 5-10%. Μενζημί εη ηςκ αζεεκχκ ιε μνμανκδηζηή MG, ζε ιεηαβεκέζηενεξ ακαθφζεζξ δίκμοκ εεηζηά απμηεθέζιαηα ζηδ δμηζιαζία βζα ακηί-achr ακηζζχιαηα, βεβμκυξ ημ μπμίμ οπμδδθχκεζ υηζ ηα ακηζζχιαηα ήηακ πζεακχξ πανυκηα αθθά ζε ιδ ακζπκεφζζιεξ ζοβηεκηνχζεζξ. Μέπνζ ζήιενα, ιενζηέξ ιεθέηεξ έπμοκ δείλεζ ίζδ ακαθμβία πνμζαμθήξ ηςκ 2 θφθςκ ζηδ SNMG (Sanders et al., 2003). Ζ δζπθςπία ηαζ δ αθεθανυπηςζδ, ιαγί ιε ηα πνμιδηζηά ζοιπηχιαηα (δοζθαβία, δοζανενία), είκαζ ζοπκά ηαζ ζηδ SNMG υπςξ ηαζ ζηδκ μνμεεηζηή MG, αθθά ανηεηέξ ακαθμνέξ δδθχκμοκ υηζ δ αδοκαιία ηςκ πνμιδηζηχκ ιοχκ ηονζανπεί ζηδ SNMG ζε ζπέζδ ιε ηδκ αδοκαιία ηςκ ιοχκ ηςκ άηνςκ, υπςξ ζημοξ πενζζζυηενμοξ αζεεκείξ ιε μνμεεηζηή MG. Ζ SNMG ζοζπεηίγεηαζ ιε ζηαεενή πμνεία ηαζ απμηνίκεηαζ θζβυηενμ ηαθά ζηζξ παναδμζζαηέξ εεναπείεξ (Birmanns et al., 1991). Οζ εκδείλεζξ βζα υθεθμξ απυ εοιεηημιή ζηδ SNMG είκαζ εθάπζζηεξ ηαζ δεδμιέκδξ ηδξ κμζδνυηδηαξ (Machens et al., 1998), δ εοιεηημιή δε δζηαζμθμβείηαζ, πνμξ ημ πανυκ, ζε αοηήκ ηδκ μιάδα. Χζηυζμ, πανά ηδκ απμοζία ακςιαθζχκ ημο εφιμο, αοηή δ άπμρδ δεκ είκαζ εονέςξ απμδεηηή ηαζ ιενζηά ηέκηνα ζοκεπίγμοκ κα εεναπεφμοκ ηδ SNMG ιε εοιεηημιή. Γείβιαηα ιοσηήξ αζμρίαξ απυ αζεεκείξ ιε μνμεεηζηή MG δείπκμοκ εηηεηαιέκδ ιείςζδ ηςκ ανζειχκ ηςκ AChRs, εκαπμεέζεζξ IgG ηαζ ζοιπθδνχιαημξ ηαζ ιμνθμθμβζηή ηαηαζηνμθή ζηδ ιεηαζοκαπηζηή ιειανάκδ. Τπάνπμοκ θίβεξ ακαθφζεζξ ηςκ AChRs ζε ιο απυ αζεεκείξ ιε SNMG ηαζ ηα εονήιαηα έπεζ ακαθενεεί υηζ είκαζ πανυιμζα ιε ηδκ μνμεεηζηή MG ή ηαζ πμζηίθα. Μζα ιεθέηδ έδεζλε υηζ ζοιπθήνςια ηαζ ακμζμζθαζνίκεξ ανίζημκηαζ ζηζξ ηεθζηέξ ηζκδηζηέξ πθάηεξ αζεεκχκ ιε ήπζα κυζμ, ιενζημί απυ ημοξ μπμίμοξ ήηακ μνμανκδηζημί βζα ηα AChR ακηζζχιαηα (Kaminski et al., 2004). Ζ απυηνζζδ ζηδκ πθαζιαθαίνεζδ ζηδ SNMG (Kuks and Das, 1998) ηαζ δ ιεηάδμζδ ηδξ κυζμο απυ ηδ ιδηένα ζημ παζδί, επζζδιαίκμοκ ζαθχξ υηζ οπάνπεζ έκαξ πανάβμκηαξ ζημκ μνυ, πζεακυκ, IgG. Ζ κυζμξ έπεζ ιεηαθενεεί ζηα πμκηίηζα απυ αζεεκείξ ιε SNMG. Σα πμκηίηζα δεκ έδεζλακ ειθακή ζοιπηχιαηα MG, αθθά μζ δθεηηνμθοζζμθμβζηέξ δμηζιαζίεξ in vitro απμηάθορακ εθάηηςια ζηδ κεονμιοσηή ιεηααίααζδ ζηα πενζζζυηενα γχα (Mossman et al., 1986). Μζα πζεακή ελήβδζδ ήηακ υηζ ημ πθάζια πενζείπε ακηζζχιαηα έκακηζ ημο AChR, αθθά ζε ηέημζμ 21

22 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ παιδθυ ηίηθμ, χζηε δεκ ήηακ ακζπκεφζζια ιε ηδ ιέεμδμ ηδξ ακμζμηαηαηνήικζζδξ. Άθθεξ ιεθέηεξ παεδηζηήξ ιεηαθμνάξ, επζαεααίςζακ υηζ δ κυζμξ ιεηαθένεηαζ ηαζ ζε ιία ιεθέηδ ανέεδηακ πνμζοκαπηζηέξ ηαζ ιεηαζοκαπηζηέξ δθεηηνμθοζζμθμβίεξ ακςιαθίεξ. Οζ ενεοκδηέξ ζοιπένακακ υηζ πζεακυκ κα εκέπμκηαζ ακηζζχιαηα έκακηζ ιδ AChR ζηυπςκ (Burges et al., 1994). Έπμοκ βίκεζ ανηεηέξ πνμζπάεεζεξ κα ανεεμφκ ακηζζχιαηα έκακηζ άθθςκ ακηζβυκςκ ηδξ κεονμιοσηήξ ζφκαρδξ εζδζηά ζηδ SNMG. Πνυηεζηαζ βζα ακηζζχιαηα έκακηζ πνμζοκαπηζηχκ ιειανακζηχκ πνςηεσκχκ, ηδξ Αηεηοθμπμθζκεζηενάζδξ (AChE), ηδξ θζθαιίκδξ ηαζ ηδξ αζκημοθίκδξ, μζ μπμίεξ είκαζ ιεηαζοκαπηζηέξ ηοηηανμζηεθεηζηέξ πνςηεΐκεξ. Χζηυζμ, ηα πενζζζυηενα δεδμιέκα εζηζάγμοκ ηαζ οπμζηδνίγμοκ ηδ ζδιαζία ηςκ ακηζζςιάηςκ πμο δεζιεφμκηαζ ζηδκ ελςηοηηάνζα επζθάκεζα ηδξ ιοσηήξ ίκαξ (Lu et al., 1993; Sideris et al., 2007). Γείβιαηα μνμφ απυ αζεεκείξ ιε SNMG ανέεδηε υηζ ιεζχκμοκ ηδ θεζημονβία ημο ιοσημφ ηφπμο AChR ζηδκ ακενχπζκδ ηοηηανζηή ζεζνά ΣΔ671, δ μπμία πνμένπεηαζ απυ νααδμιομζάνηςια. Ο οπεφεοκμξ πανάβμκηαξ θάκδηε υηζ ακήηε ζημ IgM, πανά ζημ IgG, ηθάζια. Δπζπνυζεεηεξ ιεθέηεξ έδεζλακ υηζ ημ εκδμηοηηάνζμ αζαέζηζμ ιπμνεί κα είκαζ ζδιακηζηυ βζα ηδ δνάζδ αοηή, εκμπμπμζχκηαξ έκακ ιδπακζζιυ εκδμηοηηάνζαξ ζδιαημδυηδζδξ. Δπζπθέμκ, ανηεηέξ δζαθμνεηζηέξ μοζίεξ, υπςξ θάνιαηα πμο εκενβμπμζμφκ ηδκ camp-ελανηχιεκδ ηζκάζδ, επδνέαζακ πανυιμζα ηδ θεζημονβία ημο AChR (Li et al., 1996) Μπαζζεληθά ζύλδξνκα λεπξνκπτθήο ζύλαςεο ημ πνυζθαημ πανεθευκ έπμοκ βίκεζ ζδιακηζηέξ πνυμδμζ ςξ πνμξ ηδκ ιεθέηδ ηδξ παεμβέκεζδξ ηδκ ηθζκζηή αλζμθυβδζδ ηαζ ηδκ εεναπεία, ανηεηχκ άθθςκ αοημάκμζςκ αζεεκεζχκ ζπεηζγυιεκςκ ιε ακηζζχιαηα έκακηζ δζαθυνςκ άθθςκ ζημζπείςκ ηδξ κεονμιοσηήξ ζφκαρδξ. 22

23 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Μπαζζεληθό ζύλδξνκν Lambert-Eaton (LEMS) Ζ παεμβέκεζα ηδξ κυζμο έπεζ κα ηάκεζ ιε ακμζμαζμθμβζηή πνμζαμθή ζημ πνμζοκαπηζηυ ιένμξ ηδξ κεονμιοσηήξ ζφκαρδξ απυ ηοηθμθμνμφκηα ακηζζχιαηα εκακηίμκ ηςκ ηακαθζχκ Ca (Voltage Gated Calcium Channel,VGCC), πμο μδδβεί ζε δζαηαναπέξ ζηδκ απεθεοεένςζδ ηδξ αηεηοθμπμθίκδξ ζηδ δζάνηεζα ημο κεονζημφ ενεείζιαημξ (Vincent, 2008b). Σμ ζφκδνμιμ αοηυ ζοκήεςξ ζοκμδεφεζ ημ ιζηνυ-ηοηηανζηυ ηανηίκςια ημο πκεφιμκα ηαζ ζπακζυηενα άθθα ηανηζκχιαηα, αθθά ηαζ μνζζιέκεξ αοημάκμζεξ κυζμοξ. Κθζκζηά δζαθένεζ απυ ηδ MG ζημ υηζ δ ιοσηή δφκαιδ αολάκεζ ζηδκ ανπή ιζαξ εημφζζαξ ηίκδζδξ, πνζκ ηεθζηά ειθακζζεεί ιοσηή αδοκαιία ηαζ ζημ υηζ δ πνμζαμθή ηςκ μθεαθιζηχκ ιοχκ είκαζ θζβυηενμ ζοπκή. Ζ δμηζιαζία ιε κεμζηζβιίκδ ή εδνμθχκζμ (Tensilon) δίκεζ πνμμδεοηζηή ιείςζδ ημο φρμοξ ηςκ πνμηθδηχκ δοκαιζηχκ, υπςξ ηαζ ζηδκ MG. Δνεεζζιυξ υιςξ ιε ιεβάθδξ ζοπκυηδηαξ ενεείζιαηα (> 10/sec) δίκεζ ζηδκ ανπή ιζηνμφ φρμοξ δοκαιζηά, ιε ααειζαία ηαηυπζκ αφλδζδ 2-20 θμνέξ απυ ηδκ ανπζηή ηζιή. Οζ εεναπείεξ μζ μπμίεξ πνμηείκμκηαζ είκαζ πανυιμζεξ ιε αοηέξ ηδξ αανζάξ ιοαζεέκεζαξ (πονζδμζηζβιίκδ, ζηενμεζδή, ακμζμζθαζνίκεξ), αθθά ημ απμηέθεζια πμζηίθθεζ. Θεναπεοηζηά πνδζζιμπμζείηαζ επίζδξ δ οδνμπθςνζηή βμοακζδίκδ ηαζ δ 3,4 δζαιζκμπονζδίκδ. Ζ ακηζιεηχπζζδ ηδξ εζηίαξ ημο ηανηίκμο εεςνείηαζ απαναίηδηδ ηαζ δ αθαίνεζδ ημο ζοπκά αεθηζχκεζ ημκ αζεεκή. Ζ πανμοζία ηςκ ακηί-sox1 ακηζζςιάηςκ ζημκ μνυ αζεεκχκ ιε LEMS ιπμνεί κα αμδεήζεζ ζηδκ ακαγήηδζδ οπμηεζιέκμο ηανηζκχιαημξ (Titulaer et al.) Δπίθηεηε Nεπξνκπνηνλία (ύλδξνκν Isaac) Αοηυ είκαζ έκα πενζθενζηυ κεονζηυ ζφκδνμιμ, πμο ζοπκά ζοκδέεηαζ ιε ακηζζχιαηα έκακηζ ηςκ ηακαθζχκ εθέβπμο ηαθίμο (VGKCs) ηαζ ιε απμηέθεζια ηδκ οπενδζέβενζδ ηςκ πενζθενζηχκ ηζκδηζηχκ κεφνςκ. Κθζκζηά μζ αζεεκείξ ακαθένμοκ ιοσηέξ ηνάιπεξ ηαζ ειθακίγμοκ ιοσηέξ ζοζπάζεζξ (ιομηοιία ηαζ κεονμιομημκία), οπενηνμθία ηςκ ιοχκ ηαζ ζπάκζα απχθεζα ιοσηήξ ιάγαξ, ιοσηή αδοκαιία ηαζ ιενζηέξ θμνέξ έκημκδ εθίδνςζδ. Μπμνεί επίζδξ κα ζοκοπάνπμοκ παναηηδνζζηζηά, πμο ακαθένμκηαζ ςξ ζφκδνμιμ Morvan, ιε ηαηαζηάζεζξ άβπμοξ, δζαηαναπή ικήιδξ, αθθαβέξ ηδξ πνμζςπζηυηδηαξ ηαζ δζαηαναπέξ ημο 23

24 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ φπκμο. Πμθφ ορδθυηενα επίπεδα ακηζζςιάηςκ VGKC ιπμνεί κα ανεεμφκ ζε αζεεκείξ ιε ιεηαζπιζαηή εβηεθαθίηζδα (Limbic Encephalitis). ε μνζζιέκεξ πενζπηχζεζξ, μζ αζεεκείξ ιπμνεί κα ειθακίζμοκ ηαηαζηάζεζξ πανμλοζιμφ, υπςξ επεζζυδζα ιε ζοζπάζεζξ ημο πνμζχπμο ηαζ ακαηθαζηζηά ημο αναπίμκα, ηαεχξ επίζδξ ηαζ βεκζηεοιέκεξ ηνίζεζξ ημκζημφ/ηθςκζημφ ζπαζιμφ. Σα κεμπθάζιαηα είκαζ ζπεηζηά ζπάκζα ζε αοημφξ ημοξ αζεεκείξ, ακ ηαζ πενίπμο ημ 10% έπμοκ υβημοξ εφιμο αδέκα ή άθθμοξ. Ακ ηαζ βζα ημ ζφκδνμιμ Isaac ζοπκά είκαζ ανηεηή δ ζοιπηςιαηζηή εεναπεία ιε carbamazepine, ζε αζεεκείξ πμο ζοκδέμκηαζ ιε δζαηαναπέξ ημο ηεκηνζημφ ζοζηήιαημξ απαζημφκηαζ εεναπείεξ ιε ορδθέξ δυζεζξ ημνηζημζηενμεζδχκ ηαζ εεναπεία ιε εκδμθθέαζα ακμζμζθαζνίκδ ή πθαζιαθαίνεζδ (Farrugia and Vincent, 2010) ύλδξνκν Guillain-Barre (GBS) Σμ GBS ηαζ δ παναθθαβή ημο ημ Miller-Fisher ζφκδνμιμ (MFS), είκαζ μλείεξ θθεβιμκχδεζξ αοημάκμζεξ κεονμπάεεζεξ, πνζκ ηζξ μπμίεξ ζοπκά πνμδβείηαζ θμίιςλδ. Ζ ιμνζαηή ιίιδζδ ιεηαλφ ηάπμζςκ θζπμπμθοζαηπανζηχκ ζηδκ επζθάκεζα ηςκ ιμθοζιαηζηχκ παναβυκηςκ ηαζ ηςκ βθοημζθζββμθζπζδζηχκ ακηζβμκζηχκ ζημζπείςκ ημο ηζκδηζημφ κεονχκα (βαββθζμγζδίςκ- gangliosides), πμο οπάνπμοκ ζε κεονζηά ηφηηανα πζζηεφεηαζ υηζ πνμηαθεί δζαζηαονμφιεκδ ποιζηή ηαζ ηοηηανζηή ακμζμθμβζηή απυηνζζδ. Ζ θμίιςλδ δ μπμία πνμδβείηαζ είκαζ ζοκήεςξ απυ ημ Campylobacter jejuni αθθά ηαζ ημ Mycoplasma pneumoniae ηαζ μζ επμπζαημί ζμί ηδξ βνίπδξ ιπμνεί κα είκαζ δοκδηζημί έκμπμζ. Γκςνίγμοιε πθέμκ υηζ ηα ακηζζχιαηα ζημ GBS ηαζ ηζξ παναθθαβέξ ημο, ζοκδέμκηαζ ζοπκά ιε ζοιπθέβιαηα βαββθζμγζδίςκ, πμο ζπδιαηίγμκηαζ απυ δφμ ή πενζζζυηενα βαββθζμγίδζα, ηα μπμία οπάνπμοκ ζηζξ ιζηνμπενζμπέξ ζε θζπζδζηέξ ελέδνεξ (microdomains ηςκ lipid rafts) (Farrugia and Vincent). Tα ακηζζχιαηα αοηά είκαζ πθέμκ πνμθθεβιμκχδδ ηαζ είκαζ πζεακυ κα εκενβμπμζήζμοκ ημ ζοιπθήνςια. Τπάνπμοκ αολακυιεκα ζημζπεία βζα ηδκ δζάιεζμο ημο ζοιπθδνχιαημξ δζαηαναπή ημο ζοιπθέβιαημξ ηςκ ηακαθζχκ έθεβπμο καηνίμο, ιε απμηέθεζια ηδκ απμηοπία αβςβήξ ημο ενεείζιαημξ, ζε μλείξ ηζκδηζηέξ παναθθαβέξ ημο GBS, ηα μπμία ιπμνεί κα πνμζηαηεφμκηαζ απυ ηδκ ακαζημθή ηδξ εκενβμπμίδζδξ ημο ζοιπθδνχιαημξ, υπςξ ιε ημ eculizumab, ακμίβμκηαξ έηζζ κέεξ πνμμπηζηέξ βζα ηδ εεναπεία. 24

25 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Ακηζζχιαηα έκακηζ ηςκ βαββθζμγζδίςκ πμο πενζθαιαάκμοκ ημ GQ1b, είκαζ πζμ δζαδεδμιέκα ζημ Miller-Fisher ζφκδνμιμ (MFS). Σέημζα ζοβηνμηήιαηα εηθνάγμοκ ιάθθμκ δζαθμνεηζημφξ επζηυπμοξ απυ εηείκα πμο ζοκζζημφκ ιειμκςιέκα βαββθζμγίδζα. Χζηυζμ, δ MFS δεκ είκαζ ιυκμ ιζα πενζθενεζαηή δζαηαναπή ημο κεονζημφ ζοζηήιαημξ. Μεθέηεξ PET επζαεααζχκμοκ οπενιεηααμθζζιυ ζηδκ πανεβηεθαθίδα ηαζ ημ εβηεθαθζηυ ζηέθεπμξ, εκχ δ δζαηνακζαηή ιαβκδηζηή δζέβενζδ απμδεζηκφεζ πανεβηεθαθζηή δοζθεζημονβία ζε αζεεκείξ, ιε MFS ιε ζημζπεία ηακμκζημπμίδζδξ, υηακ ηα ζοιπηχιαηα οπμπςνήζμοκ. Υνδζζιμπμζχκηαξ patch-clamp ηεπκζηέξ μθυηθδνμο ηφηηανμο, ημ IgM ακηί-gq1b ιμκμηθςκζηυ ακηίζςια, ιείςζε ζδιακηζηά ηδκ ηάζδ ημο νεφιαημξ ηςκ δζαφθςκ αζαεζηίμο ζηα ημηηζχδδ ηφηηανα ηδξ πανεβηεθαθίδαξ, αθθά υπζ ζηα ηφηηανα Purkinje, ηαζ πνςιάηζζε επζθεηηζηά ηα ημηηζχδδ ηφηηανα ηδξ πανεβηεθαθίδαξ (Farrugia and Vincent, 2010). 1.3 Δπηδεκηνινγηθέο Μειέηεο ηεο MG Ζ MG είκαζ ιζα ζπεηζηά ζπάκζα κυζμξ ακ ηαζ έπεζ παναηδνδεεί έκα ζηαεενυ ιμηίαμ ιζαξ πνμμδεοηζηήξ αφλδζδξ ζηδκ επίπηςζδ (incidence) ηαζ ημκ επζπμθαζιυ (prevalence) ιε ηδκ πάνμδμ ηςκ πνυκςκ. ε πνυζθαηεξ επζδδιζμθμβζηέξ ιεθέηεξ ηδξ MG έπμοκ βίκεζ ειθακείξ μνζζιέκεξ ηάζεζξ. Ζ πζμ ζδιακηζηή ηάζδ είκαζ υηζ μ επζπμθαζιυξ ηδξ κυζμο έπεζ αολδεεί ζηαδζαηά απυ ημ ηζξ δοηζημεονςπασηέξ πχνεξ, ηα ηεθεοηαία 50 πνυκζα αολάκεηαζ ζηαεενά: ζηδκ Αββθία π.π. ημ 1934 ήηακ 2,6/ ημ 1998 ήηακ 15 ηαζ ζηδ Γακία ημ 1970 ήηακ 2/ ηαζ ημ ,7. Τπάνπμοκ ανηεηέξ πζεακέξ ελδβήζεζξ βζα αοηή ηδκ ηάζδ. Πνχημκ, δ αφλδζδ ιπμνεί κα ζπεηίγεηαζ ιε ηδκ αεθηζςιέκδ δζάβκςζδ ηαζ αολδιέκδ εοαζζεδημπμίδζδ ςξ πνμξ ηδκ κυζμ. Οζ πενζζζυηενεξ ιεθέηεξ έπμοκ βίκεζ ζηδ Βυνεζα Αιενζηή ηαζ ζε εονςπασημφξ πθδεοζιμφξ. Σα ακαθενυιεκα πμζμζηά επζπμθαζιμφ βζα ηδ ιοαζεέκεζα ηοιαίκμκηαζ απυ 0,5 έςξ 20 ακά (Phillips, 2003). Ζ ζοπκυηδηα ειθάκζζδξ κέςκ πενζπηχζεςκ πμζηίθεζ ζοκήεςξ ιεηαλφ 1,7-10,4 ακά εηαημιιφνζμ πθδεοζιμφ, ακάθμβα ιε ηδκ πενζμπή ηδξ ιεθέηδξ (Phillips and Torner, 1996) ηαζ έπεζ ακαθενεεί έςξ ηαζ 21 ζηδκ Βανηεθχκδ (Aragones et al., 2003). ε υθμοξ ημοξ πθδεοζιμφξ πμο έπμοκ ιεθεηδεεί ςξ ζήιενα, δεκ έπμοκ εκημπζζηεί πενζμπέξ ιε ζδζαίηενα ορδθή ή παιδθή ζοπκυηδηα ηαζ επζηνάηδζδ. Γεκ έπμοκ ακαηαθοθεεί ''ζοζπεζνχζεζξ'' ηδξ κυζμο. Ζ 25

26 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ θοζζηή ζζημνία ηδξ κυζμο θαίκεηαζ έηζζ κα είκαζ ανηεηά μιμζμβεκήξ, ςζηυζμ, μζ πενζζζυηενεξ ιεθέηεξ έπμοκ βίκεζ ηονίςξ ζε Καοηάζζμοξ πθδεοζιμφξ δοηζηυ- εονςπασηήξ ηαηαβςβήξ. ηακ έπμοκ ιεθεηδεεί ιδ εονςπασημί πθδεοζιμί, έπμοκ οπάνλεζ ιενζηέξ εκδείλεζξ υηζ ιπμνεί κα οπάνπμοκ ιενζηέξ δζαθμνέξ θοθεηζηήξ εοαζζεδζίαξ. ηζξ βοκαίηεξ δ αζεέκεζα πανμοζζάγεηαζ ζοκήεςξ ιεηαλφ ηςκ δθζηζχκ 20-40, εκχ ζημοξ άκδνεξ δ δθζηία πανμοζίαζδξ ηείκεζ κα είκαζ ιεηαλφ ηςκ 40 ηαζ 60 πνυκςκ. Ζ ζοπκυηδηα ειθάκζζδξ ηδξ MG είκαζ 40 ιε 60 κέεξ πενζπηχζεζξ ακά εηαημιιφνζμ ακενχπμοξ εηδζίςξ. Ζ ηθζκζηή αοηαπυδεζηηδ αθήεεζα υηζ δ MG είκαζ ιζα αζεέκεζα ηςκ ''κέςκ βοκαζηχκ ηαζ βένςκ ακδνχκ'' θάκδηε κα ένπεηαζ απυ ημ βεβμκυξ υηζ ημ πμζμζηυ ήηακ ζδζαίηενα ορδθυ ζηζξ βοκαίηεξ ζηδ δεφηενδ ηαζ ηνίηδ δεηαεηία ηδξ γςήξ ηςκ. Ζ ιοαζεέκεζα ηαηά ηδκ παζδζηή δθζηία δεκ είκαζ ζοπκή ζηδ Δονχπδ ηαζ ηδκ Βυνεζμ Αιενζηή ηαζ απμηεθεί ημ 10-15% ηςκ πενζπηχζεςκ, αθθά είκαζ πμθφ πζμ ζοπκή ζηζξ Αζζαηζηέξ πχνεξ υπςξ ζηδκ Κίκα υπμο ζημ 50% ηςκ αζεεκχκ πανμοζζάγεηαζ δ ειθάκζζδ ηδξ αζεέκεζαξ πνζκ ηδκ δθζηία ηςκ 15 εηχκ (Zhang et al., 2007) ηαζ ειθακίγεζ πενζζζυηενεξ πενζπηχζεζξ ιοαζεέκεζαξ πμο πενζμνίγμκηαζ ζημοξ μθεαθιμηζκδηζημφξ ιφεξ. Έκα ζδζαίηενα εκδζαθένμκ εφνδια ηδξ ιεθέηδξ ήηακ υηζ δ ζοπκυηδηα ειθάκζζδξ ηδξ MG ήηακ ζδιακηζηά ορδθυηενδ ζημκ Αθνυ-Αιενζηακζηυ πθδεοζιυ. Αοηή δ ιεθέηδ ήηακ δ πνχηδ πμο έηακε ιζα ηέημζα παναηήνδζδ, ίζςξ επεζδή μζ πενζζζυηενεξ ιεθέηεξ πμο είπακ πνμδβδεεί είπακ βίκεζ ζε πθδεοζιμφξ πμο είπακ έκα ζπεηζηά ιζηνυ πμζμζηυ ηςκ Αθνυ-Αιενζηακχκ. Ζ παναηδνμφιεκδ οπένααζδ δεκ είκαζ απνμζδυηδηδ, αθμφ είκαζ βκςζηυ υηζ μζ αοημάκμζεξ αζεέκεζεξ ζε βεκζηέξ βναιιέξ έπμοκ ιεβαθφηενδ επίπηςζδ ηαζ επζπμθαζιυ ιεηαλφ ηςκ Αθνυ-Αιενζηακχκ. Σμ εφνδια αοηυ οπμδδθχκεζ υηζ οπάνπεζ έκαξ ημζκυξ πενζααθθμκηζηυξ ή βεκεηζηυξ πανάβμκηαξ πμο πνμδζαεέηεζ Αθνυ-Αιενζηακμφξ ζε ιζα ορδθυηενδ ζοπκυηδηα MG ηαεχξ ηαζ άθθα αοημάκμζα κμζήιαηα. ε επζδδιζμθμβζηή ιεθέηδ πμο έβζκε απυ ημ ηιήια Βζμπδιείαξ ημο Δθθδκζημφ Ηκζηζημφημο Παζηέν ηαζ ηδκ Πακεπζζηδιζαηή Νεονμθμβζηή Κθζκζηή ηδξ Πάηναξ, ιεθεηήεδηακ 843 αζεεκείξ εεηζημί βζα ακηζζχιαηα ηαηά ηςκ οπμδμπέςκ αηεηοθμπμθίκδξ ηαζ οπμθμβίζηδηακ δζάθμνμζ επζδδιζμθμβζημί δείηηεξ. Ο επζπμθαζιυξ (prevelance) ηδξ κυζμο, ζηζξ δζάθμνεξ ιεθέηεξ είκαζ 5 έςξ 15 πάζπμκηεξ ακά άημια. Πνυηεζηαζ ζοκεπχξ βζα ζπάκζα αννχζηζα ακ ηδκ ζοβηνίκμοιε ιε ηδ ηθήνοκζδ Καηά Πθάηαξ ~ 60 ιέπνζ 26

27 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ 100/ ή ηδ κυζμ Parkinson ~ 100 ακά , ζηζξ δζάθμνεξ ιεθέηεξ. ηδ πχνα ιαξ πνυζθαηδ ιεθέηδ ημο Ηκζηζημφημο Παζηέν ηαζ ηδξ Πακεπζζηδιζαηήξ Νεονμθμβζηήξ Κθζκζηήξ Παηνχκ, δ ιεβαθφηενδ δζεεκχξ επζδδιζμθμβζηή ιεθέηδ (843 άννςζημζ μνμεεηζημί, πμο δ κυζμξ ημοξ άνπζζε ιεηαλφ ) έδεζλε επζπμθαζιυ 8,2/ πμο ζοιπμνεφεηαζ ιε εηείκδ ηςκ εονςπασηχκ πςνχκ. Ζ πνμηίιδζδ ηδξ κυζμο ζηζξ βοκαίηεξ έκακηζ ηςκ ακδνχκ ημκίγεηαζ ζηδκ ηθαζζζηή αζαθζμβναθία (επζπμθαζιυξ 2 πνμξ 1) ζπεηζηά πνυζθαηεξ ιεθέηεξ υιςξ έδεζλακ υηζ δ επίπηςζδ (incidence) δδθ. μζ κέεξ πενζπηχζεζξ ακά έημξ ζηα δφμ θφθα είκαζ 1/1, επεζδή υιςξ ζηζξ βοκαίηεξ δ αννχζηζα λεηζκάεζ ζε πμθφ ιζηνυηενδ δθζηία απ' υηζ ζημοξ άκδνεξ ηαζ γμοκ ζοκεπχξ πενζζζυηενα πνυκζα μ επζπμθαζιυξ ιεηαηζκείηαζ ζημ 2:1 (Poulas et al., 2001; Poulas et al., 2000). Σέθμξ κα ακαθένμοιε υηζ ημ πμζμζηυ εκδζζιυηδηαξ απυ ηδκ κυζμ αοηή παθζυηενα λεπενκμφζε ημ 30%, αθθά ηχνα ιε ηδκ ηαηάθθδθδ ακμζμεεναπεία ημ πμζμζηυ αοηυ είκαζ ιζηνυηενμ απυ 5% ηαζ μζ πενζζζυηενμζ αζεεκείξ γμοκ παναβςβζηή γςή (Grob et al., 2008). 1.4 Γελεηηθή ηεο MG Ζ MG είκαζ ιζα αοημάκμζδ κυζμξ άβκςζηδξ αζηζμθμβίαξ. Χξ αζηία έπμοκ πνμηαεεί ιζα πμζηζθία απυ βεκεηζημφξ, πενζααθθμκηζημφξ, ηαζ θμζιμβυκμοξ πανάβμκηεξ. Μέπνζ ζήιενα, δεκ έπμοκ πνμζδζμνζζηεί ζαθείξ πενζααθθμκηζηέξ ή ιμθοζιαηζηέξ αζηίεξ, αθθά οπάνπεζ ιζα ζαθήξ οπένααζδ ζε αοημάκμζεξ αζεέκεζεξ ζε ιέθδ ηςκ μζημβεκεζχκ ηςκ αζεεκχκ MG. Τπάνπμοκ επίζδξ πμθθέξ, ηαθά ηεηιδνζςιέκεξ πενζπηχζεζξ MG υπμο ειθακίγμκηαζ ζε πενζζζυηενα απυ έκα ιέθδ ιζαξ μζημβέκεζαξ. Αοηυ μδήβδζε ημοξ ενεοκδηέξ κα δζενεοκήζμοκ ημκ πζεακυ νυθμ πμο έπεζ δ βεκεηζηή ζηδκ αζηζμθμβία ηδξ αζεέκεζαξ Απόδεημε ηεο θιεξνλνκηθόηεηαο Οζ βεκεηζημί πανάβμκηεξ βζα ηδκ αοημάκμζδ-βεκζηεοιέκδ MG έπμοκ πνμηαεεί απυ ηζξ ανπέξ ημο Ζ MG είκαζ ηχνα βκςζηυ υηζ ειθακίγεηαζ ζε πμζμζηυ έςξ 4% ηςκ ιεθχκ ηςκ μζημβεκεζχκ ηςκ αζεεκχκ ιε MG. Ο ηνέπςκ ηίκδοκμξ ειθάκζζδξ αοημάκμζδξβεκζηεοιέκδξ MG ζημ βεκζηυ πθδεοζιυ είκαζ θζβυηενμξ απυ 0,01%. Αοηή δ ζδιακηζηή 27

28 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ δζαθμνά δείπκεζ υηζ οπάνπεζ ιζα βεκεηζηή ή ηθδνμκμιζηή αζηία πμο πνμδζαεέηεζ ημοξ ακενχπμοξ κα ακαπηφλμοκ ηδ κυζμ. Μεθέηεξ δζδφιςκ έπμοκ πανάζπεζ αηυια πζμ αδζάζεζζηα ζημζπεία. Ο Namba επακελεηάγμκηαξ ιεβάθμ ανζειυ δίδοιςκ ιε MG, δζαπίζηςζε υηζ 6 απυ ηζξ 21 ζεζνέξ ηςκ δζδφιςκ ήηακ ζφιθςκεξ βζα ηδκ αζεέκεζα (Grob et al., 2008). ηακ ηαεμνίζεδηε δ μιμγοβςηία ηςκ δζδφιςκ, ηυηε ήηακ ζφιθςκεξ βζα ηδκ αζεέκεζα, 5 απυ 13 ζεζνέξ ηςκ ιμκμγοβςηζηχκ δζδφιςκ, εκχ ηακέκα απυ 7 ζεη δζγοβςηζηχκ δίδοιςκ ήηακ ζοβηθίκμοζεξ (ζε έκα ζφκμθμ ηςκ δζδφιςκ υπμο ηαζ μζ δφμ είπακ πθδβεί απυ MG, δ γοβςηία ήηακ απνμζδζυνζζηδ). Ζ ζοκειθάκζζδ ζε ιμκμγοβςηζηά δίδοια πανέπεζ ζζπονέξ εκδείλεζξ βζα ιζα βεκεηζηή αζηζμθμβία ηαζ υπζ βζα πενζααθθμκηζηά αίηζα. Ο ηνυπμξ ηθδνμκμιζηυηδηαξ ιπμνεί ηάθθζζηα κα είκαζ οπμθεζπυιεκμξ. Απυδεζλδ βζ' αοηυ ημ ζοιπέναζια πνμένπεηαζ απυ ημ βεβμκυξ υηζ δ μζημβεκεζαηή MG είκαζ πζμ ημζκή ιεηαλφ ηςκ αδεθθχκ (58%) ακηί βμκέα ηαζ ημ παζδί (15%). Ο Bergoffen ηαζ άθθμζ έπμοκ ακαθένεζ ιζα μζημβέκεζα ιε βμκζηή ζοββέκεζα ζηδκ μπμία 5 απυ 10 αδέθθζα είπακ αοημάκμζδ MG, βεβμκυξ πμο οπμδδθχκεζ αοημζςιζηυ οπμθεζπυιεκμ ηνυπμ ηθδνμκμιζηυηδηαξ (Bergoffen et al., 1994) Τπνςήθηα γνλίδηα Ζ αζμθμβζηή ηαζ ηθζκζηή εηενμβέκεζα ηδξ αοημάκμζδξ MG θαίκεηαζ κα ζοζπεηίγεηαζ ιε βεκεηζημφξ δείηηεξ, ηαζ ηονίςξ ιε ηα βμκίδζα HLA (Compston et al., 1980), (Janer et al., 1999). Σμ πζμ ζηαεενυ εφνδια είκαζ δ ζοζπέηζζδ ηςκ HLA-DR3 ηαζ Β8 αθθδθμιυνθςκ, ιε ηδκ πνχζιδ έκανλδ ηδξ MG ηαζ ιε ηδκ οπενπθαζία ημο εφιμο αδέκα. Ζ ηαεοζηενδιέκδξ έκανλδξ MG ζπεηίγεηαζ θζβυηενμ έκημκα ιε ημ HLA-DR2 ηαζ B7. Σα HLA-DR3 ηαζ DR7 θαίκεηαζ κα επζδνμφκ ακηίεεηα ζημκ MG θαζκυηοπμ. Σα DR3 ζοζπεηίγμκηαζ ιε ηδκ πνχζιδ έκανλδ ηδξ MG, εκχ ηα DR7 ζοζπεηίγμκηαζ ιε ηδκ έκανλδ ηδξ MG ζε ιεβάθεξ δθζηίεξ (ιε ακηί-σζηίκδ ακηζζχιαηα). Έπμοκ ακαθενεεί δζαθμνεηζημί ζοκδοαζιμί HLA ζε Αζζάηεξ αζεεκείξ ιε MG, ιε ορδθή ζοπκυηδηα ημο HLA-DR9 ζε αιθυηενμοξ ημοξ Κζκέγμοξ ηαζ ημοξ Ηάπςκεξ αζεεκείξ ηαζ ζοζπέηζζδ ηδξ μθεαθιζηήξ MG ιε ημ HLA-BW46 ζημοξ Κζκέγμοξ αζεεκείξ. Γεκ έπεζ ανεεεί ζαθήξ βεκεηζηή δζαζφκδεζδ βζα ιοαζεεκείξ ιε εοιςιαηχδδ ΜG, αθθά αζεεκείξ ιε εφιςια ηαζ ζοβηεηνζιέκα βεκεηζηά παναηηδνζζηζηά έπμοκ ορδθυηενμ ηίκδοκμ κα ακαπηφλμοκ MG. Πνυζθαηα έπεζ ακαθενεεί δ 28

29 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ζοζπέηζζδ ημο DR14-DQ5 ζε αζεεκείξ ιε ακηί-musk ακηζζχιαηα (Niks et al., 2006). Ζ ακηί-musk MG είκαζ θζβυηενμ ζοπκή ζε μνζζιέκεξ εεκζηέξ μιάδεξ ή βεςβναθζηέξ πενζμπέξ (π.π. Κίκα, Οθθακδία), βεβμκυξ πμο οπμδδθχκεζ ηδ βεκεηζηή ηαεχξ ηαζ εκδεπμιέκςξ πενζααθθμκημθμβζηέξ επζννμέξ. Πμθθά ιδ-hla βμκίδζα (PTPN22, FCGR2, CHRNA1) έπμοκ επίζδξ ανεεεί υηζ ζπεηίγμκηαζ ιε MG. Κάπμζα δζαζοκδέμκηαζ επίζδξ ιε άθθεξ αοημάκμζεξ αζεέκεζεξ (Giraud et al., 2008) ηαζ εα ιπμνμφζακ κα ακαπαναζηήζμοκ ιζα ιδ εζδζηή εοαζζεδζία ζηδκ αοημακμζία. Μζα ελαίνεζδ ζε αοηυ είκαζ ημ CHRNA1 βμκίδζμ, ημ μπμίμ ηςδζημπμζεί ηδκ οπμιμκάδα άθθα ημο AChR ηαζ εα ιπμνμφζε κα πανέπεζ παεμβεκεηζηά ζημζπεία εζδζηά βζα ηδκ MG. Δίκαζ απαναίηδηδ δ πεναζηένς ένεοκα ζπεηζηά ιε ηζξ πζεακέξ βεκεηζηέξ αζηίεξ ηδξ αοημάκμζδξ MG. Με ηδκ ακάπηολδ πζμ πνμδβιέκςκ βμκμηοπζηχκ ιεευδςκ εα είιαζηε ζε εέζδ κα έπμοιε ιζα ηαθφηενδ ηαηακυδζδ. Μζα ηαθφηενδ ηαηακυδζδ ηδξ βεκεηζηήξ ηδξ MG, ιπμνεί κα μδδβήζεζ αηυια ηαζ ζε κεχηενεξ ηαζ ηαθφηενεξ εεναπείεξ βζα ηδκ αζεέκεζα ηαζ εκδεπμιέκςξ αηυιδ ηαζ ηδκ πνυθδρή ηδξ. 1.5 Κιηληθά Υαξαθηεξηζηηθά ηεο Νόζνπ Σα ηοπζηά ηθζκζηά παναηηδνζζηζηά ηδξ ιοαζεέκεζαξ είκαζ δ αδοκαιία ηαζ δ έκημκδ ηυπςζδ ηςκ ζηεθεηζηχκ ιοχκ, ηα μπμία επζδεζκχκμκηαζ ιεηά απυ έκημκδ επακαθαιαακυιεκδ άζηδζδ, εκχ ελαζεεκμφκ υηακ ιεζμθααήζεζ πενίμδμξ δνειίαξ. Σα ζοιπηχιαηα πμζηίθμοκ ηαηά ηδ δζάνηεζα ηδξ αζεέκεζαξ ηαζ πανάβμκηεξ πμο έπμοκ ανεεεί υηζ επδνεάγμοκ ηδκ ελέθζλδ ηδξ κυζμο είκαζ δ άζηδζδ, μζ ορδθέξ εενιμηναζίεξ, μζ ιμθφκζεζξ, μζ ζοκαζζεδιαηζηέξ δζαηαναπέξ, ηαεχξ επίζδξ ηαζ ζοβηεηνζιέκα θάνιαηα (Grob et al., 1987),(Vincent et al., 2001). Ζ αζεέκεζα ιπμνεί κα πενζμνίγεηαζ ζε έκα ιυκμ ιο, υπςξ βζα πανάδεζβια ζημοξ ελςηενζημφξ μθεαθιζημφξ ή ακαπκεοζηζημφξ ιφεξ, είηε κα είκαζ ιζα βεκζηεοιέκδ ηαηάζηαζδ. ηδκ πενίπηςζδ πμο ηα ζοιπηχιαηα παναιείκμοκ εκημπζζιέκα ζημοξ μθεαθιζημφξ ιφεξ βζα παναπάκς απυ δφμ πνυκζα, ιεζχκεηαζ δ πζεακυηδηα ελέθζλδξ ηδξ κυζμο ζε βεκζηεοιέκδ ιοαζεέκεζα. Χζηυζμ, δ αζεέκεζα πανμοζζάγεηαζ βεκζηεοιέκδ ζημ 85% ηςκ ιοαζεεκχκ (Grob et al., 1987). ηα ανπζηά ζηάδζα εηδήθςζδξ ηδξ αζεέκεζαξ, ειθακίγεηαζ ζοκήεςξ 29

30 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ αθεθανυπηςζδ ηαζ δζπθςπία, ηαηαζηάζεζξ πμο πνμηαθμφκηαζ απυ ηδκ πνμζαμθή ηςκ ελμθεαθιζχκ ιοχκ ηαζ εηείκςκ πμο είκαζ οπεφεοκμζ βζα ηδκ ακαζήηςζδ ηςκ αθεθάνςκ. ηδκ πενίπηςζδ πμο πνμζαάθθμκηαζ μζ πνμζςπζημί ηαζ πενζμθεαθιζημί ιφεξ, ειθακίγμκηαζ δοζημθίεξ ζηδκ μιζθία, ηδ ιάζδζδ, ηδκ ηαηάπμζδ ηαζ ηαοηυπνμκα επδνεάγεηαζ δ έηθναζδ ημο πνμζχπμο. ε πνμπςνδιέκα ζηάδζα ηδξ αζεέκεζαξ παναηδνείηαζ ζοκήεςξ βεκζηεοιέκδ αδοκαιία, δ μπμία ηαηαηάζζεηαζ ζε ηνεζξ ηαηδβμνίεξ: εθαθνζάξ, εκδζάιεζδξ ηαζ αανζάξ ιμνθήξ, ακάθμβα ιε ηδ αανφηδηα ηςκ ηθζκζηχκ ζοιπηςιάηςκ πμο πανμοζζάγεζ μ ηάεε αζεεκήξ. ηδκ βεκζηεοιέκδ ιοαζεέκεζα ειπθέημκηαζ μζ ιφεξ ηςκ άηνςκ ηαζ ημο ημνιμφ. ε ιενζηέξ πενζπηχζεζξ, οπάνπεζ πζεακυηδηα πνμζαμθήξ ηςκ ακαπκεοζηζηχκ ιοχκ, ειθακίγμκηαξ δοζημθίεξ ζηδκ ακαπκμή. Ζ αανζάξ ιμνθήξ βεκζηεοιέκδ αδοκαιία πμθθέξ θμνέξ μδδβεί ζε ζδζαίηενα ζμαανέξ ηαηαζηάζεζξ πμο παναηηδνίγμκηαζ ςξ ιοαζεεκζηέξ ηνίζεζξ ηαζ ιπμνμφκ κα απμαμφκ ιμζναίεξ θυβς ελαζεέκζζδξ ημο ακαπκεοζηζημφ ζοζηήιαημξ. Ζ ειθάκζζδ ηςκ ζοιπηςιάηςκ ζε υθδ ηδκ πμνεία ηδξ κυζμο ιπμνεί κα είκαζ μλεία ή ιέηνζα, πανμοζζάγμκηαξ πενζυδμοξ φθεζδξ ηαζ έλανζδξ (Rodolico et al., 2005) Δηεξνγέλεηα ηεο Μπαζζέλεηαο Ζ ιοαζεέκεζα είκαζ ιία κυζμξ πμο πανμοζζάγεζ ορδθή εηενμβέκεζα ηαζ ιπμνεί κα ηαλζκμιδεεί ζε δζάθμνεξ ηαηδβμνίεξ ακάθμβα ιε ηδκ δθζηία εηδήθςζδξ ηδξ αζεέκεζαξ, ηδκ πανμοζία ή απμοζία ακηζζςιάηςκ έκακηζ ημο ιοσημφ οπμδμπέα, ηδ ζμαανυηδηα ηςκ ηθζκζηχκ ζοιπηςιάηςκ ηαζ ηδκ αζηζμθμβία ηδξ εηδήθςζδξ ηδξ κυζμο. Ακάθμβα ιε ηδκ δθζηία πμο εηδδθχκεηαζ δ ιοαζεέκεζα, ιπμνεί κα ηαλζκμιδεεί ςξ πανμδζηή ειανοσηή ιοαζεέκεζα, παζδζηή ιοαζεέκεζα, ιοαζεέκεζα ιε πνχζιδ εηδήθςζδ ηαζ ιοαζεέκεζα ιε υρζιδ εηδήθςζδ (Vincent and Rothwell, 2004),(Thanvi and Lo, 2004). Ζ πανμδζηή ειανοσηή ιοαζεέκεζα πνμηαθείηαζ απυ ιδηνζηά ακηζζχιαηα έκακηζ ημο ιοσημφ οπμδμπέα, ηα μπμία ιέζς ημο πθαημφκηα, ιεηαθένμκηαζ ζημ κεμβέκκδημ ηαζ αθθδθεπζδνμφκ ιε ημοξ οπμδμπείξ ημο. Μυκμ ημ 10-15% ηςκ κεμβέκκδηςκ πμο θένμοκ ηέημζμο είδμοξ ακηζζχιαηα ειθακίγμοκ ζοιπηχιαηα ιοαζεέκεζαξ ιέζα ζηζξ πνχηεξ χνεξ ιεηά ηδ βέκκδζδ. Ζ παζδζηή ιοαζεέκεζα είκαζ ζπάκζα κυζμξ ηαζ ειθακίγεηαζ ζε δθζηία 30

31 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ιζηνυηενδ ηςκ 15 εηχκ. Ζ παζδζηή ιοαζεέκεζα πανμοζζάγεηαζ ζπάκζα ζημοξ Καοηάζζμοξ πθδεοζιμφξ, εκχ ζε ακηίεεζδ είκαζ ημζκυ κυζδια ζημοξ αζζαηζημφξ θαμφξ (Ashraf et al., 2006). Ζ ιοαζεέκεζα ιε πνχζιδ εηδήθςζδ εηδδθχκεηαζ ζοκήεςξ πνζκ ηδκ δθζηία ηςκ 40 εηχκ ηαζ ειθακίγεηαζ ηονίςξ ζηζξ βοκαίηεξ. Οζ πενζζζυηενμζ αζεεκείξ ιε πνχζιδ εηδήθςζδ ηδξ αζεέκεζαξ θένμοκ ακηζζχιαηα ηαηά ημο ιοσημφ οπμδμπέα, εκχ μ εφιμξ αδέκαξ ημοξ πανμοζζάγεζ ιεβέεοκζδ. Απυ ηδκ άθθδ πθεονά, δ ιοαζεέκεζα ιε υρζιδ εηδήθςζδ πανμοζζάγεηαζ ιεηά ηδκ 4δ δεηαεηία ημο αίμο ηαζ ακ ηαζ ιε ιζηνή δζαθμνά, ζοπκυηενα ζημοξ άκηνεξ. Ο εφιμξ αδέκαξ ζε αοηή ηδ ιμνθή ιοαζεέκεζαξ δεκ ιεβεεφκεηαζ. ηδκ ηαηδβμνία αοηή ακήημοκ πενζζζυηενμζ απυ ημ 60% ηςκ ιοαζεεκχκ (Vincent et al., 2001). Έκα άθθμ είδμξ ηαλζκυιδζδξ ηδξ εηενμβεκμφξ αοηήξ κυζμο πναβιαημπμζείηαζ ιε αάζδ ηδκ πανμοζία ή απμοζία αοημακηζζςιάηςκ ζημοξ μνμφξ ηςκ ιοαζεεκχκ ηαηά ημο ιοσημφ οπμδμπέα. Οζ αζεεκείξ πμο θένμοκ ακηζζχιαηα ηαηά ημο οπμδμπέα μκμιάγμκηαζ μνμεεηζημί, εκχ ζηδκ ακηίεεηδ πενίπηςζδ μνμανκδηζημί. Οζ μνμεεηζημί ιοαζεεκείξ απμηεθμφκ ημ 85%-90% ηςκ αζεεκχκ ιε βεκζηεοιέκδ ιοαζεέκεζα ηαζ ημ 50%-60% ιε μθεαθιζηή ιοαζεέκεζα. Ζ ηαηδβμνία αοηήξ ηδξ ιοαζεέκεζαξ είκαζ δ πζμ ημζκή ηαζ ηαθφηενα ιεθεηδιέκδ (Vincent et al., 2001). Οζ μνμανκδηζημί ιοαζεεκείξ απμηεθμφκ ημ 10-15% ημο ζοκυθμο. Χζηυζμ, πνμ εκδεηαεηίαξ ακαηαθφθεδηε υηζ έκα πμζμζηυ ηςκ μνμανκδηζηχκ ιοαζεεκχκ θένεζ ακηζζχιαηα έκακηζ άθθςκ πνςηεσκχκ ηδξ κεονμιοσηήξ ζφκαρδξ, υπςξ είκαζ δ πνςηεΐκδ MuSK (Hoch et al., 2001). Δπζπνυζεεηα, ηάπμζμζ μνμεεηζημί ιοαζεεκείξ, πανάθθδθα ιε ηα αοημακηζζχιαηα έκακηζ ημο ιοσημφ οπμδμπέα ειθακίγμοκ ηαζ αοημακηζζχιαηα έκακηζ άθθςκ πνςηεσκχκ ηδξ κεονμιοσηήξ ζφκαρδξ, υπςξ είκαζ δ ηζηίκδ ηαζ μζ οπμδμπείξ ηδξ νοακμδίκδξ. Σέημζμο είδμοξ ακηζζχιαηα απακηχκηαζ ηονίςξ ζε ιοαζεεκείξ ιε εφιςια ηαζ ζε θίβεξ πενζπηχζεζξ, ζε ιοαζεεκείξ ιε υρζιδ εηδήθςζδ ηδξ κυζμο ηαζ ζοκήεςξ ζοκδέμκηαζ ιε αανζάξ ιμνθήξ βεκζηεοιέκδ ιοαζεέκεζα (Skeie et al., 2006a). Έκαξ άθθμξ ηνυπμξ ηαηδβμνζμπμίδζδξ ηδξ ιοαζεέκεζαξ πναβιαημπμζείηαζ ζφιθςκα ιε ηδ ζμαανυηδηα ηςκ ηθζκζηχκ ζοιπηςιάηςκ. Μέπνζ πνυζθαηα, δ ηθίιαηα πμο πνμζδζυνζγε ηδ αανφηδηα ηςκ ηθζκζηχκ ζοιπηςιάηςκ ήηακ δ ηθίιαηα Osserman. φιθςκα ιε ηδκ ηθίιαηα αοηή, δ 1δ ααειίδα ακαθένεηαζ ζηδκ 31

32 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ εζηζαζιέκδ κυζμ, δ μπμία ζοκήεςξ πενζμνίγεηαζ ζημοξ μθεαθιζημφξ ιφεξ. Ζ 2δ ααειίδα παναηηδνίγεζ ηδ βεκζηεοιέκδ ιμνθή ηδξ κυζμο, δ μπμία είκαζ είηε εθαθνζάξ ιμνθήξ (2α) είηε εκδζάιεζδξ ιμνθήξ (2α). ηδκ 3δ ααειίδα ηαηαηάζζεηαζ δ αανζάξ ιμνθήξ βεκζηεοιέκδ ιοαζεέκεζα. Σέθμξ, δ 4δ ααειίδα παναηηδνίγεζ ηζξ πενζπηχζεζξ ιοαζεεκζηήξ ηνίζδξ ιε ακαπκεοζηζηή ακεπάνηεζα. Μεηέπεζηα, ζηδκ ηθίιαηα αοηή πναβιαημπμζήεδηακ ιζηνέξ ηνμπμπμζήζεζξ απυ ημ φθθμβμ Μοαζεεκχκ ηδξ Αιενζηήξ (MGFA), πνμηεζιέκμο κα ελοπδνεηεί ηαθφηενα ενεοκδηζημφξ ζημπμφξ (Jaretzki et al., 2000). Σέθμξ, ακάθμβα ιε ηδκ αζηζμθμβία ηδξ εηδήθςζδξ ηδξ κυζμο οπάνπμοκ ηέζζενζξ οπμηαηδβμνίεξ, μζ μπμίεξ είκαζ δ επίηηδηδ αοημάκμζδ ιοαζεέκεζα, δ πανμδζηή κεμβκζηή ιοαζεέκεζα, δ ιοαζεέκεζα πμο πνμηαθείηαζ απυ ηδ πνήζδ μνζζιέκςκ θανιάηςκ (D-πεκζηζθθαιίκδ) (Tzartos et al., 1988) ηαζ ηέθμξ ηα ζοββεκή ιοαζεεκζηά ζφκδνμια Αλαηνκία θαη Φπζηνινγία ηεο Νεπξνκπτθήο ύλαςεο (NMJ) Γζα κα ηαηακμήζεζ ηακείξ ηδκ παεμθοζζμθμβία ηδξ αανείαξ ιοαζεέκεζαξ, πνεζάγεηαζ κα βκςνίγεζ ηδκ ακαημιία ηαζ ηδκ θοζζμθμβία ηδξ κεονμιοσηήξ ζφκαρδξ (ΝNJ). 32

33 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Δηθόλα 2. Ζ Νεπξνκπτθή ζύλαςε ζε ιεπηνκέξεηα Γζαηνίκμκηαζ υθα ηα βκςζηά ζημζπεία ηδξ κεονμιοσηήξ ζφκαρδξ ηα μπμία ζοιιεηέπμοκ ζε κεονμθμβζηέξ παεήζεζξ. Γζαηνίκεηαζ δ ηεθζηή ηζκδηζηή πθάηα, ημ ζδιείμ επαθήξ ιεηαλφ ηδξ ηεθζηήξ απυθδλδξ ημο κεονάλμκα ηαζ ηδξ ιειανάκδξ ηδξ ιοσηήξ ίκαξ, ηα ιυνζα πμο ειπθέημκηαζ ζηδκ μνβάκςζδ ηςκ ζημζπείςκ ηδξ ζφκαρδξ, ηδκ ιεηααίααζδ ημο κεονζημφ ενεείζιαημξ ηαζ ηα ηακάθζα ζυκηςκ Ο ππνδνρέαο ηεο αθεηπινρνιίλεο (AChR) Ζ Δζη. 3 απεζημκίγεζ ηδκ α-οπμιμκάδα ημο AChR. Ο οπμδμπέαξ ηδξ αηεηοθμπμθίκδξ (AChR) είκαζ ιζα δζαιειανακζηή βθοημπνςηείκδ. Απμηεθείηαζ απυ 4 οπμιμκάδεξ ηαζ ακεονίζηεηαζ ζε 2 ζζμιμνθέξ (Lindstrom et al., 2008). Ο AChR ζημκ εκήθζηα απμηεθείηαζ απυ δφμ α-οπμιμκάδεξ ηαζ έκα ακηίβναθμ απυ ηάεε ιία απυ ηζξ α-, δ-, ηαζ ε-οπμιμκάδεξ, εκχ μ ειανοσηυξ AChR πενζέπεζ ιζα β- ακηί ηδξ ε-οπμιμκάδαξ. Μεηαλφ ηςκ οπμιμκάδςκ ημο AChR οπάνπεζ ορδθή μιμθμβία ζηδκ αθθδθμοπία ηςκ αιζκμλέςκ, ιε ηάεε ιία οπμιμκάδα 33

34 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ κα πενζέπεζ ηέζζενζξ α-έθζηεξ (M1 έςξ M4) μζ μπμίεξ εηηείκμκηαζ ζηδκ ηοηηανμπθαζιαηζηή ιειανάκδ. Σα ελςηοηηάνζα ηιήιαηα ηςκ οπμιμκάδςκ, πμο απμηεθμφκηαζ απυ ηα αιζκμηεθζηά ηαζ ηαναμλοηεθζηά άηνα ηαζ ηδκ πενζμπή ιεηαλφ M2 ηαζ M3, δδιζμονβμφκ έκα ιεβάθμ ελςηοηηάνζμ «πνμεάθαιμ» (vestibule) μ μπμίμξ πενζαάθθεζ ημ ελςηοηηάνζμ ζηυιζμ ημο δζαφθμο. Οζ πενζμπέξ ιεηαλφ M1 ηαζ M2 ηαζ ιεηαλφ M3 ηαζ M4 ζπδιαηίγμοκ έκα ιζηνυηενμ «πνμεάθαιμ» βφνς απυ ημ εκδμηοηηάνζμ ζηυιζμ ημο ζμκηζημφ δζαφθμο (Kalamida et al., 2007). Ο κζημηζκζηυξ AChR ημο ζηεθεηζημφ ιουξ έπεζ ιία ιεβάθδ ελςηοηηάνζα επζθάκεζα πμο ημο δίκεζ ηδ δοκαηυηδηα κα ζπδιαηίγεζ πμθθμφξ επζηυπμοξ βζα ζφκδεζδ ιε αοημακηζζχιαηα ηαζ κα δζεοημθφκεζ ηδκ ηαοηυπνμκδ δέζιεοζδ δζαθμνεηζηχκ ακηζζςιάηςκ (Hughes et al., 2004). Σμ ζδιείμ ζφκδεζδξ ηδξ αηεηοθμπμθίκδξ είκαζ ζηδκ ελςηενζηή επζθάκεζα ημο ελςηοηηάνζμο ηιήιαημξ ηδξ α-οπμιμκάδμξ ημο AChR. Σμ ηακάθζ ημο οπμδμπέα βζα κα ακμίλεζ ζοκήεςξ απαζηεί ζφκδεζδ ιε δφμ ιυνζα αηεηοθμπμθίκδξ. Ζ ηφνζα ακμζμβυκμξ πενζμπή (MIR) ανίζηεηαζ ζηδκ ακχηενδ ελςηενζηή εέζδ ηδξ ελςηοηηάνζαξ ιμίναξ ημο AChR. Ζ πενζμπή αοηή είκαζ ημ ζδιείμ υπμο ηαηεοεφκμκηαζ ηα πενζζζυηενα ακηζζχιαηα ζηδκ ηθζκζηή ηαζ πεζναιαηζηή αοημάκμζδ ιοαζεέκεζα (Tzartos et al., 1998; Tzartos et al., 1985). Κάεε AChR έπεζ δομ ηφνζεξ ακμζμβυκεξ πενζμπέξ πμφ εονίζημκηαζ ζηδκ αιζκμηεθζηή απυθδλδ ηδξ α-οπμμιάδαξ, ιεηαλφ ηςκ αιζκμλζηχκ ηαηαθμίπςκ 67 ηαζ 76 ηδξ α-οπμιμκάδαξ. Ζ εκδμηοηηάνζα ιμίνα ημο AChR είκαζ ιζηνή ηαζ ανκδηζηά θμνηζζιέκδ, έπεζ δε ζδιεία ζφκδεζδξ βζα ηοηηανμζηεθεηζηέξ ηαζ νοειζζηζηέξ πνςηεΐκεξ υπςξ είκαζ μζ πνςηεσκμηζκάζεξ. Ο AChR ημο εκήθζηα ιπμνεί κα δζαπςνζζηεί απυ ημκ ειανοσηυ AChR ιε αάζδ δθεηηνμθοζζμθμβζηά παναηηδνζζηζηά. Οζ δίαοθμζ ζημκ εκήθζηα έπμοκ αναπφηενμοξ ιέζμοξ πνυκμοξ δζάκμζλδξ ηαζ δ αβςβζιυηδηά ημοξ είκαζ 50% ιεβαθφηενδ ζε ζπέζδ ιε ημοξ δζαφθμοξ ημο ειανφμο. Οζ δζαθμνέξ ιεηαλφ ηςκ δζαφθςκ ημο AChR ζημκ εκήθζηα ηαζ ημ έιανομ μθείθμκηαζ ζηδκ ακηζηαηάζηαζδ ηδξ β- ιε ηδκ ε-οπμιμκάδα. Ζ θςζθμνοθίςζδ αθθά ηαζ άθθεξ ιμνθέξ ιεηά-ιεηαθναζηζηήξ ηνμπμπμίδζδξ, ιπμνμφκ κα ιεηααάθθμοκ ηζξ ζδζυηδηεξ ημο AChR, ηαζ ζδζαίηενα δ θςζθμνοθίςζδ οπμιμκάδςκ ημο θαίκεηαζ υηζ νοειίγεζ ηδκ απεοαζζεδημπμίδζδ δ μπμία επάβεηαζ απυ αβςκζζηέξ (Hughes et al., 2004). 34

35 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ α-υπομονάδα Δηθόλα 3. Γνκή ηνπ ληθνηηληθνύ ππνδνρέα ηεο αθεηπινρνιίλεο Α. πδιαηζηή ακαπανάζηαζδ ηδξ ηεηανημηαβμφξ δμιήξ ημο ιμνίμο ημο AChR, πανμοζζάγμκηαξ ηδκ δζεοεέηδζδ ηςκ οπμιμκάδςκ, ηζξ πενζμπέξ ζφκδεζδξ ηδξ ACh ηαζ ημ ηαηζμκζηυ ηακάθζ. Πνμζανιμζιέκμ απυ Nat. Rev. Neurosci. 3, (2002). Karlin Α. Β. Γζαβναιιαηζηή απεζηυκζζδ ημο Torpedo οπμδμπέα, υπςξ πνμέηορε απυ ιεθέηδ ηνοζηαθθμβναθζηήξ ακάθοζδξ 4Å. Απεζηυκζζδ ημο οπμδμπέα υπςξ παναηδνείηαζ (α1) απυ ηδ ζοκαπηζηή ζπζζιή ηαζ (α2) πανάθθδθα πνμξ ηδκ πθαζιαηζηή ιειανάκδ. Απεζημκίγμκηαζ μζ οπμιμκάδεξ ημο οπμδμπέα: α (ηυηηζκμ πνχια), α (πνάζζκμ πνχια), β (ααεφ ιπθε), δ (ιπθε). Πνμζανιμζιέκμ απυ JMol. Biol. 346, (2005), Nature 423, (2003) ρεκαηηζκόο ηεο λεπξνκπτθήο ζύλαςεο θαη ε εηδηθή γηα ηνλ κπ θηλάζε (MuSK) Ζ ακάπηολδ ηδξ NMJ απαζηεί ζφκεεηεξ δζακηζδνάζεζξ ιεηαλφ ηςκ ακαπηοζζυιεκςκ ηζκδηζηχκ κεονχκςκ ηαζ ηςκ ιοσηχκ ζκχκ (McConville and Vincent, 2002). Ο ζπδιαηζζιυξ ηαζ δ απμηεθεζιαηζηή θεζημονβία ηδξ κεονμιοσηήξ ζφκαρδξ απαζηεί ηδ ζοκενβαζία δζαθυνςκ παναβυκηςκ. Ζ απμηοπία ζπεηίγεηαζ ιε ηδκ ειθάκζζδ ακςιαθζχκ ζε δζάθμνα 35

36 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ζηάδζα ηα μπμία μκμιάγμκηαζ ζοββεκή ιοαζεεκζηά ζφκδνμια (CMS). Ζ πανμφζα βκχζδ εζζδβείηαζ, υηζ δ αβνίκδ (agrin), ιία πνςηεΐκδ δ μπμία ζοκηίεεηαζ απυ ημοξ ηζκδηζημφξ κεονχκεξ ηαζ εκαπμηίεεηαζ ζηαεενά ιέζα ζηδ ζοκαπηζηυ ααζζηυ πέηαθμ (synaptic basal lamina), δζεβείνεζ ιία εζδζηή βζα ημκ ιο ηζκάζδ ηδξ ηονμζίκδξ (MuSK), δ μπμία εηθνάγεηαζ εηθεηηζηά ζημκ ζηεθεηζηυ ιο (Rimer, 1998),(Hoch et al., 2001). Ζ εκενβμπμίδζδ ηδξ MuSK απυ ηδκ αβνίκδ ςξ απμηέθεζια ηδξ θςζθμνοθίςζδξ ηδξ ηονμζίκδξ μδδβεί θςζθμνοθίςζδ ηδξ ναρίκδξ, ημ μπμίμ ζηδ ζοκέπεζα μδδβεί ζηδ θςζθμνοθίςζδ ηδξ α-οπμιμκάδαξ ημο AChR ηαζ ηδκ ζοβηέκηνςζδ ηςκ AChRs. H απμδμηζηή ιεηααίααζδ ημο κεονζημφ ενεείζιαημξ απαζηεί ηδκ ζοζζςιάηςζδ ηςκ οπμδμπέςκ ζηδ ιεηαζοκαπηζηή ιειανάκδ. ε nock-out επίιοεξ μζ μπμίμζ έπμοκ έθθεζρδ αβνίκδξ ή MuSK, αδοκαημφκ κα ζπδιαηίζμοκ κεονμιοσηέξ ζοκάρεζξ ηαζ ςξ απμηέθεζια αοημφ πεεαίκμοκ ζηδ βέκκδζδ, θυβς αδοκαιίαξ κα ηζκδεμφκ ή κα ακαπκεφζμοκ (Glass DJ, 1996). Eπίιοεξ ιε ιεηαθθαβιέκδ MuSK δεκ ζοβηεκηνχκμοκ AChRs ή άθθεξ ζοκαπηζηέξ πνςηεΐκεξ ζηδκ NMJ, αθθά ιάθθμκ μζ πνςηεΐκεξ αοηέξ εηθνάγμκηαζ μιμζυιμνθα ηαηά ιήημξ ηδξ ιοσηήξ ίκαξ. Ο αηνζαήξ ιδπακζζιυξ ιέζς ημο μπμίμο δ αβνίκδ εκενβμπμζεί ηδκ MuSK δεκ έπεζ λεηαεανζζεεί (Ghazanfari et al.). Ζ αβνίκδ δζεβείνεζ ηδκ ηαπεία θςζθμνοθίςζδ οπμθεζιιάηςκ ηονμζίκδξ ηδξ MuSK, εφνδια ημ μπμίμ είκαζ ζοιααηυ ιε ηδκ ζδέα υηζ δ MuSK είκαζ έκαξ οπμδμπέαξ (ή ζοζηαηζηυ εκυξ ζφκεεημο οπμδμπέα), βζα ηδκ αβνίκδ. Απυ ηδκ άθθδ πθεονά, ακαβηαζηζηή έηθναζδ ηδξ MuSK ζε ζκμαθάζηεξ ή ιομαθάζηεξ δεκ μδδβεί ζηδκ θςζθμνοθίςζδ ηδξ απυ ηδκ αβνίκδ (Glass DJ, 1996). Δπίζδξ ακαζοκδοαζιέκδ αβνίκδ δεκ ζοκδέεηαζ ιε ηδ MuSK in vitro, βεβμκυξ πμο εζζδβείηαζ υηζ επζπθέμκ ζοζηαηζηά, ηα μπμία ιπμνεί κα εηθνάγμκηαζ ζηζξ ζηεθεηζηέξ ιοσηέξ ίκεξ, αθθά υπζ ζημοξ ιομαθάζηεξ ή ημοξ ζκμαθάζηεξ, απμηεθμφκ μοζζαζηζηά ζημζπεία ηαηά ηδ δζαδζηαζία εκενβμπμίδζδξ ηδξ MuSK απυ ηδκ αβνίκδ. πςξ εα πενζβναθεί παναηάης, δ MuSK έπεζ ακαβκςνζζεεί ςξ έκαξ ακηζβμκζηυξ ζηυπμξ ζε αζεεκείξ ιε ιοαζεέκεζα, μζ μπμίμζ είκαζ μνμανκδηζημί βζα ακηζζχιαηα εκακηίμκ ημο AChR (Hughes et al., 2004). Ζ MuSK είκαζ οπεφεοκδ βζα ημ ζπδιαηζζιυ ηαζ ηδ δζαηήνδζδ ηδξ κεονμιοσηήξ ζφκαρδξ ιέζς ηδξ ναρίκδξ. Ζ εκενβμπμίδζδ ηδξ MuSK βίκεηαζ απυ ημκ πνμζδέηδ αβνίκδ μ μπμίμξ εηηνίκεηαζ απυ ημκ πνμζοκαπηζηυ κεονχκα. Ζ αβνίκδ δεκ πνμζδέκεηαζ απεοεείαξ 36

37 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ζηδκ MuSK αθθά ζε ηάπμζα άθθα ζημζπεία ηδξ ζφκαρδξ ηα μπμία ζοκμθζηά μκμιάγμκηαζ MASC (Myotube-Αssociated-Specific-Components) (Shigemoto et al., 2008). Πνυζθαηα έπεζ δζεοηνζκζζηεί δ φπανλδ εκυξ άθθμο οπμδμπέα (Lrp-4) ηδξ μζημβέκεζαξ ηςκ LDLR, o μπμίμξ ζπδιαηίγεζ ζφιπθεβια ιε ηδ MuSK, ζημκ μπμίμ πνμζδέκεηαζ δ αβνίκδ ηαζ δζαιεζμθααεί ζηδκ εκενβμπμίδζδ ηδξ MuSK (Higuchi et al., 2011). Ο Lrp-4 είκαζ πζεακχκ μ οπμδμπέαξ βζα ηδκ αβνίκδ ηαζ είκαζ απαναίηδημξ βζα ηδκ εκενβμπμίδζδ ηδξ θςζθμνοθίςζδξ ηδξ MuSK απυ ηδκ αβνίκδ. ημ ιεηαλφ έπεζ δεζπεεί υηζ δ οπενέηθναζδ ηδξ MuSK μδδβεί ζημ ζπδιαηζζιυ ηδξ κεονμιοσηήξ ζφκαρδξ απμοζία αβνίκδξ, ηαζ οπμδδθχκεζ υηζ δ εκδμβεκήξ αοηυκμιδ εκενβμπμίδζδ ηδξ ιπμνεί κα είκαζ ζηακή βζα ηδκ έκανλδ ζοκαπηζηήξ δζαθμνμπμίδζδξ. Οζ ζοκάρεζξ υιςξ αοηέξ είκαζ δζάζπανηεξ ηαζ υπζ ηεκηνζηά ημπμεεηδιέκεξ. Γζαπζζηχεδηε δ φπανλδ άθθμο πανάβμκηα ηδξ Dok-7, o μπμίμξ έπεζ παναηηδνζζηεί ςξ ιζα ηοηηανμπθαζιαηζηή πνςηεΐκδ δ μπμία εκενβμπμζεί ηδκ MuSK ζε ηαθθζένβεζεξ απυ ιομζςθήκεξ (myotubes) ηαζ μ μπμίμξ είκαζ απαναίηδημξ βζα ημκ ζπδιαηζζιυ ηδξ κεονμιοσηήξ ζφκαρδξ in vivo. Ζ ζςζηή κεονμιοσηή ζοκαπημβέκεζδ απαζηεί ηδκ έηθναζδ ηδξ Dok-7 ζημ ζηεθεηζηυ ιο ηαζ δ δοζθεζημονβία ηδξ Dok-7 ειπθέηεηαζ ζηδκ παεμβέκεζα ηςκ δζαηαναπχκ ηδξ NMJ (Motomura et al., 2008). Ζ Dok-7 εκενβμπμζεί ηδκ MuSK ζοιιεηέπμκηαξ ζημ ζπδιαηζζιυ ηδξ κεονμιοσηήξ ζφκαρδξ. Μεηαθθάλεζξ ζημ Dok-7 βμκίδζμ είκαζ δ αζηία εκυξ άθθμο ηφπμο ιοαζεεκζημφ ζοκδνυιμο (Synaptopathy - Limp Gridle), ημ μπμίμ παναηηδνίγεηαζ απυ ιζηνέξ ηαζ απθμπμζδιέκεξ ζοκάρεζξ. Ζ αβνίκδ απαζηεί ηδκ έηθναζδ ηδξ Dok-7 βζα ηδκ εκενβμπμίδζδ ηδξ MuSK. Ζ Dok-7 αθθδθεπζδνά ιε ηδκ ηοηηανμπθαζιαηζηή πενζμπή ηδξ MuSK εκενβμπμζχκηαξ ηδκ ηζκάζδ ηδξ ηονμζίκδξ. Ζ Dok-7 είκαζ απαναίηδηδ βζα κα ημκ εκημπζζιυ ηδξ έηθναζδξ ηδξ MuSK ηαζ ηςκ AChR οπμδμπέςκ ζηδκ ηεκηνζηή πενζμπή ημο ιο, πνάβια ημ μπμίμ είκαζ μοζζαζηζηυ βζα ημ ζςζηυ ζπδιαηζζιυ ηδξ κεονμιοσηήξ ζφκαρδξ (Motomura et al., 2008). Πανά ηδκ απμοζία ακηί-αchr ακηζζςιάηςκ, δ MuSK-MG παναηηδνίγεηαζ ζοπκά απυ ιέηνζα έςξ ζμαανά ζοιπηχιαηα MG. Οζ αζεεκείξ ιε MuSK-MG πανμοζζάγμοκ ηονίςξ ηα αμθαζηά ηαζ μθεαθιζηά ζοιπηχιαηα, ηδ δοζθαβία ηαζ ηδ δοζανενία, ηαζ ζοιπηχιαηα ζημοξ ιοξ ημο πνμζχπμο ηαζ επζδεζηκφμοκ πενζμνζζιέκδ παεμθμβία ημο εφιμο, ζοπκυηενεξ ακαπκεοζηζηέξ ηνίζεζξ, ηαζ θζβυηενμ ζηακμπμζδηζηή απάκηδζδ ζηδκ ακμζμηαηαζηαθηζηή εεναπεία απυ ημοξ MG αζεεκείξ ιε ακηί-αchr ακηζζχιαηα. 37

38 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Δηθόλα 4. Δλεξγνπνίεζε ηεο ΜuSK νδεγεί ζηελ ζπζζσκάησζε ησλ ππνδνρέσλ ηεο αθεηπινρνιίλεο πδιαηζηή ακαπανάζηαζδ ηςκ ζδιαημδμηζηχκ ιμκμπαηζχκ ηα μπμία μδδβμφκ ζηδκ ζοζζςιάηςζδ ηαζ ηδκ ζηαεενμπμίδζδ ηςκ AChR. Ζ απεθεοεένςζδ ηδξ αβνίκδξ απυ ηδκ κεονζηή απυθδλδ εκενβμπμζεί ημ ζφιπθεβια Lrp4/MuSK ηαζ μδδβεί ζηδκ θςζθμνοθίςζδ ηδξ MuSK, ημ μπμίμ ζηδκ ζοκέπεζα εκενβμπμζεί πμθθαπθά ζδιαημδμηζηά ιμκμπάηζα έηθναζδξ ιζαξ ζεζνάξ βμκζδίςκ, ηα μπμία επάβμοκ ηδκ ζοζζςιάηςζδ ηςκ οπμδμπέςκ ηδξ αηεηοθμπμθίκδξ. Πνμζανιμζιέκμ απυ: Strochlic L., Bioassays, 2005 and LiZhou, The Journal of Lipid Research, 50, S287-S292, April Γνκή ηεο MuSK Σμ βμκίδζμ ηδξ MuSK ημο πμκηζηζμφ απμηεθείηαζ ημοθάπζζημκ απυ 15 ελχκζα δζάζπανηα πάκς απυ 90 kb ζημ πνςιυζςια 4 (Valenzuela, 1995). Ζ πανμοζία πμθθαπθχκ ηυπςκ έκανλδξ ηδξ ιεηαβναθήξ, ηαεχξ ηαζ δζαθμνεηζηχκ νοειζζηζηχκ αθθδθμοπζχκ ζημκ οπμηζκδηή ηδξ MuSK πνμτπμεέηεζ ηδ δοκαηυηδηα εθέβπμο έηθναζδξ ηδξ MuSK ιε δζάθμνα νοειζζηζηά ζοζηήιαηα. Σμ MuSK mrna οθίζηαηαζ εκαθθαηηζηή ζονναθή (splicing). Καηά ζοκέπεζα, ηα 38

39 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ δζάθμνα cdnas πμο έπμοκ απμιμκςεεί ηςδζημπμζμφκ εθαθνχξ δζαθμνεηζηέξ εηδυζεζξ ηδξ ελςηοηηανζηήξ πενζμπήξ ηδξ MuSK. Οζ δζάθμνεξ εηδυζεζξ (splices) δζαθένμοκ απυ ηδκ πανμοζία ή ηδκ απμοζία εκυξ, δφμ ή ηνζχκ δζαθμνεηζηχκ εκεέζεςκ (πνμζεήηδ 10, 15, 8 αιζκμλέςκ) ζηδκ ελςηοηηανζηή πενζμπή. Ζ εηθναζιέκδ MuSK απμηεθείηαζ απυ 860 έςξ 893 αιζκμλέα, ιε πνμαθεπυιεκμ (ηαηά ζζμημπζηυ ιέζμ υνμ) ιμνζαηυ αάνμξ 95,6-99,6 kda, ακάθμβα ιε ηδκ εκαθθαηηζηή παναθθαβή. Αοηυ πενζθαιαάκεζ έκα πεπηίδζμ μδδβυ (signal peptide), ιζα ελςηοηηανζηή, ιία δζαιειανακζηή ηαζ ιζα ηοηηανμπθαζιαηζηή πενζμπή. Σμ ελςηοηηανζηυ ηιήια ηδξ MuSK απμηεθείηαζ απυ ηέζζενεζξ πενζμπέξ ηφπμο-ακμζμζθαζνίκδξ (Ig-like), ιε έκα ημοηί C6 (πενζμπή ιε έλζ θοθμβεκεηζηά ζοκηδνδιέκα ηαηάθμζπα ηοζηεΐκδξ) ιεηαλφ ηδξ ηνίηδξ ηαζ ηδξ ηέηανηδξ Ig πενζμπήξ. Σμ εζςηοηηανζηυ ηιήια ηδξ MuSK απμηεθείηαζ απυ 12 οπμπενζμπέξ, μζ μπμίεξ είκαζ παναηηδνζζηζηέξ ηδξ θεζημονβζηήξ ηζκάζδξ ηδξ ηονμζίκδξ. Δηθόλα 5. Γνκή θαη νξγάλσζε ηνπ εμώληνπ ηεο κπτθήο θηλάζεο (MuSK) SS - δ αημθμοεία ημο πεπηζδίμο ζήιαημξ; Ig I-IV πενζμπέξ ηφπμο-ακμζμζθαζνίκδξ; C6 ημοηί - 6 ζοκηδνδιέκα ηαηάθμζπα ηοζηεΐκδξ (frizzled domain); CRD πενζμπή πθμφζζα ζε ηοζηεΐκδ; Y - juxtamembrane ηαηάθμζπα ηονμζίκδξ; TKD - ημιέαξ ηονμζίκδξ ηζκάζδξ, NMTNAT - δφμ πζεακέξ εέζεζξ Ν-βθοημγοθίςζδξ. 39

40 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ 1.8 Φπζηνινγία ηεο λεπξνκπτθήο ζύλαςεο - Παζνθπζηνινγία ηεο MG Ζ παεμθοζζμθμβία ηδξ αανζάξ ιοαζεέκεζαξ ηαζ ηςκ ζοββεκχκ δζαηαναπχκ ηδξ κεονμιοσηήξ ζφκαρδξ, αθμνά ζηδκ πνμζοκαπηζηή κεονζηή απυθδλδ ηαζ ηζξ εζδζηέξ δμιέξ ηδξ ιεηαζοκαπηζηήξ ιειανάκδξ ηςκ βναιιςηχκ ιοσηχκ ηοηηάνςκ. Καεχξ ημ ηζκδηζηυ κεφνμ πνμζεββίγεζ έκα ιο, δζαηθαδίγεηαζ ηαζ κεονχκεζ πμθθέξ ιοσηέξ ίκεξ, δίκμκηαξ ιζα ιμκήνδ αιφεθδ κεονζηή απυθδλδ ζε ηάεε ιία απυ ηζξ ίκεξ. Ζ κεονμιοσηή ζφκαρδ (NMJ) είκαζ ιία ελεζδζηεοιέκδ ζφκαρδ, δ μπμία δζααζαάγεζ κεονζηά ενεείζιαηα απυ ηδ κεονζηή απυθδλδ ζημκ ιο, ιέζς ημο πδιζημφ δζααζααζηή αηεηοθμπμθίκδ (ACh). Ζ ACh είκαζ απμεδηεοιέκδ ζε ηοζηίδζα ζηζξ ηεθζηέξ κεονζηέξ απμθήλεζξ ηαζ απεθεοεενχκεηαζ απυ ηα ηοζηίδζα αοηά ιεηά ηδκ εηπυθςζδ (depolarization) ηδξ κεονζηήξ απυθδλδξ. Αοηά ηα ηοζηίδζα εκημπίγμκηαζ ημκηά ζηζξ εέζεζξ απεθεοεένςζδξ πμο ηαθμφκηαζ «εκενβείξ γχκεξ», υπμο μζ δίαοθμζ αζαεζηίμο δζαηάζζμκηαζ ζε πανάθθδθεξ δζπθέξ ζεζνέξ. ηακ έκα δοκαιζηυ εκενβείαξ θεάκεζ ζηδκ κεονζηή απυθδλδ, δίαοθμζ αζαεζηίμο P/Q-ηφπμο εκενβμπμζμφκηαζ, ημ αζαέζηζμ θεάκεζ ζηδκ πνμζοκαπηζηή ηεθζηή πενζμπή ηαζ δ ημπζηή ζοβηέκηνςζδ αζαεζηίμο αολάκεζ ζδιακηζηά, πονμδμηχκηαξ ηα ηοζηίδζα κα απεθεοεενχζμοκ ημ πενζεπυιεκυ ημοξ (Hughes et al., 2004). Κάεε ζοκαπηζηυ ηοζηίδζμ απεθεοεενχκεζ πενίπμο ιυνζα ACh ζηδκ ζοκαπηζηή ζπζζιή. Πανάθθδθα ιε ηδκ απεθεοεένςζδ ηδξ ACh απεθεοεενχκεηαζ ηαζ ΑΣΡ απυ ηα ζοκαπηζηά ηοζηίδζα ημ μπμίμ ηαζ επδνεάγεζ ηδκ απεθεοεένςζδ ηδξ ACh. Ζ άθζλδ ημο δοκαιζημφ εκενβείαξ μδδβεί ζηδκ έηθοζδ ζοκαπηζηχκ ηοζηζδίςκ αηεηοθμπμθίκδξ. Ακάιεζα ζημ κεφνμ ηαζ ηδκ ιοσηή ηοηηανμπθαζιαηζηή ιειανάκδ οπάνπεζ έκαξ πχνμξ πενίπμο 50nm πμο ηαθείηαζ «ζοκαπηζηή ζπζζιή». Ζ εκδμηοηηάνζα μοζία ηδξ ζοκαπηζηήξ ζπζζιήξ είκαζ ιία ζφκεεηδ ζοθθμβή απυ πνςηεΐκεξ μζ μπμίεξ νοειίγμοκ ηδ ζφκεεζδ ηςκ ιεηαζοκαπηζηχκ πνςηεσκχκ ηαζ ηδ ζοβηέκηνςζδ ηδξ αηεηοθμπμθζκεζηενάζδξ (Hughes et al., 2004). Δίκαζ ειπθμοηζζιέκδ ζε ημθθαβυκμ (ColQ) ηαζ πενζέπεζ δζάθμνεξ ιμνθέξ θαιζκίκδξ, μζ μπμίεξ ζοκδέμκηαζ υθεξ ιε ηδκ α-δοζηνμβθοηάκδ ζηδκ ιεηαζοκαπηζηή ιειανάκδ. Οζ θαιζκίκεξ ζπδιαηίγμοκ έκακ ζηεθεηυ (network) ζημ ζοκαπηζηυ πχνμ, μ μπμίμξ ηαηαηναηεί άθθεξ πνςηεΐκεξ ηδξ ελςηοηηάνζαξ μοζίαξ. Ζ αηεηοθμπμθίκδ δζαπέεηαζ ηαπέςξ ηαηά ιήημξ ηδξ ζοκαπηζηήξ ζπζζιήξ. Ζ ζοβηέκηνςζδ ηδξ αηεηοθμπμθζκεζηενάζδξ ακένπεηαζ ζε

41 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ιυνζα/ιm ηδξ ιεηαζοκαπηζηήξ ιειανάκδξ. Ζ αηεηοθμπμθζκεζηενάζδ ζοβηεκηνχκεηαζ ζηδ ααζζηή ζημζαάδα ηδξ ιεηαζοκαπηζηήξ ιειανάκδξ ηαζ δ οδνυθοζδ πμο πνμηαθεί ζηδκ ACh ηαεχξ ηαζ δ δζάποζδ ηδξ ACh έλς απυ ηδκ ζοκαπηζηή ζπζζιή, μδδβεί ζε ηαπεία εθάηηςζδ ηδξ ζοβηέκηνςζδξ ACh. Αοηυ ειπμδίγεζ ηδκ εκενβμπμίδζδ ημο οπμδμπέα αηεηοθμπμθίκδξ (AChR) πενζζζυηενμ απυ ιία θμνά, ςξ απάκηδζδ ζηδκ ACh ηαζ ηδκ έηθοζδ ημο δοκαιζημφ εκενβείαξ ηδξ κεονζηήξ ίκαξ ζηδκ ηεθζηή ηζκδηζηή πθάηα. Ζ απεκενβμπμίδζδ ηδξ πμθζκεζηενάζδξ παναηείκεζ ηδκ πνμκζηή δζάνηεζα ηδξ δνάζεςξ ηδξ ACh. Οζ ακαζημθείξ ηδξ αηεηοθμπμθζκεζηενάζδξ, υπςξ δ πονζδμζηζβιίκδ ηαζ ημ εδνμθχκζμ, επζιδηφκμοκ ηδ δζάνηεζα ηδξ δνάζδξ ηδξ ACh ζηδκ ιεηαζοκαπηζηή ιειανάκδ. ε δζαηαναπέξ ηδξ κεονμιοσηήξ δζααίααζδξ υπμο δ αθάαδ ανίζηεηαζ ζηδ ιεηαζοκαπηζηή πενζμπή, δ ακαζημθή ηδξ αηεηοθμπμθζκεζηενάζδξ επαολάκεζ ηδ δνάζδ ηδξ ACh ηαζ επάβεζ ηδκ επίηεολδ εκυξ ηέημζμο δοκαιζημφ ηεθζηήξ ηζκδηζηήξ πθάηαξ, ημ μπμίμ εα μδδβήζεζ ζε βεκζηεοιέκμ ιοσηυ δοκαιζηυ. Σα ηφηηανα Schwann ηα μπμία πενζαάθθμοκ ηδκ ηεθζηή κεονζηή απυθδλδ, έπεζ ανεεεί υηζ εηηνίκμοκ ιία πνςηεΐκδ πμο δεζιεφεζ ηδκ ACh, βεβμκυξ πμο ιπμνεί κα ιεζχζεζ ηδ ζοβηέκηνςζδ ηδξ ACh ζηδ ζοκαπηζηή ζπζζιή ηαζ κα δζαδναιαηίζεζ νυθμ ζηδκ ηνμπμπμίδζδ ηδξ κεονμιοσηήξ δζααίααζδξ (Hughes et al., 2004). Αθμφ δ ACh δζαζπίζεζ ηδ ζοκαπηζηή ζπζζιή, δεζιεφεηαζ ζημοξ AChR πμο ζοβηεκηνχκμκηαζ απέκακηζ απυ ηζξ «εκενβείξ γχκεξ» ηδξ κεονζηήξ απυθδλδξ (Hughes et al., 2004). Ζ ιζηνμζημπζηή δμιή ηδξ ιεηαζοκαπηζηήξ ιειανάκδξ ηαηά ηδκ ελέηαζή ηδξ ιε ημ δθεηηνμκζηυ ιζηνμζηυπζμ είκαζ εκδζαθένμοζα, πανμοζζάγεζ ζοβηεηνζιέκα πηοπέξ πμο έπμοκ εφνμξ πενίπμο 50nm. Αοηέξ μζ πνςημβεκείξ πηοπέξ ειθακίγμοκ δεοηενμβεκείξ πηοπχζεζξ ιε απμηέθεζια κα αολάκεηαζ δ επζθάκεζα ηδξ ιεηαζοκαπηζηήξ ιειανάκδξ. Αοηέξ μζ πηοπέξ αολάκμοκ ημ ειααδυκ επζθακείαξ ηδξ ιεηαζοκαπηζηήξ ιειανάκδξ ηαζ δ ανπζηεηημκζηή ημοξ επζηνέπεζ ζηδκ εηπυθςζδ ηδξ ηεθζηήξ ηζκδηζηήξ πθάηαξ κα εζηζάγεζ ζημ αάεμξ αοηχκ. Οζ AChR ζοβηεκηνχκεηαζ ζηζξ μνμθέξ (ακχηενα ιένδ) ηςκ δεοηενμβεκχκ ζοκαπηζηχκ πηοπχκ, ηαζ εκζςιαηχκμκηαζ ζημ ζφιπθεβια πνςηεσκχκ πμο ζπεηίγμκηαζ ιε ηδ δοζηνμθίκδ, δζαιέζμο ηδξ ναρίκδξ, ιίαξ πνςηεΐκδξ πμο εκέπεηαζ ζηδκ ζοζζχνεοζδ ηςκ AChR ζηδκ NMJ ηαηά ηδ δζάνηεζα ακάπηολδξ ηδξ ζφκαρδξ. Οζ μιάδεξ ηςκ AChR ζοκδέμκηαζ ιε ζημζπεία ημο ηοηηανμζηεθεημφ ιέζς ηςκ ζοιπθεβιάηςκ πνςηεσκχκ δοζηνμβθοηάκδξ ηαζ ζανημβθοηάκδξ ηαζ ηδξ μοηνμθίκδξ (Vincent et al., 2001). αοηέξ ηζξ πηοπέξ ηδξ ιεηαζοκαπηζηήξ ιειανάκδξ 41

42 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ οπάνπμοκ ζε ορδθή ζοβηέκηνςζδ μζ AChR ( οπμδμπείξ ακά ιm) ζε ζοζζςιαηχιαηα. Ζ ζοβηέκηνςζδ ηςκ οπμδμπέςκ ιαηνζά απυ ηδκ ζφκαρδ είκαζ 1000 θμνέξ πενίπμο ιζηνυηενδ. Οζ οπμδμπείξ ηδξ αηεηοθμπμθίκδξ ειθακίγμοκ ιεβάθδ ζοβηέκηνςζδ ζηδκ ζφκαρδ δζυηζ εηεί πανάβεηαζ ηαζ mrna ημ μπμίμ είκαζ απαναίηδημ βζα ηδκ ζφκεεζδ ηςκ οπμιμκάδςκ ηςκ AChR. Οζ παθαζυηενμζ οπμδμπείξ πμο ηαηαζηνέθμκηαζ ακηζηαείζηακηαζ απυ κέμοξ πςνίξ κα ακαηοηθχκμκηαζ. Ο πνυκμξ διίζεζαξ γςήξ ηςκ οπμδμπέςκ είκαζ 11 διένεξ. Ζ δέζιεοζδ αοηή έπεζ ςξ απμηέθεζια ηδ δζάκμζλδ ημο ζμκηζημφ ηακαθζμφ ηςκ AChR ηαζ ηδκ είζμδμ ηαηζυκηςκ, ηονίςξ καηνίμο, ιέζα ζημκ ιο, βεβμκυξ πμο μδδβεί ζηδκ παναβςβή ημο δοκαιζημφ ηδξ ηεθζηήξ ηζκδηζηήξ πθάηαξ. α c d Δηθόλα 6. Hιεθηξνληθή Mηθξνζθνπία ηεο Νεπξνκπτθήο ύλαςεο (NMJ) (α) Φςημβναθία Νεονμιοσηήξ φκαρδξ (NMJ). (c) Ζθεηηνμκζηή ιζηνμβναθία ηδξ ιεηαζοκαπηζηήξ πενζμπήξ ηδξ NM υπμο θαίκεηαζ δ ακαδίπθςζδ ηδξ ιεηαζοκαπηζηήξ ιειανάκδξ ιεηά ηδκ κεονζηή απυθδλδ ζε δζάθμνεξ πηοπέξ. (b1) Ποηκά παηεηανζζιέκεξ νμγέηεξ AChR ζε πενζμπή ηδξ ιειανάκδξ πθμφζζαξ ζε οπμδμπείξ ζηα δθεηηνζηά υνβακα ημο Torpedo ηαζ εζηίαζδ ζε έκακ οπμδμπέα μ μπμίμξ ειθακίγεζ πεκηαιενή δζαιυνθςζδ. (d) Γναθζηή ακαπανάζηαζδ ηδξ κεονμιοσηήξ ζφκαρδξ (ΝΜJ). Πνμζανιμζιέκμ απυ Postsynaptic Membranes at the Neuromuscular Junction: Molecular Organisation, Cartaud J. et al, Published online: 19 APR

43 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ηδκ δζαδζηαζία ηδξ έηθοζδξ ημο δοκαιζημφ εκενβείαξ παίγεζ εκενβυ νυθμ ηαζ ημ κάηνζμ ημο μπμίμο δ ζοβηέκηνςζδ είκαζ 5-10 θμνέξ ορδθυηενδ ζηδκ ηεθζηή ηζκδηζηή πθάηα ζοβηνζηζηά ιε πενζμπέξ ιαηνάκ ηδξ ηεθζηήξ ηζκδηζηήξ πθάηαξ. Ζ ζοβηέκηνςζδ ημο καηνίμο είκαζ ιεβαθφηενδ ζηζξ δεοηενμβεκείξ πηοπέξ ηδξ ζοκαπηζηήξ ζπζζιήξ υπμο εονίζημκηαζ ηαζ μζ δίαοθμζ ημο καηνίμο. Οζ δίαοθμζ καηνίμο, ζημκ ποειέκα ηςκ ιεηαζοκαπηζηχκ πηοπχκ, ακμίβμοκ, επζηνέπμκηαξ ηδκ ιαγζηή είζμδμ πενζζζυηενςκ ζυκηςκ καηνίμο (εηπυθςζδ), ιε απμηέθεζια κα πονμδμηείηαζ δ παναβςβή ημο ηεθζημφ δοκαιζημφ εκενβείαξ ημο ιουξ ηαζ δ ζφζπαζδ αοημφ (Ruff and Lennon, 2008), (Kalamida et al., 2007). Ζ επάνηεζα ηδξ κεονμιοσηήξ ιεηααίααζδξ ελανηάηαζ απυ πμθθμφξ πανάβμκηεξ: α) ηδκ πμζυηδηα ηδξ απεθεοεενμφιεκδξ αηεηοθμπμθίκδξ α) ηδκ ποηκυηδηα ηςκ οπμδμπέςκ ηδξ αηεηοθμπμθίκδξ β) ηδκ ποηκυηδηα ηςκ δζαφθςκ ημο καηνίμο Ο πανάβςκ αζθαθείαξ SF ηδξ κεονμιοσηήξ ιεηααίααζδξ (δ ζηακυηδηα χζηε δ κεονμιοσηή δζααίααζδ κα παναιέκεζ απμηεθεζιαηζηή ηάης απυ μπμζεζδήπμηε θοζζμθμβζηέξ ζοκεήηεξ ηαζ ζε ηαηαζηάζεζξ stress) ιπμνεί κα μνζζεεί ςξ ελήξ (Wood et al., 2001): = E.P.P /EAP EM υπμο SF είκαζ μ πανάβςκ αζθαθείαξ ηδξ κεονμιοσηήξ ιεηααίααζδξ E.P.P είκαζ ημ εφνμξ ημο δοκαιζημφ ηδξ ηεθζηήξ ηζκδηζηήξ πθάηαξ EAP είκαζ δ μοδυξ ημο δοκαιζημφ εκενβείαξ EM είκαζ ημ δοκαιζηυ εκενβείαξ ηδξ ιειανάκδξ ηδκ ιοαζεέκεζα, ημ ηφνζμ έθθεζιια είκαζ απμηέθεζια ιεζςιέκδξ ακηαπυηνζζδξ ζηδκ ACh. H ηαηάζηαζδ αοηή είκαζ ζοκέπεζα ηδξ αοημάκμζδξ επίεεζδξ ηαηά ημο AChR ηαζ πνμηαθεί ιείςζδ ηδξ ιεηαζοκαπηζηήξ εοαζζεδζίαξ ζηδκ ACh. Αοηυ μοζζαζηζηά είκαζ απμηέθεζια απχθεζαξ οπμδμπέςκ ηδξ ACh ιε ζφβπνμκδ απχθεζα ηςκ δζαφθςκ ημο καηνίμο θυβς ηαηαζηνμθήξ ηςκ ζοκαπηζηχκ πηοπχκ απυ ηδκ αοημάκμζδ δζενβαζία (Hughes et al., 2004; Kalamida et al., 2007). 43

44 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ 1.9 Παζνγέλεηα ηεο MG Απηναλνζία - Αλνζνηξνπνπνηεηηθνί κεραληζκνί Ζ ιοαζεέκεζα πθδνεί ηα ηνζηήνζα ηα μπμία μνίγμοκ ηζξ δζα ακηζζχιαημξ ιεζμθααμφιεκεξ αοημάκμζεξ δζαηαναπέξ: 1) ακηζζχιαηα εκακηίμκ ηςκ AChR ακζπκεφμκηαζ ζημ 80-90% ηςκ αζεεκχκ (Drachman, 1994), 2) οπάνπεζ εκαπυεεζδ ακμζμζθαζνίκδξ-g (IgG) ζηδ κεονμιοσηή ζφκαρδ, πμο είκαζ δ πενζμπή πμο πνμζαάθθεηαζ ζηδ ιοαζεέκεζα (Engel et al., 1977), 3) δ πμνήβδζδ IgG απυ αζεεκείξ ιε ιοαζεέκεζα ζε πεζναιαηυγςα, ακαπανάβεζ ηζξ παναηηδνζζηζηέξ ηθζκζηέξ εηδδθχζεζξ ηδξ κυζμο (Toyka et al., 1977), 4) εεναπείεξ μζ μπμίεξ εθαηηχκμοκ ηδ ζοβηέκηνςζδ ζημκ μνυ ηςκ ακηί-achr ακηζζςιάηςκ, αεθηζχκμοκ ηδ ιοσηή αδοκαιία (Pinching and Peters, 1976) ηαζ 5) ιοαζεέκεζα επάβεηαζ ζε γχα ιεηά απυ ακμζμπμίδζδ ιε απμιμκςιέκμ AChR, βεβμκυξ ημ μπμίμ οπμζηδνίγεζ επίζδξ ηδκ άπμρδ υηζ ιζα ακμζμθμβζηή ακηίδναζδ πμο ηαηεοεφκεηαζ εκακηίμκ ημο AChR εοεφκεηαζ βζα ηδ κυζμ (Hughes et al., 2004). Σα ακηζζχιαηα εκακηίμκ ηςκ AChR είκαζ πμθοηθςκζηά ηαζ ακαβκςνίγμοκ έκα εηενμβεκέξ νεπενηυνζμ επζηυπςκ, ημ μπμίμ πμζηίθεζ ιεηαλφ ηςκ αζεεκχκ (Conti-Fine et al., 2006; Lindstrom, 2003). Ζ πνυζδεζδ ηςκ αοημακηζζςιάηςκ ζημκ AChR μδδβεί ζε απχθεζα ηςκ θεζημονβζηά δζαεέζζιςκ οπμδμπέςκ ζηδκ κεονμιοσηή ζφκαρδ ιέζς ηνζχκ ιδπακζζιχκ. α) Λεηηνπξγηθή παξεκπόδηζε. Έκα ιζηνυ ηθάζια ηςκ ακηζζςιάηςκ εκακηίμκ ηςκ AChR πνμζδέκμκηαζ ημκηά ή ηαζ πάκς ζηδ εέζδ πνυζδεζδξ ηδξ αηεηοθμπμθίκδξ, πανειπμδίγμκηαξ ηδκ εκενβμπμίδζδ ηαζ ηδκ θεζημονβία ημο οπμδμπέα. Γεκζηά, εεςνείηαζ υηζ ζηδκ παεμβέκεζα ηδξ ιοαζεέκεζαξ, δεκ ζοκεζζθένεζ ζδιακηζηά δ απεοεείαξ, άιεζδ, επίδναζδ ηςκ ακηζζςιάηςκ ζηδ θεζημονβία ηςκ AChR, αθθά μνζζιέκμζ αζεεκείξ έπμοκ ηαζ ηέημζα ακηζζχιαηα. Σα ακηζζχιαηα αοηά ιπμνμφκ κα ζοκεζζθένμοκ ζηδκ ιοαζεεκζηή αδοκαιία ηαζ εα ιπμνμφζακ κα πνμηαθέζμοκ μλεία ιοαζεεκζηή ηνίζδ. ε γχα επάβμοκ ηδκ ειθάκζζδ ιίαξ ιμκαδζηήξ ιμνθήξ ζμαανήξ πεζναιαηζηήξ αοημάκμζδξ ιοαζεέκεζαξ (Hughes et al., 2004). Σα πζμ παεμβυκα ακηζζχιαηα εκακηίμκ ηςκ AChR πνμζδέκμκηαζ ζε έκα ελςηοηηάνζμ ηιήια ηδξ α-οπμιμκάδαξ ημο οπμδμπέα πμο ηαθείηαζ MIR (Main Immunogenic Region-MIR) 44

45 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ (Tzartos et al., 1991). Μζα ζεζνά απυ πεζναιαηζηυ δεδμιέκα οπμζηδνίγμοκ ημκ ηεκηνζηυ νυθμ ηδξ MIR. Ζ MIR πενζμπή, είκαζ δζαθμνεηζηή απυ ηδ εέζδ πνυζδεζδξ ηδξ αηεηοθμπμθίκδξ ηαζ δεκ ειπθέηεηαζ ζηδ θεζημονβία ημο ζμκζημφ ηακαθζμφ. Σμ ηφνζμ ηιήια ηδξ εηηείκεηαζ ιεηαλφ ηςκ αιζκμλζηχκ ηαηαθμίπςκ 67 ηαζ 76 ηδξ α-οπμιμκάδαξ ημο οπμδμπέα. Πνυηεζηαζ βζα ιζα θοθμβεκεηζηά ζοκηδνδιέκδ πενζμπή πμο πνμαάθεζ ζηδκ ημνοθή ημο ιμνίμο ηαζ ίζςξ ζπδιαηίγεζ έκα εοηίκδημ ηιήια πμο εφημθα πνμζεββίγεηαζ απυ ηα άκμζμ-εζδζηά ηφηηανα, βεβμκυξ πμο ελδβεί ηδκ ζζπονή ακηζβμκζηυηδηα ηδξ. Ακ ηαζ δ MIR είκαζ εκημπζζιέκδ ζε ιία ιζηνή πενζμπή, θαίκεηαζ υηζ απμηεθείηαζ απυ αθθδθεπζηαθοπηυιεκμοξ ακηζβμκζημφξ επίημπμοξ, υπςξ ζοιπεναίκεηαζ απυ ηδκ εηενμβέκεζα πμο έπμοκ ηα ακηί-mir ακηζζχιαηα ηαζ απυ ηδ ιζηνή έηηαζδ δζαζηαονςηχκ ακηζδνάζεςκ ιε ακηί-σδζμηοπζηά ακηζζχιαηα (Tzartos and Remoundos, 1992). β) Γξάζε ηνπ ζπκπιεξώκαηνο. Ζ πνυζδεζδ ημο ζοιπθδνχιαημξ ζημ ζφιπθμημ AChR ακηίζςια, εκενβμπμζεί ημ ιμκμπάηζ ημο ζοιπθδνχιαημξ ημ μπμίμ ηαηαθήβεζ ζημ ζπδιαηζζιυ ημο ζοιπθέβιαημξ επίεεζδξ εκακηίμκ ηδξ ηοηηανζηήξ ιειανάκδξ (Membrane Attack Complex-MAC) ηαζ επζθένεζ ημπζηή θφζδ ηαζ ηαηαζηνμθή ηδξ ιοσηήξ ιειανάκδξ πμο πενζέπεζ ημοξ AChR (Conti-Fine et al., 2006). Έπεζ δζαπζζηςεεί πανμοζία C3 ηαζ C9 παναβυκηςκ ζοιπθδνχιαημξ ζε εναφζιαηα ιειανάκδξ ιε δθεηηνμκζηή ιζηνμζημπία (Hughes et al., 2004). Ο πζμ ζδιακηζηυξ ιδπακζζιυξ αθάαδξ ηδξ κεονμιοσηήξ ιεηααίααζδξ είκαζ δ δζα ακηζζχιαημξ ιεζμθααμφιεκδ εκενβμπμίδζδ ημο ζοιπθδνχιαημξ, ηαζ αοηυ οπμζηδνίγεηαζ απυ ανηεηέξ πεζναιαηζηέξ ιεθέηεξ (Conti-Fine et al., 2006). γ) Αληηγνληθή ηξνπνπνίεζε. Σα αοημακηζζχιαηα επεζδή είκαζ δζζεεκή, ζοκδέμοκ βεζημκζημφξ AChRs ζηδκ επζθάκεζα ημο ηοηηάνμο, ιε απμηέθεζια ηδκ αφλδζδ ημο νοειμφ εκδμηοηηάνςζδξ ημοξ, ηαηά 2-3 θμνέξ. Καηά ηδκ εκδμηοηηάνςζδ ζπδιαηίγμκηαζ αααεείξ εβημθπχζεζξ πμο ηθείκμοκ ιε ηδ δδιζμονβία αζηζδίςκ ηαζ ηαηαθήβμοκ ζηα θοζμζχιαηα. Αημθμοεεί εκγοιζηή απμδυιδζδ ηςκ AChR. Σα ακηί-mir ιμκμηθςκζηά ακηζζχιαηα είκαζ πμθφ απμηεθεζιαηζηά ζηδκ επζηάποκζδ ηδξ ηαηαζηνμθήξ ηςκ οπμδμπέςκ ιέζς ημο ιδπακζζιμφ ηδξ ακηζβμκζηήξ ηνμπμπμίδζδξ ζε ηαθθζένβεζεξ ιοσηχκ ηοηηάνςκ (Tzartos et al., 1986), ηαεχξ ηαζ ζηδκ πνυηθδζδ ακηζβμκζηήξ ηνμπμπμίδζδξ in vivo (Loutrari et al., 1992). 45

46 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Δηθόλα 7. Mεραληζκνί δξάζεο ησλ αληηζσκάησλ έλαληη ηνπ ππνδνρέα ηεο αθεηπινρνιίλεο α. Άιεζδ πανειπυδζζδ ηδξ θεζημονβίαξ ημο οπμδμπέα ηδξ αηεηοθμπμθίκδξ. β. Λφζδ ηδξ ιεηαζοκαπηζηήξ ιειανάκδξ ιέζς ηδξ δνάζδξ ημο ζοιπθδνχιαημξ. Ακηζζχιαηα πμο πνμζδέκμκηαζ ζημκ AChR εκενβμπμζμφκ ηζξ πνςηεΐκεξ ημο ζοιπθδνχιαημξ, ζπδιαηίγμκηαξ ημ ηφνζμ ζφιπθμημ επίεεζδξ ημο ζοιπθδνχιαημξ (MAC, Major Attack Complex) ιε ηεθζηυ απμηέθεζια ηδκ ηαηαζηνμθή ηδξ ιεηαζοκαπηζηήξ ιειανάκδξ. γ. Ακηζβμκζηή ηνμπμπμίδζδ ιε δζαζφκδεζδ ηςκ οπμδμπέςκ ηαζ εκδμηοηηάνςζδ. Tα ιμκμηθςκζηά ακηζζχιαηα έπμοκ ηδκ ζηακυηδηα κα εκενβμπμζμφκ ημ ζοιπθήνςια in vivo ηαζ in vitro. Δίκαζ επίζδξ απμηεθεζιαηζηά ζηδ ιεηαθμνά ηδξ πεζναιαηζηήξ ιοαζεέκεζαξ ζε επίιοεξ. Σέθμξ, ηα δζζεεκή F(ab ) 2 εναφζιαηα ηςκ ακηί-mir ιμκμηθςκζηχκ ακηζζςιάηςκ δζαηδνμφκ ηδκ ζηακυηδηα πνυηθδζδξ ακηζβμκζηήξ ηνμπμπμίδζδξ (Loutrari et al., 1992). Ακηίεεηα απυ ηα δζζεεκή ακηί-mir ιμκμηθςκζηά, ηα ιμκμζεεκή Fab εναφζιαηά ημοξ δεκ πνμηαθμφκ ηαηαζηνμθή ηςκ AChR ζε ηοηηανμηαθθζένβεζεξ, μφηε πνμηαθμφκ ιοαζεέκεζα ζε πεζναιαηυγςα, πνμθακχξ επεζδή δεκ δζαζοκδέμοκ ημοξ AChR ηαζ δεκ πνμζδέκμοκ ημ 46

47 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ζοιπθήνςια. Ακηίεεηα, ηα Fab αοηά υηακ δμεμφκ ζε ηαθθζένβεζεξ ιοσηχκ ηοηηάνςκ πνμζδέκμκηαζ ζημοξ AChR ηαζ ημοξ πνμζηαηεφμοκ απυ ηδκ απμζημδμιδηζηή δνάζδ ηςκ ιεηέπεζηα πνμζηζεέιεκςκ μνχκ απυ ιοαζεεκζημφξ αζεεκείξ (Loutrari et al., 1992). Οζ παναηδνήζεζξ αοηέξ δείπκμοκ υηζ ηα ακηί-mir ακηζζχιαηα ηςκ αζεεκχκ ιε ιοαζεέκεζα, (δδθαδή αοηά πμο πανειπμδίγμκηαζ κα πνμζδεεμφκ ζηδκ AChR), είκαζ ημ ηονίςξ παεμβυκμ ηθάζια ηςκ ακηζζςιάηςκ εκακηίμκ ηςκ AChR. Δίκαζ πθέμκ ζαθέξ υηζ δ ιοαζεέκεζα μθείθεηαζ ζε ακηζζχιαηα ηα μπμία πνμζδέκμκηαζ ζημκ ιοσηυ AChR ηαζ ημκ ελαθακίγμοκ ή ημκ αδνακμπμζμφκ (Lindstrom et al., 1998). Σμ αίηζμ πμο πνμηαθεί ηαζ ζοκηδνεί ηδκ ακμζμθμβζηή απάκηδζδ ηαηά ημο AChR ζηδ ιοαζεέκεζα είκαζ άβκςζημ. Πζεακά οπάνπμοκ πμθθαπθμί ιδπακζζιμί ζε δζάθμνεξ μιάδεξ αζεεκχκ ιε ηεθζηή ημζκή ηαηάθδλδ ηδκ αοημάκμζδ απάκηδζδ (Drachman et al., 1998). Ζ αολδιέκδ ζοπκυηδηα ζοβηεηνζιέκςκ δεζηηχκ ακηζβυκςκ ζζημζοιααηυηδηαξ υπςξ είκαζ μζ Β8 ηαζ DR3 ζε μιάδεξ αζεεκχκ ιε ιοαζεέκεζα, οπμδεζηκφεζ υηζ άημια ιε μνζζιέκα βμκίδζα ακμζμαπάκηδζδξ είκαζ πζμ εοπαεή ζηδ κυζμ. Ζ βεκεηζηή αοηή πνμδζάεεζδ δεκ είκαζ απυθοηδ ηαεχξ έκαξ ανζειυξ αβκχζηςκ πενζααθθμκημθμβζηχκ παναβυκηςκ παίγεζ ζδιακηζηυ νυθμ ζηδκ πονμδυηδζδ ηδξ ακμζμαπάκηδζδξ. Δίκαζ βκςζηυ υηζ δ παναβςβή ηςκ ακηζζςιάηςκ εκακηίμκ ηςκ AChR ζηδ ιοαζεέκεζα, είκαζ ελανηχιεκδ απυ ηα Σ-θειθμηφηηανα. Γζα ηδκ εκενβμπμίδζδ ηςκ Σ- θειθμηοηηάνςκ απαζηείηαζ ακαβκχνζζδ ημο ζοιπθυημο MHC-ακηζβυκμο απυ ημκ οπμδμπέα ηςκ Σ-θειθμηοηηάνςκ (ηαεμνζγυιεκδ απυ ημ MHC ακαβκχνζζδ ακηζβυκμο). Ζ εκενβμπμίδζδ ηςκ Σ-θειθμηοηηάνςκ επζηοβπάκεηαζ είηε ιέζς ηςκ ζοιααηζηχκ ιαηνμθάβςκ (δεκδνζηζηχκ ηοηηάνςκ) είηε ιέζς ηςκ εζδζηχκ βζα ημκ AChR Β-θειθμηοηηάνςκ, πμο θένμοκ ζηδκ επζθάκεζά ημοξ ηα ακηζζχιαηα εκάκηζα ζημοξ AChR. Καζ ζηζξ δφμ πενζπηχζεζξ έπμοιε εκδμηοηηάνςζδ ημο AChR, πέρδ, επελενβαζία ηαζ πανμοζίαζδ ηςκ πεπηζδίςκ ημο ζηα Σ-θειθμηφηηανα. Σα εκενβμπμζδιέκα Σ-θειθμηφηηανα εηηνίκμοκ αολδηζημφξ πανάβμκηεξ ηαζ πανάβμκηεξ δζαθμνμπμίδζδξ βζα ηα Β-θειθμηφηηανα. Αοημί δνμοκ ηονίςξ ζηα ακηί-achr Β-θειθμηφηηανα, υπζ ιε εζδζηυ ηνυπμ, αθθά ιάθθμκ επεζδή ηα ηεθεοηαία ανίζημκηαζ ζε επαθή ιε ηα Σ-θειθμηφηηανα, εκχ ηα ιδ εζδζηά Β-θειθμηφηηανα είκαζ απμιαηνοζιέκα. Οζ πενζζζυηενεξ εέζεζξ πνυζδεζδξ ηςκ Σ-θειθμηοηηάνςκ επί ημο AChR είκαζ δζαθμνεηζηέξ απυ αοηέξ ηςκ Β-θειθμηοηηάνςκ. Μεηαλφ ηςκ εζδζηχκ βζα ημκ AChR Σ - θειθμηοηηάνςκ, ηα πζμ απμηεθεζιαηζηά είκαζ εηείκα έκακηζ ηδξ α οπμιμκάδαξ ημο AChR. 47

48 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Γοζηοπχξ, θαίκεηαζ υηζ οπάνπεζ ιεβάθδ εηενμβέκεζα ζημοξ επίημπμοξ ημο AChR βζα ηα Σ- θειθμηφηηανα, βεβμκυξ πμο δδιζμονβεί ζμαανά ειπυδζα ζημκ ζπεδζαζιυ εζδζηχκ εεναπεοηζηχκ πνμζεββίζεςκ (Drachman et al., 1998). ημκ μνυ αζεεκχκ ιε ιοαζεέκεζα έπμοκ ανεεεί επίζδξ ηαζ ακηζζχιαηα εκακηίμκ ηαζ άθθςκ πνςηεσκχκ ηςκ ζηεθεηζηχκ ιοχκ υπςξ ηδξ ηζηίκδξ, ημο οπμδμπέα ηδξ νοακμδίκδξ, ηδξ ιομζίκδξ, ηνμπμιομζίκδξ, ηνμπμκίκδξ, α-αηηζκίκδξ ηαζ αηηίκδξ (Aarli et al., 1990; Skeie et al., 1998; Skeie et al., 1995). Ζ αζηζμπαεμβεκεηζηή ζδιαζία αοηχκ ηςκ ακηζζςιάηςκ δεκ είκαζ βκςζηή (Hughes et al., 2004). Οζ αζεεκείξ πμο έπμοκ ιεβαθφηενδ δθζηία ηαηά ηδκ έκανλδ ηδξ κυζμο, ειθακίγμοκ ζοπκυηενα ακηζζχιαηα εκακηίμκ ηδξ δμιζηήξ πνςηεΐκδξ ηζηίκδξ ηαζ δ κυζμξ είκαζ ζοκήεςξ αανφηενδ (Skeie et al., 1995). Οζ αζεεκείξ ιε εφιςια ηείκμοκ κα είκαζ εεηζημί υπζ ιυκμ βζα ακηζζχιαηα εκακηίμκ ηδξ ηζηίκδξ, αθθά ηαζ βζα ακηζζχιαηα εκακηίμκ ημο οπμδμπέα ηδξ νοακμδίκδξ. Σέημζμζ αζεεκείξ έπεζ ανεεεί κα ειθακίγμοκ ζοκμδυ ιομηανδίηζδα ή ιομζίηζδα (Mygland et al., 2000). Πενίπμο 10-20% ηςκ αζεεκχκ ιε βεκζηεοιέκδ ιοαζεέκεζα είκαζ ανκδηζημί βζα ακηζζχιαηα εκακηίμκ ημο AChR ηαζ έπεζ πνυζθαηα ανεεεί υηζ πμζμζηυ πενίπμο 40-70% απυ αοημφξ ημοξ αζεεκείξ έπμοκ αοημακηζζχιαηα εκακηίμκ ηδξ πνςηεΐκδξ MuSK (muscle-specific-kinase) (Hoch et al., 2001; Vincent et al., 2003b). πςξ έπεζ πνμδβμφιεκα ακαθενεεί δ MuSK είκαζ ιζα ηζκάζδ ηδξ ηονμζίκδξ, δ μπμία παίγεζ νυθμ ζηδ ζοζζχνεοζδ ηςκ AChR ζηδ ιεηαζοκαπηζηή ιειανάκδ ζε ζοκενβαζία ιε ηδκ αβνίκδ, ιζα εηηνζκυιεκδ ζηδ κεονμιοσηή ζφκαρδ πνςηεΐκδ. Ακ ηαζ μνζζιέκα ακηί-musk ακηζζχιαηα δζαηανάζζμοκ ηδ θεζημονβία ηςκ AChR, εκ ημφημζξ δεκ έπμοκ πνμζδζμνζζεεί ζοβηεηνζιέκμζ παεμβεκεηζημί ιδπακζζιμί. Κάπμζμζ εεςνμφκ υηζ ηα MuSK ακηζζχιαηα δζαηανάζζμοκ ηδκ κεονμιοσηή ιεηααίααζδ επδνεάγμκηαξ ηδκ ζοζζχνεοζδ ηςκ AChR ζηδκ κεονμιοσηή ζφκαρδ. Σμ πνμθίθ ηςκ ακηζζςιάηςκ ζημοξ αζεεκείξ ιε ιοαζεέκεζα εζζδβείηαζ δζαθμνέξ ζηδκ ακμζμπαεμβέκεζα ηδξ κυζμο (Hughes et al., 2004) Ο ξόινο ηνπ ζύκνπ ζηελ παζνγέλεηα ηεο κπαζζέλεηαο Ο εφιμξ δζαδναιαηίγεζ ζδιακηζηυ νυθμ ζηδκ επαβςβή ηδξ ακμπήξ πνμξ ηα ακηζβυκα «ημο ζδίμο» ηαζ ζηδκ ακηαπυηνζζδ ηςκ θειθμηοηηάνςκ ζηα λέκα ακηζβυκα (Vincent et al., 48

49 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ 2001). Καηά ηδ δζάνηεζα ηδξ ακάπηολδξ, ανπέβμκα ηφηηανα (stem cells) ημο ιοεθμφ ηςκ μζηχκ ειθακίγμκηαζ ζημ οπμηαρζηυ επζεήθζμ ημο εφιμο, υπμο ανπίγεζ κα θαιαάκεζ πχνα ιία ηοπαία δζαδζηαζία ακαδζάηαλδξ βμκζδίςκ. Αοηή δ δζαδζηαζία ζοιααίκεζ ζηζξ πενζμπέξ πμο εα ηςδζημπμζμφκ ημοξ οπμδμπείξ ακηζβυκςκ ηςκ Σ-ηοηηάνςκ. Σα ακχνζια Σ- ηφηηανα πενκμφκ δζαιέζς ημο θθμζμφ ημο εφιμο ηαζ εηείκα ηα μπμία ακαβκςνίγμοκ ηα ακηζβυκα ημο ιείγμκμξ ζοιπθέβιαημξ ζζημζοιααηυηδηαξ (MHC), πενκμφκ ζημκ ιοεθυ. Ζ πθεζμρδθία ηςκ ακχνζιςκ Σ-ηοηηάνςκ ηα μπμία δεκ ακαβκςνίγμοκ ηα «ίδζα» ακηζβυκα ημο MHC, ελαθείθμκηαζ. Καηά ηδ δζάνηεζα αοημφ ημο ζηαδίμο ζημ θθμζυ ημο εφιμο, ηα Σ-ηφηηανα ηα μπμία εα ακηζδνμφζακ εκακηίμκ ακηζβυκςκ ημο «ζδίμο», απμιαηνφκμκηαζ επίζδξ. Ωζηυζμ, μζ ιδπακζζιμί ιέζς ηςκ μπμίςκ ζοιααίκεζ αοηυ, δεκ είκαζ βκςζημί. Σα Σ-ηφηηανα πμο πενκμφκ ζημ ιοεθυ, δζαθμνμπμζμφκηαζ ζε επζημονζηά ηαζ ηαηαζηαθηζηά Σ-ηφηηανα ηαζ ηεθζηά απεθεοεενχκμκηαζ ζηδκ πενζθένεζα. Τπάνπμοκ πμθθέξ εκδείλεζξ πμο οπμζηδνίγμοκ ημ βεβμκυξ υηζ μ εφιμξ ειπθέηεηαζ ζηδκ παεμβέκεζα ηδξ ιοαζεέκεζαξ (Conti-Fine et al., 2006). Δπζπθέμκ, δ εοιεηημιή ειθακίγεηαζ κα αεθηζχκεζ ηδκ ηθζκζηή πμνεία αζεεκχκ ιε ιοαζεέκεζα (Gronseth and Barohn, 2002) Κιηληθέο Δθδειώζεηο ηεο MG Ζ ιοσηή αδοκαιία απμηεθεί ημ ηονίανπμ ζφιπηςια ηδξ ιοαζεέκεζαξ. Καηά ζεζνά ζοπκυηδηαξ πνμζαάθθμκηαζ μζ μθεαθιζημί, μζ πνμιδηζημί, μζ ιφεξ ηςκ άηνςκ ηαζ ημο ημνιμφ. θμζ μζ βναιιςημί ιφεξ, αηυιδ ηαζ μζ ελςηενζημί ζθζβηηήνεξ ηδξ ηφζηδξ ηαζ ημο μνεμφ, ιπμνμφκ κα πνμζαθδεμφκ (Massey, 1997; Romi et al., 2005). Ζ ζοιπηςιαημθμβία, πμο ηαεμνίγεηαζ απυ ηζξ ιοσηέξ μιάδεξ πμο ζοιιεηέπμοκ, υηακ αθμνά ζημοξ μθεαθιζημφξ ιφεξ πενζθαιαάκεζ δζπθςπία ή απθή αζάθεζα ηςκ μνίςκ ηςκ ακηζηεζιέκςκ, ζηνααζζιυ, πηχζδ ημο άκς αθεθάνμο. Οζ θείμζ ιφεξ ηδξ ηυνδξ, υπςξ ηαζ υθμζ μζ θείμζ ιφεξ, δεκ πνμζαάθθμκηαζ ηαζ δ ηυνδ δζαηδνεί θοζζμθμβζηυ ιέβεεμξ. Οζ ζθζβηηήνεξ ηςκ ημνχκ ζπάκζα πανμοζζάγμοκ απμηάικςζδ. ε ιζα μθεαθιμπθδβία, ζηδκ μπμία δ ηυνδ δζαηδνεί θοζζμθμβζηή δζάιεηνμ ηαζ ακηζδναζηζηυηδηα, δ πενζζζυηενμ πζεακή δζάβκςζδ είκαζ αανεία ιοαζεέκεζα. Oζ ιφεξ ημο πνμζχπμο επίζδξ ιπμνεί κα πνμζαθδεμφκ ηαζ πνμηαθείηαζ δοζπένεζα ζημ ζθφνζβια ηαζ ηάπμηε παναηηδνζζηζηή παναιυνθςζδ ημο παιυβεθμο πμο 49

50 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ εοιίγεζ πενζζζυηενμ ζηοενχπζαζια (βηνίκζα, snarl). Ζ πνμζαμθή ηςκ πνμιδηζηχκ ιοχκ εηδδθχκεηαζ ιε δοζπένεζα ζηδ ιάζδζδ, ηδκ ηαηάπμζδ ηαζ ηδκ μιζθία. Ζ επέηηαζδ ηδξ ιοσηήξ αδοκαιίαξ πνμξ ημοξ ακαπκεοζηζημφξ ιφεξ ζοκμδεφεηαζ ιε δφζπκμζα ηαζ ηοάκςζδ ηαζ ιπμνεί άιεζα κα απεζθήζεζ ηδ γςή ημο αζεεκμφξ εάκ δεκ οπάνλεζ έβηαζνδ ακηζιεηχπζζδ (ηναπεζμζημιία-ακαπκεοζηζηή οπμζηήνζλδ). ηδκ πενζμπή ημο αοπέκα είβμκηαζ ηονίςξ μζ εηηείκμκηεξ ιφεξ ηδξ ηεθαθήξ ηαζ μ άννςζημξ ζηδνίγεζ ημ ηεθάθζ, ημπμεεηχκηαξ ημ πένζ ημο ζημ πδβμφκζ. Πνμηεζιέκμο βζα ηα άηνα οπάνπεζ ζοκήεςξ ηάπμζα πνμηίιδζδ ζημοξ ηεκηνμιεθζημφξ ιφεξ, ημοθάπζζημκ ζηζξ εθαθνέξ ή ανπυιεκεξ πενζπηχζεζξ. Δηείκμ πμο ζδζαίηενα παναηηδνίγεζ ηδκ πάεδζδ είκαζ δ ηοιαζκυιεκδ ιοσηή αδοκαιία ηαζ δ βνήβμνδ ελάκηθδζδ ηςκ ζηεθεηζηχκ ιοχκ ηαηά ηδκ πνμζπάεεζα. Αοηυ έπεζ ζακ ζοκέπεζα ηα εονήιαηα κα πμζηίθθμοκ απυ ηδ ιία ελέηαζδ ζηδκ άθθδ ηαζ δ ζοιπηςιαημθμβία κα επδνεάγεηαζ απυ ηδκ ζςιαηζηή ηυπςζδ. Σμ δζάααζια ή δ παναημθμφεδζδ ηδθευναζδξ εηθφμοκ δζπθςπία ή επζδεζκχκμοκ ηδκ ήδδ οπάνπμοζα δζπθςπία. Ζ μιζθία ζημ λεηίκδιά ηδξ έπεζ θοζζμθμβζηή πνμζά ηαζ έκηαζδ αθθά πνμμδεοηζηά βίκεηαζ έκνζκδ, αδφκαηδ, αηαηάθδπηδ. Σμ ίδζμ επζδεζκχκεηαζ δ ιάζδζδ, αθθά ηαζ υθεξ μζ ηζκδηζηέξ θεζημονβίεξ, ιε ηδκ πανάηαζδ ηδξ ιοσηήξ πνμζπάεεζαξ. Ακηίεεηα, δ ακάπαοζδ ηαζ θοζζηά μ φπκμξ, αεθηζχκμοκ ή ηαζ ελαθακίγμοκ πμθθά απυ ηα ζοιπηχιαηα. Οζ άννςζημζ ηζξ πνςζκέξ χνεξ είκαζ βεκζηά ηαθφηενα, ζε ζφβηνζζδ ιε ηζξ αναδζκέξ χνεξ, ή αηυια ιπμνεί κα είκαζ ηαζ εθεφεενμζ ζοιπηςιάηςκ υηακ λοπκμφκ. Ζ ιμκαδζηή βζα ηδ ιοαζεέκεζα, ζοιπενζθμνά ηςκ ζηεθεηζηχκ ιοχκ ζηδκ άζηδζδ, αλζμπμζείηαζ ιαγί ιε ημ ζζημνζηυ ηςκ δζαηοιάκζεςκ ηδξ ζοιπηςιαημθμβίαξ ζημ δζάζηδια ημο εζημζζηεηναχνμο, βζα ηδ δζάβκςζδ ηδξ παεήζεςξ. Ο αζεεκήξ οπμαάθθεηαζ ζε ηθζκζηέξ δμηζιαζίεξ ηυπςζδξ ηαζ ηαηαβνάθμκηαζ μζ επζπηχζεζξ. Θα ημο γδηδεεί βζα πανάδεζβια κα ημζηάλεζ παναηεηαιέκα πνμξ ηα πάκς (εα πνμηθδεεί ηυηε πηχζδ ηςκ αθεθάνςκ ή δζπθςπία) ή κα ηάκεζ επακεζθδιιέκα ααεζά ηαείζιαηα (δεκ εα ιπμνέζεζ κα ακηέλεζ πενζζζυηενμ απυ 3-5) ή εα ημο γδηδεεί κα ηναηήζεζ ημ άκς άηνμ ζε έηηαζδ (ζφκημια ηα πένζα ημο εα πέζμοκ). Ζ ζςιαηζηή ακάπαοζδ πνέπεζ κα ημκζζεεί υηζ ζηζξ πνμπςνδιέκεξ πενζπηχζεζξ απθχξ αεθηζχκεζ ηδ ιοσηή ζζπφ. Παναιέκεζ υιςξ ιοσηή αδοκαιία, δ μπμία δφζημθα ηάπμηε ακαηάζζεηαζ, αηυιδ ηαζ ιε ηδ θανιαηεοηζηή αβςβή. Δηηυξ απυ ηδ ιοσηή αδοκαιία ιε ηα επαηυθμοεα ζοιπηχιαηα ηαζ ζδιεία, δ κεονμθμβζηή ελέηαζδ δεκ πνμζεέηεζ άθθα μοζζαζηζηά εονήιαηα. Σα ηεκυκηζα ακηακαηθαζηζηά είκαζ 50

51 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ θοζζμθμβζηά ή ηάπμηε γςδνά. Δάκ έκα ακηακαηθαζηζηυ παναπεεί πμθθέξ θμνέξ, ηεθζηά παφεζ κα πανάβεηαζ (ηαηανβείηαζ). Ο ιοσηυξ υβημξ είκαζ ζοκήεςξ θοζζμθμβζηυξ αθθά ιοσηή αηνμθία είκαζ δοκαηυκ κα παναηδνδεεί ζε ιειμκςιέκμοξ ιφεξ. ε πνμπςνδιέκεξ πενζπηχζεζξ ιπμνεί κα οπάνπεζ βεκζηεοιέκδ αηνμθία (ηαπελία), δ μπμία είκαζ ηονίςξ ζοκέπεζα ηδξ απνδζίαξ ηςκ ιοχκ. Αζζεδηζηέξ δζαηαναπέξ ιπμνεί κα παναηδνδεμφκ ζηδκ ιοαζεέκεζα, αθθά αοηέξ είκαζ οπμηεζιεκζημφ ηφπμο. Δίκαζ ζοπκυ ημ ιοσηυ άθβμξ, ζδζαίηενα ζημκ αοπέκα ηαζ βφνς απυ ηα ιάηζα ηαζ απμδίδεηαζ ζηδκ παναηεηαιέκδ πνμζπάεεζα ηςκ οβζχκ ιοχκ κα ακαπθδνχζμοκ άθθμοξ ιφεξ, δ ζζπφξ ηςκ μπμίςκ έπεζ εηπέζεζ. Οζ ιεηςπζαίμζ ιφεξ βζα πανάδεζβια ανίζημκηαζ ζε ιάηαζα οπενπνμζπάεεζα βζα κα ακεθηφζμοκ ηα πεζιέκα αθέθανα, ιε ζοκέπεζα άθβμξ ζηζξ πνμζθφζεζξ ημοξ (Παπαπεηνυπμοθμξ, 1990) Θεξαπεπηηθέο Πξνζεγγίζεηο Οζ πζμ απμηεθεζιαηζηέξ εεναπείεξ βζα αζεεκείξ ιε ιοαζεέκεζα είκαζ αοηέξ πμο ζημπεφμοκ ζημ ακμζμθμβζηυ ζφζηδια. Αοηέξ είηε ηνμπμπμζμφκ ηδκ παναβςβή ακηζζςιάηςκ ηαηά ηςκ οπμδμπέςκ αηεηοθμπμθίκδξ, είηε ηνμπμπμζμφκ ηδκ αθάαδ πμο πνμηαθείηαζ ζηδ κεονμιοσηή ζφκαρδ απυ αοηά ηα ακηζζχιαηα. Πεναζηένς δζαηνίκμκηαζ ζε ιαηνμπνυκζεξ ηαζ αναποπνυκζεξ εεναπείεξ. ημπυξ ηςκ εεναπεζχκ αοηχκ είκαζ πνχημκ κα μδδβήζμοκ ζε φθεζδ ηςκ ζοιπηςιάηςκ, ηαζ εκ ζοκεπεία κα δζαηδνήζμοκ ηδκ φθεζδ αοηή ιε ηδκ ιζηνυηενδ ακαθμβία ηυζημξ πνμξ ςθέθεζα. Ζ ηθζκζηή εζηυκα ηςκ ιοαζεεκχκ έπεζ αεθηζςεεί δναιαηζηά ηα ηεθεοηαία πνυκζα, εθαπζζημπμζχκηαξ ηα πμζμζηά εκδζζιυηδηαξ. Ζ εηήζζα επίπηςζδ ( incidence rate ) ζηζξ Ζ.Π.Α οπμθμβίζηδηε ζημ 0,01 ακά 1,000 αζεεκείξ/έημξ. Ζ ζοκμθζηή εκδμκμζμημιεζαηή εκδηυηδηα ήηακ 2,2%, πμο είκαζ ορδθυηενδ ζε MG ηνίζδ (4,47%) (Alshekhlee et al., 2009). Οζ ζφβπνμκεξ εεναπείεξ ειπίπημοκ ζε δφμ ηαηδβμνίεξ, ηςκ ζοιπηςιαηζηχκ, μζ μπμίεξ ζημπεφμοκ ζηδκ ηαηαπμθέιδζδ ηςκ ζοιπηςιάηςκ ηδξ αζεέκεζαξ ηαζ υπζ ζηδκ αζηία πμο ηδκ πνμηαθεί, ηαζ ηςκ ακμζμνοειζζηζηχκ. Οζ εεναπείεξ πμο ζημπεφμοκ ημ ακμζμπμζδηζηυ ζφζηδια, έπμοκ ζημπυ κα επάβμοκ ηαζ κα δζαηδνμφκ ηδκ φθεζδ ηδξ αζεέκεζαξ. ηζξ ζοιπηςιαηζηέξ εεναπείεξ ακήημοκ ηονίςξ ηα ακηζπμθζκεζηεναζζηά θάνιαηα. ηδκ ηαηδβμνία ηςκ ακμζμνοειζζηζηχκ εεναπεζχκ ακήημοκ δ εοιεηημιή, ηα 51

52 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ημνηζημζηενμεζδή θάνιαηα, ηα ιδ ζηενμεζδή ακμζμηαηαζηαθηζηά, δ «πθαζιαθαίνεζδ ηαζ μζ εκδμθθέαζεξ ακμζμζθαζνίκεξ Αληηρνιηλεζηεξαζηθά (ρνιηλεξγηθά) θάξκαθα πςξ ακαθένεδηε, δ παεμβέκεζδ ηδξ ιοαζεέκεζαξ μθείθεηαζ ζε αοημακηζζχιαηα ηαηά ημο ιοσημφ οπμδμπέα ηδξ αηεηοθμπμθίκδξ, ηα μπμία έπμοκ ςξ απμηέθεζια κα ιεζχκμοκ ημκ ανζειυ ηςκ δζαεέζζιςκ οπμδμπέςκ ζηδ κεονμιοσηή ζφκαρδ. Σα ακηζπμθζκεζηεναζζηά θάνιαηα ακαζηέθθμοκ ηδ δνάζδ ηδξ αηεηοθμπμθζκεζηενάζδξ ζηδ κεονμιοσηή ζφκαρδ, αολάκμκηαξ ηδ ζοβηέκηνςζδ ηδξ δζαεέζζιδξ αηεηοθμπμθίκδξ ηαζ ιε ημκ ηνυπμ αοηυ εκζζπφμοκ ηδ κεονμιοσηή δζααίααζδ. Ζ πονζδμζηζβιίκδ (mestinon), πνδζζιμπμζείηαζ πενζζζυηενμ απυ ηα άθθα ακηζπμθζκεζηεναζζηά (πνμζηζβιίκδ, ubretid, mytelase, nivalin). Απμηεθεί ηδκ πνχηδ επζθμβή ηαζ ίζςξ ηδ ιμκαδζηή ζηδκ μθεαθιζηή ηαζ ηζξ ήπζεξ ιμνθέξ, υηακ ακηαπμηνίκμκηαζ ζηακμπμζδηζηά ηαζ ζοβπςνείηαζ ιε ηα ακμζμηαηαζηαθηζηά ζηζξ αανζέξ πενζπηχζεζξ. Θα πνέπεζ κα απμθεφβμκηαζ μζ ιεβάθεξ δυζεζξ - πάκς απυ 5-6 δζζηία - βζαηί ιπμνεί κα πνμηαθέζμοκ πμθζκενβζηέξ εηδδθχζεζξ, ιμοζηανζκζηέξ (εθζδνχζεζξ, δζάννμζεξ, ειεημφξ, δφζπκμζα) ή κζημηζκζηέξ (δεζιζδχζεζξ, επχδοκεξ ιοσηέξ ζοζπάζεζξ, ζφβποζδ, ζπαζιμφξ, ηχια) (Παπαπεηνυπμοθμξ, 1990). Γζα ηδκ οπμηαθζαζιία πμο πνμηαθμφκ ηαζ μζ ιζηνυηενεξ δυζεζξ ημο mestinon, ζοβπμνδβείηαζ ακαζημθέαξ ηδξ αθδμζηενυκδξ (aldactone), βζα αναπφ πνμκζηυ δζάζηδια, ζδζαίηενα ζημοξ άκδνεξ, βζαηί πνμηαθεί βοκαζημιαζηία. Ζ πονζδμζηζβιίκδ ηαζ δ κεμζηζβιίκδ είκαζ ηα πθέμκ εονέςξ πνδζζιμπμζμφιεκα θάνιαηα ηδξ ηαηδβμνίαξ αοηήξ (Keesey, 2004). Πνυηεζηαζ βζα ζοιπηςιαηζηή αέααζα εεναπεία. Σα θάνιαηα αοηά είκαζ απμηεθεζιαηζηά ζηα πνχηα ζηάδζα ηδξ ιοαζεέκεζαξ ή ζε αζεεκείξ ιε εθαθνζάξ ιμνθήξ ιοαζεέκεζα ηαζ παιδθή ζοβηέκηνςζδ αοημακηζζςιάηςκ. Οζ πανεκένβεζεξ ηςκ ακηζπμθζκεζηεναζζηχκ θανιάηςκ ζοιπενζθαιαάκμοκ ημζθζαημφξ ζπαζιμφξ, αολδιέκδ ζζεθυννμζα ηαζ δζάννμζα. Γφμ αηυια μοζίεξ πμο ακήημοκ ζηζξ ζοιπηςιαηζηέξ εεναπείεξ είκαζ δ εθεδνίκδ ηαζ δ δζαιζκμπονζδίκδ, μζ μπμίεξ έπμοκ πανυιμζα δνάζδ ιε ηα ακηζπμθζκεζηεναζζηά θάνιαηα, αολάκμκηαξ ηδ ζοβηέκηνςζδ ηδξ αηεηοθμπμθίκδξ πμο εηηνίκεηαζ απυ ημ πνμζοκαπηζηυ 52

53 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ άηνμ. Χζηυζμ, δεκ είκαζ ηυζμ απμηεθεζιαηζηά μφηε αζθαθή ζοβηνζηζηά ιε ηδκ πονζδμζηζβιίκδ (Richman and Agius, 2003) Θπκεθηνκή Ζ αθαίνεζδ ημο εφιμο αδέκα, ή αθθζχξ εοιεηημιή, εεςνείηαζ υηζ μδδβεί ζηδκ πθήνδ «οπμπχνδζδ ηςκ ζοιπηςιάηςκ ηδξ κυζμο ζημ 35% επί ημο ζοκυθμο ηςκ αζεεκχκ, εκχ αεθηζχκεζ αζζεδηά ηδκ ηθζκζηή εζηυκα ζημ 50% ηςκ οπμθμίπςκ. Έπεζ δζαπζζηςεεί υηζ ζημ 65% ηςκ αννχζηςκ οπάνπεζ οπενπθαζία ημο εφιμο ηαζ υηζ ηαζ ζημ 10% εφιςια, ακ ηαζ μ θυβμξ παναιέκεζ αηυιδ αδζεοηνίκζζημξ (Mantegazza et al., 2003). Τπάνπμοκ πμθθέξ αιθζαμθίεξ βζα ημ πνυκμ εθανιμβήξ ηδξ ηαζ ίζςξ είκαζ πζμ απμηεθεζιαηζηή ακ βίκεζ ηδκ πνχηδ πεκηαεηία απυ ηδκ έκανλδ, ζηδ βεκζηεοιέκδ ιμνθή, ζηζξ κεανέξ βοκαίηεξ ηαζ θζβυηενμ απμηεθεζιαηζηή ζηδκ μθεαθιζηή ιμνθή ηαζ ζημοξ αννχζημοξ πςνίξ εφιςια ηαζ ημοξ μνμανκδηζημφξ. Απυθοηα ηνζηήνζα-δείηηεξ αέααζα δεκ οπάνπμοκ αηυιδ ηαζ ζηδκ μθεαθιζηή ιμνθή, υηακ μζ ακμζμηαηαζηαθηζηέξ εεναπείεξ δεκ απμδίδμοκ ή δ εεναπεία ιε ημνηζημζηενμεζδή, ζε ιεβάθεξ δυζεζξ ιε ηζξ βκςζηέξ πανεκένβεζεξ, πνέπεζ κα παναηείκεηαζ ιαηνμπνυκζα. Ζ ηάζδ, είκαζ κα αθαζνείηαζ μθυηθδνμξ μ εφιμξ ιε εηηεηαιέκδ δζαζηενκζηή εςναημημιή, χζηε κα ιδκ απμιέκμοκ έηημπα ζημζπεία ημο. Ζ δζαηναπδθζηή εηημιή ημο εφιμο, έπεζ πθέμκ εβηαηαθεζθεεί ηαζ βίκμκηαζ εκδμζημπζηέξ, νμιπμηζηέξ επειαάζεζξ, ακ ηαζ δεκ έπεζ αηυιδ ηεηιδνζςεεί υηζ είκαζ απμηεθεζιαηζηυηενεξ. ηζξ αανζέξ πενζπηχζεζξ, ηαθυ είκαζ κα πνμδβείηαζ πθαζιαθαίνεζδ (Gronseth and Barohn, 2002). Σμ απμηέθεζια ηδξ εοιεηημιήξ δεκ είκαζ ειθακέξ ιέπνζ ημ ηέθμξ ημο πνχημο πνυκμο ιεηά ηδκ επέιααζδ, ηαζ ηα πθήνδ απμηεθέζιαηα είκαζ πζεακυκ κα βίκμοκ αζζεδηά ιεηά ημ πέναξ ηδξ πνχηδξ πεκηαεηίαξ. Ακ ηαζ μ νυθμξ ημο εφιμο αδέκα ζηδκ παεμβέκεζδ ηδξ ιοαζεέκεζαξ παναιέκεζ ακελζπκίαζημξ, δ αθαίνεζδ ημο δνα εοενβεηζηά πζεακχξ ιε ηδκ απμιάηνοκζδ ηςκ ιομεζδχκ ηοηηάνςκ ημο εφιμο πμο ίζςξ απμηεθμφκ αοημακηζβυκμ (Drachman et al., 1998), είηε ιε ηδκ απμιάηνοκζδ ηςκ Β θειθμηοηηάνςκ πμο εηηνίκμοκ ακηζζχιαηα ηαηά ημο ιοσημφ οπμδμπέα, είηε ιε δζυνεςζδ ηάπμζαξ δζαηαναπήξ ζηδ νφειζζδ 53

54 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ημο ακμζμπμζδηζημφ ζοζηήιαημξ, ζηδκ μπμία εα ιπμνμφζε κα ειπθέηεηαζ ηαζ μ εφιμξ αδέκαξ Κνξηηθνζηεξνεηδή Οζ ακμζμηαηαζηαθηζηέξ εεναπείεξ, υπςξ είκαζ ηα ημνηζημζηενμεζδή, πμνδβμφκηαζ ζε αζεεκείξ ιε εκδζάιεζδ ή αανζάξ ιμνθήξ ιοαζεέκεζα. Σα ημνηζημζηενμεζδή, ζοκήεςξ πνεδκζγμθυκδ (Prezolon), είκαζ ημ θάνιαημ πνχηδξ επζθμβήξ ιεηαλφ ηςκ ακμζμηαηαζηαθηζηχκ ζηδ εεναπεία ηδξ βεκζηεοιέκδξ ιοαζεέκεζαξ, ζε δυζδ πμο ελαημιζηεφεηαζ, mg ακάθμβα ιε ηδ αανφηδηα ηαζ ηδκ ακηαπυηνζζδ (Sanders and Evoli, 2008; Παπαπεηνυπμοθμξ, 1990). ηζξ αανζέξ ιμνθέξ ηδξ κυζμο ζοκήεςξ πνμδβείηαζ πμνήβδζδ ακμζμζθαζνίκδξ ή πθαζιαθαίνεζδ. Καζ ζηδκ μθεαθιζηή ιοαζεέκεζα, αηυιδ ηαζ ακ ακηζδνά ζηακμπμζδηζηά ζηα ακηζπμθζκεζηεναζζηά, πνμζηίεεηαζ ζοκήεςξ ηαζ ημνηζημζηενμεζδέξ ζε ιζηνυηενδ δυζδ, βζαηί οπμζηδνίγεηαζ υηζ πανειπμδίγεζ ηδ βεκίηεοζδ ηδξ. Σα ημνηζημζηενμεζδή έπμοκ πμθθαπθή δνάζδ ζηα ιαηνμθάβα ηφηηανα, ζηα Β ηαζ ηα Σ θειθμηφηηανα (Schwendimann et al., 2005). Ζ δνάζδ ηςκ θανιάηςκ αοηχκ έβηεζηαζ ζηδ ιείςζδ ηδξ παναβςβήξ θθεβιμκμδχκ ηοηηανμηζκχκ ηαζ ηδξ ηοηθμθμνίαξ θθεβιμκμδχκ ηοηηάνςκ (Richman and Agius, 2003). Σα ημνηζημζηενμεζδή πνμηαθμφκ εθάηηςζδ ηδξ ζοβηέκηνςζδξ ηςκ αοημακηζζςιάηςκ ηαηά ημο ιοσημφ οπμδμπέα ηαζ ιείςζδ ηςκ πενζθενζηχκ θειθμηοηηάνςκ έκακηζ ημο οπμδμπέα (Tindall, 1980) Με-ζηεξνεηδή αλνζνθαηαζηαιηηθά Σα οπυθμζπα ακμζμηαηαζηαθηζηά, υπςξ δ αγαεζμπνίκδ, δ ηοηθμζπμνίκδ Α, δ ηοηθμθμζθαιίδδ ηαζ πνυζθαηα ημ Fk506 (Nagane et al., 2005) πνδζζιμπμζμφκηαζ βζα ηδ εεναπεία ηδξ ιοαζεέκεζαξ, πμνδβμφκηαζ μπςζδήπμηε ζημοξ αννχζημοξ πμο έπμοκ απυθοηδ ακηέκδεζλδ πμνήβδζδξ ζηενμεζδχκ (έθημξ ζημιάπμο η.θ.π.) ή ζε εηείκμοξ πμο δεκ ακηαπμηνίκμκηαζ ζηα ζηενμεζδή ή πνεζάγμκηαζ πμθφ ιεβάθεξ δυζεζξ ηαζ παναηεηαιέκδ εεναπεία (Παπαπεηνυπμοθμξ, 1990). Ζ αγαεζμπνίκδ ακαζηέθθεζ ηδ ζφκεεζδ πμονίκδξ ηαζ ηαηά ζοκέπεζα ημκ ηοηηανζηυ 54

55 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ πμθθαπθαζζαζιυ (Mertens et al., 1969). To βεβμκυξ αοηυ επδνεάγεζ ημοξ ηοηηανζημφξ πθδεοζιμφξ, υπςξ είκαζ ηα θειθμηφηηανα ηα μπμία δζαζνμφκηαζ ζε ζφκημια πνμκζηά δζαζηήιαηα ηαζ πανμοζζάγεζ θζβυηενεξ πανεκένβεζεξ απυ ηα ημνηζημζηενμεζδή. Σμ ηφνζμ πνυαθδια πμο ζπεηίγεηαζ ιε ηδ πμνήβδζδ αγαεζμπνίκδ είκαζ δ ηαεοζηένδζδ ηδξ αεθηίςζδξ ηςκ ηθζκζηχκ ζοιπηςιάηςκ ηςκ αζεεκχκ. ηδκ πενίπηςζδ πμο απαζηείηαζ ακμζμηαηαζηαθηζηή εεναπεία επί ιαηνυκ, ζοκζζηάηαζ δ πμνήβδζδ ζηενμεζδχκ ζε ζοκδοαζιυ ιε αγαεζμπνίκδ (Skeie et al., 2006b). Ζ ηοηθμζπμνίκδ Α έπεζ ζζπονή ακμζμηαηαζηαθηζηή δνάζδ ηαζ ακαζηέθθεζ ηδκ παναβςβή ηδξ IL-2 απυ ηα αμδεδηζηά Σ θειθμηφηηανα (Drachman et al., 1998). Ζ ηοηθμθμζθαιίδδ είκαζ έκα δοκαηυ ακμζμηαηαζηαθηζηά ηαζ δνα ζημ DNA ακαζηέθθμκηαξ ημκ ηοηηανζηυ πμθθαπθαζζαζιυ, επζδνχκηαξ ηονίςξ ζηα Β ηαζ υπζ ηα Σ θειθμηφηηανα. Σμ θάνιαημ αοηυ είκαζ ημ ίδζμ απμηεθεζιαηζηυ ιε ηα ημνηζημζηενμεζδή, ςζηυζμ μζ πανεκένβεζεξ είκαζ πζμ ζμαανέξ (Niakan et al., 1986) Πιαζκαθαίξεζε Ζ πθαζιαθαίνεζδ απμηεθεί εεναπεία δ μπμία εθανιυγεηαζ ηονίςξ ζε ζμαανέξ ηαηαζηάζεζξ, υπςξ είκαζ δ ιοαζεεκζηή ηνίζδ, ηαζ απμηεθεί απμηεθεζιαηζηή αθθά πανμδζηή εεναπεία (Dalakas, 2004b). Ζ δζαδζηαζία ηδξ πθαζιαθαίνεζδξ αθμνά ζηδκ απμιάηνοκζδ ημο πθάζιαημξ ημο ιοαζεεκμφξ, ιε υηζ αοηυ πενζθαιαάκεζ, ηαζ ηνμθμδυηδζδ ιε θοζζμθμβζηυ πθάζια ή ζοζηαηζηά ημο πθάζιαημξ πμο έπμοκ αθαζνεεεί (Batocchi et al., 2000). Αθαζνμφκηαζ 2-3 θίηνα πθάζιαημξ, 3 θμνέξ ηδκ εαδμιάδα βζα 1-2 εαδμιάδεξ, ακάθμβα ιε ηδκ ακηαπυηνζζδ. Ζ αεθηίςζδ είκαζ άιεζδ, ζε ςνα απυ ηδκ πνχηδ πθαζιαθαίνεζδ. Δθανιυγεηαζ, ζε ελεζδζηεοιέκεξ ιμκάδεξ, ζηζξ βεκζηεοιέκεξ ιμνθέξ ιε αζθκίδζα επζδείκςζδ ηαζ πνμεβπεζνδηζηά ή ηαζ ζηζξ βεκζηεοιέκεξ ιμνθέξ ηδξ κυζμο πμο δεκ ακηαπμηνίκμκηαζ ζηζξ άθθεξ εεναπεοηζηέξ πνμζεββίζεζξ. Ζ αεθηίςζδ, πμο δζανηεί ιυκμ 1-2 ιήκεξ, απμδίδεηαζ ζηδκ απμιάηνοκζδ παεμθμβζηχκ μοζζχκ, ηονίςξ ακηζζςιάηςκ. Έπεζ ζδιακηζηέξ πανεκένβεζεξ (οπυηαζδ, οπένηαζδ, έιεημ, αζιμνναβίεξ, ενμιαμθθεαίηζδα ) ζημ 12-40% ηςκ πενζπηχζεςκ. Μεθέηεξ έπμοκ δείλεζ υηζ δ εεναπεία αοηή είκαζ απμηεθεζιαηζηή αηυια ηαζ ζε 55

56 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ μνμανκδηζημφξ αζεεκείξ (Skeie et al., 2006b). Χζηυζμ, έπεζ ημ ιεζμκέηηδια υηζ αθαζνεί ακελαζνέηςξ υθεξ ηζξ πνςηεΐκεξ ημο πθάζιαημξ ηαζ ακηζηαηάζηαζδ ηςκ πνςηεσκχκ αοηχκ δφκαηαζ κα πνμηαθέζεζ ακαθοθαηηζηέξ ακηζδνάζεζξ, ηαεχξ επίζδξ ηαζ θμζιχλεζξ πμο μθείθμκηαζ ζηδ ιεηάββζζδ (Skeie et al., 2010). Δπζπνυζεεηα, ημ ηυζημξ ηδξ εεναπείαξ αοηήξ είκαζ ιεβάθμ Δλδνθιέβηεο αλνζνζθαηξίλεο (ΗVIG) Οζ εκδμθθέαζεξ ακμζμζθαζνίκεξ απμηεθμφκ ιζα πανμδζηή εεναπεία, ιε απμηεθέζιαηα πανυιμζα ιε ηδκ πθαζιαθαίνεζδ. Υμνδβμφκηαζ ιε εκδμθθέαζα δυζδ 0,4gr/Kgr αάνμοξ ημο αννχζημο βζα 5 ζοκεπείξ διένεξ (Zinman et al., 2007). Ζ πμνήβδζδ ακμζμζθαζνζκχκ απυ οβζείξ δυηεξ ηαηαζηέθθεζ ηδκ ακμζμαπυηνζζδ ηςκ ιοαζεεκχκ, πζεακχξ ιεζχκμκηαξ ηδκ έηθναζδ πνμ-θθεβιμκςδχκ ηοηηανμηζκχκ ηαζ αολάκμκηαξ ηδκ έηθναζδ ηςκ ακηί-θθεβιμκςδχκ ηοηηανμηζκχκ (Zhu et al., 2006), πανυθμ πμο μ ιδπακζζιυξ δνάζδξ ημοξ δεκ είκαζ πθήνςξ ηαηακμδηυξ. Ζ εεναπεία αοηή έπεζ θζβυηενεξ πανεκένβεζεξ απυ ηδκ πθαζιαθαίνεζδ, ιε ηφνζα ζοιπηχιαηα ημκ πονεηυ ηαζ ημκ πμκμηέθαθμ (Gajdos et al., 1998). οκζζηάηαζ ζοκήεςξ ςξ ακμζμεκζζποηζηυ ηαηά ηδ δζάνηεζα ακμζμηαηαζηαθηζηήξ εεναπείαξ (Dalakas, 2004a). Χζηυζμ έπεζ ημ ιεζμκέηηδια υηζ είκαζ ιζα εεναπεία ιε ιεβάθμ ηυζημξ Δηδηθέο αλνζνηξνπνπνηεηηθέο ζεξαπείεο ζε ζηάδην θιηληθώλ δνθηκώλ Οζ ζφβπνμκεξ εεναπείεξ βζα ηδ ιοαζεέκεζα πμο πνμακαθένεδηακ, είκαζ ανηεηά απμηεθεζιαηζηέξ, ςζηυζμ έπμοκ πμθθέξ πανεκένβεζεξ ελαζηίαξ ηδξ πενζμνζζιέκδξ ελεζδίηεοζδξ ημοξ. Οζ ενεοκδηζηέξ πνμζπάεεζεξ ζήιενα επζηεκηνχκμκηαζ ζε πενζζζυηενμ εζδζηέξ εεναπείεξ, μζ μπμίεξ εα είκαζ απμηεθεζιαηζηυηενεξ, ηαζ πανάθθδθα εα πανμοζζάγμοκ θζβυηενεξ πανεκένβεζεξ. Ζ πνμζέββζζδ αοηή είκαζ πθέμκ εθζηηή, ηαεχξ ημ ακηζβυκμ πμο είκαζ οπεφεοκμ βζα ηδ ιοαζεέκεζα είκαζ ηαθά παναηηδνζζιέκμ. Μζα κέα εεναπεοηζηή ζηναηδβζηή, δ μπμία μκμιάγεηαζ «επακεηηίκδζδ ημο ακμζμπμζδηζημφ ζοζηήιαημξ», εθανιυζηδηε ζε ιζηνυ ανζειυ αζεεκχκ, μζ μπμίμζ δεκ 56

57 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ακηαπμηνίκμκηακ ζηζξ ζοιααηζηέξ εεναπείεξ. Ζ εεναπεία αοηή απμηεθείηαζ απυ ορδθέξ δυζεζξ ηοηθμθμζθαιίδδξ (200 mg/kg), δ μπμία ελμοδεηενχκεζ ημ χνζιμ ακμζμπμζδηζηυ ζφζηδια, αθθά δεκ επζδνά ζηα πνυδνμια αζιαημπμζδηζηά ηφηηανα. Σμ ιεβαθφηενμ πμζμζηυ ηςκ αζεεκχκ έδεζλε ζδιακηζηή αεθηίςζδ εκχ ηάπμζμζ απυ αοημφξ άνπζζακ κα ακηαπμηνίκμκηαζ ζε ακμζμηαηαζηαθηζηέξ εεναπείεξ. Σα απμηεθέζιαηα ηδξ ένεοκαξ αοηήξ έδεζλακ υηζ μζ ορδθέξ δυζεζξ ηδξ μοζίαξ αοηήξ είκαζ αζθαθείξ ηαζ απμηεθεζιαηζηέξ, ζε πενζπηχζεζξ πμο μζ αζεεκείξ δεκ ακηαπμηνίκμκηαζ ζε άθθμο είδμοξ εεναπεία. Χζηυζμ, δ αεθηίςζδ βζα μνζζιέκμοξ αζεεκείξ δεκ ήηακ ιυκζιδ (Drachman et al., 2008). Μζα εκαθθαηηζηή ιμνθή εεναπείαξ, απμηεθεί δ μοζία Mycophenolate mofetil. Χζηυζμ, δ απμηεθεζιαηζηυηδηα ηδξ εεναπείαξ αοηήξ είκαζ αηυια αιθζθεβυιεκδ. Γφμ πνυζθαηεξ ηθζκζηέξ ιεθέηεξ (Sanders and Evoli, 2008) παναηήνδζακ υηζ δεκ οπήνπε «ηακέκα υθεθμξ απυ ηδ πνήζδ ημο θανιάημο αοημφ ζε ιοαζεεκείξ. Πανυθα αοηά, βζα κα ελαπεεί έκα αζθαθέξ ζοιπέναζια βζα ηδκ απμηεθεζιαηζηυηδηα ή ιδ ηδξ εεναπείαξ αοηήξ πνεζάγμκηαζ πεναζηένς ηθζκζηέξ ιεθέηεξ (Sanders et al., 2008). Σμ θάνιαημ Tacrolimus είκαζ έκα ηαζκμφνζμ ακμζμηαηαζηαθηζηυ ιε πανυιμζα δνάζδ ιε αοηή ηδξ ηοηθμζπμνίκδξ Α. Σνέπμοζεξ ηθζκζηέξ ιεθέηεξ ζοκζζημφκ υηζ πανμοζζάγεζ ηδκ ίδζα απμηεθεζιαηζηυηδηα ιε ηδκ ηοηθμζπμνίκδ ηαζ πανάθθδθα δδιζμονβεί θζβυηενεξ πανεκένβεζεξ (Tada et al., 2006). Χζηυζμ, πνεζάγμκηαζ πενεηαίνς ηθζκζηέξ ιεθέηεξ βζα ηδκ επζαεααίςζδ ηδξ απμηεθεζιαηζηυηδηαξ ημο ζηδ ιοαζεέκεζα. Ονζζιέκα αζμηεπκμθμβζηά θάνιαηα, ηα μπμία είκαζ απμηεθεζιαηζηά ζηδ εεναπεία άθθςκ αοημάκμζςκ κυζςκ, εθέβπμκηαζ ιε ηθζκζηέξ ιεθέηεξ βζα ηδκ απμηεθεζιαηζηυηδηα ημοξ ζηδ εεναπεία ηδξ ιοαζεέκεζαξ. Γζα πανάδεζβια, ημ Rituximab, ημ μπμίμ είκαζ έκα ακηί- CD20 ιμκμηθςκζηυ ακηίζςια ηαζ επάβεζ ηδκ ηοηηανμημλζηυηδηα έκακηζ ηςκ CD20 Β- θειθμηοηηάνςκ, έπεζ πνδζζιμπμζδεεί επζηοπχξ βζα ηδ εεναπεία ηδξ ιοαζεέκεζαξ (Wylam et al., 2003). Μζα πνυζθαηδ ηθζκζηή ιεθέηδ ηαηέθδλε υηζ δ πνήζδ ημο θανιάημο αοημφ ζε ιοαζεεκείξ είπε ςξ απμηέθεζια ηδ αεθηίςζδ ηςκ ηθζκζηχκ ζοιπηςιάηςκ ημοξ (Ma et al., 2008). Σμ ακμζμηαηαζηαθηζηυ mitoxantrone ηαηεοεφκεηαζ ζηα Β θειθμηφηηανα, ακαζηέθθεζ εκενβμπμίδζδ ηςκ Σ αμδεδηζηχκ ηοηηάνςκ ηαζ μνζζιέκςκ ηοηηανμηζκχκ. Ζ μοζία αοηή απμηεθεί έκα εθπζδμθυνμ οπμρήθζμ θάνιαημ βζα ηδ ιοαζεέκεζα (Dalakas, 57

58 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ 2008). Δπζπνυζεεηα, ημ θάνιαημ Etanercept είκαζ ιζα δζιενήξ πνςηεΐκδ πμο πνμζδέκεζ ζηδκ ηοηηανμηίκδ TNF-α ηαζ ακαζηέθθεζ ηδ δνάζδ ηδξ. Ο TNF-α έπεζ απμδεζπηεί υηζ ειπθέηεηαζ ζηδκ παεμβέκεζδ πμθθχκ αοημάκμζςκ κμζδιάηςκ. Κθζκζηέξ ιεθέηεξ ζε ιοαζεεκείξ είπακ επζηοπή απμηεθέζιαηα ζε μνζζιέκμοξ, εκχ πνμηάθεζακ επζδείκςζδ ηδξ αζεέκεζαξ ζε άθθμοξ (Rowin, 2008) Πεηξακαηηθέο ζεξαπεπηηθέο πξνζεγγίζεηο Μζα εεναπεοηζηή πνμζέββζζδ απμηεθεί δ ακάπηολδ ακμζζαηήξ ακμπήξ ιε ηδ πμνήβδζδ απυ ημοξ αθεκκμβυκμοξ (ζηυιαημξ ή μζθνδηζηυ αθεκκμβυκμ), ακηζβυκςκ πμο ακηζζημζπμφκ ζε ηιήιαηα ημο ιοσημφ οπμδμπέα (οπμδμπέαξ ακέπαθμξ ή απμδζαηαβιέκμξ, ακαζοκδοαζιέκα ηιήιαηα ημο οπμδμπέα ή επζθεβιέκα πεπηίδζα οπμιμκάδςκ ημο). Ζ πμνήβδζδ ηςκ ακηζβυκςκ θαίκεηαζ κα επδνεάγεζ ηδκ αοημάκμζδ απυηνζζδ, πζεακυηαηα ιέζς ηνμπμπμζήζεςκ ζηδκ εκενβμπμίδζδ ηςκ δζαθμνεηζηχκ οπμμιάδςκ ηςκ αμδεδηζηχκ Σ- ηοηηάνςκ, πμο μδδβμφκ ζηδκ ακάπηολδ ακμζζαηήξ ακμπήξ βζα ημ πμνδβμφιεκμ ακμζμβυκμ (Barchan et al., 1998; Lindstrom, 2002). Με ηδ πνήζδ ηιδιάηςκ ιμκμηθςκζηχκ ακηζζςιάηςκ (Fostieri et al., 2005; Sophianos and Tzartos, 1989) ηαζ ακενςπμπμζδιέκςκ ιμκμηθςκζηχκ ακηζζςιάηςκ (Papanastasiou et al., 2000) επζηοβπάκεηαζ δ πνμζηαζία ημο ιοσημφ οπμδμπέα απυ ηα παεμβυκα ακηζζχιαηα (Mamalaki et al., 1993; Tsantili et al., 1999; Tzartos et al., 1985). Σα ιδ-παεμβυκα ηιήιαηα ηςκ αοημακηζζςιάηςκ αοηχκ πνέπεζ κα είκαζ ιμκμζεεκή, χζηε κα ιδκ πνμηαθμφκ απμδυιδζδ ηςκ οπμδμπέςκ ιέζς ηδξ ακηζβμκζηήξ ηνμπμπμίδζδξ, ηαζ επζπθέμκ κα θείπεζ δ εέζδ πνυζδεζδξ ημο ζοιπθδνχιαημξ. Ο ηνυπμξ δνάζδξ ηςκ ηιδιάηςκ αοηχκ έβηεζηαζ ζημκ ακηαβςκζζιυ ιε ηα παεμβυκα ακηζζχιαηα πνμηεζιέκμο κα πνμζδέζμοκ ζημκ οπμδμπέα. Χζηυζμ, ηα Fabs έπμοκ πμθφ ιζηνυ πνυκμ διζγςήξ in vivo ζηδκ ηοηθμθμνία ζε πεζναιαηζηά γςζηά ιμκηέθα ηαζ ειθακίγμοκ ακηζβμκζηυηδηα θυβς ημο υηζ έπμοκ παναπεεί ζε ηνςηηζηά (Papanastasiou et al., 2000). Τπήνλακ πνμζπάεεζεξ βζα ηδκ πνμζηαζία ηςκ Fabs δζα ηδξ ζφγεολδξ αοηχκ ιέζς methoxy-peg-maleimide δ μπμία είπε ζακ απμηέθεζια ηδκ αφλδζδ ημο πνυκμο διζγςήξ ηαηά 15 θμνέξ ηαζ ηδκ ιείςζδ ηδξ ακηζβμκζηυηδηαξ, αθθά ιε υπζ πμθφ ζηακμπμζδηζηυ ηεθζηυ απμηέθεζια ςξ πνμξ ηδκ πνμζηαζία ζε πεζναιαηζηά γςζηά 58

59 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ιμκηέθα (Trakas and Tzartos, 2001). Μζα άθθδ εεναπεοηζηή πνμζέββζζδ είκαζ δ δδιζμονβία βεκεηζηά ηνμπμπμζδιέκςκ ακηζβμκμπανμοζζαζηζηχκ ηφηηανςκ, ηα μπμία αθθδθεπζδνχκηαξ ιε Σ-θειθμηφηηανα, δναζηζηά έκακηζ ημο ιοσημφ οπμδμπέα, ηα ελςεμφκ ζηδκ ηαηαζηνμθή ιέζς πονμδυηδζδξ ηδξ απμπηςηζηήξ μδμφ (Drachman et al., 2003). Πνυζθαηεξ ιεθέηεξ πανμοζίαζακ ηδκ πανειπυδζζδ ηδξ έηθναζδξ ηδξ αηεηοθμπμθζκεζηενάζδξ ιε ηδ πνήζδ ακηί-κμδιαηζηχκ κμοηθεμηζδίςκ, ιέζς απμζζχπδζδξ ηδξ έηθναζδξ ημο ζπεηζημφ βμκζδίμο. Σα απμηεθέζιαηα απυ ηδκ εθανιμβή ηδξ ιεευδμο ζε πεζναιαηυγςα είκαζ εκεαννοκηζηά (Boneva et al., 2006). Χζηυζμ πνεζάγμκηαζ πεναζηένς ιεθέηεξ βζα ηδκ εθανιμβή ηδξ εεναπείαξ αοηήξ ηαζ ζημκ άκενςπμ. Πνυζθαηα, δζαπζζηχεδηε δ ειπθμηή ηςκ θςζθμδζεζηεναζχκ ζηδκ παεμβέκεζδ ηδξ πεζναιαηζηήξ ιοαζεέκεζαξ (Aricha et al., 2006). Μζα ηαζκμφνζα εεναπεοηζηή πνμζέββζζδ απμηεθεί δ πνήζδ ακαζημθέςκ ηςκ θςζθμδζεζηεναζχκ πνμηεζιέκμο κα ηαηαζηαθεί δ ελέθζλδ ηδξ πεζναιαηζηήξ ιοαζεέκεζαξ. Έκαξ απυ ημοξ ακαζημθείξ αοημφξ είκαζ δ πεκημλζθοθθίκδ, δ πνήζδ ηδξ μπμίαξ ζε ζοκδοαζιυ ιε παιδθέξ δυζεζξ ημνηζημζηενμεζδχκ επέθενε ηαηαζηαθηζηά απμηεθέζιαηα ζηδκ πεζναιαηζηή ιοαζεέκεζα (Menon et al., 2008). ηδ ιοαζεέκεζα, δ εκενβμπμίδζδ ηδξ δνάζδξ ημο ζοιπθδνχιαημξ απυ ηα αοημακηζζχιαηα ηαηά ημο ιοσημφ οπμδμπέα, εεςνείηαζ έκαξ ζδιακηζηυξ ιδπακζζιυξ ζηδκ παεμβέκεζδ ηδξ κυζμο. Μζα ηαζκμφνζα θανιαηεοηζηή μοζία, δ rev576, δ μπμία απμηεθεί ακαζημθέα ημο ζοιπθδνχιαημξ, ιείςζε δναζηζηά ηα ηθζκζηά ζοιπηχιαηα ζε πεζναιαηζηά ιμκηέθα ιοαζεέκεζαξ (Soltys et al., 2009). Μζα κέα ακηζβμκμεζδζηή εεναπεοηζηή πνμζέββζζδ ζηδνίγεηαζ ζηδκ εζδζηή αθαίνεζδ ηςκ αοημακηζζςιάηςκ απυ ημκ μνυ ημο αίιαημξ ηςκ ιοαζεεκχκ, πνδζζιμπμζχκηαξ ακμζμπνμζνμθδηζηέξ ζηήθεξ πμο ηαηαηναημφκ εζδζηά, ιυκμ ηα αοημακηζζχιαηα αοηά. Ζ ακμζμπνμζνυθδζδ ιε ζηήθεξ πμο εα θένμοκ αηζκδημπμζδιέκμ ημ ιοσηυ οπμδμπέα ζε ζηαεενυ οπυζηνςια, εεςνείηαζ ςξ ιζα πμθφ εθπζδμθυνα εεναπεοηζηή πνμζέββζζδ, εκαθθαηηζηή ηδξ πθαζιαθαίνεζδξ. Χζηυζμ, δ εθανιμβή ηδξ ηεπκζηήξ αοηήξ ζοκακηά δοζημθίεξ θυβς ηδξ πενζμνζζιέκδξ δζαεέζζιδξ πμζυηδηαξ θοζζημφ ακενχπζκμο οπμδμπέα. Μζα εθηοζηζηή εκαθθαηηζηή θφζδ είκαζ δ πνήζδ ακαζοκδοαζιέκςκ ηιδιάηςκ ημο οπμδμπέα, ιε πανυιμζα ιε αοηή ημο θοζζημφ δζαιυνθςζδ. 59

60 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Σέημζεξ ζηήθεξ ηαηαζηεοάζηδηακ πνδζζιμπμζχκηαξ ςξ ακμζμπνμζνμθδηή έκα ζοκεεηζηυ πεπηίδζμ (αιζκμλέα ), ημ μπμίμ ακηζζημζπμφζε ζε ηιήια ηδξ α1 οπμιμκάδαξ απυ ημ ράνζ Torpedo marmorata (Takamori and Maruta, 2001). Χζηυζμ, ηα απμηεθέζιαηα ακμζμπνμζνυθδζδξ ιε ηδ πνήζδ ηςκ ζηδθχκ αοηχκ ήηακ ακεπανηή, πνμθακχξ βζαηί μζ ζηήθεξ έθενακ ιζηνά, ηαζ υπζ ακενχπζκα, ζοκεεηζηά πεπηίδζα, εκχ δ πθεζμκυηδηα ηςκ αοημακηζζςιάηςκ ηαηά ημο ιοσημφ οπμδμπέα ζημοξ μνμφξ ηςκ ιοαζεεκχκ ελανηάηαζ απυ ηδ δζαιυνθςζδ ημο οπμδμπέα. Μζα άθθδ πνμζέββζζδ βζα ηδκ ηαηαζηεοή ζηδθχκ ακμζμπνμζνυθδζδξ, είκαζ δ πνήζδ ακαζοκδοαζιέκςκ ελςηοηηανζηχκ ηιδιάηςκ ηςκ α1, α1, β, ηαζ ε οπμιμκάδςκ ημο ακενχπζκμο ιοσημφ οπμδμπέα, ιε δζαιυνθςζδ πανυιμζα ιε αοηή ημο θοζζημφ οπμδμπέα. Μεθέηεξ ακμζμπνμζνυθδζδξ ιε ηζξ ζηήθεξ αοηέξ έδεζλακ υηζ ηα πμζμζηά αθαίνεζδξ ηςκ αοημακηζζςιάηςκ απυ μνμφξ ιοαζεεκχκ ήηακ 35% υηακ ςξ ακμζμπνμζνμθδηήξ πνδζζιμπμζμφηακ δ α1 οπμιμκάδα, 22% ζηδκ πενίπηςζδ ηδξ α1 οπμιμκάδαξ, ηαζ 21% ηαζ 18%, βζα ηδ β ηαζ ε οπμιμκάδα ακηίζημζπα (Kostelidou et al., 2007; Kostelidou et al., 2006; Psaridi-Linardaki et al., 2005). ακ ζοιπέναζια, υθεξ αοηέξ μζ ζπεηζγυιεκεξ ιε ακηζζχιαηα ηαηαζηάζεζξ θαίκεηαζ πςξ επζδέπμκηαζ ακμζμηνμπμπμζδηζηέξ εεναπείεξ. Δίκαζ ζδιακηζηυ κα βίκεηαζ ζπεηζηά κςνίξ δ ακαβκχνζζδ ηςκ ζοιπηςιάηςκ ηαζ κα είιαζηε ζίβμονμζ ςξ πνμξ ηδ δζάβκςζδ, έηζζ χζηε κα βίκεηαζ πζμ απμηεθεζιαηζηή δζαπείνζζδ ηδξ αζεέκεζαξ. Γζα κα βίκεζ αοηυ δοκαηυ οπάνπεζ ακάβηδ βζα πζμ αεθηζςιέκεξ ηαζ πζμ επζδέλζεξ δζαβκςζηζηέξ δμηζιαζίεξ. Οζ ιεθθμκηζηέξ εεναπείεξ ζημπεφμοκ κα ζηναθμφκ πνμξ ηδκ ανπζηή επίεεζδ ηςκ ακηζζςιάηςκ πνμξ ηα ακηζβυκα ζηυπμοξ, ακαζηέθθμκηαξ ηδκ ακηζβμκζηή ηνμπμπμίδζδ ηαζ ημ ιμκμπάηζ ζοιπθδνχιαημξ, ιεζχκμκηαξ ημζμοημηνυπςξ ηδκ έηηαζδ ηςκ γδιζχκ. Δηθνάγεηαζ δ εθπίδα υηζ αοηυ εα ιεζχζεζ ηεθζηά θμνηίμ ηδξ κυζμο ηαζ ηδ ιαηνμπνυεεζιδ ακαπδνία Γηάγλσζε ηεο MG Ζ δζάβκςζδ ζηδνίγεηαζ ζηδκ ηθζκζηή ζοιπηςιαημθμβία, ηδκ ελμκοπζζηζηή θοζζηή ελέηαζδ ημο αννχζημο ηαζ ημκ πθήνδ ενβαζηδνζαηυ έθεβπμ. Σμ ζζημνζηυ ηαζ δ κεονμθμβζηή ελέηαζδ πανέπμοκ ηα πζμ ζδιακηζηά ζημζπεία ζηα μπμία ααζίγεηαζ δ δζάβκςζδ ηδξ ιοαζεέκεζαξ. Ζ ιοαζεέκεζα, υπςξ πνμακαθένεδηε, πνμηαθεί αδοκαιία δ μπμία είκαζ πζμ 60

61 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ έηδδθδ ζε μνζζιέκεξ ιοσηέξ μιάδεξ, ηοπζηά πανμοζζάγεζ δζαηοιάκζεζξ, εκχ ημ ηφνζμ παναηηδνζζηζηυ ηδξ είκαζ δ βνήβμνδ ελάκηθδζδ ηςκ ζηεθεηζηχκ ιοχκ ηαηά ηδκ πνμζπάεεζα. Φανιαημθμβζηέξ, δθεηηνμθοζζμθμβζηέξ ηαζ μνμθμβζηέξ δμηζιαζίεξ πνδζζιμπμζμφκηαζ ιε ζημπυ κα επζαεααζχζμοκ ηδκ ηθζκζηή δζάβκςζδ ηδξ ιοαζεέκεζαξ (Meriggioli and Sanders, 2009; Παπαπεηνυπμοθμξ, 1990). Δηθόλα 8. Γηαγλσζηηθό ζρήκα γηα ηελ νινθιεξσκέλε δηάγλσζε θμζ μζ αζεεκείξ ιε οπμρία MG εα πνέπεζ κα οπμαθδεμφκ ζε δμηζιαζίεξ βζα ακηί-achr ακηζζχιαηα. Ζ ακίπκεοζδ ακηί-achr ακηζζςιάηςκ ημο μνμφ ζε έκακ αζεεκή ιε ηδκ ηαηάθθδθδ ηθζκζηή εζηυκα, ηαη' μοζία επζαεααζχκεζ ηδ δζάβκςζδ ηδξ MG ηαζ απμθεφβεηαζ δ ακάβηδ βζα πεναζηένς δμηζιέξ. Ζ ακηί-musk δμηζιή βίκεηαζ ζοκήεςξ ζε αζεεκείξ ιε βεκζηεοιέκδ MG πμο είκαζ ανκδηζημί βζα AChR ακηζζχιαηα, αθθά εα ιπμνμφζε υιςξ κα βίκεζ εεχνδζδ ζηδκ απεοεείαξ ακηί-musk ελέηαζδ (ηαοηυπνμκα ιε ηδκ ακηί-achr ελέηαζδ) ζηδκ πανμοζία ηδξ ζμαανήξ πνμιδηζηήξ ηαζ αδοκαιίαξ ζημοξ ιοξ ημο πνυζςπμο ηαζ έκημκδξ ιοσηήξ αηνμθίαξ. Οζ επακαθαιαακυιεκεξ δμηζιέξ ζηδκ δζέβενζδ ηςκ κεφνςκ ηαζ SFEMG ζοκήεςξ βίκμκηαζ, εκχ ακαιέκμκηαζ ηα απμηεθέζιαηα ηδξ ελέηαζδξ ηςκ ακηζζςιάηςκ ηαζ αηυια ηαζ ακ μζ δθεηηνμθοζζμθμβζηέξ ελεηάζεζξ είκαζ εεηζηέξ, ηα απμηεθέζιαηα ημο εθέβπμο ηςκ ακηζζςιάηςκ είκαζ αηυια πνήζζια βζα ημκ εκημπζζιυ αζεεκχκ ιε ζδζαίηενμοξ οπυηοπμοξ ηδξ MG. Οζ δμηζιέξ εδνμθχκζμ ηαζ παβμηφζηδ βίκμκηαζ ζε επζθεβιέκμοξ αζεεκείξ πανάθθδθα, υπμο οπάνπεζ οπμρία βζα MG δζάβκςζδ (οπμδεζηκφμκηαζ απυ έκα δζαηεημιιέκμ πενίβναιια), αθθά είκαζ επζεοιδηή πζμ ακηζηεζιεκζηή επζαεααίςζδ (ακηί-achr ακηζζχιαηα, επακαθαιαακυιεκδ δζέβενζδ ηςκ κεφνςκ, ή SFEMG). AChR: οπμδμπείξ αηεηοθμπμθίκδξ, MG: αανζά ιοαζεέκεζα, MuSK: εζδζηή ιοσηή ηζκάζδ ηδξ ηονμζίκδξ, SFEMG: δθεηηνμιομβνάθδια ιμκήνμοξ ίκαξ. Πνoζανιμζιέκμ απυ ημ Lancet Neurol May; 8(5): Merrigioli M. et al. 61

62 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ πκπηώκαηα Ζ ιοσηή αδοκαιία είκαζ ημ ηονίανπμ ζφιπηςια ηαζ δ βνήβμνδ ηυπςζδ ελάκηθδζδ ηςκ ζηεθεηζηχκ ιοχκ ζηζξ ζοκδεζζιέκεξ ηαεδιενζκέξ δναζηδνζυηδηεξ, υπςξ πηχζδ ηςκ αθεθάνςκ, δ δζπθςπία ζηδκ παναημθμφεδζδ ηδθεμνάζεςξ ηζκδιαημβνάθμο, δ βνήβμνδ ημφναζδ ζηδ αάδζζδ, ηζξ πνςζκέξ χνεξ ηα πνάβιαηα είκαζ ηαθφηενα ζπεδυκ πςνίξ αδοκαιία ηαζ υζμ πνμπςνάεζ δ διένα δ αδοκαιία ειθακίγεηαζ ηαζ δοκαιχκεζ. Σα ζοιπηχιαηα ζοκήεςξ ανπίγμοκ απυ ημοξ μθεαθιζημφξ ιοξ ζημ 50% ηςκ αννχζηςκ ηαζ ζημ 30% απυ ημοξ πνμιδηζημφξ (δοζηαηαπμζία-δοζανενία) ηαζ ημοξ οπυθμζπμοξ απυ ημοξ ιοξ ηςκ άηνςκ ημο αοπέκα ή ημοξ ακαπκεοζηζημφξ (δφζπκμζα ηοάκςζδ πμο ιπμνεί κα απεζθήζεζ ηδ γςή ακ δεκ ακηζιεηςπζζεεί έβηαζνα). Ζ ζοκήεδξ ηάζδ είκαζ ιεηά απυ διένεξ-εαδμιάδεξ κα επεηηαεεί ηαζ ζε άθθμοξ ιοξ ηαζ κα βεκζηεοεεί (βεκζηεοιέκδ ιοαζεέκεζα). Λζβυηενμ ζοπκά ιέκεζ εκημπζζιέκδ ζοκήεςξ ζημοξ μθεαθιζημφξ ιοξ (μθεαθιζηή ιοαζεέκεζα) ή ηα ζοιπηχιαηα οπμπςνμφκ (φθεζδ) βζα ιήκεξ ή ηαζ πνυκζα ηαζ ιεηά πάθζ οπμηνμπζάγεζ. Βέααζα μζ εεναπεοηζηέξ ιαξ πανειαάζεζξ ηνμπμπμζμφκ μοζζαζηζηά ηδκ πμνεία ηδξ. Δζδζηά δ εκημπζζιέκδ ζημοξ μθεαθιζημφξ ιοξ ανηεηά ζοπκά έπεζ ηδκ ηάζδ κα παναιέκεζ εκημπζζιέκδ. Παθζυηενα πζζηεουηακ υηζ ακ παναιείκεζ εκημπζζιέκδ βζα δφμ πνυκζα απμηθείεηαζ κα βεκζηεοεεί, πνάβια πμο ζήιενα δεκ βίκεηαζ δεηηυ ηυζμ δμβιαηζηά, υπςξ έδεζλε ηαζ ιία πνυζθαηδ ιεθέηδ (απυ ημοξ 28 αννχζημοξ ιε μθεαθιζηή ιμνθή ζηα δφμ πνυκζα είπε βεκζηεοεεί ζημοξ 9 ηαζ ζηα μηηχ ζημοξ 11). ε ιενζημφξ αννχζημοξ ηα ζοιπηχιαηα ειθακίγμκηαζ ιεηά ηδκ ημφναζδ ηαζ ελαθακίγμκηαζ βνήβμνα ζε ζδιείμ πμο εφημθα μδδβεί ζε παναπθακδηζηή θάεμξ δζάβκςζδ (Τπυηνζζδ-Τζηενία) (Papapetropoulos et al., 2003). ε ιενζημφξ αννχζημοξ πνμζηίεεκηαζ ζηδ ιοσηή αδοκαιία ηαζ αζζεδηζηέξ δζαηαναπέξ, υπςξ άθβδ ζημοξ ιεηςπζαίμοξ, ζηδκ έκημκδ παναηεζκυιεκδ πνμζπάεεζά ημοξ κα ακεαάγμοκ ηα πεζιέκα αθέθανα ηαζ ζημοξ ιοξ ημο αοπέκα. ηδ θοζζηή ελέηαζδ ημο αννχζημο ιε ηδ δμηζιαζία ημπχζεςξ, ακαδεζηκφεηαζ δ βνήβμνδ ελάκηθδζδ ηςκ ιοχκ: ζε θίβα δεοηενυθεπηα ζηδκ εκαηέκζζδ, πέθημοκ ηα αθέθανα ηαζ ανπίγμοκ κα αθέπμοκ δζπθά, ηαεχξ ηαζ ηα πένζα-πυδζα ζηδκ έηηαζδ, πέθημοκ επίζδξ πμθφ βνδβμνυηενα απ υηζ ζηα θοζζμθμβζηά άημια. Κάηζ πμο αμδεά πενζζζυηενμ απυ ηδκ ημπςζζιυηδηα ηαηά ηδ δζάνηεζα ηδξ πμνείαξ αλζμθυβδζδξ εκυξ αζεεκμφξ, είκαζ δ ειθάκζζδ δζαηοιακζζιυηδηαξ, δ μπμία 62

63 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ επζζδιαίκεηαζ απυ ηδ δζαθμνά ιεηαλφ ζηζβιζαίςκ εηηζιήζεςκ ηδξ ιοσηήξ ζζπφμξ ζε δζαθμνεηζηέξ χνεξ ηδξ διέναξ. Ο μθεαθιυξ ιπμνεί κα παναιέκεζ πθήνςξ ακμζηηυξ ηαηά ηδκ έκανλδ ηδξ ελέηαζδξ, εκχ ανβυηενα ιπμνεί κα πανμοζζάγεζ ιενζηή πηχζδ ή ημ ακηίεεημ, δ ιπμνεί κα οπάνπεζ ζζημνζηυ ζδιακηζηήξ δζαηφιακζδξ ηςκ ζοιπηςιάηςκ απυ ηδκ ηζκδηζηυηδηα ζηζξ δζαθμνεηζηέξ χνεξ ηδξ διέναξ, ιε ηα παναπάκς κα είκαζ πμθφ πζμ εζδζηά βζα ηδ βεκζηεοιέκδ ιοαζεέκεζα. Μεηά ηδκ πθήνδ θοζζηή ελέηαζδ ημο αννχζημο εα αημθμοεήζμοκ δ θανιαημθμβζηή δμηζιαζία ηαζ μ ενβαζηδνζαηυξ (δθεηηνμθοζζμθμβζηυξ κεονμαηηζκμθμβζηυξ ακμζμπδιζηυξ) έθεβπμξ βζα ηδκ επζαεααίςζδ ηδξ δζάβκςζδξ (Παπαπεηνυπμοθμξ, 1990) Φαξκαθνινγηθέο - δνθηκαζίεο α. Γνθηκαζία Δδξνθσλίνπ (Tensilon test) Ζ δζάβκςζδ επζαεααζχκεηαζ ιε ηδκ πμνήβδζδ θανιάηςκ, ηα μπμία ακαζηέθθμοκ ηδ δνάζδ ηδξ αηεηοθμπμθζκεζηενάζδξ ηαζ επζηνέπμοκ ζηδκ αηεηοθμπμθίκδ κα παναηείκεζ ηδκ αθθδθεπίδναζδ ηδξ ιε ημοξ οπμδμπείξ πμο έπμοκ απμιείκεζ ζηδ κεονμιοσηή ζφκαρδ ηςκ αζεεκχκ, πνμηαθχκηαξ ιοσηή εκδοκάιςζδ. ηδκ πενίπηςζδ πμο δ απυηνζζδ ημο αζεεκμφξ (αφλδζδ ηδξ ιοσηήξ ζζπφμξ) ζηδ πμνήβδζδ ημο θανιάημο (εδνμθχκζμ) είκαζ εεηζηή, απμηεθεί δζαβκςζηζηυ δείηηδ ηδξ κυζμο. Ζ ακηαπυηνζζδ ζημ θάνιαημ αοηυ είκαζ άιεζδ (ζε 30 δεοηενυθεπηα πενίπμο) αθθά ημ απμηέθεζια αναπείαξ δζάνηεζαξ (πενίπμο 5 θεπηά (Sanders and Massey, 2008). Γζα ηδκ μθεαθιζηή ιμνθή είκαζ πνμηζιυηενδ δ πνμζηζβιίκδ (Παπαπεηνυπμοθμξ, 1990). β. Γνθηκαζία παγνθύζηεο (Ice Pack Test) Ζ «δμηζιαζία ηδξ παβμηφζηδξ» [ice pack test] ιπμνεί κα είκαζ πνήζζιδ βζα ηδ δζάβκςζδ ηδξ μθεαθιζηήξ ιοαζεέκεζαξ, αθθά εα πνέπεζ κα ενιδκεφεηαζ ςξ εεηζηή ιυκμ υηακ οπάνπεζ ιζα λεηάεανδ ηαζ ακαιθζζαήηδηδ αεθηίςζδ ηδξ αθεθανυπηςζδξ (ηαηά ημοθάπζζημκ 2 πζθζμζηά) ιεηά απυ εθανιμβή ιζαξ παβμηφζηδξ ζημ πνμζαεαθδιέκμ αθέθανμ βζα δζάζηδια 2 θεπηχκ. Ζ εοαζζεδζία ηαζ δ εζδζηυηδηα αοηήξ ηδξ δμηζιαζίαξ (82% ηαζ 96%, ακηίζημζπα), δεκ έπμοκ ιεθεηδεεί επανηχξ. Σα δεδμιέκα απυ ιζα ζεζνά ιεθεηχκ δείπκμοκ υηζ 63

64 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ιπμνεί κα είκαζ ακαιεκυιεκδ δ ιενζηή ηαζ υπζ δ πθήνδξ ακηαπυηνζζδ ζηδ δμηζιαζία παβμηφζηδξ ζε ιοαζεεκείξ ιε δζπθςπία (Chatzistefanou et al., 2009). Δηθόλα 9. Φαξκαθνινγηθέο Γνθηκαζίεο α) Γμηζιαζία Δδνμθςκίμο (Tensilon test): Ζ πμνήβδζδ ημο θανιάημο πνμηαθεί πνμζςνζκή αφλδζδ ηδξ ιοζηήξ ζζπφμξ ηαζ αεθηίςζδ ηδξ εζηυκαξ. α) Γμηζιαζία παβμηφζηδξ (Ice pack test): Bεθηίςζδ ηδξ αθεθανυπηςζδξ ιεηά απυ εθανιμβή ιζαξ παβμηφζηδξ ζημ αθέθανμ Ζιεθηξνθπζηνινγηθέο - δνθηκαζίεο α. Ζιεθηξνκπνγξάθεκα κνλήξνπο ίλαο (SFEMG) Με ηζξ δθεηηνμδζαβκςζηζηέξ ιεευδμοξ, ηαζ ηονίςξ ιε ημ δθεηηνμιομβνάθδια ιμκήνμοξ ίκαξ (single fiber electromyography), ηαηαβνάθμκηαζ ηα δοκαιζηά εκένβεζαξ ιειμκςιέκςκ ιοσηχκ ζκχκ πμο ακήημοκ ζηδκ ίδζα ηζκδηζηή ιμκάδα ηαζ ιε ημκ ηνυπμ αοηυ ακζπκεφεηαζ δ ηαεοζηένδζδ ή απμηοπία ηδξ κεονμδζααίααζδξ. ε δφμ ιοσηέξ ίκεξ ηδξ ίδζαξ ηζκδηζηήξ ιμκάδμξ εθανιυγμκηαζ εζδζηά εκδμιοσηά δθεηηνυδζα βζα ηδκ ηαηαβναθή ηςκ δοκαιζηχκ εκενβείαξ ηαζ ηαηαδεζηκφεηαζ δ ηοιαζκυιεκδ πνμκζηή δζαθμνά ηςκ δφμ δοκαιζηχκ πμο μκμιάγεηαζ θαζκυιεκμ jitter. ηδ ιοαζεέκεζα ημ jitter είκαζ πζμ έκημκμ παεμθμβζηυ, εκχ ζημ θοζζμθμβζηυ ιο, ιυκμ ημ 1 απυ ηα 20 πμο ελεηάγμκηαζ ιπμνεί κα ανεεεί παεμθμβζηυ. ηδ ιοαζεέκεζα ημ 1 απυ ηα 2 δοκαιζηά ιπμνεί ηαζ κα απμοζζάγεζ. Ζ 64

65 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ ελέηαζδ αοηή είκαζ πμθφ αλζυπζζημξ δζαβκςζηζηυξ δείηηδξ ηαζ ακ έκαξ αδφκαημξ ιοξ έπεζ θοζζμθμβζηυ jitter, ηυηε ιπμνμφιε κα απμηθείζμοιε ηδ ιοαζεέκεζα. (Stalberg, 1999). β. Δπαλαιεπηηθόο εξεζηζκόο (Repetitive Nerve stimulation) Ζ ιέεμδμξ ημο επακαθδπηζημφ ενεεζζιμφ (δμηζιαζία Desmedt) ημο κεφνμο έβηεζηαζ ζηδκ επίδναζδ δθεηηνζηχκ παθιχκ ιε νοειυ πενίπμο 3 παθιμφξ/δεοηενυθεπημ ζημ κεφνμ ηαζ ζηδ ζοκέπεζα ηαηαβναθή ηςκ δοκαιζηχκ εκενβείαξ ζηδκ επζθάκεζα ημο ιουξ. ε οβζή άημια μζ δζαδμπζημί ενεεζζιμί ημο κεφνμο πνμηαθμφκ ιζα ανβή ηαζ αζήιακηδ εθάηηςζδ ημο πθάημοξ ηςκ δοκαιζηχκ εκενβείαξ πμο ηαηαβνάθμκηαζ ζημ ιο. ε ιοαζεεκείξ ςζηυζμ αοηή δ εθάηηςζδ ειθακίγεηαζ πμθφ πζμ ζφκημια ηαζ είκαζ πμθφ ιεβαθφηενδ. H ιείςζδ ημο φρμοξ ζημοξ ιοαζεεκείξ θεάκεζ απυ 10 έςξ 80%, εκχ ζημοξ θοζζμθμβζημφξ δεκ λεπενκά ημ 8% (Keesey, 1989). Δηθόλα 10. Ζιεθηξνθπζηνινγηθέο - δνθηκαζίεο α. Ζθεηηνμιομβνάθδια ιμκήνμοξ ίκαξ (SFEMG): Παναηδνείηαζ αολδιέκδ ηοιαζκυιεκδ πνμκζηή δζαθμνά ζημ πθάημξ ηςκ δφμ δοκαιζηχκ (jitter) ηαζ απμηθεζζιυξ ημο δοκαιζημφ. β. Δπακαθδπηζηυξ κεονζηυξ ενεεζζιυξ: ηακ βίκεηαζ ζφβηνζζδ ιεηαλφ ημο πνχημο ιε ημ ηέηανημ ή ημ πέιπημ ενέεζζια ηυηε παναηδνείηαζ εθάηηςζδ ζημ φρμξ ημο δοκαιζημφ 65

66 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Νεπξναθηηλνινγηθόο έιεγρνο Ζ αλμκζηή ημιμβναθία ημο ιεζμεςναηίμο ζημ 65% ηςκ πενζπηχζεςκ, απμηαθφπηεζ οπενπθαζία ημο εφιμο αδέκα ηαζ ζημ 10% εφιςια. πςξ ζδιεζχκεηαζ ζηδ ζοκέπεζα αλμκζηή ημιμβναθία εα πνέπεζ κα βίκεηαζ ηαζ ζηδ αάζδ ημο ηνακίμο (Wolf et al., 1986) Αλνζνινγηθέο δνθηκαζίεο - Οξνινγηθή δηάγλσζε Χξ ααζζηυξ ποθχκαξ ηδξ δζάβκςζδξ ηδξ ιοαζεέκεζαξ παναιέκεζ μ μνμθμβζηυξ έθεβπμξ ηςκ ακηζζςιάηςκ πμο ζηνέθμκηαζ εκακηίμκ ηςκ οπμδμπέςκ αηεηοθμπμθίκδξ. Σα ακηζζχιαηα πμο ζοκδεέζηενα ιεηνζμφκηαζ είκαζ ηα δεζιεοηζηά [binding] ακηζζχιαηα έκακηζ ηςκ οπμδμπέςκ αηεηοθμπμθίκδξ. Ζ εζδζηυηδηα ηδξ φπανλδξ αοηχκ ηςκ ακηζζςιάηςκ είκαζ ελαζνεηζηά ορδθή (>98%) αθθά δ εοαζζεδζία ημοξ είκαζ ζπεηζηά παιδθή (πενίπμο 85% βζα ηδ ιοαζεέκεζα ηαζ πενίπμο 44% βζα ηδκ μθεαθιζηή ιοαζεέκεζα). Σμ πθήνεξ ζφκμθμ ακηζζςιάηςκ έκακηζ ηςκ οπμδμπέςκ αηεηοθμπμθίκδξ πενζθαιαάκεζ ηαζ ηα ακαζηαθηζηά [blocking] ηαζ ηα ηνμπμπμζδηζηά [modulating] ακηζζχιαηα, ηαεχξ ηαζ ηα ακηζζχιαηα έκακηζ ηςκ βναιιςηχκ ιοχκ [anti-striational antibodies]. Σμ εφνδια εκυξ αολδιέκμο ηίηθμο ακαζηαθηζηχκ ακηζζςιάηςκ επί απμοζίαξ δεζιεοηζηχκ ακηζζςιάηςκ πζεακχξ ακηζπνμζςπεφεζ έκα ρεοδχξ-εεηζηυ απμηέθεζια, αθθά ιζα ιεζμρδθζηή μιάδα αζεεκχκ ιε ιοαζεέκεζα ιπμνεί κα πανμοζζάγμοκ ηνμπμπμζδηζηά ακηζζχιαηα εκχ απμοζζάγμοκ ηα δεζιεοηζηά ακηζζχιαηα (Howard et al., 1987). Σα δεζιεοηζηά ακηζζχιαηα ιπμνμφκ κα εκενβμπμζήζμοκ ημ ζοιπθήνςια ηαζ κα μδδβήζμοκ ζηδκ απχθεζα ηςκ AChRs. Σα ακαζηαθηζηά ακηζζχιαηα ιπμνεί κα επδνεάζμοκ ηδ δέζιεοζδ ηδξ αηεηοθμπμθίκδξ ζημκ οπμδμπέα, ιε απμηέθεζια ηδκ ηαηή ζοζημθή ηςκ ιοχκ. Tα ηνμπμπμζδηζηά ακηζζχιαηα πνμηαθμφκ δζαζφκδεζδ ηςκ οπμδμπέςκ ηαζ ζηδκ ζοκέπεζα εκδμηοηηάνςζδ αοηχκ, ιε ηεθζηυ απμηέθεζια ηδκ απχθεζα ηςκ θεζημονβζηχκ AChRs. Σμ 10-15% πενίπμο ηςκ αηυιςκ ιε επζαεααζςιέκδ MG, δεκ έπμοκ ιεηνήζζιεξ ηζιέξ βζα ηα δεζιεοηζηά, ακαζηαθηζηά ηαζ ηνμπμπμζδηζηά ακηζζχιαηα (Howard et al., 1987). Ανηεημί αζεεκείξ MG εεηζημί ζε ακηί-achr έπμοκ επίζδξ αοημακηζζχιαηα ηαηά ακηζβυκςκ ηςκ νααδςηχκ ιοχκ, υπςξ ηςκ οπμδμπέςκ ηζηίκδξ ηαζ νοακμδίκδξ (Skeie and 66

67 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Romi, 2008). Ζ πανμοζία ηςκ ακηζζςιάηςκ αοηχκ δεκ αθμνά ηδκ πζεακυηδηα πανμοζίαξ ηδξ ίδζαξ ηδξ ιοαζεέκεζαξ, αθθά εβείνεζ ηδκ πζεακυηδηα εκυξ οπμηείιεκμο εοιχιαημξ (ζδίςξ ζε κευηενμοξ αζεεκείξ) (Skeie et al., 2003).Σέημζα ακηζζχιαηα ηαεχξ ηαζ ακηζζχιαηα ηαηά ηοημηζκχκ είκαζ πμθφ ζοκδεζζιέκα ζε αζεεκείξ MG ιε εφιςια ηαζ πνδζζιμπμζμφκηαζ ςξ δζαβκςζηζηυξ δείηηδξ ηδξ πανμοζίαξ εοιχιαημξ. Αοηά ηα ακηζζχιαηα ζοκήεςξ ακζπκεφμκηαζ ιε απθέξ ELISA (π.π. ιία ειπμνζηή ELISA ηδξ DLD-Diagnostika, Αιαμφνβμ) αθθά είκαζ επζεοιδηέξ πενζζζυηενμ εοαίζεδηεξ δμηζιαζίεξ. ημ 40-70% ηςκ αζεεκχκ ιε ανκδηζηέξ μνμθμβζηέξ ηζιέξ βζα ακηί-achr ακηζζχιαηα, έπμοκ ακζπκεοεεί ακηζζχιαηα ζε ιζα εζδζηή ιοσηή ηζκάζδ (MuSK), δ μπμία είκαζ ιένμξ ημο ζοιπθέβιαημξ ημο οπμδμπέα ηδξ αβνίκδξ δ μπμία είκαζ απαναίηδηδ βζα ηδκ ακάπηολδ ηδξ κεονμιοσηήξ ζφκαρδξ (Hoch et al., 2001). O ζφβπνμκμξ ηαζ πθήνδξ μνμθμβζηυξ δζαβκςζηζηυξ έθεβπμξ βζα ηδκ ακίπκεοζδ αοημακηζζςιάηςκ εκακηίμκ ημο οπμδμπέα ηδξ αηεηοθμπμθίκδξ ηαεχξ ηαζ ηςκ άθθςκ ζημζπείςκ ηδξ κεονμιοσηήξ ζφκαρδξ ηα μπμία ειπθέημκηαζ ζηζξ βκςζηέξ έςξ ηχνα αζεέκεζεξ ηδξ κεονμιοσηήξ ζφκαρδξ, πενζθαιαάκεζ δζάθμνεξ ακμζμθμβζηέξ δμηζιαζίεξ υπςξ: δ ναδζμακμζμηαηαηνήικζζδ (RIΡA), δ ακμζμπνμζνμθδηζηή δμηζιαζία εκγοιαηζηήξ δεζιεφζεςξ (ELISA), δ ναδζμακμζμηαηαηνήικζζδ-θεμνζζιμφ (FIPA), δ ααζζζιέκδ ζηα ηφηηανα δμηζιαζία (CBA), ηαζ δ δμηζιαζία έιιεζμο ακμζμθεμνζζιμφ (IFA). Σα αοημακηζζχιαηα πανειπμδίγμοκ ηδκ μιαθή κεονμιοσηή θεζημονβία, πνμηαθχκηαξ ιοσηή αδοκαιία ηαζ ηυπςζδ. Σα επίπεδα ηςκ ακηζζςιάηςκ έκακηζ ηςκ οπμδμπέςκ ηείκμοκ κα ζδιεζχζμοκ αφλδζδ ανηεηέξ εαδμιάδεξ πνζκ απυ ηδκ ειθάκζζδ ζοιπηςιάηςκ ζε αζεεκείξ ιε δζαπζζηςιέκδ MG. Ζ φθεζδ ιεηά ηδκ εοιεηημιή ζοκδέεηαζ ιε ιζα πνμμδεοηζηή ιείςζδ ηςκ επζπέδςκ ηςκ ακηζζςιάηςκ. Καηά ζοκέπεζα, μζ ιεηνήζεζξ ηςκ AChR ακηζζςιάηςκ ιπμνμφκ κα πνδζζιμπμζδεμφκ βζα ηδκ παναημθμφεδζδ ηδξ ελέθζλδξ ηδξ κυζμο, ηαεχξ ηαζ ηα απμηεθέζιαηα ηδξ εεναπείαξ. Ζ MG ζοπκά ζοκδέεηαζ ιε ακηζζχιαηα έκακηζ ηςκ βναιιςηχκ ιοχκ (Striational). Σα ακηζζχιαηα αοηά ανίζημκηαζ ζημ 30% πενίπμο ηςκ αζεεκχκ πμο απέηηδζακ MG. Ο νοειυξ αφλδζδξ ηδξ εεηζηυηδηαξ αολάκεηαζ ιε ηδκ δθζηία έκανλδξ ηδξ κυζμο ηαζ ημ 55% ηςκ αηυιςκ ιε έκανλδ ηδξ κυζμο ιεηά ηδκ δθζηία ηςκ 60 εηχκ εα έπμοκ ηα ακηζζχιαηα αοηά. Σα ακηζζχιαηα αοηά ιπμνεί κα είκαζ εεηζηά ζε αζεεκείξ ιε MG πμο έπμοκ έθθεζρδ ακηί-achr ακηζζςιάηςκ (Meriggioli and Sanders, 67

68 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ 2009). Σα AChR δεζιεοηζηά ακηζζχιαηα ιπμνμφκ επίζδξ κα είκαζ εεηζηά ζε απθά εοιχιαηα υπςξ ημ Lambert-Eaton ιοαζεεκζηυ ζφκδνμιμ, ημκ πνςημπαεή ηανηίκμ ημο πκεφιμκα ηαζ ζε αζεεκείξ ιε αοημάκμζδ αζεέκεζα ημο ήπαημξ. Παναηήνδζδ ρεοδχξ εεηζηχκ απμηεθεζιάηςκ ιπμνεί κα ζοιαεί ζε αζεεκείξ ιε μνυ πμο έπεζ θδθεεί εκηυξ 48 ςνχκ απυ ηδ πμνήβδζδ ηδξ βεκζηήξ ακαζζεδζίαξ ηαζ ιομπαθανςηζηχκ. Ακηζζχιαηα ζηδκ α- ιπμοκβηανμημλίκδ ιπμνεί ιενζηέξ θμνέξ κα ανεεμφκ ζε αζεεκείξ πμο έθααακ εεναπεία ιε δδθδηήνζμ θζδζμφ (Botox). Ραδζμσζυημπα ηα μπμία έπμοκ πμνδβδεεί πνυζθαηα ιπμνεί κα επδνεάζμοκ ημκ έθεβπμ ιε απνυαθεπημοξ ηνυπμοξ. Αοημακηζζχιαηα έκακηζ ηςκ οπμδμπέςκ ηδξ αηεηοθμπμθίκδξ δεκ ακζπκεφμκηαζ ηαηά ηακυκα ζε ζοββεκή ιοαζεέκεζα. Καηά ζοκέπεζα, μζ ιεηνήζεζξ ηςκ ακηζζςιάηςκ AChR ιπμνεί κα είκαζ πνήζζιεξ ζηδκ παναημθμφεδζδ ηδξ πνμυδμο ηδξ κυζμο, ηαεχξ ηαζ ηζξ επζπηχζεζξ μνζζιέκςκ εεναπεζχκ (Meriggioli and Sanders, 2009). Δηθόλα 11. Γηαγλσζηηθέο κέζνδνη γηα ηελ αλίρλεπζε αληί-achr θαη αληί-musk αληηζσκάησλ Βαζζηή ιεεμδμθμβία ηςκ ηεζζάνςκ ηεπκζηχκ βζα ηδκ ακίπκεοζδ ακηζζςιάηςκ ζημκ μνυ ηςκ ιοαζεεκχκ, Ραδζμακμζμηαηαηνήικζζδ (RIPA), εκγοιζηή ακμζμπνμζνμθδηζηή δμηζιαζία (ΔLISA), ακμζμθεμνζγμιεηνζηυξ πνμζδζμνζζιυξ (FIPA), ααζζζιέκδ ζηα ηφηηανα δμηζιαζία (CBA): Πνμζανιμζιέκμ απυ Autoimmunity, August September 2010; 43(5 6): , Leite et al. 68

69 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Πξνζδηνξηζκόο ησλ δεζκεπηηθώλ (binding) αληηζσκάησλ έλαληη ηνπ AChR Ζ επζηναηέζηενδ μνμθμβζηή ενβαζηδνζαηή δζαβκςζηζηή δμηζιαζία βζα ηδκ ακίπκεοζδ ηςκ ακηί-αchr ακηζζςιάηςκ, ααζίγεηαζ ζημκ ναδζμακμζμθμβζηή πνμζδζμνζζιυ (RIPA) ηςκ ακηζζςιάηςκ έκακηζ ημο δζαθοημπμζδιέκμο ακενχπζκμο οπμδμπέα ηδξ αηεηοθμπμθίκδξ (Lindstrom, 1977), Lindstrom US δζπθχιαηα εονεζζηεπκίαξ, 1977, ηαζ US , Σα ακηζζχιαηα εκακηίμκ ηςκ AChR εεςνμφκηαζ ςξ μ πθέμκ αλζυπζζημξ δζαβκςζηζηυξ δείηηδξ βζα ηδκ ιοαζεέκεζα. Σα ακηζζχιαηα αοηά ακζπκεφμκηαζ ζημκ μνυ, ιε ναδζμακμζμθμβζηυ πνμζδζμνζζιυ, ζε πενίπμο 85-90% ηςκ αζεεκχκ ιε βεκζηεοιέκδ ιοαζεέκεζα. Ωζηυζμ, ζηδκ μθεαθιζηή ιμνθή ηδξ κυζμο ακζπκεφμκηαζ ζε πμζμζηυ ηάης ημο 50-60% ηςκ αζεεκχκ. Χξ ακηζβυκμ πνδζζιμπμζείηαζ δζαθοημπμζδιέκμξ οπμδμπέαξ ηδξ αηεηοθμπμθίκδξ, μ μπμίμξ πνμένπεηαζ είηε απυ ακενχπζκμοξ ιοξ, είηε απυ ηδκ ακενχπζκδ ιοεθμαθαζηζηή ηοηηανζηή ζεζνά (TE671) δ μπμία εηθνάγεζ ιοσημφ-ηφπμο AChR. Οζ οπμδμπείξ είκαζ ζδιαζιέκμζ ιε 125 I-α-ιπμοκβηανμημλίκδ. Σμ δδθδηήνζμ αοηυ πνμένπεηαζ απυ ημ θίδζ (Bungarus multicinctus) ηαζ δεζιεφεηαζ ζημοξ οπμδμπείξ πμθφ ζοβηεηνζιέκα ηαζ ζπεδυκ ιδ ακηζζηνεπηά. Σα αοημακηζζχιαηα πμο οπάνπμοκ ζημκ μνυ ημο αζεεκμφξ πνμζδέκμκηαζ ζημοξ ζδιαζιέκμοξ οπμδμπείξ. Σα πνμηφπημκηα ακμζμζοιπθέβιαηα ηαεζγάκμοκ ιε ακηί-ακενχπζκδ IgG. Σμ πμζυ ηδξ ναδζεκένβεζαξ ζημ ίγδια είκαζ εοεέςξ ακάθμβμ πνμξ ηδκ ζοβηέκηνςζδ ηςκ αοημακηζζςιάηςκ έκακηζ ημο οπμδμπέα ηδξ αηεηοθμπμθίκδξ ζημ δείβια ημο μνμφ (Lindstrom, 1977). Απυ ηδκ δμηζιή αοηήκ εεηζημί ηίηθμζ εεςνμφκηαζ ζοκήεςξ εηείκμζ επάκς απυ πενίπμο 0,4-0,6 nm, ηίηθμζ ηςκ οβζχκ αηυιςκ εηείκμζ ηάης απυ πενίπμο 0,2 nm, εκχ μζ ηίηθμζ εκδζάιεζα εεςνμφκηαζ αιθίαμθμζ (Lindstrom, 1977; Vincent and Newsom-Davis, 1985). Δπζπθέμκ, οπάνπμοκ ιενζηέξ ελαζνέζεζξ υπμο μζ ανκδηζημί ηίηθμζ εεςνήεδηακ ιυκμ εηείκμζ ηάης απυ 0,1 nm (Hayashi et al., 1995), 0,07 nm (Ohta et al., 1990), 0,04 nm (Oda and Ito, 1981) ή αηυια ηαζ ηάης απυ 0,03 nm (Chan et al., 2007). Δπζπθέμκ ηςκ ναδζμακμζμθμβζηχκ δμηζιαζζχκ, δζάθμνεξ θζβυηενμ εοαίζεδηεξ ηαζ αηνζαείξ, ακμζμθμβζηέξ ELISA ιέεμδμζ, έπμοκ ακαπηοπεεί ηαηά ηαζνμφξ (Franciotta et al., 1999; Gotti et al., 1997; Hewer et al., 2006). 69

70 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Σα επίπεδα μνμφ ηςκ ακηζζςιάηςκ εκακηίμκ ηςκ AChR πμζηίθθμοκ εονέςξ ακάιεζα ζε ιοαζεεκζημφξ αζεεκείξ ιε πανυιμζμ ααειυ ιοσηήξ αδοκαιίαξ. Παναηδνείηαζ ιζα ηαθή ζοζπέηζζδ ιεηαλφ ημο ηίηθμο ηςκ ακηζζςιάηςκ ηαζ ηδ ιοσηή αδοκαιία, ζε ιειμκςιέκμοξ υιςξ αζεεκείξ. Δπίζδξ δ ζοβηέκηνςζδ ηςκ ακηζζςιάηςκ αοηχκ ιπμνεί κα είκαζ παιδθή ηαηά ηδκ έκανλδ ηςκ ζοιπηςιάηςκ ηδξ ιοαζεέκεζαξ ηαζ κα αολάκεζ ανβυηενα, μπυηε επακάθδρδ ηδξ ελέηαζδξ ακαγήηδζήξ ημοξ ιπμνεί κα είκαζ απαναίηδηδ, υηακ μζ ανπζηέξ ηζιέξ είκαζ θοζζμθμβζηέξ. Πναηηζηά, υθμζ μζ αζεεκείξ ιε ιοαζεέκεζα ηαζ εφιςια εα έπμοκ αολδιέκμοξ ηίηθμοξ ακηζζςιάηςκ εκακηίμκ ηςκ AChRs (Meriggioli and Sanders, 2004; Παπαπεηνυπμοθμξ, 1990). Ζ δζαβκςζηζηή εζδζηυηδηα ηςκ ακηζζςιάηςκ αοηχκ βζα ηδκ ιοαζεέκεζα είκαζ ανηεηά ηαθή, ακ ηαζ αολδιέκμζ ηίηθμζ ιπμνεί ζπακίςξ κα ανεεμφκ ζε πενζπηχζεζξ αοημάκμζδξ δπαηζηήξ κυζμο, ζοζηδιαηζημφ ενοεδιαηχδμοξ θφημο, θθεβιμκχδμοξ κεονμπάεεζαξ, πθάβζαξ ιοαηνμθζηήξ ζηθήνοκζδξ, υπςξ ηαζ ζε αζεεκείξ ιε εφιςια πςνίξ ιοαζεέκεζα, ζε ζοββεκείξ πνχημο ααειμφ αζεεκχκ ιε επίηηδηδ αοημάκμζδ ιοαζεέκεζα ηαζ ζε αζεεκείξ ιε ιοαζεεκζηυ ζφκδνμιμ Lambert-Eaton (Lennon et al., 1995). ημ 5% πενίπμο ηςκ αζεεκχκ MG πμο δεκ έπμοκ ακζπκεφζζια ακηί-achr ακηζζχιαηα, ακζπκεφεδηακ ακηζζχιαηα ηαηά ηδξ εζδζηήξ ηζκάζδξ ημο ιο (MuSK) (Hoch et al., 2001), (McConville et al., 2004). Oζ MG αζεεκείξ ιε ακηί-musk ακηζζχιαηα απμηεθμφκ ιζα εζδζηή οπμηαηδβμνία ηςκ MG αζεεκχκ. Σα ακηζζχιαηα αοηά ιπμνεί κα δζαδναιαηίζμοκ ζδιακηζηυ νυθμ ζηδκ αθάαδ ηδξ κεονμιοσηήξ ιεηααίααζδξ, δεδμιέκμο υηζ δ MuSK ζοιιεηέπεζ ζηδ ιεηαζοκαπηζηή δζαθμνμπμίδζδ ηαζ ζηδκ ζοκάενμζζδ ηςκ AChRs. ημ οπυθμζπμ πενίπμο 5-10% ηςκ αζεεκχκ ιε βεκζηεοιέκδ MG ηαζ ζημ 50% ηςκ αζεεκχκ μθεαθιζηή MG πνμξ ημ πανυκ δεκ είκαζ δοκαηή δ ακίπκεοζδ ακηζζςιάηςκ. Οζ Leite et al. (Leite et al., 2008) ακέπηολακ ιζα διί-πμζμηζηή ιε αάζδ ημκ θεμνζζιυ δμηζιαζία, βζα ηδκ ακίπκεοζδ ηςκ παιδθήξ ζοββέκεζαξ ακηζζςιάηςκ πμο ζοκδέμκηαζ ιε ημ ζφιπθεβια AChR-Ραρίκδξ, ζηδκ επζθάκεζα ηςκ ακενχπζκςκ ειανοσηχκ κεθνζηχκ ηοηηάνςκ ηα μπμία είκαζ επζιμθοζιέκα απυ ημζκμφ ιε ημ cdna ηςκ AChR οπμιμκάδςκ ηαζ ηδξ Ραρίκδξ (πνςηεΐκδ ημο ηοηηανμζηεθεημφ δ μπμία επάβεζ ζοζζςιαηχιαηα ηςκ AChR). Με ηδκ ακάθοζδ αοηή ακζπκεφμκηαζ ακηί-achr ακηζζχιαηα ζε δζάθμνμοξ μνμφξ, μζ μπμίμζ πνμδβμοιέκςξ είπακ παναηηδνζζεεί ςξ MG μνμανκδηζημί. Γζάθμνμζ ακηί-αchr MG εεηζημί αζεεκείξ, έπμοκ επίζδξ αοημακηζζχιαηα ζηα ακηζβυκα ηςκ βναιιςηχκ ιοχκ, υπςξ ημοξ 70

71 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ οπμδμπείξ ηδξ ηζηίκδξ (titin) ηαζ ηδξ νοακμδίκδξ (ryanodine) (Skeie and Romi, 2008). Σέημζα ακηζζχιαηα ηαεχξ επίζδξ ηαζ ηα ακηζζχιαηα έκακηζ ηςκ ηοημηζκχκ είκαζ πμθφ ημζκά ζημοξ MG αζεεκείξ ιε εφιςια ηαζ πνδζζιμπμζμφκηαζ ςξ δζαβκςζηζηυξ δείηηδξ βζα ηδκ πανμοζία εοιχιαημξ. Σα ακηζζχιαηα αοηά ακζπκεφμκηαζ ζοκήεςξ απυ απθέξ ELISA δμηζιαζίεξ (π.π. έκα ειπμνζηυ ELISA ηαη απυ Did-Diagnostic, Homburg) αθθά οπάνπεζ ακάβηδ βζα πζμ εοαίζεδηεξ δμηζιαζίεξ Πξνζδηνξηζκόο ησλ αλαζηαιηηθώλ (blocking) αληηζσκάησλ έλαληη ηνπ AChR Σα ακαζηαθηζηά ακηζζχιαηα ιπμνεί κα επδνεάζμοκ ηδ δέζιεοζδ ηδξ αηεηοθμπμθίκδξ ζημκ οπμδμπέα, ιε απμηέθεζια ηδκ ηαηή ζοζημθή ηςκ ιοχκ. Σα αοημακηζζχιαηα αοηά πανειπμδίγμοκ ηδκ μιαθή κεονμιοσηή θεζημονβία, ηαζ πνμηαθμφκ ιοσηή αδοκαιία ηαζ ηυπςζδ. Ακαζηαθηζηά AChR ακηζζχιαηα παναηδνμφκηαζ ζημ 52% ηςκ αζεεκχκ ιε αοημάκμζδ MG. Σμ πμζμζηυ ηςκ αηυιςκ μζ μπμίμζ είκαζ εεηζημί βζα ακαζηαθηζηά AChR ακηζζχιαηα, απμοζία AChR δεζιεοηζηχκ ακηζζςιάηςκ, είκαζ 1% πενίπμο. Τπάνπεζ ζδιακηζηή ζοζπέηζζδ ιεηαλφ ηδξ βεκζηεοιέκδξ ιοσηήξ αδοκαιίαξ ηαζ ημο ααειμφ ηδξ ακαζημθήξ ημο οπμδμπέα ηδξ αηεηοθμπμθίκδξ απυ ηα ακηζζχιαηα αοηά. Χξ εη ημφημο, δ ιέηνδζδ ηςκ ακαζηαθηζηχκ αοημακηζζςιάηςκ ηςκ οπμδμπέςκ ηδξ αηεηοθμπμθίκδξ έπεζ πνυζεεηδ αλία ζηδ δζαθμνζηή δζάβκςζδ ηδξ MG. Καηά ηδκ δμηζιαζία αοηή βίκεηαζ πνμεπχαζδ ημο δζαθοημπμζδιέκμο οπμδμπέα ιε ημκ οπυ ελέηαζδ μνυ ημο αζεεκμφξ πνζκ ηδκ πνμζεήηδ 125 I-α-ιπμοκβηανμημλίκδξ βζα ηδκ ζήιακζδ ημο οπμδμπέα ηδξ αηεηοθμπμθίκδξ. Σα ακαζηαθηζηά ακηζζχιαηα έκακηζ ημο οπμδμπέα ηδξ αηεηοθμπμθίκδξ πμο πενζέπμκηαζ ζημ δείβια ακηαβςκίγμκηαζ ιε ηδκ 125 I-α-ιπμοκβηανμημλίκδ βζα πενζμνζζιέκμ ανζειυ εέζεςκ δέζιεοζδξ ζημοξ οπμδμπείξ. Ακ ηα δείβιαηα είκαζ εεηζηά, ηα ακαζηαθηζηά ακηζζχιαηα πνμζημθθχκηαζ ζημοξ οπμδμπείξ ηδξ αηεηοθμπμθίκδξ ηαζ δεκ επζηνέπμοκ ηδκ πνυζδεζδ ηδξ ναδζμζδιαζιέκδξ ημλίκδξ. Σα πνμηφπημκηα ζοιπθέβιαηα απυ ημοξ οπμδμπείξ ηδξ αηεηοθμπμθίκδξ ηαζ ηα εζδζηά ακηζζχιαηα ηαεζγάκμοκ ιε Con-A εθανυγδ. Μεηά ηδ θοβμηέκηνδζδ ηαζ απυννζρδ ημο οπενηείιεκμο ημ ίγδια πνμζιεηνείηαζ βζα 125 I ιε ηδ πνήζδ εκυξ ιεηνδηή β-αηηζκμαμθίαξ. Οζ ιεηνμφιεκεξ ηνμφζεζξ είκαζ ακηζζηνυθςξ ακάθμβεξ πνμξ ηδ ζοβηέκηνςζδ ακαζηαθηζηχκ αοημακηζζςιάηςκ έκακηζ ηςκ οπμδμπέςκ ηδξ αηεηοθμπμθίκδξ 71

72 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ πμο οπάνπμοκ ζημ δείβια. Ζ πθήνδξ ακαζημθή δέζιεοζδξ ηςκ ακηζζςιάηςκ επζηοβπάκεηαζ ιε ηδκ πνμζεήηδ 100πθάζζαξ ιμνζαηήξ ζοβηέκηνςζδξ ιδ ζδιαζιέκδξ α- ιπμοκβηανμημλίκδξ. Ζ ζοβηέκηνςζδ εηθνάγεηαζ ςξ δ (%) δναζηζηυηδηα ηδξ ακαζημθήξ ηδξ δέζιεοζδξ ηδξ 125 I-α-ιπμοκβηανμημλίκδξ ζημοξ οπμδμπείξ (Howard et al., 1987) Αληηγνληθή ηξνπνπνίεζε (antigenic modulation): Βαζηζκέλε ζε θπηηαξνθαιιηέξγεηεο - ξαδηναλνζνινγηθή δνθηκαζία Σα ακηζβυκμ-ηνμπμπμζδηηά ακηζζχιαηα είκαζ οπεφεοκα βζα ηδκ επζηάποκζδ ηδξ απμζφκεεζδξ ηςκ AChRs ζηδκ επζθάκεζα ηςκ ηοηηάνςκ ηςκ ιοχκ. Σα ηνμπμπμζδηζηά δζζεεκή ακηζζχιαηα δζα-ζοκδέμκηαζ ζε δφμ ιυνζα ημο οπμδμπέα, ζηδκ επζθάκεζα ηςκ ηοηηάνςκ ηαζ επζηαπφκμοκ ηδκ εκδμηοηηάνςζδ ηαζ ηδκ απμζημδυιδζδ αοηχκ. Ζ ζπεηζηή αφλδζδ ημο πμζμζημφ απμζημδυιδζδξ, ακηζζημζπεί ζε ιεβάθμ ααειυ ιε ηδ αανφηδηα ηδξ κυζμο. Δπεζδή δ δζαθμνμπμίδζδ ημο AChR ελανηάηαζ απυ ημκ εκενβυ ιεηααμθζζιυ, είκαζ απαναίηδηδ δ πνήζδ γςκηακχκ ακενχπζκςκ ζηεθεηζηχκ ηοηηάνςκ ζε ηαθθζένβεζα βζα ηδκ ακίπκεοζδ ηςκ ακηζβυκμ-ηνμπμπμζδηζηχκ ακηζζςιάηςκ. Μζα ακενχπζκδ ιοεθμαθαζηζηή ηοηηανζηή ζεζνά (TE671), ανέεδηε κα εηθνάγεζ ιοσημφ-ηφπμο AChR (Luther et al., 1989). Ακ ηαζ είκαζ πενίενβμ πςξ ιζα κεονμθμβζηή ηοηηανζηή ζεζνά εηθνάγεζ ιοσημφ-ηφπμο οπμδμπείξ, απμδείπεδηε υηζ δ TE671 ηοηηανζηή ζεζνά είκαζ πνήζζιδ βζαηί υπζ ιυκμ πνδζζιεφεζ ςξ αλζυπζζηδ πδβή δζαθοημφ AChR, αθθά ηαζ βζαηί επζηνέπεζ ημκ ηαεμνζζιυ πθέμκ εζδζηυηενςκ ηαζ εοαίζεδηςκ δμηζιαζζχκ βζα ηδκ ακίπκεοζδ ακηζβυκμ-ηνμπμπμζδηζηχκ ακηζζςιάηςκ. Βαζίγεηαζ ζηδκ ηαπεία εκδμηοηηάνςζδ ημο 125 I-α-ιπμοκβηανμημλίκδξ-AChR ζοιπθυημο πνδζζιμπμζχκηαξ RD ηφηηανα (Tzartos et al., 1986) Αληηζώκαηα ελαληίνλ ηεο πξσηεΐλεο MuSK ε έκα πμζμζηυ αζεεκχκ ιε βεκζηεοιέκδ «μνμανκδηζηή» ιοαζεέκεζα (ιοαζεέκεζα πςνίξ ακηζζχιαηα εκακηίμκ ηςκ AChR), έπμοκ ακζπκεοεεί IgG ακηζζχιαηα εκακηίμκ ηδξ MuSK, ιίαξ πνςηεΐκδξ ηδξ κεονμιοσηήξ ζφκαρδξ, δ μπμία, υπςξ έπεζ ακαθενεεί κςνίηενα, δζαδναιαηίγεζ ζδιακηζηυ νυθμ ζηδ ζοζζχνεοζδ ηςκ AChR ζηδ ιεηαζοκαπηζηή ιειανάκδ. 72

73 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Σδκ πανμφζα πενίμδμ ηα ακηί-musk ακηζζχιαηα ζημοξ μνμφξ ηςκ αζεεκχκ ακζπκεφμκηαζ ιε ναδζμακμζμθμβζηυ πνμζδζμνζζιυ απυ ιζα RIPA πμο πνδζζιμπμζεί μθυηθδνδ ηδκ ελςηοηηανζηή πενζμπή ακενχπζκδξ MuSK, δ μπμία ζδιαίκεηαζ άιεζα ιε 125 Η (Matthews et al., 2004), ιζα ειπμνζηή δζαβκςζηζηή ελέηαζδ δζαεέζζιδ απυ ηδκ RSR Ltd. Δκ ζοκημιία, μ μνυξ επςάγεηαζ ιε 125 I-MuSK οπμδμπέα ηαζ ηα ζφιπθμημ 125 I- MuSK-ακηίζςια ηαηαηνδικίγεηαζ ιε ακηί-ακενχπζκα IgG ακηζζχιαηα. Σμ πμζυ ηδξ ναδζεκένβεζαξ ζημ ίγδια είκαζ εοεέςξ ακάθμβμ πνμξ ηδκ ζοβηέκηνςζδ ηςκ αοημακηζζςιάηςκ έκακηζ ηδξ MuSK. H ναδζεκένβεζα ημο ζγήιαημξ ιεηνάηαζ ζε ιεηνδηή β- αηηζκμαμθίαξ ηαζ ζηδ ζοκέπεζα βίκεηαζ πνμζδζμνζζιυξ ηδξ ζοβηέκηνςζδξ ηςκ ακηί-musk αοημακηζζςιάηςκ Αληί-Tηηίλε αληηζώκαηα ημ 80% πενίπμο ηςκ αζεεκχκ ιε MG ιπμνεί κα ακζπκεοεεί αθθμίςζδ ημο εφιμο αδέκα. Πενίπμο ημ 10% ηςκ αζεεκχκ ειθακίγμοκ κεμπθαζίεξ ημο εφιμο αδέκα, υπςξ επζεδθζαηχκ υβηςκ εφιμο (ΣΔΣ) ή εοιζημφ ηανηζκχιαημξ. Ζ έβηαζνδ δζάβκςζδ ηδξ εοιχιαημξ ηαζ δ επαηυθμοεδ εοιεηημιή είκαζ ηαεμνζζηζηή βζα ηδκ εεναπεία ηςκ αζεεκχκ αοηχκ. Οζ πενζζζυηενμζ απυ ημοξ αζεεκείξ ακαπηφζζμοκ ακηζζχιαηα έκακηζ ηςκ οπμδμπέςκ ηδξ αηεηοθμπμθίκδξ πμο ιπμνεί κα ακζπκεοεμφκ ιε ηδκ AChR-Ab δμηζιαζία βζα ηδ δζάβκςζδ ηδξ ιοαζεέκεζαξ, ηαεχξ επίζδξ ηαζ αοημακηζζχιαηα έκακηζ ηςκ βναιιςηχκ ιοχκ, υπςξ ιεηαλφ άθθςκ ακηζζχιαηα ηαηά ηδξ ηζηίκδξ. Ζ ηζηίκδ είκαζ ιζα πνςηεΐκδ ηςκ νααδςηχκ ιοχκ ιε ελαζνεηζηά ορδθυ ιμνζαηυ αάνμξ. Ζ ακμζμβμκζηή πενζμπή ηδξ ηζηίκδξ ανίζηεηαζ ζε έκα εναφζια 30 kd ηδξ πνςηεΐκδξ. Ακηζζχιαηα ηαηά ημο εκ θυβς εναφζιαημξ πζεακχξ ακηζδνμφκ δζαζηαονςηά ιε ημοξ επίημπμοξ ηςκ οπμδμπέςκ ηδξ αηεηοθμπμθίκδξ (πανακεμπθαζιαηζηή MG). Σμ ακαζοκδοαζιέκμ πεπηίδζμ MGT30 πνδζζιμπμζείηαζ ζηδκ ELISA βζα ημκ εζδζηυ πνμζδζμνζζιυ ηςκ ακηί-ηζηίκδ ακηζζςιάηςκ. Ζ κέα ακάθοζδ ELISA είκαζ ζαθχξ ακχηενδ απυ ηδ δμηζιή ακμζμθεμνζζιμφ πνμξ ηιήιαηα ημο βναιιςημφ ιο πνμενπυιεκμο απυ ακενχπμοξ ή ηςκ πζεήημοξ. Σμ ακηί-ηζηίκδ ELISA kit, πνδζζιμπμζεί ηδ ιμνθή πθάηαξ ιζηνμηζηθμδυηδζδξ. Σμ ακαζοκδοαζιέκμο ηιήια ηδξ ηζηίκδξ (MGT30 πεπηίδζμ) επζζηνχκεηαζ επάκς ζηδκ επζθάκεζα ηδξ πθάηαξ. Σα αναζςιέκα δείβιαηα ημο μνμφ 73

74 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ επςάγμκηαζ χζηε κα επζηνέρμοκ ζηα ακηζζχιαηα ηδξ ηζηίκδξ κα πνμζημθθδεμφκ ζηδκ πθαζηζηή επζθάκεζα. Μεηά απυ ημ λέπθοια ηςκ αδέζιεοηςκ ακηζζςιάηςκ ηαζ ηςκ ζοζηαηζηχκ ημο μνμφ, ηα εζδζηά ακηζζχιαηα ηζηίκδξ ακζπκεφμκηαζ απυ πνςηεΐκδ A- οπενμλεζδάζδ. Ζ ακηίδναζδ TMB/οπενμλεζδάζδ παναημθμοεείηαζ ζηα 450nm (Voltz et al., 1997) Νέεο αλαδπόκελεο αλνζνινγηθέο δνθηκαζίεο γηα ηε βειηίσζε ηεο δηάγλσζεο Τπάνπμοκ δφμ ηφνζμζ θυβμζ βζα ηδκ ακάπηολδ κέςκ πζμ εοαίζεδηςκ ηαζ πζμ απμηεθεζιαηζηχκ ηεπκζηχκ βζα ακμζμθμβζημφξ πνμζδζμνζζιμφξ. Πνχημκ, δ επίιμκδ μνμανκδηζηυηδηα βζα ακηί-achr ηαζ ακηί-musk ακηζζχιαηα ζε ζδιακηζηυ πμζμζηυ ηςκ μνχκ MG αζεεκχκ, ιε ηδκ πνήζδ ηςκ ζοκήεςκ δζαβκςζηζηχκ δμηζιαζζχκ (RIPA, ELISA) υπςξ ακαθένεδηε παναπάκς. Γεφηενμκ, δ δοκαηυηδηα πνήζδξ ζδιαζιέκςκ ιε θεμνζζιυ πνςηεσκχκ, μζ μπμίεξ είηε εηθνάγμκηαζ ζηδκ επζθάκεζα ηςκ ηοηηάνςκ ζε ηοηηανζηέξ ζεζνέξ εδθαζηζηχκ ή πανάβμκηαζ ζε δζαθοηή ιμνθή ζε άθθα ηφηηανα έηθναζδξ (π.π. ηφηηανα εκηυιςκ) Γνθηκαζία αλνζνθαηαθξήκληζεο θζνξηζκνύ (FIPA) Ζ πνήζδ ηεπκζηχκ ακμζμηαηαηνήικζζδξ θεμνζζιμφ (FIPAs), ιε ηδκ πνήζδ ακηζβυκςκ ζδιαζιέκςκ απεοεείαξ ιε θεμνζζιυ, ακαθένμκηαζ βζα πνχηδ θμνά βζα ηδ ιέηνδζδ ακηζζςιάηςκ έκακηζ ηδξ αημοαπμνίκδξ-4 ζηδκ Οπηζηή Νεονμιοεθίηζδα (Νeuromyelitis Optica) (Waters P, 2008), ή πνμξ ηδκ α-1 οπμιμκάδα ημο οπμδμπέα ηδξ βθοηίκδξ ζε έκακ αζεεκή ιε πνμμδεοηζηή εβηεθαθμπάεεζα ιε αηαιρία ηαζ ιουηθμκμ (Hutchinson 2008). Ζ πνμζέββζζδ αοηή εηηυξ ημο υηζ δεκ πνδζζιμπμζεί ναδζεκενβά ζδιαζιέκα ακηζβυκα, έπεζ επζπθέμκ ημ πθεμκέηηδια υηζ ιπμνεί ηακείξ κα πνδζζιμπμζήζεζ δζαθμνεηζηά ζδιαζιέκεξ ιε θεμνζζιυ πνςηεΐκεξ, μφηςξ χζηε κα επζηνέπεηαζ δ ηαοηυπνμκδ ακίπκεοζδ ηςκ ακηζζςιάηςκ ζε δφμ ή πενζζζυηενα ακηζβυκα. Γζα πανάδεζβια, ιεηνήεδηακ ηαοηυπνμκα ζε ιζα μιάδα απυ 51 μνμφξ απυ MG αζεεκείξ ζηδκ Κίκα, ηα ακηζζχιαηα βζα ημκ EGFP-AChR ηαζ ηδκ mcherry-musk, ιε ιία κέα ιέεμδμ δ μπμία δεκ είπε δμηζιαζηεί ζημ 74

75 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ πανεθευκ. Σα απμηεθέζιαηα ηςκ FIPAs ζοζπεηίγμκηαζ ζδζαίηενα ζηακμπμζδηζηά ιε εηείκα ηςκ RIPAs ή ιε ηζξ ιεευδμοξ ιε αάζδ ηα ηφηηανα (Yang et al.) Γνθηκαζία κε ηε ρξήζε κε-κπηθήο θπηηαξηθήο ζεηξάο (Cell Based Assay- CBA) Πνυζθαηα ακαπηφπεδηε ηαζ ακαημζκχεδηε ιζα κέα ηεπκζηή βζα ηδκ ακίπκεοζδ ακηζζςιάηςκ έκακηζ ζοζζςιαηςιάηςκ ημο AChR, εηθναζιέκςκ ζηδκ ιειανάκδ HEK ηοηηάνςκ, ηα μπμία είπακ ζοκ-επζιμθοκεεί ιε ηζξ οπμιμκάδεξ ημο AChR. Ζ ζοκεπζιυθοκζδ βίκεηαζ ηαοηυπνμκα ηαζ ιε ηδ ναρίκδ, δ μπμία είκαζ ιζα εκδμηοηηάνζα πνςηεΐκδ δ μπμία ζοιιεηέπεζ ζημ ζπδιαηζζιυ ποηκχκ ζοζηάδςκ ηςκ AChRs ζηδ κεονμιοσηή ζφκαρδ. Ζ ιέεμδμξ αοηή επέηνερε ηδκ ακίπκεοζδ ακηί-achr ακηζζςιάηςκ, ζε πενζζζυηενεξ απυ 60% πενζπηχζεζξ αζεεκχκ, μζ μπμίμζ πνμδβμοιέκςξ είπακ εεςνδεεί ςξ εκηεθχξ ανκδηζηέξ πενζπηχζεζξ ιεηά ημκ ναδζμθμβζηυ ακμζμπνμζδζμνζζιυ ηςκ ακηί-achr ακηζζςιάηςκ (Leite et al., 2008). Δίκαζ επίζδξ ηαηάθθδθδ βζα ηδκ ακίπκεοζδ παιδθήξ ζοββέκεζαξ ακηζζςιάηςκ, ηα μπμία είκαζ εζδζηά βζα ημοξ δφμ ηφπμοξ οπμδμπέςκ (ειανοζημφ ή εκδθίημο), ή ηςκ ακηζζςιάηςκ πνμξ ηδκ εέζδ ζφκδεζδξ ηδξ α-ιπμοκβηανμημλίκδξ (blocking), δ μπμία δεκ είκαζ ηαηεζθδιιέκδ απυ ηδκ ιπμοκβηανμημλίκδ ζε αοηήκ ηδκ ηεπκζηή. Ζ ίδζα ηεπκζηή πμο πνδζζιμπμζήεδηε βζα ημκ οπμδμπέα πνδζζιμπμζήεδηε ηαζ βζα ηδκ ακίπκεοζδ ηςκ ακηί-musk ακηζζςιάηςκ. Ακ ηαζ μζ οπμδμπείξ αοημί δεκ ήηακ ανηεηά ζοβηεκηνςιέκμζ, δ ζπεηζηή έηθναζδ ημοξ ζηδκ επζθάκεζα ημο ηφηηανμο είκαζ πμθφ ορδθή ηαζ ηα απμηεθέζιαηα έδεζλακ υηζ δ ιέεμδμξ πανέπεζ ιεβαθφηενδ εοαζζεδζία. Δίκαζ επίζδξ ζδιακηζηυ κα ακαθενεεί, υηζ ιε ηδκ ααζζζιέκδ ζημ ηφηηανμ πνμζέββζζδ, ιπμνεί κα πνδζζιμπμζδεμφκ βζα ηδκ ιέηνδζδ ηδξ δέζιεοζδξ ηςκ ακηζζςιάηςκ, δζαθμβήξ ηοηηάνςκ (cell sorters), μζ μπμίμζ εκενβμπμζμφκηαζ απυ ημκ θεμνζζιυ (Leite et al., 2008), βεβμκυξ ημ μπμίμ δίκεζ δοκδηζηή αλία ηδξ πνμζέββζζδξ αοηήξ, βζα πνήζδ νμοηίκαξ ζηα δζαβκςζηζηά ενβαζηήνζα. 75

76 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ Έκκεζνο αλνζνθζνξηζκόο (IFA) Ζ έιιεζδ δμηζιαζία πνδζζιμπμζείηαζ βζα ηδκ ακίπκεοζδ IgG ακηζζςιάηςκ βζα ηα ακηζβυκα ηςκ βναιιςηχκ ζηεθεηζηχκ ιοχκ ιε ηδ πνήζδ θεμνζγυκηςκ ακηζζςιάηςκ. Ο ζζηυξ ημπμεεηείηαζ ζε εζδζηά πνμπαναζηεοαζιέκα θνεάηζα ακηζηεζιεκμθυνςκ πθαηχκ ιζηνμζημπίμο. ηδ ζοκέπεζα, πνμζηίεεκηαζ μζ αναζχζεζξ ηςκ μνχκ ηςκ αζεεκχκ, υπμο εάκ οπάνπεζ ακηίζςια, ηυηε αοηυ ζοκδέεηαζ ιε ημ ακηζβυκμ. Ζ ακηίδναζδ βίκεηαζ μναηή ιέζα απυ ηδ πνήζδ εκυξ ζογεφβιαημξ ημ μπμίμ είκαζ ζδιαζιέκδ fluorescein isothiocyanate (FITC), ιε ακηί-ακενχπζκδ IgG (εζδζηή ακηί-βάια αθοζίδα). Σμ ζφγεοβια εα δεζιεοεεί ιε ακενχπζκα IgG ακηζζχιαηα, ηα μπμία ζοκδέμκηαζ ιε ηα ακηζβυκα πμο πνμηαθμφκ θεμνζζιυ, υηακ παναηδνμφκηαζ ιέζα απυ έκα ιζηνμζηυπζμ εθμδζαζιέκμ ιε ιζα πδβή οπενζχδμοξ θςηυξ. Ζ δζέβενζδ ημο FITC απυ ηδκ οπενζχδδ (UV), πνμηαθεί ηδκ πνςζηζηή αοηή κα εηπέιπεζ πθέμκ ζημ μναηυ ιήημξ ηφιαημξ ημο θςηυξ, ηαζ ζοβηεηνζιέκα ζημ ηίηνζκμπνάζζκμ ηιήια ημο θάζιαημξ πνςιάηςκ (Farrugia et al., 2007). 76

77 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ 1.13 ηόρνη ηεο Παξνύζαο Γηαηξηβήο Ζ επζαεααίςζδ ηδξ δζάβκςζδξ ηδξ αοημάκμζδξ αανζάξ ιοαζεέκεζαξ ααζίγεηαζ ηονίςξ ζηδκ μνμθμβζηή ακίπκεοζδ αοημακηζζςιάηςκ έκακηζ δζαθυνςκ ζημζπείςκ ηδξ κεονμιοσηήξ ζφκαρδξ. Οζ δζαεέζζιεξ δζαβκςζηζηέξ δμηζιαζίεξ ζοκήεςξ είκαζ ζηακέξ κα ακζπκεφμοκ ακηζζχιαηα πενίπμο ζημ 90% πενίπμο ηςκ πενζπηχζεςκ ιοαζεεκχκ ιε βεκζηεοιέκδ MG ηαζ ζημ 50% πενίπμο ηςκ πενζπηχζεςκ ιε μθεαθιζηή MG. ημοξ οπυθμζπμοξ αζεεκείξ ηα ακηζζχιαηα αοηά δεκ είκαζ ακζπκεφζζια ηαζ ςξ εη ημφημο οπάνπεζ ιεβάθδ ακάβηδ βζα ηδκ ακάπηολδ ζδζαίηενα εοαίζεδηςκ δζαβκςζηζηχκ ιεευδςκ. Ζ αδοκαιία ακίπκεοζδξ ακηζζςιάηςκ ιπμνεί κα μθείθεηαζ ζηδκ πανμοζία αοημακηζζςιάηςκ έκακηζ αβκχζηςκ αηυια ακηζβυκςκ, ή μζ ζοβηεκηνχζεζξ ηςκ ηοηθμθμνμφκηςκ ακηζζςιάηςκ κα είκαζ ηάης απυ ημ υνζμ εοαζζεδζίαξ ηςκ δζαεέζζιςκ δζαβκςζηζηχκ δμηζιαζζχκ. Ζ οπμρία βζα MG ιπμνεί κα ααζίγεηαζ ζηα ζοιπηχιαηα ή άθθεξ, θζβυηενμ ζοβηεηνζιέκεξ κεονμθοζζμθμβζηέξ δζαβκςζηζηέξ πνμζεββίζεζξ, αθθά δεκ πανέπμοκ αεααζυηδηα βζα ηδκ αζεέκεζα. Ζ αζάθεζα αοηή ζηδκ δζάβκςζδ ηδξ MG πνμηαθεί ζμαανυ πνυαθδια ζηζξ πενζζζυηενεξ πενζπηχζεζξ, δζυηζ ακ ημ απμηέθεζια είκαζ ανκδηζηυ, δδιζμονβείηαζ δ αιθζαμθία ςξ πνμξ ημ ακ οπάνπεζ ή δεκ οπάνπεζ MG ιε επζπηχζεζξ ζηδκ θανιαηεοηζηή αβςβή. ηδκ πναβιαηζηυηδηα, έκαξ πμθφ παιδθυξ ηίηθμξ εα ιπμνμφζε κα είκαζ επανηήξ αηυια ηαζ βζα κα ελδβήζεζ ηδκ πανμοζία ηδξ MG, δεδμιέκμο υηζ δεκ έπεζ δζαπζζηςεεί ζδιακηζηή ζοζπέηζζδ ιεηαλφ ημο ηίηθμο ηςκ ακηζζςιάηςκ ηαζ ηδξ ζμαανυηδηαξ ηδξ κυζμο. Δπζπθέμκ, μζ αζεεκείξ ιε παιδθή πενζεηηζηυηδηα ακηζζςιάηςκ ζημ αίια ημοξ εα ιπμνμφζακ κα έπμοκ ηα πενζζζυηενα ηςκ ακηζζςιάηςκ ημοξ δεζιεοιέκα ζημοξ οπμδμπείξ αοηχκ, αθήκμκηαξ έηζζ ιυκμ εθάπζζηεξ πμζυηδηεξ εθεφεενςκ ακηζζςιάηςκ ζηδκ ηοηθμθμνία πνμξ ακίπκεοζδ ή ιπμνεί κα ανίζημκηαζ ζε ιενζηή ακμζμηαηαζημθή θυβς θήρδξ θανιάηςκ. Άθθεξ ιεθέηεξ πνμηείκμοκ υηζ ηα ακηζζχιαηα αοηά είκαζ πζεακυκ παιδθήξ ζοββέκεζαξ ηαζ ςξ εη ημφημο απαζημφκηαζ ορδθέξ ζοβηεκηνχζεζξ ζοκαενμζζιέκςκ οπμδμπέςκ ζηδκ επζθάκεζα ηοηηάνςκ βζα ηδκ ακίπκεοζδ ημοξ (Vincent et al., 2008). Αηυιδ, ηα ιδ ακζπκεφζζια ακηζζχιαηα ιπμνεί κα ζπεηίγμκηαζ ιε ιδ πνμζδζμνζζιέκα αηυιδ ακηζβυκα (Lindstrom, 2008). Οζ οπάνπμοζεξ ακμζμδζαβκςζηζηέξ δμηζιαζίεξ βζα ηδκ MG, υπςξ δ ναδζμακμζμθμβζηή ηαείγδζδ (RIPA) ηαζ δ έκγοιμ-ζοκδεδειέκδ ακμζμπνμζνμθδηζηή δμηζιή 77

78 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ (ELISA), δεκ είκαζ ανηεηά εοαίζεδηεξ βζα ηδκ ακίπκεοζδ παιδθήξ ζοβηέκηνςζδξ ακηζζςιάηςκ έκακηζ ηςκ ζοζηαηζηχκ ηδξ κεονμιοσηήξ ζφκαρδξ ηαζ πανά ηδκ ακάπηολδ κέςκ δζαβκςζηζηχκ ιεευδςκ υπςξ δ ακμζμηαηαηνήικζζδ-θεμνζζιμφ (FIPA), δ ααζζζιέκδ ζηα ηφηηανα δμηζιαζία (Cell Based Assay, CBA) ηαζ δ δμηζιαζία ακμζμθεμνζζιμφ (IFA), δεκ είκαζ ζηακέξ βζα ηδκ ακίπκεοζδ αοημακηζζςιάηςκ ζημ 100% ηςκ ιοαζεεκχκ ιε κεονμιοσηέξ κυζμοξ. Οζ βκςζηέξ ακαθφζεζξ βεκζηά απαζημφκ ηδ πνήζδ πμθφ ιζηνχκ πμζμηήηςκ ημο οπυ ελέηαζδ μνμφ ηαζ ζοπκά ζοκμδεφμκηαζ απυ αναίςζδ ηςκ μνχκ, πνμηεζιέκμο κα απμθεοπεεί μ οπεναμθζηυξ ευνοαμξ οπυααενμο θυβς ιδ εζδζηήξ πνυζδεζδξ. Σμ πνυαθδια ζηζξ RIPA δδιζμονβείηαζ απυ ηδκ ιεβάθδ πενζεηηζηυηδηα ημο μνμφ ζε ιδ εζδζηέξ ακμζμζθαζνίκεξ ηαζ ηδκ επαηυθμοεδ πνήζδ ορδθχκ υβηςκ ακηί-μνχκ πμο εα μδδβμφζε ζε οπεναμθζηά ιεβάθα ζγήιαηα. Σα ιεβάθα ζγήιαηα ιε ηδ ζεζνά ημοξ ζοκδέμκηαζ ιε ζδζαίηενα αολδιέκα επίπεδα ιδ εζδζημφ εμνφαμο οπυααενμο (δδθ. ιδ απμδεηηέξ ηζιέξ ναδζεκένβεζαξ απυ ημοξ ανκδηζημφξ ιάνηονεξ). Πνμξ απμθοβή ημο ακαζηαθηζημφ αοημφ πανάβμκηα ζηζξ νάδζμ-ακμζμθμβζηέξ δμηζιαζίεξ ζοκήεςξ βίκεηαζ πνήζδ ιυκμ ιενζηχκ ιζηνμθίηνςκ (π.π ιl) ημο οπυ ελέηαζδ μνμφ. Έηζζ, απμθεφβεηαζ δ επαηυθμοεδ πνήζδ ηςκ ορδθχκ υβηςκ ηςκ ακηί-μνχκ ιε απμηεθέζιαηα πμο πενζβνάθμκηαζ παναπάκς. Καηά ζοκέπεζα μζ ζδιενζκέξ ηεπκζηέξ δζάβκςζδξ δεκ είκαζ πθήνςξ επανηείξ ηαζ δ εοαζζεδζία ημοξ είκαζ επίζδξ πενζμνζζιέκδ ηαζ ςξ εη ημφημο, οπάνπεζ επείβμοζα ακάβηδ βζα ορδθυηενδξ εοαζζεδζίαξ ακαθφζεζξ. Δπζπθέμκ, ζε πμθθέξ πενζπηχζεζξ, μ ηίηθμξ ηςκ ακηζζςιάηςκ μ μπμίμξ οπμθμβίγεηαζ ιπμνεί κα είκαζ πμθφ ημκηά ζηζξ ιδ εζδζηέξ ηζιέξ ηαζ δεκ ιπμνεί κα εεςνείηαζ αλζυπζζημξ ηαζ βζα αοηυ εεςνείηαζ αιθίαμθμξ, δζυηζ ανίζηεηαζ ηάης απυ ημ επίπεδμ ημο εεηζημφ ηίηθμο, αθθά δεκ είκαζ αιεθδηέμξ. Ακ οπήνπε δ δοκαηυηδηα πνήζδξ ιεβαθοηένςκ υβηςκ μνμφ απυ ηδκ ηθαζζζηή RIPA, εα αολακυηακ δ δοκαηυηδηα ακίπκεοζδξ ηέημζςκ ακηζζςιάηςκ ηαζ έηζζ εα αολακυηακ ακαθμβζηά δ εοαζζεδζία ηδξ ιεευδμο. Ζ απαθθαβή απυ ηδκ πθεζμκυηδηα ηςκ ζοζηαηζηχκ ημο μνμφ ηαζ εζδζηυηενα ηςκ ιδ εζδζηχκ ακμζμζθαζνζκχκ μζ μπμίεξ δδιζμονβμφκ ημ πνυαθδια ημο ορδθμφ εμνφαμο οπυααενμο (background), εα ιπμνμφζε κα επζηεοπεεί ιε ηδκ ιενζηή απμιυκςζδ ηςκ εζδζηχκ MG αοημακηζζςιάηςκ ιε πνςιαημβναθία ζοββεκείαξ ιέζς ηδξ δέζιεοζήξ ημοξ ζε αηζκδημπμζδιέκμοξ οπμδμπείξ. Ο ηαεανζζιυξ ηςκ πνςηεσκχκ ιε ζηήθεξ ζοββέκεζαξ, ζοιπενζθαιαακμιέκδξ ηδξ ακμζμαπμιυκςζδξ ηςκ εζδζηχκ ακηζζςιάηςκ απυ 78

79 ΘΕΨΡΗΣΙΚΟ ΜΕΡΟ αηζκδημπμζδιέκα ακηζβυκα είκαζ ιζα ζοκδεζζιέκδ ηεπκζηή. Οζ αηζκδημπμζδιέκμζ αοημί οπμδμπείξ εα ιπμνμφζακ κα είκαζ, είηε μζ οπμδμπείξ υπςξ εηθνάγμκηαζ ζηδκ επζθάκεζα ιοσηχκ ηοηηάνςκ, ή κα έπεζ βίκεζ αηζκδημπμίδζδ απμιμκςιέκςκ οπμδμπέςκ ζε ζηενεά οπμζηνχιαηα υπςξ ζθαζνίδζα ζεθανυγδξ. Ζ αηζκδημπμίδζδ ηςκ οπμδμπέςκ ζε ζθαζνίδζα ιπμνεί κα βίκεζ είηε άιεζα ιε μιμζμπμθζηυ δεζιυ, είηε έιιεζα ιέζς άθθμο πνμζδέηδ (ππ ακηί-οπμδμπέα ιμκμηθςκζημφ ακηζζχιαημξ). ηδκ ζοκέπεζα, ιπμνεί κα βίκεζ απμηυθθδζδ - απμιυκςζδ ηςκ εζδζηχκ MG ακηζζςιάηςκ ιε ζοκεήηεξ παιδθμφ ph ηαζ πνμζδζμνζζιυξ αοηχκ ιε ιζα απθή RIPA, ή κα βίκεζ πνμζπάεεζα απμιυκςζδξ μθμηθήνμο ημο ζοιπθυημο ακηζβυκμο-ακηζζχιαημξ ιε δζαθοημπμίδζδ ή ιε ακηαβςκζζιυ ιέζς εκυξ ζζπονυηενμο πνμζδέηδ ηαζ κα αημθμοεήζεζ ακμζμηαείγδζδ ημο ζοιπθυημο αοημφ. O ηφνζμξ ζηυπμξ ηδξ πανμφζαξ δζαηνζαήξ είκαζ δ ακάπηολδ εκυξ οπέν-εοαίζεδημο ναδζμακμζμπνμζδζμνζζιμφ πνδζζιμπμζχκηαξ ηδκ παναπάκς πνμζέββζζδ, βζα ηδκ ακίπκεοζδ πμθφ ιζηνχκ πμζμηήηςκ αοημακηζζςιάηςκ έκακηζ ηςκ ακηζβυκςκ ζηυπςκ ηδξ κεονμιοσηήξ ζφκαρδξ (ηονίςξ ημο AChR ηαζ ηδξ MuSK) ηαζ δ πνήζδ ηδξ ακάθοζδξ αοηήξ βζα ημκ παναηηδνζζιυ ηαζ ηδκ δζαθεφηακζδ ηδξ ηαηάζηαζδξ μνυ-ανκδηζηχκ ή δζθμνμφιεκςκ πενζπηχζεςκ αζεεκχκ ή ηδκ επζαεααίςζδ ημο ανκδηζημφ απμηεθέζιαημξ άθθςκ δζαβκςζηζηχκ δμηζιαζζχκ βζα ηδκ απμοζία ιοαζεέκεζαξ. 79

80 ΤΛΙΚΑ ΜΕΘΟΔΟΙ 2. ΤΛΗΚΑ - ΜΔΘΟΓΟΗ 2.1 Τιηθά Δξγαζηεξηαθόο εμνπιηζκόο Γζα ηδκ εηπυκδζδ ηδξ πανμφζαξ ενβαζίαξ, μζ ζοζηεοέξ ηαζ ηα υνβακα πμο πνδζζιμπμζήεδηακ, ακαθένμκηαζ παναηάης: οζηεοή PCR MJ Research PTC-200 (Θενιζηυξ ηοηθμπμζδηήξ) Δπςαζηήναξ βζα ηαθθζένβεζεξ ααηηδνίςκ οπυ ακάδεοζδ GALLENKAMP Φοπυιεκμζ Δπςαζηήνεξ βζα ηαθθζένβεζεξ γοιμιοηήηςκ οπυ ακάδεοζδ GALLENKAMP, MRC Φαζιαημθςηυιεηνμ μναημφ/οπενζχδμοξ Jenway 6305 Φαζιαημθςηυιεηνμ μναημφ/οπενζχδμοξ BIORAD SmartSpec Plus Φαζιαημθςηυιεηνμ ΔLISA BIORAD-680 Microplate Reader Κθίαακμξ απμζηείνςζδξ REYPA Steam Sterilizer φζηδια ηνζχκ ζοζηεοχκ βζα ιεηαζπδιαηζζιυ ηοηηάνςκ γφιδξ ιε δθεηηνμδζάηνδζδ GENE PULSER, PULSE CONTROLLER ηαζ GENE TRANSFORMER, BIORAD Φοβυηεκηνμζ: Sorvall RC5C (ηεθαθέξ GS3 ηαζ SS34), KUBOTA 7780 (ηεθαθέξ AG-580CA ηαζ AG-5006 ηαζ ζςθήκεξ θοβμηέκηνμο πθαζηζημί ηαζ βοάθζκμζ (corex) ηαηάθθδθμζ βζα θοβμηέκηνδζδ ζε ορδθέξ ζηνμθέξ Μζηνμθοβυηεκηνμξ Eppendorf 5410 Φοπυιεκδ ιζηνμθοβυηεκηνμξ Eppendorf 5415 R Δπζηναπέγζα θοβυηεκηνμξ Juan CR422 οζηεοέξ μνζγυκηζαξ δθεηηνμθυνδζδξ αβανυγδξ οζηεοέξ ηάεεηδξ δθεηηνμθυνδζδξ πνςηεσκχκ Mini-Protean II ηαζ Mini-Protean III BIORAD ηαζ ιεηαθμνάξ πνςηεσκχκ ζε κζηνμηοηηανίκδ MiniTrans-Blot BIORAD οζηεοή λήνακζδξ πδηηςιάηςκ Gel Air Dryer BIORAD

81 ΤΛΙΚΑ ΜΕΘΟΔΟΙ Τπμδμπέαξ θίθηνςκ βζα Micro-filtration Millipore φζηδια οπενδζήεδζδξ δζαθοιάηςκ PALL Corp. Ultrasette 10K Πενζζηαθηζηή ακηθία Millipore/Masterflex (Variable speed) Τδαηυθμοηνα Memmert ηαζ Digiterm οζηεοή οπενήπςκ (Sonicator) MISONIX Ακηθία ηεκμφ WELTC Gemini οζηεοή δζήεδζδξ οπυ ηεκυ βζα πθάηεξ MACHEREY-NAGEL Chromabond Multi 96 Μεηνδηήξ β-αηηζκμαμθίαξ Perkin Elmer Wizard οζηεοή FPLC ACTA purifier 90 ηδξ Amersham Biosciences Θενιαζκυιεκμ θμοηνυ οπενήπςκ BRANSON 2200 Πζπέηεξ Gilson Αλαιώζηκα Σνοαθία βζα ζηενεέξ ηαθθζένβεζεξ ααηηδνίςκ απυ Costar Γμηζιαζηζημί ζςθήκεξ πμθοπνμποθεκίμο ιζαξ πνήζδξ 15 ηαζ 50 ml απυfalcon Πθαζηζημί ζςθήκεξ ιζαξ πνήζδξ 1,5 ml απυ Greiner Πθαζηζημί ζςθήκεξ ιζαξ πνήζδξ 0,25 ml απυ Costar Πθαζηζηά αηνμνφβπζα (tips), ηαζ πθαζηζηέξ απμζηεζνςιέκεξ πζπέηεξ 1, 2, 5, 10 ηαζ 25 ml απυ Costar Πθαζηζηά αηνμνφβπζα (tips) βζα επακαθδπηζηή πζπέηα απυ Eppendorf Κορεθίδεξ βζα δθεηηνμδζάηνδζδ 0,1 cm απυ BIORAD ηαζ 0,2 cm απυ Invitrogen Πθαζηζηέξ ηορεθίδεξ ιζαξ πνήζδξ απυ SARSTEDT Κορεθίδεξ παθαγία μπηζηήξ δζαδνμιήξ 0,25 cm, βζα ιέηνδζδ μπηζηήξ απμννυθδζδξ δζαθφιαημξ ζηδκ πενζμπή ημο οπενζχδμοξ 81

82 ΤΛΙΚΑ ΜΕΘΟΔΟΙ Φίθηνα ιε δζάιεηνμ πυνμο 0,22, 0,45ιι, profilter απυ Millipore Μειανάκεξ κζηνμηοηηανίκδξ Hybond C-extra ηαζ Hybond P, Amersham Biosciences Ακζμκημακηαθθαηηζηά θίθηνα ηοηηανίκδξ DE81 ηαζ πανηί δζήεδζδξ 3 MM απυ Whatmann Αληηδξαζηήξηα Υδιζηά ακηζδναζηήνζα ακαθοηζημφ ααειμφ ηαεανυηδηαξ απυ Sigma, Merck:, B.D.H. Chemicals Ltd, Fluka ηαζ Apllichem Αβανυγδ απυ Sigma Taq DNA πμθοιενάζδ απυ Minotech Molecular Biology Products (IMMB) Δκανηηήνζα ιυνζα απυ MWG dntps απυ Promega Πενζμνζζηζηέξ εκδμκμοηθεάζεξ απυ Roche, Fermentas ηαζ New England Biolabs Μάνηοναξ ιμνζαηχκ ιεβεεχκ DNA : 1 kb, Fermentas Αθηαθζηή θςζθαηάζδ (CIAP, 26 U/ιΗ) απυ Gibco BRL T4 DNA θζβάζδ (1 U/ιθ) απυ Fermentas Λοζμγφιδ απυ Applichem ηαζ RNase Α, απυ Sigma Bacto-tryptone, Bacto-peptone, Bacto-yeast extract ηαζ Bacto-agar απυ Difco Laboratories Αιπζηζθθίκδ απυ Bristol Mayers Squib Εεμζίκδ απυ Invitrogen Ν,Ν,Ν,Ν-ηεηναιεεοθαζεοθεκμδζαιίκδ (TEMED), πενμλοδζεεζζηυ αιιχκζμ (APS), 3,3' δζαιζκμαεκγζδίκδ (DAB), δζεεζμενεζηυθδ (DTT), οδαηζηυ δζάθοια πμθοαζεοθεκζιίκδξ (ΡΔΗ) 50% (w/v) ηαζ ζιζδαγυθζμ απυ Sigma, Applichem Αθαμοιίκδ απυ μνυ αμδζμφ (BSA) απυ Applichem 82

83 ΤΛΙΚΑ ΜΕΘΟΔΟΙ Έβπνςιμξ ιάνηοναξ πνςηεσκχκ ιμνζαηχκ ιεβεεχκ kda απυ Fermentas Νΐ 2+ -ΝΣΑ αβανυγδ απυ QIAGEN Inc. Παηεηανζζιέκεξ ζηήθεξ Superose 12, Mono Q απυ Amersham Biosciences α-ιπμοκβηανμημλίκδ απυ Sigma CNBr- activated Sepharose ζθαζνίδζα απυ GE Healthcare Πξνζπζθεπαζκέλα αληηδξαζηήξηα QIAquick Gel Extraction Kit απυ QIAGEN Inc. πμο πενζθαιαάκεζ: ζηήθεξ QIAquick spin, νοειζζηζηά δζαθφιαηα ΡΒ (πενζέπεζ παμηνμπζηά άθαηα) ηαζ ΡΔ QIAquick PCR Purification kit απυ QIAGEN Inc, πμο πενζθαιαάκεζ: ζηήθεξ QIAquick spin, νοειζζηζηά δζαθφιαηα QG (πενζέπεζ παμηνμπζηά άθαηα) ηαζ ΡΔ AChRAb RIPA kit απυ RSR Ltd, πμο πενζθαιαάκεζ: 125 Η AChR, Goat anti-human IgG, θοζζμθμβζηυ ακενχπζκμ μνυ (NHS), washing solution, reconstitution buffer, precipitation enhancer MuSKAb RIPA kit απυ RSR Ltd πμο πενζθαιαάκεζ: 125 Η MuSK Goat anti-human IgG, θοζζμθμβζηυ ακενχπζκμ μνυ (NHS), washing solution, reconstitution buffer, precipitation enhancer Ραδηελεξγά αληηδξαζηήξηα Na 125 I βζα ηδ ζήιακζδ α-ιπμοκβηανμημλίκδξ (α-bgt) ηαζ MuSK απυ Perkin Elmer Αληηζώκαηα ηδκ πανμφζα ιεθέηδ πνδζζιμπμζήεδηακ ηα παναηάης ιμκμηθςκζηά ηαζ πμθοηθςκζηά ακηζζχιαηα: Μνλνθισληθά αληηζώκαηα Μμκμηθςκζηυ ακηίζςια 9Δ10, πμο πνμένπεηαζ απυ ηδκ οανζδςιαηζηή ζεζνά πμκηζημφ ATCC CRL 1729 ηαζ ακαβκςνίγεζ ημκ c-myc επίημπμ. 83

84 ΤΛΙΚΑ ΜΕΘΟΔΟΙ Μμκμηθςκζηυ ακηίζςια anti-6xhis ζογεοβιέκμ ιε ημ έκγοιμ οπενμλεζδάζδ ηδξ ναπακίδμξ απυ Invitrogen, (ιε απαίηδζδ βζα εθεφεενμ ημ ηαναμλοηεθζηυ άηνμ βζα ακαβκχνζζδ). πδεπγκέλα κε ην έλδπκν ππεξνμεηδάζε ηεο ξαπαλίδνο αληηζώκαηα Ακηίζςια ακμζμζθαζνζκχκ ακεπηοβιέκςκ ζε ημοκέθζ έκακηζ β-ακμζμζθαζνζκχκ πμκηζημφ. (DakoCytomation) Ακηίζςια ακμζμζθαζνζκχκ ακεπηοβιέκςκ ζε ημοκέθζ έκακηζ β-ακμζμζθαζνζκχκ ανμοναίμο. (DakoCytomation) Γηαιύκαηα Γζα ηδκ παναζηεοή υθςκ ηςκ δζαθοιάηςκ πνδζζιμπμζήεδηε δζξ-απεζηαβιέκμ ηαζ απζμκζζιέκμ κενυ (ddh 2 O). Ζ απμζηείνςζδ ηςκ ενεπηζηχκ οθζηχκ βζα ηζξ ηαθθζένβεζεξ Ε. coli ηαζ P. pastoris ηαεχξ ηαζ ηςκ νοειζζηζηχκ δζαθοιάηςκ πμο πνδζζιμπμζήεδηακ ζηζξ ηεπκζηέξ ιμνζαηήξ αζμθμβίαξ πναβιαημπμζήεδηε ζε οβνυ ηθίαακμ βζα 40 min ζε 15 lb/in 2 ή ιε δζήεδζδ απυ ζηείνμ θίθηνμ ιε δζάιεηνμ πυνμο 0,2 ιm Θξεπηηθά πιηθά LB (Luria Bertani) LB-agar LB παιδθήξ αθαηυηδηαξ (LB-LS) LB-LS-agar YPD YPD-agar 1 % (w/v) NaCl, 1 % (w/v) πεπηυκδ, 0,5 % (w/v) εηπφθζζια γφιδξ, νζ 7,0 LB πμο πενζέπεζ 1,5 % (w/v) agar 0,5% (w/v) NaCl, 1% (w/v) πεπηυκδ, 0,5 % (w/v) εηπφθζζια γφιδξ, νζ 7,0 LB-LS πμο πενζέπεζ 1,5% (w/v) agar 1 % (w/v) εηπφθζζια γφιδξ, 2 % (w/v) πεπηυκδ, 2 % (w/v) δεληνυγδ YPD πμο πενζέπεζ 1,5 % (w/v) agar 84

85 ΤΛΙΚΑ ΜΕΘΟΔΟΙ YPDS YPDS-agar RDB- agar BMGY BMMY 1 % (w/v) εηπφθζζια γφιδξ, 2 % (w/v) πεπηυκδ, 2 % (w/v) δεληνυγδ, ηαζ 1 Μ ζμναζηυθδ YPDS πμο πενζέπεζ 1,5 % (w/v) agar 1 Μ ζμναζηυθδ, 2 % (w/v) δεληνυγδ, % (w/v) YNB, 4xlO -5 % (w/v) αζμηίκδ, 0,00 5% (w/v) αιζκμλέα, 2 % 1 (w/v) % (w/v) agar εηπφθζζια γφιδξ, 2 % (w/v) πεπηυκδ, 100 mm νοειζζηζηυ δζάθοια θςζθμνζηχκ, νζ 6,0, 1,34 % (w/v) ΤΝΒ, 4xlO -5 % (w/v) αζμηίκδ, 1 % (κ/κ) 1 % (w/v) εηπφθζζια γφιδξ, 2 % (w/v) βθοηενυθδ πεπηυκδ, 100 mm νοειζζηζηυ δζάθοια θςζθμνζηχκ, νζ 6,0, 1,34 % (w/v) ΤΝΒ, 4xlO -5 % (w/v) αζμηίκδ, 0,5 % (v/v) ιεεακυθδ Ρπζκηζηηθά δηαιύκαηα ΣΒΔ ΣΔ(10:1) PBS 89 mm Tris-H 3 BO 3, νζ 8,0, 2 mm EDTA 10 mm Tris-HCl, νζ 8,0, 1 mm EDTA 60 mm νοειζζηζηυ δζάθοια θςζθμνζηχκ νζ 7,4, 137 mm NaCl, 2,7 mm KC1 TBS 25 mm Tris-HCl, ph 7,4, 137 mm NaCl, 2,7 mm KC1 Tris-Triton 10 mm Tris-HCl ph 7,4, 2 % (v/v) Triton X-100 (Tris- GTE Triton) 50 mm βθοηυγδ, 25 mm Tris-HCl, ph 8,0,10 mm EDTA Ζθεηηνμθυνδζδξ 25 mm Tris-base, 200 mm βθοηίκδ, 1 % (w/v) SDS, ph 8,5 Ζθεηηνμιεηαθμνάξ 25 mm Tris-base, 200 mm βθοηίκδ, 20 % (w/v) ιεεακυθδ, Απμθςζθμνοθίςζδξ ph8,5 0,1 Μ Tris-HCl, ph 7,5, 0,1 Μ MgCl 2 85

86 ΤΛΙΚΑ ΜΕΘΟΔΟΙ Άιια δηαιύκαηα Υνςιαηζζιμφ πδηηήξ πμθοαηνοθαιζδίμο 0,1 % (w/v) Coomassie R % (v/v) ιεεακυθδ, 10 % (v/v) CH 3 COOH Απμπνςιαηζζιμφ πδηηήξ 10 % (v/v) CH 3 COOH, 40 % πμθοαηνοθαιζδίμο (κ/κ) ιεεακυθδ Γζάθοια ειθάκζζδξ ιε οπυζηνςια DAB 0,03 % (w/v) DAB, 0,03 % (w/v) NiCl 2, 0,009 % (v/v) Ζ 2 Ο 2 ζε PBS "Φυνηςζδξ" δείβιαημξ πνςηεσκχκ 45 mm Tris-HCl, ph 6,8, 10 % (v/v) βθοηενυθδ, 1 % (w/v) SDS, 0,01 % (w/v) ηοακμφκ ηδξ ανςιμθαζκυθδξ, 5% (v/v) α-ιενηαπημαζεακυθδ 86

87 ΤΛΙΚΑ ΜΕΘΟΔΟΙ 2.2 Μέζνδνη Ραδηναλνζνινγηθόο πξνζδηνξηζκόο (RIPA) ησλ αληί-achr αληηζσκάησλ Ζ ναδζμακμζμθμβζηή ιέεμδμξ (RIPA) είκαζ ιζα ανηεηά εοαίζεδηδ ηεπκζηή ιε ηδκ αμήεεζα ηδξ μπμίαξ ακζπκεφμκηαζ ακηζζχιαηα έκακηζ εκυξ ζοβηεηνζιέκμο ακηζβυκμο ζε έκα δείβια. Ζ ανπή θεζημονβίαξ ηδξ ανίζηεηαζ ζηδκ ζδζυηδηα πμο έπμοκ ηα ακηζζχιαηα κα πνμζδέκμκηαζ εζδζηά ζημ ακηζβυκμ ημοξ ζπδιαηίγμκηαξ ζφιπθμηα ιεβάθμο ιμνζαημφ αάνμοξ. ηδκ πνάλδ ημ πνχημ αήια είκαζ δ νάδζμ-ζήιακζδ ηδξ πνςηεΐκδξ-ακηζβυκμο. Σμ δεφηενμ αήια είκαζ δ επχαζδ ημο νάδζμ-ζδιαζιέκμο ακηζβυκμο ιε ημ δείβια. Ακ ημ δείβια πενζέπεζ ακηζζχιαηα έκακηζ ηδξ πνςηεΐκδξ-ακηζβυκμο εα δδιζμονβδεεί ζφιπθμημ. Αημθμοεεί επχαζδ ιε ακηζζχιαηα απυ άθθμ είδμξ ηα μπμία πνμζδέκμκηαζ ζηα πνχηα ακηζζχιαηα δδιζμονβχκηαξ πμθφ αανφηενα ζφιπθμηα πμο ηαηααοείγμκηαζ εφημθα ιε θοβμηέκηνδζδ. Δάκ ζημ δείβια οπήνπακ ακηζζχιαηα έκακηζ ηδξ πνςηεΐκδξ-ακηζβυκμο, ζημ ίγδια εα έπεζ εβηθςαζζηεί ναδζεκένβεζα, δ μπμία εα πνμένπεηαζ απυ ηδκ ζδιαζιέκδ πνςηεΐκδ-ακηζβυκμ. Σμ ηεθεοηαίμ αήια πενζθαιαάκεζ πθφζεζξ ιε ηαηάθθδθμ δζάθοια άθαημξ πενζέπμκ απμννοπακηζηυ βζα ηδκ απμιάηνοκζδ ηδξ ιδ πνμζδειέκδξ ναδζεκένβεζαξ ηαζ ιέηνδζδ ηςκ ναδζεκενβχκ ηνμφζεςκ. ζμ πενζζζυηενα ακηζζχιαηα έκακηζ ημο ακηζβυκμο οπάνπμοκ ζημ δείβια, ηυζεξ πενζζζυηενεξ ηνμφζεζξ ζηδ ιμκάδα ημο πνυκμο ιεηνχκηαζ. Πζμ ζοβηεηνζιέκα, ζηδκ ιέεμδμ αοηήκ πνδζζιμπμζείηαζ έκα δείβια οπμδμπέα δζαθοημπμζδιέκμο ζε απμννοπακηζηυ απυ ακενχπζκμ ιοσηυ ζζηυ ή απυ ακενχπζκεξ ηοηηανζηέξ ζεζνέξ πμο εηθνάγμοκ ιοσημφ ηφπμο AChR (ζοκήεςξ fmoles AChR). ηακ πνμηεζηαζ βζα ηοηηανζηέξ ζεζνέξ μ AChR πνμένπεηαζ απυ ιείβια ίζςκ υβηςκ ΣΔ671 ηαζ CN21 ηοηηάνςκ ηα μπμία εηθνάγμοκ ειανοσημφ ηαζ εκήθζημο ηφπμο AChR [ηοηηανζηή ζεζνά ΣΔ671 (ATCC CCL-136) βζα AChR ειανοσημφ ηφπμο ηαζ ηοηηανζηή ζεζνά CN21 βζα AChR εκδθίημο ηφπμο]. Ο AChR πνμεπςάγεηαζ ιε ζδιαζιέκδ ιε 125 I α-ιπμοκβηανμημλίκδ (δ μπμία ζοκήεςξ οπενααίκεζ ηαηά ιενζηέξ θμνέξ ημκ ανζειυ ηςκ ιμνίςκ ημο AChR, πενίπμο cpm). ηδ ζοκέπεζα, ημ ιείβια επςάγεηαζ ιε ιζηνυ υβημ ημο οπυ ελέηαζδ μνμφ ημο αζεεκμφξ (ζοκήεςξ ιέπνζ 5 ιl ηαζ πενζζηαζζαηά ιέπνζ ηαζ 20 ιl) ηαζ 87

88 ΤΛΙΚΑ ΜΕΘΟΔΟΙ αημθμοεεί δ πνμζεήηδ ακμζμζθαζνίκδξ έκακηζ ημο ακενχπζκμο μνμφ (10-50ιl) βζα κα ηαηαηνδικίζεζ ηζξ ακμζμζθαζνίκεξ ημο αζεεκμφξ ιαγί ιε ημκ δεζιεοιέκμ ηαζ ζδιαζιέκμ AChR. Σα πεζνάιαηα έβζκακ πνδζζιμπμζχκηαξ ημ AChRAb RIPA kit (RSR Ltd) ζφιθςκα ιε ηζξ μδδβίεξ ημο ηαηαζηεοαζηή. Ακαθοηζηυηενα, 50 ιl ζδιαζιέκμο ιοσημφ οπμδμπέα (ιείβια ειανοζημφ ηαζ εκήθζημο ηφπμο) επςάγμκηαζ βζα 2 χνεξ ζε εενιμηναζία δςιαηίμο ιε 5 ιl μνμφ. ηδ ζοκέπεζα, πνμζηίεεκηαζ 50 ιl ακηί-ακενχπζκμο IgG ηαζ ημ ιίβια επςάγεηαζ βζα 2 χνεξ, ζημοξ 4 C. Αημθμοεεί πνμζεήηδ 1 ml δζαθφιαημξ έηπθοζδξ ηαζ θοβμηέκηνδζδ βζα 20 min, ζημοξ 4 C, ζηα 1500xg. Έπεζηα βίκεηαζ επακαζχνδζδ ηαζ δεφηενδ έηπθοζδ ημοξ ζγήιαημξ πμο δδιζμονβείηαζ ιεηά ηδ θοβμηέκηνδζδ (ακμζμηαηαηνήικζζδ) ιε ημ δζάθοια έηπθοζδξ ηαζ βίκεηαζ δ ιέηνδζδ ναδζεκένβεζαξ πμο δεζιεφηδηε ζημ ίγδια ζε ιεηνδηή β-αηηζκμαμθίαξ. Ζ ναδζεκένβεζα ημο ζγήιαημξ είκαζ ακάθμβδ ηδξ πμζυηδηαξ ηςκ ακηί-οπμδμπέα ακηζζςιάηςκ ηα μπμία έπμοκ πνμζδεεεί ζημκ νάδζμ-ζδιαζιέκμ AChR. Δηθνάγεηαζ ςξ nmoles δεζιεοιέκμο AChR ακά θίηνμ μνμφ ηαζ οπμθμβίγεηαζ ιε ημκ ηφπμ: υπμο: A είκαζ μ ζοκηεθεζηήξ ελαζεέκδζδξ ημο 125 Η, ιεηαλφ ηδξ διέναξ ζήιακζδξ ημο οπμδμπέα ηαζ ηδξ διέναξ εηηέθεζδξ ηδξ ελέηαζδξ B είκαζ μ ζοκηεθεζηήξ απυδμζδξ ημο ιεηνδηή ηδξ β-αηηζκμαμθίαξ C είκαζ μ υβημξ ημο μνμφ πμο πνδζζιμπμζήεδηε Κ είκαζ δ εζδζηή εκενβυηδηα (specific activity) ζε Ci/mmole ηδξ 125 Η-α-ιπμοκβηανμημλίκδξ ηαηά ημκ πνυκμ ζήιακζδξ ημο οπμδμπέα Οζ ηζιέξ βζα ημοξ Α ηαζ K πμζηίθμοκ ζε ηάεε παναβςβή δζαβκςζηζημφ kit ηαζ δζαηίεεκηαζ ηάεε θμνά βναπηχξ. Οζ ηζιέξ ημο Β πμζηίθμοκ βζα ημκ δζαεέζζιμ ιεηνδηή ημο ηάεε ενβαζηδνίμο ηαζ πνμξ ημφημ είκαζ απαναίηδημξ μ έθεβπμξ ημο μνβάκμο ηαζ μ οπμθμβζζιυξ αοημφ ζε ηαηηά πνμκζηά δζαζηήιαηα. οκήεςξ εεηζημί ηίηθμζ εεςνμφκηαζ εηείκμζ επάκς απυ 88

89 ΤΛΙΚΑ ΜΕΘΟΔΟΙ πενίπμο 0,6 nm, ηίηθμζ ηςκ οβζχκ αηυιςκ εηείκμζ ηάης απυ 0,2 nm, εκχ μζ ηίηθμζ εκδζάιεζα εεςνμφκηαζ αιθίαμθμζ Ραδηναλνζνινγηθή δνθηκαζία δύν-ζηαδίσλ γηα ηελ αλίρλεπζε θαη ηνλ πξνζδηνξηζκό αληί-achr αληηζσκάησλ Ζ δμηζιαζία απμηεθείηαζ απυ δφμ ζηάδζα: Καηά ημ πνχημ ζηάδζμ πναβιαημπμζείηαζ διί-ηαεανζζιυξ ηςκ ελεζδζηεοιέκςκ βζα ημ ακηζβυκμ ακηζζςιάηςκ δζα ζοκάθεζαξ ιε ιία επζδέλεζα αθθά υπζ ζδζαίηενα αοζηδνή δζαδζηαζία ηαεανζζιμφ. Καηά ημ ζηάδζμ αοηυ πνδζζιμπμζείηαζ ημ ακηζβυκμ ζε αδζάθοηδ ή αηζκδημπμζδιέκδ ιμνθή, βζα κα ηαηαζηήζεζ δοκαηυ ημκ διί-ηαεανζζιυ ηαζ ηδκ απμιυκςζδ ηςκ ακηίζημζπςκ ακηζζςιάηςκ απυ ημκ μνυ. ηδκ πανμφζα πενίπηςζδ ζοιααίκεζ κα είκαζ έκα ιυνζμ ηδξ ηοηηανζηήξ ιειανάκδξ, μπυηε ιπμνμφκ κα πνδζζιμπμζδεμφκ απ' εοεείαξ ηα ηφηηανα ηα μπμία θένμοκ ημ ακηζβυκμ (AChR) ή μζ απμιμκςιέκεξ ιειανάκεξ αοηχκ ςξ δ αηζκδημπμζδιέκδ ιμνθή ημο ακηζβυκμο πςνίξ ηδκ πεναζηένς ακάβηδ μπμζαζδήπμηε απμιυκςζδξ ηαζ αηζκδημπμίδζδξ ημο ακηζβυκμο. Δκαθθαηηζηά, ακ ημ ακηζβυκμ είκαζ ζε δζαθοηή ιμνθή, ηυηε ιπμνεί κα αηζκδημπμζδεεί μιμζμπμθζηά ζε έκα αδζάθοημ οπυζηνςια, υπςξ ζθαζνίδζα εκενβμπμζδιέκδξ ιε CNBr ζεθανυγδξ. ηδκ πενίπηςζδ ηαηά ηδκ μπμία ημ ακηζβυκμ ανίζηεηαζ ζε ηφηηανα ή ζε ιειανάκεξ, ημ πθήνεξ ζφιπθμημ ακηζβυκμο-ακηζζχιαημξ ιπμνεί κα δζαθοημπμζδεεί, παναιέκμκηαξ ςξ ζφιπθμημ, (π.π. δζα δζαθοημπμζήζεςξ ηςκ ηοηηάνςκ/ιειανακχκ ιε ημ ιδ ιεημοζζςηζηυ απμννοπακηζηυ, Σriton) ή εκαθθαηηζηά, ζηδκ πενίπηςζδ ημο μιμζμπμθζηά αηζκδημπμζδιέκμο ακηζβυκμο κα βίκεζ δζαπςνζζιυξ ηςκ ακηζζςιάηςκ (π.π. οπυ ζοκεήηεξ παιδθμφ ph). Σμ ζηάδζμ αοηυ επζηοβπάκεζ ημκ ορδθυ ειπθμοηζζιυ ακηζζςιάηςκ επζθεηηζηχκ ςξ πνμξ ημ ακηζβυκμ ζημ δείβια εκχ δ μθζηή πενζεηηζηυηδηα ακμζμζθαζνίκδξ είκαζ πμθφ ιζηνή (πμθφ ιζηνυηενδ απυ ηδκ μθζηή πενζεηηζηυηδηα ζε ακμζμζθαζνίκδ 1 ιl ακενχπζκμο μνμφ). Καεχξ δ εκ θυβς δζαδζηαζία απμιμκχζεςξ ιπμνεί κα ιδκ είκαζ πμθφ αοζηδνή, ιπμνεί κα οπάνπμοκ ηαζ ιδ εζδζηέξ ακμζμζθαζνίκεξ. Καηά ημ 2μ ζηάδζμ πναβιαημπμζείηαζ ηακμκζηή ακμζμθμβζηή δμηζιαζία (RIPA), βζα ημκ πνμζδζμνζζιυ ζοιποηκςιέκςκ, επζθεηηζηχκ ςξ πνμξ ημ ακηζβυκμ ακηζζςιάηςκ απυ ημ 89

90 ΤΛΙΚΑ ΜΕΘΟΔΟΙ ζφκμθμ ημο διί-ηαεανζζιέκμο παναζηεοάζιαημξ ηςκ ακηζζςιάηςκ. ηδκ πενίπηςζδ υπμο δζαθφεηαζ μθυηθδνμ ημ ζφιπθμημ ακηζβυκμο-ακηζζχιαημξ, ημ ακηζβυκμ πνέπεζ είηε κα είκαζ ήδδ ζδιαζιέκμ είηε κα ζδιαίκεηαζ έπεζηα ειιέζςξ (π.π. μ AChR ιε ηδκ πνμζεήηδ ημο πνμζδέιαημξ 125 Η-α-ιπμοκβηανμημλίκδξ). Έβζκε έθεβπμξ ακίπκεοζδξ ακηί-achr ακηζζςιάηςκ ιε πνςιαημβναθία ζοββέκεζαξ πνδζζιμπμζχκηαξ ημκ AChR ςξ ακηζβυκμ πνυζδεζδξ ζηζξ ελήξ ιμνθέξ: 1) άιεζα επί αηέναζςκ ηοηηάνςκ ηα μπμία εηθνάγμοκ ημκ οπμδμπέα ηδξ αηεηοθμπμθίκδξ (ΣΔ671, CN21), ή ζηα εναφζιαηα απμιμκςιέκςκ ηοηηανζηχκ ιειανακχκ ηαζ 2) ςξ δζαθοημπμζδιέκμ ιε απμννοπακηζηυ ακηζβυκμ ηαζ αηζκδημπμζδιέκμ ζε εκενβμπμζδιέκα ιε CNBr ζθαζνίδζα ζεθανυγδξ RIPA δύν-ζηαδίσλ κε ηελ ρξήζε θπηηάξσλ πνπ θέξνπλ AChRs Απμροβιέκα ηφηηανα ΣΔ671 ηαζ CN21, επςάζεδηακ ιε ναδζεκενβά ζδιαζιέκδ ιε 125 I-α-ιπμοκβηανμημλίκδ ( cpm ακά 40 fmoles επζθακεζαημφ AChR) βζα 2 χνεξ ζημοξ 4 0 C. Σα επζζδιαζιέκα ηφηηανα δζακειήεδηακ ζε ζςθήκεξ ηφπμο Eppendorf (40 fmoles επζθακεζαηχκ AChR ιε 100,000 cpm 125 I-α-ιπμοκβηανμημλίκδ ζε ζοκμθζηά 50 ιl δζαθφιαημξ PBS-2%BSA/ακαζημθέςκ πνςηεαζχκ ακά ζςθδκάνζμ). ε ηάεε δμηζιαζηζηυ ζςθήκα πνμζηέεδηακ, 0,3-0,5 ml ημο μνμφ (ή PBS-7% BSA βζα ημκ έθεβπμ ηςκ ηζιχκ οπυααενμο) ηαζ επςάζεδηακ βζα ιία κφηηα ζημοξ 4 0 C. ηδ ζοκέπεζα ηα ηφηηανα πθφεδηακ δφμ θμνέξ ιε 1ml PBS-0,2%BSA ιε θοβμηέκηνδζδ ζηζξ ζ.α.θ. ζε θοβυηεκηνμ ηφπμο Eppendorf. ημ ίγδια πνμζηέεδηακ 50 ιl PBS-2%Triton ηαζ επςάζεδηακ οπυ πενζζηνμθή βζα 30 θεπηά ζε εενιμηναζία 4 0 C βζα ηδκ δοαθοημπμίδζδ ηςκ οπμδμπέςκ. ηδ ζοκέπεζα, αθμφ μζ ζςθήκεξ θοβμηεκηνήεδηακ βζα 5 θεπηά ζηζξ rpm, ηα οπενηείιεκα ιεηαθένεδηακ ζε κέμοξ δμηζιαζηζημφξ ζςθήκεξ. ε αοημφξ πνμζηέεδηακ 10 ιl PBS πμο πενζέπεζ 1 ιl NHS ςξ ιεηαθμνέα μνυ βζα αμήεεζα ζηδκ ακμζμηαηαηνήικζζδ ηαζ 10 ιl ακηίακενχπζκδξ ακμζμζθαζνίκδξ. Μεηά ηδκ επχαζδ βζα 60 min ηα ζπδιαηζζεέκηα ζγήιαηα πθφεδηακ δφμ θμνέξ ιε 1ml PBS-0,5%Triton ηαζ δ ναδζεκένβεζα ηςκ ζγδιάηςκ ιεηνήεδηε ζε ιεηνδηή β-αηηζκμαμθίαξ. 90

91 ΤΛΙΚΑ ΜΕΘΟΔΟΙ ηδκ πενίπηςζδ ηαηά ηδκ μπμία πνδζζιμπμζήεδηακ ηοηηανζηέξ ιειανάκεξ ακηί αηέναζςκ ιοσηχκ ηοηηάνςκ, υθεξ μζ ζοκεήηεξ ήηακ πανυιμζεξ ιε ιυκδ ελαίνεζδ υηζ μζ θοβμηεκηνήζεζξ ιε ηζξ πνμπαναζηεοαζιέκεξ ιειανάκεξ πναβιαημπμζήεδηακ ζε ορδθυηενεξ ηαπφηδηεξ ( rpm ζε θοβυηεκηνμ ηφπμο Eppendorf) RIPA δύν-ζηαδίσλ βαζηζκέλε ζε αθηλεηνπνηεκέλν AChR ζε ζηεξεό ππόζηξσκα Ζ δμηζιαζία αοηή απμηεθείηαζ απυ δφμ ζηάδζα. Καηά ημ 1 μ ζηάδζμ αοηυ ημ εζδζηυ ακηζβυκμ (AChR ) είκαζ ζε αηζκδημπμζδιέκδ ιμνθή ζε ζθαζνίδζα ζεθανυγδξ, πνμηεζιέκμο κα πνδζζιμπμζδεεί ζε δζαδζηαζία ακάθμβδ ηδξ πνςιαημβναθίαξ ζοββέκεζαξ, βζα ηδκ διζηαεανζζιυ ηςκ ακηίζημζπςκ ακηζζςιάηςκ απυ ημκ μνυ. Γζα ηδκ αηζκδημπμίδζδ ζηα ζθαζνίδζα πνδζζιμπμζήεδηε δζαθοηυξ οπμδμπέαξ απυ έκα ιίβια ΣΔ671 ηαζ CN21ακενχπζκςκ ηοηηάνςκ. Ο AChR δζαθοημπμζήεδηε ιε απμννοπακηζηυ 2%Triton X-100 ζε PBS πανμοζία εκυξ ιείβιαημξ ακαζημθέςκ πνςηεαζχκ (5 mm ζςδμαηεηαιίδζμ, 0,5 mm θαζκοθιεεοθζμοθθμκοθμθεμνίδζμ, 5 ιμκάδεξ/ml απνςηζκίκδ, 5 ιg/ml πεπζηαηίκδ). Σμ πενζέπμκ AChR εηπφθζζια αηζκδημπμζήεδηε επί ζθαζνζδίςκ εκενβμπμζδιέκδξ ιε CNBr Sepharose 4B, ζφιθςκα ιε ηζξ μδδβίεξ ημο ηαηαζηεοαζηή (Amersham Pharmacia Biotech), έηζζ χζηε κα αηζκδημπμζδεμφκ πενίπμο 100 fmoles AChR ζε πενίπμο 10 ιl ζθαζνζδίςκ. Καηά ηδκ δζαδζηαζία αοηή ζε ιία ζεζνά δμηζιαζηζηχκ ζςθήκςκ, πνμζηέεδηακ ανπζηά 20 ιl εκαζςνήιαημξ 50% Sepharose-AChR ζε PBS-0,1% Triton. ηδ ζοκέπεζα, έκαξ ιεβάθμξ υβημξ (0,1-1 ml) ημο εθεβπυιεκμο μνμφ πνμζηίεεηαζ, πανμοζία 0,2% Triton ηαζ επςάζεδηακ επί ιία κφηηα ζημοξ 4 C οπυ ζηαεενή πενζζηνμθή. Έπεζηα ηα ζθαζνίδζα πθφεδηακ ιε PBS-0,5% Triton ηαζ εκ ζοκεπεία ιε 10 mm θςζθμνζημφ νοειζζηζημφ δζαθφιαημξ, ph 7,0-0,5% Triton, αημθμοεμφιεκμο ηάεε θμνά απυ θοβμηέκηνδζδ επί 1 min οπυ 1000 rpm. Έπεζηα ζηα ζγήιαηα πνμζεηέεδζακ 75 ιl πνυζθαηα παναζηεοαζεέκημξ νοειζζηζημφ δζαθφιαημξ 0,05 M βθοηίκδξ-hcl, ph 2,3, ζηνμαζθίζεδηακ ηαζ θοβμηεκηνήεδηακ αιέζςξ επί 1 min οπυ 1000 rpm Σμ πενζέπμκ ακηίζςια οπενηείιεκμ ιεηαθένεδηε ζε κέμοξ δμηζιαζηζημφξ ζςθήκεξ μζ μπμίμζ πενζείπακ ήδδ 4 ιl νοειζζηζημφ 91

92 ΤΛΙΚΑ ΜΕΘΟΔΟΙ δζαθφιαημξ Tris Base 1M, ph 8,8 βζα ελμοδεηένςζδ. Σμ αήια αοηυ επζηοβπάκεζ ορδθυ ειπθμοηζζιυ ημο δείβιαημξ ζε ακηζζχιαηα εζδζηά βζα ημ ακηζβυκμ, εκχ ηαοηυπνμκα δ ζοκμθζηή πενζεηηζηυηδηα ακμζμζθαζνίκδξ ζημ δείβια κα είκαζ πμθφ ιζηνή. Αηυια, δεδμιέκμο υηζ δ δζαδζηαζία απμιυκςζδξ δεκ ιπμνεί κα είκαζ πμθφ αοζηδνή, ιδ εζδζηέξ ακμζμζθαζνίκεξ ιπμνεί κα είκαζ επίζδξ πανμφζεξ. Αημθμοεεί 2 μ ζηάδζμ ηαηά ημ μπμίμ βίκεηαζ ηαηηζηυξ ακμζμπνμζδζμνζζιυξ ακηζβυκμζοβηεηνζιέκςκ ακηζζςιάηςκ απυ ημ διζηαεανζζιέκμ παναζηεφαζια ιε ιζα ηακμκζηή RIPA ηαηά ηδκ μπμία ζημ ακςηένς ιίβια, πνμζεηέεδζακ 50 ιl PBS-0,5% Triton πενζέπμκημξ 70 fmoles δζαθοιέκμο ιε απμννοπακηζηυ ακενχπζκμο AChR (εκυξ ιίβιαημξ ειανοσημφ ηαζ εκήθζημο AChR) ζδιαζιέκμο ιε πενίπμο cpm 125 Η-αιπμοββανμημλίκδξ ηαζ πνμζεηέεδζακ 5 ιl ηακμκζημφ ακενχπζκμο μνμφ (NHS) ςξ θμνέα. Μεηά απυ επχαζδ 2 ςνχκ ζε εενιμηναζία πενζαάθθμκημξ, πνμζεηέεδζακ 50 ιl μνμφ αζβυξ έκακηζ ακενχπζκδξ ακμζμζθαζνίκδξ. Μεηά ηδκ επχαζδ επί πενίπμο 2 χνεξ, ημ ζπδιαηζγυιεκμ ίγδια πθφεδηε δζξ ιε 1 ml PBS-0,5% Triton X-100. Ζ ναδζεκένβεζα ημο πθοεέκημξ ζγήιαημξ ιεηνήεδηε ζε ιεηνδηή αηηίκςκ-β. Σα ζθαζνίδζα ιάνηονεξ Sepharose- AChR επςάζεδηακ ιε πανυιμζμοξ υβημοξ NHS βζα ηδκ εηηίιδζδ ηδξ ναδζεκένβεζαξ οπμαάενμο Παξαγσγή αλαζπλδπαζκέλσλ ηκεκάησλ ηεο αλζξώπηλεο Μπτθήο Κηλάζεο (MuSK) Αιπζηδσηή αληίδξαζε ηεο πνιπκεξάζεο (PCR) γηα ηελ ελίζρπζε αιιεινπρηώλ DNA Γζα ηδκ εκίζποζδ ηςκ αθθδθμοπζχκ DNA, ανπζηά πναβιαημπμζείηαζ απμδζάηαλδ ηδξ ιήηναξ ημο δίηθςκμο DNA, ιε εένιακζδ, χζηε κα παναπεμφκ ιμκυηθςκα ιυνζα DNA. Αημθμοεεί ρφλδ ημο ιίβιαημξ ηδξ ακηίδναζδξ ζε παιδθυηενδ εενιμηναζία, δ μπμία επζηνέπεζ ηδκ οανζδμπμίδζδ ηςκ εκανηηήνζςκ ιμνίςκ ιε ηζξ ζοιπθδνςιαηζηέξ αθοζίδεξ ηδξ ιήηναξ DNA ηαζ ηέθμξ, πναβιαημπμζείηαζ επζιήηοκζδ ηςκ κέςκ αθοζίδςκ DNA ιε ηδκ DNA πμθοιενάζδ. Ο ηφηθμξ ηδξ απμδζάηαλδξ, οανζδμπμίδζδξ ηαζ επζιήηοκζδξ 92

93 ΤΛΙΚΑ ΜΕΘΟΔΟΙ επακαθαιαάκεηαζ πμθθέξ θμνέξ ηαζ ηα πνμσυκηα ηάεε ηφηθμο εκίζποζδξ πνδζζιμπμζμφκηαζ, ςξ ιήηνα DNA, ζημκ επυιεκμ ηφηθμ. Οζ πμζυηδηεξ ηαζ μζ ζοκεήηεξ πμο πνδζζιμπμζήεδηακ βζα ηδκ εκίζποζδ ηςκ αθθδθμοπζχκ DNA ζε ηάεε ακηίδναζδ είκαζ 20 ng απυ ημ DNA πμο πνδζζιμπμζείηαζ ζακ ιήηνα, 10 pmoles απυ ηάεε εκανηηήνζμ ιυνζμ, 0,2 mm απυ ηάεε dntp ηαζ 1 U Taq DNA πμθοιενάζδξ (Minotech). Ζ ακηίδναζδ πναβιαημπμζήεδηε ζε νοειζζηζηυ δζάθοια πμο ζοκμδεφεζ ηδκ πμθοιενάζδ (10x: 50 mm KC1, 10 mm Tris-HCl, ph 8,5, 1,5 mm MgCl 2, 0,1% Triton X-100) (Minotech). Σα μθζβμκμοηθεμηίδζα πμο πνδζζιμπμζήεδηακ ζηζξ PCR πμο πναβιαημπμζήεδηακ ζηδκ πανμφζα ιεθέηδ, ζπεδζάζηδηακ έηζζ χζηε κα δζαεέημοκ αθθδθμοπίεξ ακαβκχνζζδξ απυ ηαηάθθδθα πενζμνζζηζηά έκγοια, πνμηεζιέκμο δ αθθδθμοπία DNA πμο εκζζπφεηαζ κα ιπμνεί κα ηθςκμπμζδεεί ζε ηαηάθθδθμ πθαζιζδζαηυ θμνέα έηθναζδξ. Οζ ακηζδνάζεζξ πναβιαημπμζήεδηακ ζε εενιζηυ ηοηθμπμζδηή MJ Research PTC200. Ανπζηά, ηα δείβιαηα εενιάκεδηακ ζημοξ 94 C, βζα 2 min, πνμηεζιέκμο κα απμδζαηαπεεί πθήνςξ ημ δίηθςκμ ιυνζμ ημο πθαζιζδζαημφ DNA. Αημθμφεδζακ 25 ηφηθμζ εκίζποζδξ ιε ηζξ αηυθμοεεξ ζοκεήηεξ: απμδζάηαλδξ οανζδμπμίδζδξ επζιήηοκζδξ 94 C, 30 sec 56 C, 30 sec 72 C, 1 min Μεηά ηδκ μθμηθήνςζδ ηςκ 25 ηφηθςκ εκίζποζδξ ηα δείβιαηα επςάζηδηακ βζα επζπθέμκ 10 min ζημοξ 72 C πνμηεζιέκμο κα πναβιαημπμζδεεί ημ ηεθζηυ ζηάδζμ ηδξ εκίζποζδξ ηςκ άηνςκ ηςκ πνμσυκηςκ ηαζ δ απεκενβμπμίδζδ ηδξ πμθοιενάζδξ. Σα πνμσυκηα ηδξ PCR ακαθφεδηακ ιε δθεηηνμθυνδζδ ζε πήηηςια 1% w/v αβανυγδξ Παξαζθεπή πιαζκηδηαθνύ DNA ζε κεγάιε θιίκαθα (maxi-preps) (α) Απνκόλσζε πιαζκηδηαθνύ DNA Γζα ηδκ απμιυκςζδ ιεβάθδξ πμζυηδηαξ ηαεανμφ πθαζιζδζαημφ DNA απυ ηαθθζένβεζεξ ααηηδνίςκ, πνδζζιμπμζείηαζ δ ιέεμδμξ ηδξ αθηαθζηήξ θφζδξ. 5 ml ενεπηζημφ οθζημφ LB ιε 50 ιg/ml αιπζηζθθίκδ ή LB-LS ιε 50 ιg/ml γεμζίκδ, ειαμθζάγμκηαζ ιε ηφηηανα ιίαξ απμζηίαξ ιεηαζπδιαηζζιέκςκ ααηηδνίςκ ηαζ αημθμοεεί επχαζδ οπυ ακάδεοζδ, ζημοξ 37 93

94 ΤΛΙΚΑ ΜΕΘΟΔΟΙ C, βζα πενίπμο 16 χνεξ. Απυ ηδκ παναπάκς ηαθθζένβεζα, 1 ml πνδζζιμπμζείηαζ βζα ημκ ειαμθζαζιυ 1 It ενεπηζημφ οθζημφ. Αημθμοεεί επχαζδ οπυ ακάδεοζδ, ζημοξ 37 C, βζα πενίπμο 16 χνεξ. Σα ηφηηανα θοβμηεκηνμφκηαζ ζηζξ rpm, βζα 15 min, ζημοξ 4 C, ζε θοβυηεκηνμ Sorvall, ιε ηεθαθή GS3. Σμ ίγδια ηςκ ααηηδνζαηχκ ηοηηάνςκ επακαδζαθφεηαζ ζε 40 ml νοειζζηζημφ δζαθφιαημξ GTE οπυ ακάδεοζδ ηαζ ημπμεεηείηαζ ζε πάβμ. Γζα ηδκ ηαηαζηνμθή ηςκ ιειανακχκ, πνμζηίεεκηαζ 200 mg θοζμγφιδξ οπυ ήπζα ακάδεοζδ ηαζ αημθμοεεί επχαζδ βζα 5 min. Έπεζηα βζα κα πναβιαημπμζδεεί απμδζάηαλδ ηςκ πνςηεσκχκ ηαζ δζάζπαζδ ημο πνςιμζςιζημφ DNA, πνμζηίεεκηαζ 80 ml θνέζημο δζαθφιαημξ 0,2 Μ NaOH / 1 % (w/v) SDS οπυ ακάδεοζδ ηαζ ημ ιίβια επςάγεηαζ ζημκ πάβμ, βζα 10 min. ηδ ζοκέπεζα, πνμζηίεεκηαζ 60 ml νοειζζηζημφ δζαθφιαημξ μλζηχκ, νζ 5,5 (3Μ KOAc/2M HOAc), πνμηεζιέκμο κα βίκεζ μοδεηενμπμίδζδ ημο νζ ηαζ ημ ιίβια ακαδεφεηαζ ηαζ επςάγεηαζ ζημκ πάβμ, βζα 10 min. Έπεζηα, απμιαηνφκεηαζ ιε θοβμηέκηνδζδ ζηζξ rpm, βζα 10 min, ζημοξ 4 C, ζε θοβυηεκηνμ Sorvall, ιε ηεθαθή GS3 ημ ίγδια ηςκ ηοηηανζηχκ οπμθεζιιάηςκ (ιειανακζηά εναφζιαηα, πνςηεΐκεξ ηαζ πνςιμζςιζηυ DNA). To οπενηείιεκμ ιεηαθένεηαζ ζε ηαεανυ ζςθήκα, αθμφ έπεζ πνμδβδεεί δζήεδζδ ημο απυ οαθμαάιααηα. Σα κμοηθεσκζηά μλέα ηαηαηνδικίγμκηαζ ιε πνμζεήηδ 0,6 υβηςκ ζζμπνμπακυθδξ, ακάδεοζδ, επχαζδ βζα 15 min, ζε εενιμηναζία δςιαηίμο ηαζ θοβμηέκηνδζδ ζηζξ rpm, βζα 15 min, ζημοξ 15 C, ζε θοβυηεκηνμ Sorvall, ιε ηεθαθή GS3. Σμ ίγδια ημο DNA εηπθέκεηαζ ιε 20 ml δζαθφιαημξ αζεακυθδξ 70% κ/κ ηαζ επακαθαιαάκεηαζ δ πνμδβμφιεκδ θοβμηέκηνδζδ. Μεηά ηδκ ελάπκςζδ ημο δζαθφηδ, επακαδζαθφεηαζ ζε 16 ml νοειζζηζημφ δζαθφιαημξ ΣΔ (10:1). ηδ ζοκέπεζα, ημ δζάθοια ημο DNA ιεηαθένεηαζ ζε ζςθήκα Corex ηαζ πνμζηίεεκηαζ 6ml παβςιέκμο δζαθφιαημξ 5 Μ LiCl, πμο ηαηαηνδικίγεζ ημ RNA. Αημθμοεεί ακάδεοζδ ηαζ θοβμηέκηνδζδ ζηζξ rpm, βζα 10 min, ζημοξ 4 C, ζε θοβυηεκηνμ Sorvall, ιε ηεθαθή SS34, πνμηεζιέκμο κα επζηεοπεεί δ απμιάηνοκζδ ημο RNA. (β) Απνκόλσζε ηνπ πιαζκηδηαθνύ DNA κε θαηαβύζηζε κε πνιπαηζπιελνγιπθόιε (PEG) Σμ ιίβια DNA πμο ανίζηεηαζ ζημ οπενηείιεκμ ιεηαθένεηαζ ζε ηαεανυ ζςθήκα Corex, πνμζηίεεηαζ ίζμξ υβημξ ζζμπνμπακυθδξ, ηαζ αημθμοεεί ακάδεοζδ ηαζ θοβμηέκηνδζδ ζηζξ 94

95 ΤΛΙΚΑ ΜΕΘΟΔΟΙ rpm, βζα 10 min, ζε θοβυηεκηνμ Sorvall, ιε ηεθαθή SS34. Σμ ίγδια ημο DNA εηπθέκεηαζ ιε δζάθοια αζεακυθδξ 70% v/v ηαζ, ιεηά ηδκ ελάηιζζδ ημο δζαθφηδ, επακαδζαθφεηαζ ζε 1 ml TE (10:1) πμο πενζέπεζ παβηνεαηζηή νζαμκμοηθεάζδ A (RΝase A) (20 ιg/ml) απαθθαβιέκδ απυ δεμλονίαμ-κμοηθεάζδ (DNase). Αημθμοεεί επχαζδ βζα 30 min. ηδ ζοκέπεζα, πνμζηίεεηαζ 1 ml δζαθφιαημξ 1,6 Μ NaCl, 13% (w/v) PEG Σμ ιίβια ακαδεφεηαζ ηαζ θοβμηεκηνείηαζ ζηζξ rpm, βζα 5 min, ζημοξ 4 C. To ίγδια επακαδζαθφεηαζ ζε 800 ιθ ΣΔ (10:1). (γ) Καζαξηζκόο πιαζκηδηαθνύ DNA κε εθρύιηζε κε νξγαληθνύο δηαιύηεο Καηά ηδκ εηπφθζζδ ιε ααζζηυ δζάθοια θαζκυθδξ, μζ πνςηεΐκεξ απμιαηνφκμκηαζ ζηδκ μνβακζηή θάζδ, εκχ ημ ηαεανυ DNA παναθαιαάκεηαζ ζηδκ οδαηζηή θάζδ. Ζ ιέεμδμξ είκαζ βνήβμνδ, εφημθδ ηαζ ιε παιδθυ ηυζημξ. Δπεζδή ηα πνμσυκηα μλείδςζδξ ηδξ θαζκυθδξ ιπμνεί κα ηαηαζηνέρμοκ ηα κμοηθεσηά μλέα, επζαάθθεηαζ δ πνήζδ ελζζζμνμπδιέκδξ θαζκυθδξ. Ζ δζαδζηαζία αοηή έπεζ ςξ ελήξ: Σμ οδαηζηυ δζάθοια DNA εηπεζθίγεηαζ ιε δζαδμπζηή πνμζεήηδ ίζςκ υβηςκ δζαθφιαημξ θαζκυθδξ, θαζκυθδξπθςνμθμνιίμο/ζζμαιοθζηήξ αθημυθδξ 1:1 ηαζ πθςνμθμνιίμο/ζζμαιοθζηήξ αθημυθδξ. Οζ δφμ θάζεζξ ακαιζβκφμκηαζ ιε έκημκδ ακάδεοζδ ηαζ δζαπςνίγμκηαζ ιεηά απυ ζφκημιδ θοβμηέκηνδζδ ( rpm, 5 min, εενιμηναζία δςιαηίμο) Παξαζθεπή πιαζκηδηαθνύ DNA ζε κηθξή θιίκαθα κε ηε κέζνδν ηεο αιθαιηθήο ιύζεο (mini preps) 5 ml ενεπηζημφ οθζημφ LB ιε 50 ιg/ml αιπζηζθθίκδ ή LB-LS ιε 50 ιg/ml γεμζίκδ, ειαμθζάγμκηαζ ιε ηφηηανα ιίαξ απμζηίαξ ιεηαζπδιαηζζιέκςκ ααηηδνίςκ ηαζ αημθμοεεί επχαζδ οπυ ακάδεοζδ, ζημοξ 37 C, βζα πενίπμο 16 χνεξ. Απυ ηδκ παναπάκς ηαθθζένβεζα, 1,5 ml ιεηαθένεηαζ ζε ζςθήκα 1,5 ml ηαζ θοβμηεκηνείηαζ ζηζξ rpm, βζα 5 min, ζε εενιμηναζία δςιαηίμο. ημκ ίδζμ δμηζιαζηζηυ ζςθήκα, ιεηαθένμκηαζ επζπθέμκ 1,5 ml ηαζ επακαθαιαάκεηαζ δ πνμδβμφιεκδ θοβμηέκηνδζδ. Σμ ίγδια ηςκ ααηηδνζαηχκ ηοηηάνςκ επακαδζαθφεηαζ ζε 100 ιl νοειζζηζημφ δζαθφιαημξ GTE οπυ ακάδεοζδ ηαζ ημ εκαζχνδια ημπμεεηείηαζ ζε πάβμ. Πνμζηίεεκηαζ 200 ιl θνέζημο δζαθφιαημξ 0,2 Μ NaOH / 1 % (w/v) SDS, ημ ιίβια ακαδεφεηαζ ηαζ επςάγεηαζ ζημκ πάβμ, βζα 10 min. ηδ ζοκέπεζα, 95

96 ΤΛΙΚΑ ΜΕΘΟΔΟΙ πνμζηίεεκηαζ 150 ιl νοειζζηζημφ δζαθφιαημξ μλζηχκ (3Μ KOAc/2M HOAc), ph 5,5, ημ ιίβια ακαδεφεηαζ ηαζ επςάγεηαζ ζημκ πάβμ, βζα 10 min. To ίγδια ηςκ ηοηηανζηχκ οπμθεζιιάηςκ (ιειανακζηά εναφζιαηα, πνςηεΐκεξ, πνςιμζςιζηυ DNA) απμιαηνφκεηαζ ιε θοβμηέκηνδζδ ζηζξ rpm, βζα 10 min, ζημοξ 4 C, ζε ροπχιεκδ ιζηνμθοβυηεκηνμ Eppendorf. Καηυπζκ, ημ οπενηείιεκμ ιεηαθένεηαζ ζε ηαζκμφνβζμ δμηζιαζηζηυ ζςθήκα υβημο 1,5 ml ηαζ αημθμοεεί ηαεανζζιυξ πθαζιζδζαημφ DNA ιε εηπφθζζδ ζε μνβακζημφξ δζαθφηεξ θαζκυθδξ/πθςνμθμνιίμο Πνηνηηθή αλάιπζε δείγκαηνο DNA α) Παναζηεοή πδηηχιαημξ αβανυγδξ Ανπζηά, ηαηάθθδθδ πμζυηδηα αβανυγδξ (βζα ιεβέεδ DNA 500 bp bp πνδζζιμπμζείηαζ 1% αβανυγδ) δζαθφεηαζ πθήνςξ ζε νοειζζηζηυ δζάθοια ΣΒΔ ιε εένιακζδ. Πνμζηίεεηαζ, 0,5 ιl ανςιζμφπμ αζείδζμ (πμνημηαθμηυηηζκδ θεμνίγμοζα πνςζηζηή) ηαζ ημ δζάθοια απμπφκεηαζ ζε ηαηάθθδθδ ζοζηεοή υπμο αθήκεηαζ κα πήλεζ ζε εενιμηναζία δςιαηίμο. α) Ζθεηηνμθυνδζδ Μεηά απυ πνμζεήηδ δζαθφιαημξ "θυνηςζδξ" δείβιαημξ DNA, ηα δείβιαηα ημπμεεημφκηαζ ζημ μνζγυκηζμ πήηηςια αβανυγδξ. Αημθμοεεί δθεηηνμθυνδζδ ζε νοειζζηζηυ δζάθοια ΣΒΔ, ιε νεφια ζηαεενήξ ηάζδξ, (βζα ιυνζα DNA > 500 bp είκαζ 1-3 V/cm). Λυβς ημο ζμκζζιμφ ηςκ θςζθμνζηχκ ημοξ μιάδςκ, ηα ιυνζα DNA είκαζ μιμζυιμνθα ανκδηζηά θμνηζζιέκα. Έηζζ, οπυ ηδκ επίδναζδ δθεηηνζημφ πεδίμο ζημ μνζγυκηζμ πήηηςια αβανυγδξ ηα ιυνζα ιεηαηζκμφκηαζ πνμξ ημ εεηζηυ πυθμ ιε ηαπφηδηα ακηζζηνυθςξ ακάθμβδ πνμξ ημ ιέβεεμξ ημοξ (Southern, 1979). Πανάθθδθα ιε ηα πνμξ ελέηαζδ δείβιαηα, ακαθφεηαζ ηαηάθθδθμξ ιάνηοναξ βκςζηχκ ιμνζαηχκ ιεβεεχκ DNA. Μεηά ηδκ μθμηθήνςζδ ηδξ δθεηηνμθυνδζδξ, ημ πήηηςια εηηίεεηαζ ζε οπενζχδδ αηηζκμαμθία ( nm), μπυηε δζαηνίκμκηαζ θεμνίγμοζεξ γχκεξ ζηζξ εέζεζξ υπμο έπμοκ ιεηακαζηεφζεζ ηα ιυνζα DNA. Ζ ιέεμδμξ πανέπεζ ορδθή ακάθοζδ ηαζ πνδζζιμπμζείηαζ βζα ηδκ ηαοημπμίδζδ, ημ δζαπςνζζιυ ηαζ ηδκ 96

97 ΤΛΙΚΑ ΜΕΘΟΔΟΙ απμιυκςζδ ιμνίςκ DNA, ιε αάζδ ημ ιέβεεμξ ημοξ. Μπμνεί κα πνδζζιμπμζδεεί βζα ακαθοηζημφξ ή παναζηεοαζηζημφξ ζημπμφξ Καζαξηζκόο πιαζκηδηαθνύ DNA α) Με εηπφθζζδ ιε μνβακζημφξ δζαθφηεξ Σμ οδαηζηυ δζάθοια DNA εηποθίγεηαζ, δζαδμπζηά, ιε ίζμ υβημ δζαθφιαημξ θαζκυθδξ, θαζκυθδξ-πθςνμθμνιίμο/ζζμαιοθζηήξ αθημυθδξ 1:1 ηαζ πθςνμθμνιίμο/ζζμαιοθζηήξ αθημυθδξ. Οζ δφμ θάζεζξ ακαιζβκφμκηαζ ιε έκημκδ ακάδεοζδ ηαζ δζαπςνίγμκηαζ ιεηά απυ ζφκημιδ θοβμηέκηνδζδ ( rpm, 5 min). Καηά ηδκ εηπφθζζδ ιε ααζζηυ δζάθοια θαζκυθδξ, μζ πνςηεΐκεξ απμιαηνφκμκηαζ ςξ ίγδια ζηδ δζεπζθάκεζα ιεηαλφ ηςκ δφμ θάζεςκ (μνβακζηή ηαζ οδαηζηή θάζδ), εκχ ημ ηαεανυ DNA παναθαιαάκεηαζ ζηδκ οδαηζηή θάζδ. α) Με "ζοζηδιαημπμζδιέκεξ" πνςιαημβναθζηέξ ιεευδμοξ Με ηδ ιέεμδμ QIAquick Gel Extraction Kit (QIAGEN Inc.) Απυ πήηηςια αβανυγδξ ηυαεηαζ ηαζ γοβίγεηαζ δ επζεοιδηή γχκδ DNA. ηδ ζοκέπεζα, μ ηαεανζζιυξ βίκεηαζ ζφιθςκα ιε ημ πνςηυημθθμ ηδξ ηαηαζηεοάζηνζαξ εηαζνείαξ. Πνμζηίεεηαζ νοειζζηζηυ δζάθοια QG ( βζα ηάεε 100 ιg πδηηχιαημξ πνμζηίεεκηαζ 300 ιl δζαθφιαημξ QG) ηαζ ημ ιίβια επςάγεηαζ ζημοξ 55 C, βζα 10 min, πνμηεζιέκμο κα δζαθοεεί δ αβανυγδ. Σμ δζάθοια ημπμεεηείηαζ ζηδ ζηήθδ QIAquick spin column ηαζ αημθμοεεί θοβμηέκηνδζδ ζε ιζηνμθοβυηεκηνμ, ζηζξ rpm, βζα 60 sec, ηαηά ηδκ μπμία ημ DNA δεζιεφεηαζ ζηδ ζηήθδ. Σμ έηθμοζια απμιαηνφκεηαζ ηαζ αημθμοεεί έηπθοζδ ηδξ ζηήθδξ ιε 0,75 ml νοειζζηζημφ δζαθφιαημξ ΡΔ ηαζ αημθμοεεί (δ ζφκεεζδ ημο μπμίμο δεκ ακαθένεηαζ απυ ημκ ηαηαζηεοαζηή), ημ μπμίμ πενζέπεζ 80% κ/κ αζεακυθδ. Αημθμοεεί θοβμηέκηνδζδ ζηζξ rpm, βζα 60 sec. To έηθμοζια, πμο πενζέπεζ ηζξ πνμζιίλεζξ, απμιαηνφκεηαζ ηαζ ηεθζηά δ έηθμοζδ ημο ηαεανμφ DNA απυ ηδ ζηήθδ πναβιαημπμζείηαζ ζε νοειζζηζηυ δζάθοια 10 mm Tris/HCl ph 8,0 ιε θοβμηέκηνδζδ ζηζξ rpm, βζα 60 sec. Με ηδ ιέεμδμ QIAquick PCR purification Kit (QIAGEN Inc) ε έκακ υβημ δζαθφιαημξ ακηίδναζδξ PCR πνμζηίεεκηαζ 5 υβημζ δζαθφιαημξ ΡΒ ηαζ ημ δείβια ημπμεεηείηαζ ζηδ ζηήθδ. Αημθμοεεί θοβμηέκηνδζδ ζηζξ rpm, βζα 60, ζε 97

98 ΤΛΙΚΑ ΜΕΘΟΔΟΙ εενιμηναζία δςιαηίμο ηαζ απμιάηνοκζδ ημο εηθμουιεκμο ηθάζιαημξ. ηδ ζοκέπεζα, δ ζηήθδ εηπθέκεηαζ ιε 0,75 ml δζαθφιαημξ ΡΔ ηαζ αημθμοεεί δ ίδζα δζαδζηαζία ιε ημ Gel Extraction Kit. Ζ ιέεμδμξ πνδζζιμπμζείηαζ ηονίςξ βζα ημκ ηαεανζζιυ πνμσυκηςκ ακηίδναζδξ PCR απυ ηα εκανηηήνζα ιυνζα, ηα εθεφεενα ιμκμκμοηθεμηίδζα ηαζ ηδκ πμθοιενάζδ, ηαεχξ ηαζ βζα ημκ ηαεανζζιυ ιμνίςκ DNA ιεηά απυ πέρεζξ Καηαθξήκληζε ηνπ DNA Ζ ηαηαηνήικζζδ ημο DNA, ζε δζάθμνα ζηάδζα, πναβιαημπμζείηαζ ιε πνμζεήηδ 1/10 ημο ανπζημφ υβημο δζαθφιαημξ 3 Μ μλζημφ καηνίμο, νζ 4,8 ηαζ δζπθάζζμο υβημο πνμροβιέκδξ απυθοηδξ αζεακυθδξ, δ μπμία πνδζζιμπμζείηαζ ςξ αθοδαηζηυ ιέζμ. Αημθμοεεί θοβμηέκηνδζδ ζηζξ rpm, βζα 15 min ζημοξ 4 C ηαζ έηπθοζδ ημο ζγήιαημξ πμο πνμηφπηεζ ιε δζάθοια αζεακυθδξ 70% v/v, βζα ηδκ απμιάηνοκζδ αθάηςκ. Μεηά ηδκ ελάηιζζδ ημο δζαθφηδ ιέζς παναιμκήξ ζημοξ 37 C, ημ ίγδια επακαδζαθφεηαζ ζημκ επζεοιδηυ υβημ νοειζζηζημφ δζαθφιαημξ ΣΔ (10:1). Ζ ιέεμδμξ πνδζζιμπμζείηαζ βζα ηδ ζοιπφηκςζδ ηςκ κμοηθεσκζηχκ μλέςκ, υηακ απαζηείηαζ αθθαβή ημο νοειζζηζημφ δζαθφιαημξ, ή βζα ηδκ απμιάηνοκζδ αθάηςκ, μθζβμκμοηθεμηζδίςκ ηαζ άθθςκ δζαθοηχκ πνμζιίλεςκ απυ οδαηζηά δζαθφιαηα κμοηθεσκζηχκ μλέςκ Πνζνηηθή αλάιπζε δηαιύκαηνο DNA Ζ ζοβηέκηνςζδ δζαθφιαημξ δίηθςκμο DNA πνμζδζμνίγεηαζ θςημιεηνζηά, ιε ιέηνδζδ ηδξ απμννυθδζδξ ημο δζαθφιαημξ ζηδκ πενζμπή ημο οπενζχδμοξ, υπμο απμννμθμφκ μζ αγςημφπεξ αάζεζξ ημο DNA. Μεηνάηαζ δ απμννυθδζδ ημο δείβιαημξ ζηα 260 nm ηαζ δ ζοβηέκηνςζδ ημο πνμζδζμνίγεηαζ αάζεζ ηδξ παναηάης ζπέζδξ: = [(O.D. 260 nm x 50 x αναίςζδ) / 1000] (ιg/ιl). Ζ ηαεανυηδηα ημο DNA ζημ παναζηεφαζια πνμζδζμνίγεηαζ απυ ημ θυβμ Α260/Α280, μ μπμίμξ βζα ηαεανά παναζηεοάζιαηα είκαζ ίζμξ πνμξ 1,8. 98

99 ΤΛΙΚΑ ΜΕΘΟΔΟΙ Πέςε DNA κε πεξηνξηζηηθέο ελδνλνπθιεάζεο Οζ πενζμνζζηζηέξ εκδμκμοηθεάζεξ, μζ μπμίεξ απμιμκχκμκηαζ απυ θοζζηέξ πδβέξ (ααηηήνζα), ακαβκςνίγμοκ ιζηνέξ αθθδθμοπίεξ DNA ηαζ ηυαμοκ ημ δίηθςκμ DNA ζε ζοβηεηνζιέκεξ εέζεζξ, εκηυξ ηδξ αθθδθμοπίαξ ακαβκχνζζδξ ή ζε βεζημκζηυ ηδξ ζδιείμ. Μζα ιμκάδα (1 U) πενζμνζζηζηήξ εκδμκμοηθεάζδξ μνίγεηαζ ςξ δ πμζυηδηα ημο εκγφιμο πμο απαζηείηαζ βζα ηδκ πθήνδ πέρδ 1 ιg ηαεανμφ DNA, ιε ιζα εέζδ ακαβκχνδζδξ. Οζ ακηζδνάζεζξ πέρδξ, πναβιαημπμζμφκηαζ ζε ζοβηεκηνχζεζξ άθαημξ ηαζ εενιμηναζίεξ πμο ακαβνάθμκηαζ ηάεε θμνά ζηα ζοκμδεοηζηά θοθθάδζα ηςκ εκγφιςκ ηδξ ηαηαζηεοάζηνζαξ εηαζνείαξ. Οζ ζοκεήηεξ αοηέξ είκαζ εζδζηέξ βζα ηάεε πενζμνζζηζηή εκδμκμοηθεάζδ. Χζηυζμ, ιενζηέξ πενζμνζζηζηέξ εκδμκμοηθεάζεξ είκαζ δναζηζηέξ ηαζ ζε δζαθμνεηζηέξ ζοβηεκηνχζεζξ άθαημξ. Σέημζα έκγοια πνδζζιμπμζήεδηακ απμηεθεζιαηζηά βζα δζπθή πέρδ ζημ ίδζμ νοειζζηζηυ δζάθοια. Σα έκγοια πνμζηέεδηακ ζε υβημ πμο δεκ λεπενκμφζε ηάεε θμνά ημ 1/10 ημο ηεθζημφ υβημο ηδξ ακηίδναζδξ, χζηε δ ηεθζηή ζοβηέκηνςζδ ηδξ βθοηενυθδξ, πμο πενζέπεηαζ ζημ δζάθοια θφθαλδξ ημο εκγφιμο, κα παναιέκεζ παιδθή ηαζ κα ιδκ επδνεάγεζ ηδκ ακηίδναζδ. Ο έθεβπμξ ηςκ ακηζδνάζεςκ πέρδξ έβζκε ιε δθεηηνμθυνδζδ δείβιαημξ απυ ημ δζάθοια ηδξ ακηίδναζδξ ζε πήηηςια αβανυγδξ 1% (w/v) Απνθσζθνξπιίσζε γξακκηθνύ πιαζκηδηαθνύ DNA Πνμξ απμθοβή ηδξ επακαζφκδεζδξ ηςκ άηνςκ ημο πθαζιζδζαημφ DNA, ζηζξ πενζπηχζεζξ πμο πνμηφπημοκ ζ' αοηυ ζοιπθδνςιαηζηά ημθθχδδ άηνα ιεηά ηδκ πέρδ ημο ηαζ πνζκ απυ ηδκ ακηίδναζδ ζφκδεζδξ ιε ηδ DNA θζβάζδ, πναβιαημπμζείηαζ απμθςζθμνοθίςζδ ιε πνήζδ ημο εκγφιμο ηδξ αθηαθζηήξ θςζθαηάζδξ απυ έκηενμ ιμζπανζμφ (calf intestinal alkaline phosphatase, CIAP). To έκγοιμ αοηυ απμθςζθμνοθζχκεζ ηα 5' άηνα ημο βναιιζημφ πθαζιζδζαημφ DNA. To πνμξ ηθςκμπμίδζδ ιυνζμ DNA ιπμνεί ηαζ ζοκδέεηαζ ιε ημ απμθςζθμνοθζςιέκμ πθαζιίδζμ, ζπδιαηίγμκηαξ ζε ηάεε άηνμ θςζθμδζεζηενζηυ δεζιυ ζηδ ιία απυ ηζξ δφμ αθοζίδεξ. ηδ ζοκέπεζα ημ ααηηήνζμ Ε. coli επζδζμνεχκεζ ηα απμζθςθμνοθζςιέκα άηνα, δδιζμονβμφκηαζ μζ δεζιμί ηαζ ζηζξ δφμ άθθεξ αθοζίδεξ ηαζ ημ ακαζοκδοαζιέκμ πθαζιίδζμ δζπθαζζάγεηαζ πθέμκ ηακμκζηά. Έηζζ θμζπυκ, 50 99

100 ΤΛΙΚΑ ΜΕΘΟΔΟΙ ιl δζαθφιαημξ 10 mm Tris-HCl, νζ 8,0 πμο πενζέπμοκ 10 ιg ηαεανζζιέκμο απυ ζηήθδ QIAquick βναιιζημφ πθαζιζδζαημφ DNA ακαιζβκφμκηαζ ιε 10 ιl νοειζζηζημφ δζαθφιαημξ απμθςζθμνοθίςζδξ, πνμζηίεεηαζ 5 ιl (0,5 U) δζαθφιαημξ CΗAP (Gibco BRL) ηαζ 35 ιl ddh 2 O ηαζ ημ ιίβια επςάγεηαζ ζημοξ 37 C, βζα 60 min. ηδ ζοκέπεζα ημ ιίβια επςάγεηαζ ζημοξ 65 C, βζα 15 min χζηε κα απεκενβμπμζδεεί δ δνάζδ ημο εκγφιμο. Αημθμοεεί ηαεανζζιυξ απυ ζηήθδ QIAquick ηαζ ημ DNA εηθμφεηαζ ιε πνμζεήηδ ζηδ ζηήθδ 40 ιl νοειζζηζημφ δζαθφιαημξ 10 mm Tris-HCl, ph 8,0 ηαζ θοβμηέκηνδζδ ζηζξ rpm, βζα 60 min, ζε εενιμηναζία δςιαηίμο Αληίδξαζε ζύλδεζεο κε ηε ρξήζε Σ4 DNA ιηγάζεο Πνμηεζιέκμο κα πναβιαημπμζδεεί δ ακηίδναζδ ζφκδεζδξ ημο πθαζιζδζαημφ DNA ιε ημ πνμξ ηθςκμπμίδζδ ιυνζμ DNA, ng πθαζιζδζαημφ DNA ακαιεζβκφμκηαζ ιε ng ημο πνμξ ηθςκμπμίδζδ ιμνίμο πανμοζία 2ιl (1U/ιl) Σ4 DNA θζβάζδξ ηαζ ημο ακηίζημζπμο νοειζζηζημφ ηδξ δζαθφιαημξ (40 mm Tris-HCl, 100 mm MgCl, 10 mm DTT, 0,5 mm ATP, ph 7,8) (Fermentas). Ζ ακηίδναζδ πναβιαημπμζείηαζ ζε ηεθζηυ υβημ 22 ιl ζε εενιμηναζία δςιαηίμο, βζα 60. ηδ ζοκέπεζα, μζ ακηζδνάζεζξ πνδζζιμπμζμφκηαζ άιεζα βζα ημ ιεηαζπδιαηζζιυ ααηηδνίςκ. ε πενζπηχζεζξ πμο ημ πνμξ ηθςκμπμίδζδ ιυνζμ DNA ηαζ ημ πθαζιίδζμ δζαεέημοκ ζζμηεθή ή ζοιπθδνςιαηζηά ημθθχδδ άηνα πμο έπμοκ πνμηφρεζ απυ πέρδ ιε ημ ίδζμ πενζμνζζηζηυ έκγοιμ, δ ζφκδεζδ ημο ιμνίμο DNA πναβιαημπμζείηαζ ιε ηδκ ίδζα πζεακυηδηα ηαζ ιε ημοξ δφμ πνμζακαημθζζιμφξ (5 >3' ή 3' >5'). Ζ εφνεζδ ημο ζςζημφ πνμζακαημθζζιμφ ζφκδεζδξ βίκεηαζ ιε ηδ πνήζδ πενζμνζζηζηχκ εκγφιςκ πμο ηυαμοκ αζφιιεηνα ιέζα ζημ ηθςκμπμζδιέκμ ηιήια DNA Τγξέο θαη ζηεξεέο θαιιηέξγεηεο βαθηεξηαθώλ θπηηάξσλ Υνδζζιμπμζμφκηαζ ηα ζηεθέπδ TOP10 F' ηα μπμία ηαθθζενβμφκηαζ ζε οβνυ ή ζηενευ ενεπηζηυ ιέζμ LB πανμοζία ηαηάθθδθμο ακηζαζμηζημφ. Ζ ακάπηολδ ημοξ πναβιαημπμζείηαζ ζημοξ 37 C, ζε επςαζηζημφξ εαθάιμοξ. Γζα ηζξ οβνέξ ηαθθζένβεζεξ, δ επχαζδ πναβιαημπμζείηαζ, οπυ ακάδεοζδ, ζε απμζηεζνςιέκμοξ ζςθήκεξ ιζαξ πνήζδξ ηςκ 15 ml 100

101 ΤΛΙΚΑ ΜΕΘΟΔΟΙ (ιζηνέξ ηαθθζένβεζεξ), ή ζε θθάζηεξ ηςκ 2 θίηνςκ (ηαθθζένβεζεξ ζε ιεβάθδ ηθίιαηα). Γζα υθεξ ηζξ ηαθθζένβεζεξ πναβιαημπμζείηαζ επχαζδ βζα πνυκμ 16 χνεξ. Σα ιεηαζπδιαηζζιέκα ηαζ ιδ ιεηαζπδιαηζζιέκα ααηηήνζα δζαηδνμφκηαζ βζα ιεβάθα πνμκζηά δζαζηήιαηα ζημ ηαηάθθδθμ ενεπηζηυ ιέζμ πανμοζία 20% βθοηενυθδξ, ζημοξ -80 C. Οζ ζηενεέξ ηαθθζένβεζεξ δζαηδνμφκηαζ ζημοξ 4 C βζα δζάζηδια ανηεηχκ διενχκ έςξ ηαζ ιενζηχκ εαδμιάδςκ Μεηαζρεκαηηζκόο βαθηεξίσλ α) Πνμεημζιαζία επζδεηηζηχκ ηοηηάνςκ ιε ηδ πνήζδ πθςνζμφπμο αζαεζηίμο (CaCl 2 ) Ανπζηά, ιζα απμζηία ααηηδνίςκ ειαμθζάγεηαζ ζε 10 ml LB ηαζ αημθμοεεί επχαζδ οπυ ακάδεοζδ, ζημοξ 37 C, βζα πενίπμο 16 h. Απυ ηδκ παναπάκς ηαθθζένβεζα 2 ml πνδζζιμπμζμφκηαζ βζα ημκ ειαμθζαζιυ 100 ml LB. Αημθμοεεί επχαζδ οπυ ακάδεοζδ, ζημοξ 37 C, ιέπνζ O.D. 600 nm = 0,6 (~2 χνεξ). ηδ ζοκέπεζα, δ ηαθθζένβεζα ημπμεεηείηαζ ζημκ πάβμ, βζα 30, αθμφ ιεηαθενεεί ζε ζηείνμοξ πνμροβιέκμοξ ζςθήκεξ, ηαζ θοβμηεκηνείηαζ ζηζξ rpm, βζα 10 min, ζημοξ 4 C. ε υθδ ηδκ οπυθμζπδ πμνεία ηα ηφηηανα δζαηδνμφκηαζ ζημκ πάβμ. Σμ ίγδια ηςκ ααηηδνίςκ επακαδζαθφεηαζ ζε 25 ml ζηείνμο παβςιέκμο δζαθφιαημξ 0,05 Μ CaCl 2. Ζ έηεεζδ ηςκ ααηηδνίςκ ζε CaCl 2 έπεζ ςξ απμηέθεζια ηδκ απυδμζδ εεηζημφ θμνηίμο ζημ ημίπςια ηςκ ααηηδνίςκ, ηαζ ζε ζοκδοαζιυ ιε εενιζηυ ζμη, δζεοημθφκεηαζ δ δζείζδοζδ ηςκ ακαζοκδοαζιέκςκ πθαζιζδίςκ πμο είκαζ ανκδηζηά θμνηζζιέκα (Gething et al., 1989). Σμ εκαζχνδια θοβμηεκηνείηαζ ζηζξ rpm, βζα 10 min, ζημοξ 4 C ηαζ ημ ίγδια ηςκ ααηηδνίςκ επακαδζαθφεηαζ ζε 5 ml ζηείνμο παβςιέκμο δζαθφιαημξ 0,05 Μ CaCl 2. ηδ ζοκέπεζα, ημ εκαζχνδια ημπμεεηείηαζ ζημκ πάβμ, βζα 2-3 χνεξ. Πνμζηίεεηαζ απμζηεζνςιέκδ βθοηενυθδ ζε ηεθζηή ζοβηέκηνςζδ 20% v/v ηαζ ημ ιίβια ακαδεφεηαζ ηαθά, χζηε κα ζπδιαηζζηεί έκα μιμζμβεκέξ εκαζχνδια ηςκ ααηηδνζαηχκ ηοηηάνςκ. Σμ ααηηδνζαηυ αοηυ εκαζχνδια ιμζνάγεηαζ ακά 100 ιl ζε ζηείνμοξ ζςθήκεξ 1,5 ml ηαζ αιέζςξ ιεηαθένμκηαζ ζε οβνυ άγςημ. Με ημκ ηνυπμ αοηυ ηα ηφηηανα παβχκμοκ αηανζαία. Σα επζδεηηζηά ααηηήνζα δζαηδνμφκηαζ ζημοξ -80 C. 101

102 ΤΛΙΚΑ ΜΕΘΟΔΟΙ α) Μεηαζπδιαηζζιυξ ααηηδνίςκ Σμ εκαζχνδια ηςκ επζδεηηζηχκ ααηηδνίςκ ιεηαθένεηαζ ζε πάβμ. Σμ δζάθοια ηδξ ακηίδναζδξ ζφκδεζδξ ιε θζβάζδ 22 ιl ή 10 ng πθαζιζδίμο, ιεηαθένμκηαζ ζε 100 ιl ααηηδνζαημφ εκαζςνήιαημξ πςνίξ ακάδεοζδ, ηαζ επςάγμκηαζ ζημκ πάβμ, βζα 1 χνεξ. Πναβιαημπμζείηαζ εενιζηυ ζμη ιε επχαζδ ζε οδαηυθμοηνμ ζημοξ 42 C βζα 90 sec, ηζ αημθμοεεί ημπμεέηδζδ ζε πάβμ ηαζ επχαζδ βζα 5 min. Πνμζηίεεηαζ 1 ml ενεπηζημφ οθζημφ LB ηαζ αημθμοεεί επχαζδ οπυ ακάδεοζδ, ζημοξ 37 C, βζα min. ηδ ζοκέπεζα, ηα ααηηήνζα επζζηνχκμκηαζ ζε ζηενευ ενεπηζηυ ιέζμ, ζε ηνοαθίμ Petri, πανμοζία ηαηάθθδθμο ακηζαζμηζημφ, ηαζ επςάγμκηαζ ζημοξ 37 C βζα 16 χνεξ Έθθξαζε ηεο αλαζπλδπαζκέλεο πξσηεΐλεο ζε βαθηήξηα ζε Ε. coli Σμ αιζκμηεθζηυ ελςηοηηανζηυ ηιήια (αιζκμλέα 1-463) ηδξ ακενχπζκδξ Μοσηήξ Κζκάζδξ (MuSK) ηθςκμπμζήεδηε ιε PCR πνδζζιμπμζχκηαξ ςξ ιήηνα έκακ μθζηυ MuSK cdna ηθχκμ (ζζμιμνθή #2), (εοβεκζηή παναπχνδζδ απυ ημκ D. Beeson, Πακεπζζηήιζμ Oxford, UK) ηαζ πνδζζιμπμζήεδηε ζε ακαζοκδοαζιέκδ ιμνθή αθμφ πνχηα εηθνάζεδηε ζηδκ. Ε. Coli. Χξ πνυζεζμ (forward) εκανηηήνζμ ιυνζμ πνδζζιμπμζήεδηε ημ (5'- TAATTACTCGAGCTTCCAAAAGCTCCTGTCATCAC-3 ), MuSKforXho ηαζ ςξ ακάζηνμθμ (reverse) ημ (5'-TAATTACTCGAGTCATTAAGGTGAGACAGAGAAGG-3 ), MuSKrevXho, ηα μπμία ήηακ ζπεδζαζιέκα έηζζ χζηε κα πενζθαιαάκμοκ ηδκ πενζμνζζηζηή εέζδ XhoI υπςξ έπεζ οπμβναιιζζεεί. Σμ ακενχπζκμ ελςηοηηανζηυ ηιήια ηδξ ακενχπζκδξ Μοζηήξ Κζκάζδξ (MuSK) ηθςκμπμζήεδηε ζημκ πθαζιζδζαηυ θμνέα pet-15b (Novagen) ζηδ εέζδ XhoI. ηδ ζοκέπεζα έβζκε ιεηαζπδιαηζζιυξ ηαζ έηθναζδ ηδξ ακαζοκδοαζιέκδξ πνςηεΐκδξ ζηα BL21(DE3)pLysS ααηηήνζα. Σα ααηηήνζα BL21(DE3) plyss πενζέπμοκ ζημ βεκεηζηυ ημοξ οθζηυ ημ βμκίδζμ ηδξ Σ7 RNA πμθοιενάζδξ (πμθοιενάζδ ημο ααηηδνζμθάβμο Σ7). Ζ έηθναζδ ηδξ ακαζοκδοαζιέκδξ πνςηεΐκδξ ιε ημκ πθαζιζδζαηυ θμνέα pet-15b ανίζηεηαζ ηάης απυ ημκ έθεβπμ ηδξ Σ7 RNA πμθοιενάζδξ, ηαεχξ ημ πθαζιίδζμ δζαεέηεζ έκακ Σ7 οπμηζκδηή 102

103 ΤΛΙΚΑ ΜΕΘΟΔΟΙ ιπνμζηά απυ ηδκ πενζμπή ημο πμθοζοκδέηδ. H MuSK-ECD, πενζέπεζ ιζα πμθφ-ζζηζδζκζηή αθθδθμοπία (6xHis tag) ζημ αιζκμηεθζηυ εκανηηήνζμ άηνμ (Ν-terminal). Ζ πνμζεήηδ 1mM α-ζζμπνμποθμ-1-εεζμ-α-d-βαθαηημγζδίμο (IPTG) ζημ οθζηυ ηδξ ηαθθζένβεζαξ υηακ δ OD 590 = 0,6 βζα 4 χνεξ ζημοξ 37 μ C, επάβεζ ηδ ζφκεεζδ ηδξ Σ7 RNA πμθοιενάζδξ, δ μπμία ιε ηδ ζεζνά ηδξ ιεηαβνάθεζ ηδκ αθθδθμοπία-ζηυπμ πμο έπεζ ηθςκμπμζδεεί ζημ πθαζιίδζμ pet- 15b. Δηθόλα 13. Υάξηεο θισλνπνίεζεο πξνο έθθξαζε ζε E. coli Υάνηδξ ηδξ ηαηαζηεοήξ pet-15b-μusk-ecd ζημκ μπμίμ θαίκεηαζ δ έκεεζδ ΜuSK-ECD (463 γεφβδ αάζεςκ) ζηδ εέζδ XhoI ημο πθαζιζδίμο, δ αθθδθμοπία ηςκ έλζ ζζηζδζκχκ (His tag). ημζπεία εθέβπμο ημο ζοζηήιαημξ έηθναζδξ Σ7. Aκαπανάζηαζδ ααηηδνζαημφ ηοηηάνμο BL21(DE3)pLysS, ιεηαζπδιαηζζιέκμο ιε πθαζιίδζμ ηδξ ζεζνάξ pδσ, ζημ μπμίμ έπεζ ηθςκμπμζδεεί ημ βμκίδζμ-ζηυπμξ), (απυ Novagen, pet vector, instruction manual, version TB055 11th Edition 01/06). Έβζκε ακαγήηδζδ ηδξ έηθναζδξ ηδξ ακαζοκδοαζιέκδξ πνςηεΐκδξ ζηα δζάθμνα ηθάζιαηα ηα μπμία πνμηφπημοκ ιεηά ηδκ θφζδ ημο ζγήιαημξ ηςκ ηοηηάνςκ, είηε ζε 103

104 ΤΛΙΚΑ ΜΕΘΟΔΟΙ δζαθοηή ιμνθή ζημ οπενηείιεκμ, είηε ζε απμδζαηαβιέκδ ιμνθή ζημ αδζάθοημ ίγδια ηςκ εβηθείζηςκ ζςιαηζδίςκ, ιεηά απυ ακμζμαπμηφπςζδ ηαηά Western ηαζ ακίπκεοζδ ιε ακηί- Ζis ιμκμηθςκζηυ ακηίζςια. Ζ εηθναγυιεκδ πνςηεΐκδ ηαεανίζηδηε ηαζ απμιμκχεδηε ιεηά ηδκ πνυζδεζδ ζε ζηήθεξ ζθαζνζδίςκ Ni 2+ -NTA αβανυγδξ ηάης απυ απμδζαηαηηζηέξ ζοκεήηεξ ζε δζάθοια 6 Μ οδνμπθςνζηήξ βμοακζδίκδξ (GuHCl) ηαζ έηθμοζδ ιε 50 mm θςζθμνζημφ νοειζζηζημφ δζαθφιαημξ πμο πενζέπεζ 100 mm ζιζδαγυθζμ, ph 8 ηαζ 8 Μ μονία. Σα δζάθμνα ζηάδζα ηδξ δζαδζηαζίαξ δ μπμία αημθμοεήεδηε πενζβνάθμκηαζ πενζζζυηενμ ακαθοηζηά ηαηςηένς. Γζα ηδκ έηθναζδ ηδξ ακαζοκδοαζιέκδξ πνςηεΐκδξ, ανπζηά ειαμθζάγμκηαζ 10 ml LB ενεπηζημφ οθζημφ 50 ιg/ιl πθςναιθεκζηυθδ, ιε ιία απμζηία ιεηαζπδιαηζζιέκςκ ααηηδνίςκ BL21(DE3)pLysS ηαζ αημθμοεεί επχαζδ αοηχκ, ιε ακάδεοζδ ζημοξ 37 C βζα πενίπμο 16 χνεξ. ηδ ζοκέπεζα, βίκεηαζ ειαμθζαζιυξ 1 lt ενεπηζημφ οθζημφ LB, πμο πενζέπεζ 100 mg αιπζηζθθίκδξ ηαζ 50 ιg/ml πθςναιθεκζηυθδ, ιε 1 ml απυ ηδκ παναπάκς ηαθθζένβεζα ηαζ επχαζδ ιε ακάδεοζδ ζημοξ 37 C, ιέπνζ δ O.D. 590 nm κα βίκεζ 0,6. Αημθμοεεί, πνμζεήηδ IPTG ζε ηεθζηή ζοβηέκηνςζδ 1 mm ηαζ επχαζδ ηδξ ηαθθζένβεζαξ ζημοξ 37 C βζα 4 χνεξ. Έπεζηα, βίκεηαζ θοβμηέκηνδζδ ηδξ ηαθθζένβεζαξ ζηζξ rpm βζα 15 θεπηά ζημοξ 4 C ηαζ αημθμοεεί απμιάηνοκζδ ημο οπενηεζιέκμο ηαζ πθφζδ ημο ζγήιαημξ ιε PBS. Ζ ακαζοκδοαζιέκδ πνςηεΐκδ ανίζηεηαζ ιε ηδ ιμνθή εβηθείζηςκ ζςιαηίςκ ζημ εζςηενζηυ ηςκ ααηηδνζαηχκ ηοηηάνςκ, ηα μπμία δζαθοημπμζμφκηαζ ιε 100 ml απμδζαηαηηζημφ δζαθφιαημξ 6 Μ οδνμπθςνζηήξ βμοακζδίκδξ (GuHCl), 10 mm Tris-HCl, 300mM NaCl, ph 8,0. ηδ ζοκέπεζα, βίκεηαζ θφζδ ημο ααηηδνζαημφ θφιαημξ ζηαδζαηά ιε ηνεζξ ηφηθμοξ ααεζάξ ρφλδξ-ηήλδξ, ηδκ πνμζεήηδ Λοζμγφιδξ (1mg/ml) βζα 30 θεπηά ζε οδαηυθμοηνμ πάβμο, ηδ πνήζδ οπενήπςκ βζα 3 πενζυδμοξ δζάνηεζαξ 1 θεπημφ δ ηαεειία ζημ ιέβζζημ, ημ πέναζια απυ 17G ζφνζββα-αεθυκα ηαζ θοβυηεκηνδ ζδ ζηζξ xg βζα 30 θεπηά ζημοξ 4 C. Σέθμξ, βίκεηαζ ζοθθμβή ημο οπενηεζιέκμο πμο πενζέπεζ ημ ζφκμθμ ηςκ ααηηδνζαηχκ πνςηεσκχκ (ιαγί ηαζ ηδκ ακαζοκδοαζιέκδ πνςηεΐκδ) ζε απμδζαηαβιέκδ ιμνθή, ηαζ θφθαλδ ημο ζε εενιμηναζία δςιαηίμο ιέπνζ ηδ δζαδζηαζία ημο ηαεανζζιμφ ηδξ πνςηεΐκδξ. 104

105 ΤΛΙΚΑ ΜΕΘΟΔΟΙ Καζαξηζκόο πξσηετλώλ κε ρξσκαηνγξαθία ζπγγέλεηαο από ζηήιε Ni 2+ -NTA αγαξόδεο Ο ηαεανζζιυξ ηαζ δ απμιυκςζδ ηςκ εηθναζιέκςκ ακαζοκδοαζιέκςκ πνςηεσκχκ έβζκε ιε ζηήθεξ ζθαζνζδίςκ Ni 2+ -NTA αβανυγδξ ηάης απυ απμδζαηαηηζηέξ ζοκεήηεξ ζε δζάθοια 6 Μ οδνμπθςνζηήξ βμοακζδίκδξ (GuHCl) ηαζ δ έηθμοζδ ζε 50 mm θςζθμνζημφ νοειζζηζημφ δζαθφιαημξ πμο πενζέπεζ 100 mm ζιζδαγμθίμο, ph 8 ηαζ 8 Μ μονίαξ (urea). Οζ ακαζοκδοαζιέκεξ πνςηεΐκεξ πμο εηθνάζηδηακ ιε ημ πθαζιίδζμ νδσ-15b δζαεέημοκ ζημ Ν-ηεθζηυ ημοξ άηνμ ιία αθθδθμοπία απυ έλζ ζοκεπή ηαηάθμζπα ζζηζδίκδξ (6xHis tag). Ζ αθθδθμοπία αοηή επζηνέπεζ ημκ ηαεανζζιυ ημοξ ιε πνςιαημβναθία ζοββέκεζαξ ζε ζηήθδ κζηεθίμο (Ni 2+ -NTA-αβανυγδ). Οζ πνςηεΐκεξ πνμζδέκμκηαζ ιε ορδθή ζοββέκεζα ζηδ ζηήθδ ζε pζ 8,0, ηαεχξ ζ' αοηήκ ηδκ ηζιή νζ ηα ηαηάθμζπα ζζηζδίκδξ θμνηίγμκηαζ ανκδηζηά ηαζ ζπδιαηίγμοκ έκα δαηηφθζμ βφνς απυ ημ ηαηζυκ κζηεθίμο. Ζ ζηακυηδηα ηδξ ζηήθδξ κζηεθίμο κα πνμζδέκεζ 6xHis-επζζδιαζιέκεξ πνςηεΐκεξ είκαζ 5-10 mg πνςηεΐκδξ/ml ζηήθδξ. ηδκ πενίπηςζδ ηδξ έηθναζδξ ζε Ε. coli, μ ηαεανζζιυξ πναβιαημπμζήεδηε ζε ζζπονά απμδζαηαηηζηέξ ζοκεήηεξ, ιε ηθίζδ αολακυιεκδξ ζοβηέκηνςζδξ ζιζδαγμθίμο (40, 70 ηαζ 100 mm ζιζδαγμθίμο ζε δζάθοια PBS νζ 8,0, 500 mm NaCl). Ζ ηαεανυηδηα ηαζ δ πμζυηδηα ηςκ ακαζοκδοαζιέκςκ πμθοπεπηζδίςκ ιεηά ημκ ηαεανζζιυ, έβζκε ιε πνχζδ πδηηχιαημξ πμθοαηνοθαιζδίμο ιε ηζξ πνςζηζηέξ Coomassie Brilliant Blue (πνςζηζηή ηοακμφκ ημο Coomassie R-250 0,1% η.α., ιεεακυθδ 40% η.μ., μλζηυ μλφ 10% η.μ.) Ζιεθηξνθόξεζε πξσηετλώλ ζε πήθησκα Πνιπαθξπιακηδίνπ-Γιπθίλεο παξνπζία SDS (SDS-PAGE) α) Παναζηεοή πδηηχιαημξ πμθοαηνοθαιζδίμο Ο δζαπςνζζιυξ ηαζ δ ηαοημπμίδζδ ηςκ πνςηεσκχκ βίκεηαζ, ιε αάζδ ημ ιμνζαηυ ημοξ αάνμξ, ιε δθεηηνμθυνδζδ ζε ηάεεημ πήηηςια πμθοαηνοθαιζδίμο, πανμοζία εεζζημφ δςδεηοθζημφ καηνίμο (SDS). Οζ πνςηεΐκεξ ημπμεεημφκηαζ ανπζηά ζε πήηηςια παιδθήξ πενζεηηζηυηδηαξ ζε αηνοθαιίδζμ (πήηηςια ζοιπφηκςζδξ), εκχ μ δζαπςνζζιυξ πναβιαημπμζείηαζ, αθμφ μζ πνςηεΐκεξ πενάζμοκ ζε πήηηςια ορδθήξ πενζεηηζηυηδηαξ ζε αηνοθαιίδζμ (πήηηςια 105

106 ΤΛΙΚΑ ΜΕΘΟΔΟΙ δζαπςνζζιμφ). Σμ πήηηςια δζαπςνζζιμφ, πενζέπεζ 0,375Μ Tris-HCl, νζ 8,8, 0,1 % (w/v) SDS ηαζ 12,5% (w/v) αηνοθαιίδζμ. Σμ πήηηςια ζοιπφηκςζδξ πενζέπεζ 0,125Μ Tris-HCl, νζ 6,8, 0,1% (w/v) SDS ηαζ 4% (w/v) αηνοθαιίδζμ. Ο πμθοιενζζιυξ ηςκ πδηηςιάηςκ πναβιαημπμζείηαζ ιε πνμζεήηδ 1% (w/v) APS ηαζ 0,04% (v/v) TEMED ςξ ηαηαθφηδξ ημο πμθοιενζζιμφ ημο αηνοθαιζδίμο, ηαζ μθμηθδνχκεηαζ ιεηά απυ ~30 min. α) Πνμεημζιαζία δεζβιάηςκ βζα δθεηηνμθυνδζδ Σα πνμξ δθεηηνμθυνδζδ δείβιαηα ακαιεζβκφμκηαζ ιε δζάθοια "θυνηςζδξ" πνςηεσκχκ, πμο πενζέπεζ, SDS ηαζ α-ιενηαπημαζεακυθδ, ηαζ εενιαίκμκηαζ ζημοξ 100 C, βζα 3 min. Οζ πνςηεΐκεξ, ιε ηδκ έηεεζδ ημοξ ζημ ανκδηζηά θμνηζζιέκμ απμννοπακηζηυ SDS, απμηημφκ ανκδηζηυ θμνηίμ (ζε ηάεε αιζκμλφ ιζαξ πνςηεΐκδξ δεζιεφεηαζ έκα πενίπμο ιυνζμ SDS ηαεζζηχκηαξ υθμ ημ ιυνζμ ανκδηζηά θμνηζζιέκμ) ηαζ ιεηαηζκμφκηαζ πνμξ ημ εεηζηυ πυθμ ιε ηαπφηδηα ακηζζηνυθςξ ακάθμβδ πνμξ ημ ιέβεεμξ ημοξ. Οζ ζοκεήηεξ αοηέξ είκαζ απμδζαηαηηζηέξ βζα ηζξ πνςηεΐκεξ. Ο αναζιυξ, πανμοζία SDS, έπεζ ςξ απμηέθεζια ηδ δζάζπαζδ ηςκ αζεεκχκ δεζιχκ (οδνμβυκμο, ζμκηζηχκ, οδνυθμαςκ ηαζ Van der Waals αθθδθεπζδνάζεςκ), εκχ δ α-ιενηαπημαζεακυθδ, ςξ ακαβςβζηυ ιέζμ, πνμηαθεί ακαβςβή ηςκ μιμζμπμθζηχκ δζζμοθθζδζηχκ δεζιχκ. Πανάθθδθα ιε ηα πνμξ ελέηαζδ δείβιαηα, βίκεηαζ ακάθοζδ ιίβιαημξ πνςηεσκχκ βκςζημφ ιμνζαημφ αάνμοξ, πμο πνδζζιμπμζμφκηαζ ςξ ιάνηονεξ ιμνζαηχκ ιεβεεχκ. β) Ζθεηηνμθυνδζδ Ζ δθεηηνμθυνδζδ πναβιαημπμζείηαζ οπυ ζηαεενή ηάζδ 120 Volts, ζε νοειζζηζηυ δζάθοια δθεηηνμθυνδζδξ πνςηεσκχκ, πμο πενζέπεζ 0,1 % (w/v) SDS. Οζ γχκεξ ηςκ πνςηεσκχκ ειθακίγμκηαζ, ιε πνχζδ Coomassie. δ) Υνχζδ Coomassie Μεηά ηδκ δθεηηνμθυνδζδ αημθμοεεί πνςιαηζζιυξ ημο πδηηχιαημξ ιε ηδ πνςζηζηή Coomassie R-250, ιε ήπζα ακάδεοζδ, ζε δζάθοια πνςιαηζζιμφ, βζα 30 ζημοξ 37 C, ή μθμκοηηίςξ ζε εενιμηναζία δςιαηίμο. Έπεζηα πναβιαημπμζείηαζ απμπνςιαηζζιυξ ημο 106

107 ΤΛΙΚΑ ΜΕΘΟΔΟΙ πδηηχιαημξ ζε δζάθοια απμπνςιαηζζιμφ, ζημοξ 37 C έςξ υημο απμιαηνοκεεί δ πενίζζεζα ηδξ πνςζηζηήξ (πενίπμο 1 χνεξ) ή μθμκοηηίςξ ζε εενιμηναζία δςιαηίμο Αλνζναπνηύπσζε πξσηετλώλ (Western blotting θαη Dot blotting) α) Μεηαθμνά ηςκ πνςηεσκχκ Οζ πνςηεΐκεξ, ιεηά ημ δζαπςνζζιυ ημοξ ζε πήηηςια πμθοαηνοθαιζδίμο, ιεηαθένμκηαζ ζε ζηαεενυ ιειανακζηυ οπυζηνςια, πμο ανίζηεηαζ ζε επαθή ιε ημ πήηηςια. Γζα ηδ ιεηαθμνά ηςκ πνςηεσκχκ απυ ημ πήηηςια ζηδ ιειανάκδ, πνδζζιμπμζείηαζ ηαηάθθδθμ νοειζζηζηυ δζάθοια δθεηηνμιεηαθμνάξ ιε νζ 8,5. ' αοηή ηδκ ηζιή νζ μζ πνςηεΐκεξ απμηημφκ ανκδηζηυ θμνηίμ ηαζ ιεηαηζκμφκηαζ ιέζα ζημ δθεηηνζηυ πεδίμ πνμξ ημ εεηζηυ πυθμ. Έκα ημιιάηζ ιειανάκδξ (Hybond-C, Amersham) ηαζ δφμ ημιιάηζα απμννμθδηζηυ πανηί Whatman 3ΜΜ ηυαμκηαζ ζε ιέβεεμξ θίβμ ιεβαθφηενμ απυ αοηυ ημο πδηηχιαημξ ηαζ ειααπηίγμκηαζ ζημ νοειζζηζηυ δζάθοια ιεηαθμνάξ. ηδκ πθεονά ηδξ ζοζηεοήξ, πμο εα εθανιμζηεί μ ανκδηζηυξ πυθμξ, ημπμεεημφκηαζ ηαηά ζεζνά: έκα απμννμθδηζηυ πανηί Whatmann 3MM, ημ πήηηςια πμθοαηνοθαιζδίμο, δ κζηνμηοηηανίκδ, έκα απμννμθδηζηυ πανηί Whatman 3MM ηαζ ηέθμξ, δ πθάηα ηδξ ζοζηεοήξ πμο εα εθανιμζεεί μ εεηζηυξ πυθμξ. Ζ ιεηαθμνά ηςκ πνςηεσκχκ πναβιαημπμζείηαζ ιε δζααίααζδ νεφιαημξ ζηαεενήξ έκηαζδξ 300 ma, ζημοξ 4 C. Ζ δζάνηεζα ηδξ δθεηηνμιεηαθμνάξ ηαεμνίγεηαζ απυ ημ ιέβεεμξ ηςκ πνςηεσκχκ. Γζα πνςηεΐκεξ ιε ιάγα ~30 kda, 1 χνεξ εεςνείηαζ ανηεηυξ πνυκμξ βζα ηδκ ιεηαθμνά ημοξ απυ ημ πήηηςια ζηδ κζηνμηοηηανίκδ. Δάκ πνδζζιμπμζμφκηαζ έβπνςιμζ ιάνηονεξ ιμνζαηχκ αανχκ, δ ιεηαθμνά απυ ημ πήηηςια ζηδ ιειανάκδ ιπμνεί κα εθεβπεεί έιιεζα ελαζηίαξ ηδξ πανμοζίαξ ηδξ πνςζηζηήξ. α) Ακμζμεκγοιζηή ακίπκεοζδ ηςκ πνςηεσκχκ Ζ ιειανάκδ ηδξ κζηνμηοηηανίκδξ επςάγεηαζ ιε δζάθοια 5% (w/v) θομθζθζςιέκμο βάθαηημξ ζε PBS, οπυ ακάδεοζδ, βζα 40 min, ζε εενιμηναζία δςιαηίμο. Με ηδ δζαδζηαζία αοηή, βίκεηαζ δέζιεοζδ πάκς ζηδ ιειανάκδ ηςκ εθεφεενςκ εέζεςκ, ζηζξ μπμίεξ δεκ έπμοκ ιεηαθενεεί πνςηεΐκεξ, μπυηε πανειπμδίγεηαζ δ ιδ εζδζηή πνυζδεζδ ηςκ ακηζζςιάηςκ ζηζξ 107

108 ΤΛΙΚΑ ΜΕΘΟΔΟΙ εέζεζξ αοηέξ. Αημθμοεεί επχαζδ ηδξ ιειανάκδξ ιε ημ πνχημ ακηίζςια, αναζςιέκμ ζε δζάθοια 3% (w/v) θομθζθζςιέκμο βάθαηημξ ζε PBS. Ο πνυκμξ επχαζδξ ελανηάηαζ απυ ημ ακηίζςια. Μεηά ηδκ επχαζδ ιε ημ πνχημ ακηίζςια (ακηί-his), πναβιαημπμζμφκηαζ ηνεζξ δζαδμπζηέξ πθφζεζξ ιε PBS δζάνηεζαξ 10 min πενίπμο δ ηάεε ιία. Αημθμοεεί επχαζδ ηδξ ιειανάκδξ ιε ημ δεφηενμ-ζογεοβιέκμ ιε οπενμλεζδάζδ ηδξ ναπακίδμξ (HRP) ακηίζςια (ακηί-mouse), βζα 2 χνεξ, ζε εενιμηναζία δςιαηίμο, οπυ ζοκεπή ακάδεοζδ. ηδ ζοκέπεζα, πναβιαημπμζμφκηαζ ηνεζξ δζαδμπζηέξ πθφζεζξ ιε PBS. Αημθμοεεί επχαζδ ηδξ ιειανάκδξ ζε νοειζζηζηυ δζάθοια ειθάκζζδξ ιε οπυζηνςια 3,3'-δζαιζκμαεκγζδίκδ (DAB). Ζ DAB δνα ςξ οπυζηνςια βζα ημ έκγοιμ ηδξ οπενμλεζδάζδξ, ηαζ πανμοζία Ζ 2 Ο 2, μλεζδχκεηαζ πνμξ ζημφνμ ηαθέ ίγδια. Ζ ακηίδναζδ πναβιαημπμζείηαζ πανμοζία ζυκηςκ κζηεθίμο. Οζ γχκεξ ηςκ πνςηεσκχκ ειθακίγμκηαζ άιεζα ιεηά ηδκ ειαάπηζζδ ηδξ κζηνμηοηηανίκδξ ζημ νοειζζηζηυ δζάθοια ειθάκζζδξ. Ζ ακηίδναζδ δζαηυπηεηαζ ιε ειαάπηζζδ ηδξ ιειανάκδξ ζε ddh 2 0, μπυηε απμθεφβεηαζ πεναζηένς δ ιδ εζδζηή πνχζδ ηδξ ιειανάκδξ. ε ιζα παναθθαβή ηδξ ιεευδμο, δ ακμζμαπμηφπςζδ ιπμνεί κα πναβιαημπμζδεεί ζε δείβια πνςηεσκχκ, πμο έπεζ πνμζνμθδεεί ζε ιειανάκδ κζηνμηοηηανίκδξ, πςνίξ κα πνμδβδεεί δζαπςνζζιυξ ηςκ πνςηεσκζηχκ ιμνίςκ ιε δθεηηνμθυνδζδ. ηδκ πενίπηςζδ αοηή, δ πνμζνυθδζδ ηςκ πνςηεσκζηχκ ιμνίςκ πναβιαημπμζείηαζ, οπυ ηεκυ, ζε εζδζηή ζοζηεοή πμθθαπθχκ δεζβιάηςκ (dot blot). Μεηά ηδκ πνμζνυθδζδ ημο δείβιαημξ ζηδ ιειανάκδ κζηνμηοηηανίκδξ, αημθμοεεί δζαδζηαζία ακίπκεοζδξ ηςκ πνςηεσκχκ, υπςξ πενζβνάθεηαζ πζμ πάκς Πνζνηηθή αλάιπζε πξσηετλώλ Γζα ημκ πνμζδζμνζζιυ ηδξ ζοβηέκηνςζδξ πνςηεσκζηχκ δζαθοιάηςκ πνδζζιμπμζμφκηαζ θαζιαημζημπζηέξ ή πνςιαημιεηνζηέξ ιέεμδμζ. α) Φαζιαημζημπζηέξ ιέεμδμζ βζα ηδκ πμζμηζημπμίδζδ πνςηεσκχκ Ζ ζοβηέκηνςζδ ιίαξ πνςηεΐκδξ ζε έκα δζάθοια πνμζδζμνίγεηαζ αάζεζ ειπεζνζηχκ ηφπςκ πμο απμδίδμοκ ηδκ απμννυθδζδ ημο πνςηεσκζημφ δζαθφιαημξ, ζηδκ πενζμπή ημο οπενζχδμοξ ημο δθεηηνμιαβκδηζημφ θάζιαημξ, υπμο ηαζ απμννμθμφκ ηα ανςιαηζηά αιζκμλέα ηςκ 108

109 ΤΛΙΚΑ ΜΕΘΟΔΟΙ πνςηεσκχκ. Μεηνζέηαζ δ μπηζηή απμννυθδζδ ημο δείβιαημξ ζηα 280 nm ηαζ δ ζοβηέκηνςζδ ημο πνμζδζμνίγεηαζ απυ ημκ ηφπμ: Molarity = (O.D. 280 nm Υ ααειυ αναίςζδξ) / (5500 NW+4910 ΝΤ+ 125 NSS) μ μπμίμξ θαιαάκεζ οπυρδ ηδκ πενζεηηζηυηδηα ζε ηαηάθμζπα ηνοπημθάκδξ ηαζ ηονμζίκδξ (Nw ηαζ Ny μζ ανζειμί ηςκ ηαηαθμίπςκ ηνοπημθάκδξ ηαζ ηονμζίκδξ ακηίζημζπα) ζηδ ιεηνμφιεκδ πνςηεΐκδ ηαζ Ns.s μ ανζειυξ ηςκ δζζμοθθζδζηχκ δεζιχκ. α) Υνςιαημιεηνζηή ιέεμδμξ Bradford βζα ηδκ πμζμηζημπμίδζδ πνςηεσκχκ Ζ ιέεμδμξ αοηή ζηδνίγεηαζ ζηδκ ζδζυηδηα ηδξ υλζκδξ πνςζηζηήξ Coomassie Brilliant Blue G-250 κα πνμζδέκεηαζ ηονίςξ ζε ααζζηά ηαζ ανςιαηζηά αιζκμλζηά ηαηάθμζπα ηαζ εζδζηυηενα ζε ηαηάθμζπα ανβζκίκδξ (Arg), πανάβμκηαξ έβπνςιμ πνμσυκ, έκηαζδξ ακάθμβδξ ηδξ ζοβηέκηνςζδξ ηδξ πνςηεΐκδξ (Bradford 1976). Ζ ηζιή ηδξ ζοβηέκηνςζδξ ηδξ πνςηεΐκδξ πνμηφπηεζ απυ ηδκ ηζιή απμννυθδζδξ ημο ζοιπθυημο πνςηεΐκδ-πνςζηζηή ζηα 595 nm ηαζ ηδ ζφβηνζζδ ηδξ ιεηνμφιεκδξ αοηήξ ηζιήξ ιε πνυηοπδ ηαιπφθδ πμο έπεζ πνμηφρεζ απυ ηζιέξ απμννυθδζδξ ζηα 595 nm ζοιπθυημο πνςζηζηήξ ιε βκςζηέξ ζοβηεκηνχζεζξ αθαμοιίκδξ μνμφ αμυξ (BSA). Ζ πεζναιαηζηή πμνεία αοηήξ ηδξ ιεευδμο είκαζ δ αηυθμοεδ: Ανπζηά ηαηαζηεοάγεηαζ πνυηοπδ ηαιπφθδ ααειμκυιδζδξ ιε πνήζδ δζάθμνςκ ζοβηεκηνχζεςκ BSA. Ζ ηαηαζηεοή ηδξ ηαιπφθδξ είκαζ βνήβμνδ ηαζ εφημθδ ηαζ δ βναιιζηή ηδξ πενζμπή είκαζ ιεηαλφ 0,2 ιε ηαζ 0,9 mg/ml. Γζα ηδκ ηαιπφθδ ααειμκυιδζδξ παναζηεοάγμκηαζ 100 ιl. δζαθοιάηςκ 0,2, 0,3, 0,4, 0,5, 0,6, 0,7, 0,8 ηαζ 1 mg/ml BSA ζε ddh 2 O. ηδ ζοκέπεζα, 20 ιl ηςκ παναπάκς δεζβιάηςκ πνμζηίεεκηαζ ζε 1 ml δζαθφιαημξ Biorad protein assay, αναζςιέκμο 1:4 ιε ddh 2 Ο, ηαζ ιεηνάηαζ δ απμννυθδζδ ηςκ δζαθοιάηςκ αοηχκ ζηα 595 nm ιεηά απυ 5 min. Αημθμοεεί δ ηαηαζηεοή πνυηοπδξ ηαιπφθδξ πμο ζοζπεηίγεζ ηζξ ιεηνμφιεκεξ ηζιέξ Α 595 ιε ηζξ βκςζηέξ ζοβηεκηνχζεζξ ηςκ δεζβιάηςκ BSA. Σέθμξ, 20 ιθ. ημο ηαηάθθδθα αναζςιέκμο ηαζ πνμξ ιέηνδζδ δείβιαημξ πνμζηίεεκηαζ ζε 1 ml αναζςιέκμο δζαθφιαημξ Biorad protein assay ηαζ απυ ηδκ ηζιή απμννυθδζδξ ζηα 595 nm οπμθμβίγεηαζ ηαζ δ ζοβηέκηνςζδ (mg/ml) ημο πνςηεσκζημφ δείβιαημξ ιε ηδ πνήζδ ηδξ πνυηοπδξ ηαιπφθδξ ακαθμνάξ. 109

110 ΤΛΙΚΑ ΜΕΘΟΔΟΙ Έθθξαζε ησλ αλαζπλδπαζκέλσλ ηκεκάησλ ηεο MuSK-ECD ζηελ δύκε P. Pastoris Δηθόλα 14. Υάξηεο θισλνπνίεζεο πξνο έθθξαζε ζε P. pastoris Υάνηδξ ηδξ ηαηαζηεοήξ ppicza-μusk-ecd ζημκ μπμίμ δζαηνίκμκηαζ: (i) δ έκεεζδ ημο MuSK-ECD ζηζξ εέζεζξ EcoRI-NotI ημο πθαζιζδίμο (ii) ημ βμκίδζμ πμο πνμζδίδεζ ακεεηηζηυηδηα ζημ ακηζαζμηζηυ γεμζίκδ (Zeosin), (iii) ημ ζδιείμ έκανλδξ ηδξ ακηζβναθήξ (pucon), (iv) δ ηαζζέηηα ηθςκμπμίδζδξ/έηθναζδξ (v) ημ πεπηίδζμ μδδβυξ (α-factor) πνζκ απυ ηδκ πενζμπή ηθςκμπμίδζδξ, (vi) μ οπμηζκδηήξ ΑΟΥ1 (vii) o c-myc επίημπμξ ηαζ ηα 6 ζοκεπυιεκα ηαηάθμζπα ζζηζδίκδξ ιεηά ηδκ πενζμπή ηθςκμπμίδζδξ, [από EasySelect Pichia expression kit, manual, version G (cat. no. K )]. Σμ αιζκμηεθζηυ ελςηοηηανζηυ ηιήια ηδξ ακενχπζκδξ Μοσηήξ Κζκάζδξ εηθνάζεδηε επζπθέμκ ζε δζαθοηή, ζε ζπεδυκ θοζζηή δζαιυνθςζδ ζημ γοιμιφηδηα P. pastoris. οβηεηνζιέκα, ημ ηιήια αοηυ ηθςκμπμζήεδηε ζημκ πθαζιζδζαηυ θμνέα ppiczaa, πνδζζιμπμζχκηαξ ημοξ ηαηάθθδθμοξ εηηζκδηέξ. Χξ πνυζεζμ (forward) εκανηηήνζμ ιυνζμ πνδζζιμπμζήεδηε ημ (5'- TTAATTGAATTCCTTCCAAAAGCTCCTGTCATC-3') ηαζ ςξ ακάζηνμθμ ημ (5'- TTATTAGCGGCCGCAGGTGAGACAGAGAAGGAAGAAG 3 ) ηα μπμία ήηακ ζπεδζαζιέκα έηζζ χζηε κα πενζθαιαάκμοκ ηζξ πενζμνζζηζηέξ εέζεζξ EcoRI-ΝotI υπςξ οπμβναιιίγμκηαζ. Ζ έηθναζδ ηςκ ακαζοκδοαζιέκςκ πνςηεσκχκ, ηα βμκίδζα ηςκ μπμίςκ έπμοκ ηθςκμπμζδεεί ζε πθαζιίδζα ηδξ ζεζνάξ ppicza (Eζηυκα 14), επάβεηαζ ηαηά 110

111 ΤΛΙΚΑ ΜΕΘΟΔΟΙ ηδκ πνμζεήηδ ιεεακυθδξ ζηδκ ηαθθζένβεζα. Ζ ιεεακυθδ εκενβμπμζεί ημκ οπμηζκδηή ηδξ αθημμθζηήξ μλεζδάζδξ ηαζ μζ ακαζοκδοαζιέκεξ πνςηεΐκεξ μδδβμφκηαζ, απυ ημ πεπηίδζμ μδδβυ ημο πανάβμκηα α (α-anti) ημο Saccharomyces cerevisiae πμο δζαεέημοκ ηα παναπάκς πθαζιίδζα, βζα έηηνζζδ ζημ οπενηείιεκμ ηςκ ηοηηάνςκ, απυ ημ μπμίμ ζοθθέβμκηαζ εφημθα. Ζ ακαζοκδοαζιέκδ πνςηεΐκδ έπεζ ζοκηδπεεί ζημ C-ηεθζηυ άηνμ ιε ιζα αθθδθμοπία πμο ηςδζημπμζεί ημκ c-myc επίημπμ ηαζ ηδκ πμθφ-ζζηζδζκζηή (6 x His) tag Τγξέο θαη ζηεξεέο θαιιηέξγεηεο θπηηάξσλ ηνπ δπκνκύθεηα P. pastoris Ο γοιμιφηδηαξ P. pastoris είκαζ έκαξ ιμκμηφηηανμξ ιεεοθμηνμθζηυξ γοιμιφηδηαξ, πμο πνδζζιμπμζείηαζ ςξ ζφζηδια εηενυθμβδξ έηθναζδξ πνςηεσκχκ απυ ακχηενμοξ εοηανοςηζημφξ μνβακζζιμφξ. Χξ εοηανοςηζηυξ μνβακζζιυξ έπεζ ηα πθεμκεηηήιαηα ηςκ ακχηενςκ εοηανοςηζηχκ ζοζηδιάηςκ έηθναζδξ, πανέπμκηαξ ηδ δοκαηυηδηα παναβςβήξ δζαθοηχκ, ζςζηά δζαιμνθςιέκςκ ακαζοκδοαζιέκςκ πνςηεσκχκ, μζ μπμίεξ έπμοκ οπμζηεί υθεξ ηζξ ιεηαιεηαθναζηζηέξ ηνμπμπμζήζεζξ πμο απαζημφκηαζ βζα ηδ θεζημονβζηυηδηα ημοξ (βθοημγοθίςζδ, θςζθμνοθίςζδ, δδιζμονβία δζζμοθθζδζηχκ δεζιχκ). ε ζφβηνζζδ ιε άθθα εοηανοςηζηά ζοζηήιαηα ηα μπμία πνδζζιμπμζμφκηαζ βζα εηενυθμβδ έηθναζδ, υπςξ μζ ηαθθζένβεζεξ ηοηηάνςκ απυ εδθαζηζηά, μ P. pastoris είκαζ έκα ζφζηδια, πζμ βνήβμνμ, εοημθυηενμ ηαζ ιε θζβυηενμ ηυζημξ, εκχ ζοκήεςξ δίκεζ ηαζ ορδθυηενα επίπεδα έηθναζδξ εηενυθμβςκ πνςηεσκχκ. Δπζπθέμκ, μζ οδαηακεναηζηέξ αθοζίδεξ πμο πνμζηίεεκηαζ ζε μιάδεξ αγχημο είκαζ ορδθήξ πενζεηηζηυηδηαξ ζε ιακυγδ, εκχ ημ ιήημξ ημοξ είκαζ πμθφ ιζηνυηενμ ζοβηνζηζηά ιε ηζξ αθοζίδεξ πμο πνμζηίεεκηαζ ζημ ζφζηδια ημο S. Cerevisiae, βεβμκυξ πμο ηαεζζηά ημκ P. pastoris έκα πνήζζιμ ζφζηδια εηενυθμβδξ έηθναζδξ (Cereghino and Cregg, 2000). Ο γοιμιφηδηαξ P. pastoris δζαεέηεζ έκακ ζζπονυ οπμηζκδηή, πμο επάβεζ ηδκ παναβςβή πνςηεΐκδξ ιεηά ηδκ πνμζεήηδ ιεεακυθδξ ζημ ενεπηζηυ οθζηυ, επζηνέπμκηαξ ηδκ εθεβπυιεκδ έηθναζδ εηενυθμβςκ πνςηεσκχκ. Ο γοιμιφηδηαξ Ρ. pastoris ιπμνεί κα ακαπηφζζεηαζ ζε οθζηυ ιε ιεεακυθδ, ςξ ιυκδ πδβή άκεναηα. Σμ πνχημ αήια είκαζ δ μλείδςζδ ηδξ ιεεακυθδξ ζε θμνιαθδεΰδδ ηαζ οπενμλείδζμ ημο οδνμβυκμο. Σμ αήια αοηυ ηαηαθφεηαζ απυ ημ έκγοιμ ηδξ αθημμθζηήξ μλεζδάζδξ. Τπάνπμοκ δφμ βμκίδζα βζα ηδκ 111

112 ΤΛΙΚΑ ΜΕΘΟΔΟΙ αθημμθζηή μλεζδάζδ: ηα ΑΟΥ1 ηαζ ΑΟΥ2, ηα μπμία πανμοζζάγμοκ ιεβάθδ μιμθμβία. Σμ ΑΟΥ1 είκαζ οπεφεοκμ βζα ημ ιεβαθφηενμ ιένμξ ηδξ δνάζδξ ηδξ αθημμθζηήξ μλεζδάζδξ ζημ ηφηηανμ. Ακηίζημζπα μζ οπμηζκδηέξ ημοξ πανμοζζάγμοκ πμθφ ιζηνή μιμθμβία. Καηά ηδκ ακάπηολδ ηςκ ηοηηάνςκ ζε ιεεακυθδ, δ αθημμθζηή μλεζδάζδ ιπμνεί κα πανάβεζ πενίπμο ημ 5% ηςκ ζοκμθζηχκ ηοηηανζηχκ πνςηεσκχκ. Δπεζδή, o P. pastoris εηηνίκεζ πμθφ θίβεξ δζηέξ ηδξ πνςηεΐκεξ, είκαζ εφημθδ δ απμιυκςζδ εηενυθμβα εηθναζιέκςκ πνςηεσκχκ μζ μπμίεξ εηηνίκμκηαζ (Daly and Hearn, 2005). ηδκ πανμφζα ενβαζία πνδζζιμπμζήεδηε ημ ζηέθεπμξ X33 ημο γοιμιφηδηα P. pastoris. To X33 είκαζ ζηέθεπμξ αβνίμο ηφπμο. Σμ ζηέθεπμξ αοηυ ακαπηφζζεηαζ ζε YPD ενεπηζηυ οθζηυ, ιε επχαζδ ζημοξ 30 C. Γζα ηδ δζαηήνδζδ ιεηαζπδιαηζζιέκςκ ηαζ ιδ ιεηαζπδιαηζζιέκςκ ζηεθεπχκ ηδξ Ρ. pastoris βζα ιεβάθα πνμκζηά δζαζηήιαηα, ζημοξ -80 C, ηα ζηεθέπδ ακαπηφζζμκηαζ ζε οθζηυ YPD, βζα 16 χνεξ, ζημοξ 30 C ηαζ θοθάζζμκηαζ πανμοζία 15% v/v βθοηενυθδξ. Οζ ζηενεέξ ηαθθζένβεζεξ δζαηδνήεδηακ ζημοξ 4 C, βζα δζάζηδια ανηεηχκ διενχκ έςξ ηαζ ιενζηχκ εαδμιάδςκ Μεηαζρεκαηηζκόο θπηηάξσλ ηνπ δπκνκύθεηα P. pastoris γηα ηνλ νκόινγν αλαζπλδπαζκό ηνπ πιαζκηδηαθνύ DNA ζην ρξσκόζσκα ηνπ P. pastoris α) Πνμεημζιαζία ηςκ ηοηηάνςκ ημο γοιμιφηδηα βζα ημ ιεηαζπδιαηζζιυ Ανπζηά, 10 ml ενεπηζημφ οθζημφ YPD ειαμθζάγμκηαζ ιε ηφηηανα ιζαξ απμζηίαξ απυ ημ ζηέθεπμξ ημο P. pastoris πμο έπεζ επζθεπεεί ηαζ έπεζ ακαπηοπεεί ζε ενεπηζηυ οθζηυ YPDagar. Ζ ηαθθζένβεζα ακαπηφζζεηαζ ιε επχαζδ οπυ ακάδεοζδ, ζημοξ 30 C, βζα πενίπμο 16 χνεξ. 50 ιl απυ ηδκ παναπάκς ηαθθζένβεζα πνδζζιμπμζμφκηαζ βζα ημκ ειαμθζαζιυ 500 ml YPD ηαζ πναβιαημπμζείηαζ επχαζδ ζημοξ 30 C, ιέπνζ O.D. 600 nm = 1,3 (πενίπμο 16 χνεξ). Αημθμοεεί θοβμηέκηνδζδ ζε 1500xg, βζα 5 min, ζημοξ 4 C ηαζ ακαδζάθοζδ ημο ζγήιαημξ ζε 100 ml πνμροβιέκμο, ζηείνμο ddh 2 O. Δπακαθαιαάκεηαζ θοβμηέκηνδζδ ζηζξ ίδζεξ ζοκεήηεξ ηαζ δζαδμπζηή ακαδζάθοζδ ζε 50 ml πνμροβιέκμο ζηείνμο ddh 2 O ηαζ 4 ml πνμροβιέκμο δζαθφιαημξ 1 Μ ζμναζηυθδξ. Σα ηφηηανα θοβμηεκηνμφκηαζ λακά ζηζξ ίδζεξ ζοκεήηεξ ηαζ ηεθζηά ακαδζαθφμκηαζ ζε 1 ml πνμροβιέκμο δζαθφιαημξ 1 Μ ζμναζηυθδξ, μπυηε πνμηφπηεζ εκαζχνδια ηςκ ηοηηάνςκ ηεθζημφ υβημο πενίπμο 1,5 ml. Σμ εκαζχνδια αοηυ πνδζζιμπμζείηαζ εκηυξ 24 χνεξ βζα ημ ιεηαζπδιαηζζιυ ηςκ ηοηηάνςκ. 112

113 ΤΛΙΚΑ ΜΕΘΟΔΟΙ α) Μεηαζπδιαηζζιυξ ηςκ ηοηηάνςκ ηδξ P. pastoris ιε ημ θμνέα έηθναζδξ. Πμζυηδηα 80 ιl εκαζςνήιαημξ ηςκ επζδεηηζηχκ ηοηηάνςκ, ακαιεζβκφμκηαζ ιε 5-10 ιg ακαζοκδοαζιέκμο πθαζιζδζαημφ DNA, πμο έπεζ οπμζηεί πέρδ ιε ηδκ πενζμνζζηζηή εκδμκμοηθεάζδ Pme1, ζε ιμκαδζηή εέζδ ακαβκχνζζδξ, χζηε κα πνμηφρεζ βναιιζηυ ιυνζμ. Ζ ιεηαηνμπή ημο πθαζιζδίμο ζε βναιιζηυ ιυνζμ αολάκεζ ηδκ ζηακυηδηα ιεηαζπδιαηζζιμφ. Σμ ιίβια ιεηαθένεηαζ ζε ηορεθίδα 0,2 cm πμο έπεζ πνμροπεεί ηαζ επςάγεηαζ βζα 5 min, ζημοξ 4 C. ηδ ζοκέπεζα, πναβιαημπμζείηαζ ιεηαζπδιαηζζιυξ ιε δθεηηνμδζάηνδζδ ζηδ ζοζηεοή Biorad Gene Pulser πμο έπεζ νοειζζηεί ζε 25 ιρ ηαζ 1,5 kv εκχ δ ζοζηεοή Pulce Controller έπεζ νοειζζηεί ζηα 200 Ohms. Καηά ηδκ εθανιμβή ορδθήξ ηάζδξ, ηα ηφηηανα ημο γοιμιφηδηα βίκμκηαζ δζαπεναηά ζημ πθαζιίδζμ, πμο εζζένπε&e