ΣΗΜΕΙΩΣΕΙΣ ΦΑΡΜΑΚΟΛΟΓΙΑ Ι. Θεόδωρος Σκλαβιάδης Αναπληρωτής καθηγητής

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΣΗΜΕΙΩΣΕΙΣ ΦΑΡΜΑΚΟΛΟΓΙΑ Ι. Θεόδωρος Σκλαβιάδης Αναπληρωτής καθηγητής"

Transcript

1 ΣΗΜΕΙΩΣΕΙΣ ΦΑΡΜΑΚΟΛΟΓΙΑ Ι Θεόδωρος Σκλαβιάδης Αναπληρωτής καθηγητής Θεσσαλονίκη 2001

2 OPMONEΣ Eισαγωγή. H ενδοκρινολογική φαρµακολογία ασχολείται µε τη θεραπευτική και διαγνωστική χρήση ορµονών καθώς επίσης ουσιών παροµοίων µε ορµόνες ή φαρµάκων που καταστέλλουν ή διεγείρουν τη λειτουργία αδένων, οι οποίοι είναι υπεύθυνοι για την έκκριση ορµονών. H ενδοκρινολογική θεραπεία καλύπτει τη φυσιολογική χρήση ορµονών που αποσκοπεί στη συµπλήρωση χαµηλών επιπέδων ενδογενών ορµονών όπως π.χ. η χορήγηση ινσουλίνης είναι µία κατ' εξοχήν αναγνωρισµένη ορµονοθεραπεία υποκατάστασης. Yπερφυσιολογικές (φαρµακολογικές) δόσεις ορµονών µπορούν να χρησιµοποιηθούν για την αντιφλεγµονώδη δράση τους, όπως π.χ.κορτικοστεροειδή για τη θεραπεία της ρευµατοειδούς αρθρίτιδας και ορισµένων ασθενειών του κολλαγόνου. όσεις ορµονών σε επίπεδα πάνω από τα φυσιολογικά µπορούν επίσης να χρησιµοποιηθούν για τη διάγνωση ενδοκρινολογικών ανωµαλιών. Περιλαµβάνει επίσης τη χορήγηση φαρµάκων µη ορµονικής φύσης για την αντιµετώπιση ορµονικών διαταραχών όπως συµβαίνει µε τη χορήγηση των µη ορµονικής φύσης αναστολέων της σύνθεσης της θυροξίνης κατά του υπερθυρεοειδισµού και σχετίζεται µε τη χορήγηση φαρµάκων που δεν χρησιµοποιούνται για ορµονοθεραπεία αλλά επιδρούν σηµαντικά στα ορµονικά συστήµατα και στα επίπεδα των εκκρινοµένων ορµονών. Παράδειγµα αποτελούν τα φάρµακα που χρησιµοποιούνται για τη θεραπεία νεοπλασιών και προκαλούν αναστολή των ταχέως πολλαπλασιαζόµενων καρκινικών κυττάρων εξασκώντας κυτταροτοξική δράση στο σύστηµα αναπαραγωγής, το οποίο ελέγχεται κυρίως από ορµόνες. Φάρµακα επίσης που δρουν στο νευρικό σύστηµα χωρίς καµία ορµονική δράση επιδρούν στο ορµονικό σύστηµα, οδηγώντας σε ανώµαλη έµµηνο ρύση και στειρότητα. Στον πίνακα που ακολουθεί επισηµαίνονται οι πιο σηµαντικές εξελίξεις στην ορµονοθεραπεία.

3 Xρονολογία Eξελίξεις στην ορµονοθεραπεία 1906 ιέγερση της µήτρας µε εκχύλισµα υπόφυσης Xρησιµοποίηση εκχυλισµάτων υπόφυσης 1914 Aποµόνωση της θυροξίνης 1921 Aποµόνωση της ινσουλίνης 1925 Xρησιµοποίηση εκχυλισµάτων παραθυρεοειδούς αδένα 1928 Aνακάλυψη των γοναδοτρόπων υποκατάστατων 1929 ιευκρίνιση του ανταγωνισµού οιστρογόνων-ανδρογόνων 1940 Θεραπευτική χρησιµοποίηση αδρενοκορτικοστεροειδών 1945 Aνακάλυψη φαρµάκων κατά του θυρεοειδισµού 1946 Aποµόνωση των ορµονών που εκκρίνονται στον υποθάλαµο 1950 Σύνθεση στεροειδών που χορηγούνται από το στόµα 1953 Σύνθεση της οκυτοκίνης Aποµόνωση και Σύνθεση της ACTH 1970 Kαθαρισµός των ρυθµιστικών παραγόντων του υποθάλαµου και ανάπτυξη της ραδιοανοσοαντίδρασης Παραγωγή συνθετικής ινσουλίνης (ανασυνδυαζόµενο DNA) 1979 Παραγωγή συνθετικής αυξητικής ορµόνης (GH) (ανασυνδυαζόµενο DNA 1980 Kλινική χρησιµοποίηση συνθετικής ινσουλίνης 1985 Kλινική χρησιµοποίηση συνθετικής αυξητικής ορµόνης Παράδειγµα ορµονοθεραπείας αποτελεί η αντισυλληπτική αγωγή, η οποία λόγω της συνεχούς αύξησης του πληθυσµού της γης και της δηµιουργίας ανάπτυξης τρόπων ελέγχου της, γίνεται περισσότερο απαραίτητη. Παρά τις επανειληµµένες προσπάθειες για την ανάπτυξη φυσικών και χηµικών µεθόδων ελέγχου του ανθρώπινου πληθυσµού, η σύνθεση των χορηγουµένων από το στόµα στεροειδών (αντισυλληπτικά) ήταν και είναι η πιο αποτελεσµατική µέθοδος ελέγχου. Tα συνθετικά 19-νορστεροεϊδή, παρόµοια µε την τεστοστερόνη, αντιπροσωπεύουν ενεργά υποκατάστατα τα οποία αναστέλλουν την έκκριση των γοναδοτρόφων

4 ορµονών µε αποτέλεσµα την αναστολή της ωρίµανσης του ωαρίου. Tα παράγωγα αυτά πρωτοκυκλοφόρησαν το 1950 και έκτοτε πολλά άλλα αντισυλληπτικά φάρµακα τέθηκαν σε κυκλοφορία. Σήµερα εκατοµµύρια γυναίκες σε όλο τον κόσµο χρησιµοποιούν χηµικά αντισυλληπτικά που παρεµποδίζουν την ωρίµανση των ωαρίων και η χρήση τους προκάλεσε εξαιρετικά µεγάλο ενδιαφέρον στην ενδοκρινολογική φαρµακολογία. Bέβαια, τα φάρµακα αυτά έχουν ανεπιθύµητες ενέργειες και η εξαιρετικά µεγάλη διάδοσή τους ίσως δηµιουργεί επιπρόσθετες ευθύνες στους γιατρούς που τα χορηγούν. H πρόοδος στην ενδοκρινολογία έκανε εφικτή την αποµόνωση, τον καθαρισµό και τη σύνθεση ορµονών του υποθαλάµου, οι οποίες είναι υπεύθυνες για την έκκριση ορµονών που συντίθενται στην υπόφυση που αποτελείται από τον πρόσθιο λοβό ή νευροϋπόφυση, και τον οπίσθιο λοβό ή αδενοϋπόφυση. H χρήση τους περιορίζεται µόνο σε διαγνωστικούς σκοπούς λόγω των περιορισµένων ποσοτήτων των φυσικών ορµονών που είναι διαθέσιµοι. H τεχνική του ανασυνδυαζόµενου DNA µπορεί να βοηθήσει στη µαζική παραγωγή τους οπότε θα είναι δυνατόν να αντιµετωπισθούν ασθένειες που οφείλονται ακόµη και σε µειωµένη παραγωγή ορµονών που εκκρίνονται από αδένες των οποίων η λειτουργία καθορίζεται από την υπόφυση. H πιο καλά µελετηµένη ορµόνη που χρησιµοποιείται στην κλινική πράξη είναι η ACTH (επινεφριδοφλοιοτρόπος ορµόνη). Eίναι µια πρωτεΐνη που αποτελείται από39 αµινοξέα. H συνθετική ACTH µε 24 αµινοξέα είναι επίσης δραστική. Eπειδή µόνον περιορισµένα ποσά ορµονών µπορούν να αποµονωθούν από την ανθρώπινη υπόφυση και επειδή υπάρχει πρόβληµα συµβατότητας του ανοσοποιητικού συστήµατος του ανθρώπου, όσον αφορά τη χρήση ορµονών που αποµονώνονται από ζώα, έχει δοθεί ιδιαίτερη ώθηση στην παραγωγή υποκατάστατων ορµονών. Tα ανθρώπινα ούρα χρησιµοποιούνται για την αποµόνωση ορµονών που µοιάζουν δοµικά και έχουν δράση όµοια µε αυτή των γοναδοτροφικών ορµονών της υπόφυσης. H γοναδοτροφίνη Human menopausalgonadotrophic (HMG) αποµονώνεται από ούρα γυναικών που βρίσκονται στο στάδιο της εµµηνόπαυσης και χρησιµοποιείται αντί της ωοθηλακιοτρόπου ορµόνης FSH. Eπίσης η γοναδοτροφίνη Human chorionic gonadotrοphic(hcg), που εκκρίνεται στα ούρα γυναικών κατά το τελευταίο τρίµηνο της κύησης χρησιµοποιείται αντί της ωχρινοποιητικής ορµόνης

5 (LH). H τεχνική του ανασυνδυαζόµενου DNA µπορεί να αντικαταστήσει τα υποκατάστατα ορµονών. Mε εξαίρεση την ινσουλίνη, οι ορµονοθεραπείες αναφέρονται κυρίως σε ορµόνες µικρού µοριακού βάρους, όπως π.χ. τα στεροειδή, η θυροξίνη κλπ. Mεγάλου µοριακού βάρους ορµόνες όπως οι ορµόνες της αδενοϋπόφυσης, η θυροτροπίνη και η προλακτίνη δεν έχουν αποκτήσει ακόµη σηµαντική θεραπευτική αξία. Mικρού µοριακού βάρους ορµόνες, φυσικά ή συνθετικά στεροειδή όπως ανδρογόνα, οιστρογόνα και κορτικοστεροειδή, χρησιµοποιούνται ευρέως για τη θεραπεία ασθενειών που σχετίζονται ή όχι µε το ορµονικό σύστηµα. H θυροξίνη είναι ένα µικρό µόριο ευρέως χρησιµοποιούµενο κατά του µυξοιδήµατος και άλλων ασθενειών που δεν σχετίζονται µε το θυρεοειδή αδένα. Συνήθως οι χαµηλού µοριακού βάρους ορµόνες δεσµεύονται αντιστρεπτά από πρωτεΐνες του πλάσµατος, όπως από την πρωτεΐνη που είναι υπεύθυνη για τη δέσµευση της θυροξίνης (thyroxine binding protein, TBG) και από την πρωτεΐνη που είναι υπεύθυνη για τη δέσµευση κορτικοστεροειδών (corticosteroid-binding globulin, CBG). Oιπρωτεΐνες αυτές είναι υπεύθυνες για τη µεταφορά και την ανακύκλωση των ορµονών. H χρήση ορµονών µε σκοπό τη συµπλήρωση χαµηλών επιπέδων ενδογενών ορµονών δεν προκαλεί καµία διαταραχή του ορµονικού συστήµατος. Σε περιπτώσεις που είναι αναγκαία η χορήγηση συνθετικών στεροειδών ορµονών σε πολύ υψηλές δόσεις για να έχουν τη βέλτιστη δράση είναι προτιµότερο να αντικατασταθούν από άλλα πιο δραστικά στεροειδή, αφού η υψηλή συγκέντρωση ορµονών στο αίµα εγκυµονεί ανεπιθύµητες παρενέργειες. Oρµονικές και µη ουσίες είναι δυνατόν να αναστείλουν την έκκριση ορµονών. Φαρµακολογικές δόσεις φυσικών ή ηµισυνθετικών υποκατάστατων ορµονών αναστέλλουν την έκκριση ορµονών της αδενοϋπόφυσης. Aναστέλλοντας την έκκριση των γοναδοτροφικών ορµονών αναστέλλεται π.χ. και η ωρίµανση των ωαρίων. Γενικά όµως τα φάρµακα που επιδρούν στην έκκριση των γοναδοτρόφων ορµονών είναι τοξικά και δεν χρησιµοποιούνται συχνά στην κλινική πράξη, µε εξαίρεση τη θεραπεία αδενοκαρκινωµάτων. Oι περισσότεροι µηχανισµοί αλληλεπίδρασης µεταξύ φαρµάκων και ορµονών δεν είναι γνωστοί. Mερικοί µόνο από αυτούς έχουν µελετηθεί, όπως ο µηχανισµός που αφορά την υπέρµετρη χρήση βαρβιτουρικών, µε συνέπεια την επαγωγή της

6 σύνθεσης µικροσωµικών ενζύµων στο ήπαρ, τα οποία στη συνέχεια µεταβολίζουν τις στεροειδείς ορµόνες, µε αποτέλεσµα την ελάττωση της συγκέντρωσης των ορµονών στο αίµα και την εµφάνιση συµπτωµάτων που οφείλονται στην έλλειψη τους.mια άλλη αλληλεπίδραση φαρµάκων µε ορµόνες µπορεί να συµβεί στα σηµεία δέσµευσης τους στις πρωτεΐνες του πλάσµατος, όπως π.χ. συµβαίνει στην περίπτωση του ακετυλοσακυλικού οξέος, που ανταγωνίζεται τη θυροξίνη ή στην περίπτωση της µορφίνης και της µαριχουάνας που επιδρούν στην αδενοϋπόφυση µε αποτέλεσµα την αναστολή έκκρισης των γοναδοτρόφων ορµονών, γεγονός που µπορεί να οδηγήσει σε στείρωση. Σε ορισµένες κλινικές καταστάσεις, παρά το γεγονός ότι οι ορµόνες βρίσκονται σε φυσιολογικά επίπεδα, δεν παρατηρείται το αναµενόµενο φυσιολογικό αποτέλεσµα. Eπειδή οι ορµόνες δρουν µέσο ειδικών υποδοχέων στην επιφάνεια των κυττάρων στόχων, είναι πιθανόν αλλαγές στη διαµόρφωση, στη θέση ή στον αριθµό των διαθέσιµων υποδοχέων να είναι υπεύθυνες για τη µειωµένη δραστικότητα των ορµονών. Πιθανόν µια τέτοια συµπεριφορά να αποτελεί έναν αµυντικό µηχανισµό του κυττάρου. Περαιτέρω µελέτη είναι απαραίτητη ώστε να εξακριβωθεί ο µηχανισµός αλληλεπίδρασης ορµονών µε τους υποδοχείς τους. OPMONEΣ THΣ YΠOΦYΣHΣ KAI TOY YΠOΘAΛAMOY Oι ορµόνες της υπόφυσης έχουν σχέση µε τον έλεγχο µιας µεγάλης ποικιλίας διεργασιών, όπως αυτή της αναπαραγωγής, της ανάπτυξης και του µεταβολισµού των κυττάρων. Mεταβολές των επιπέδων τους στο αίµα οδηγούν σε παθολογικές καταστάσεις. Kατά συνέπεια η φαρµακολογική ρύθµιση της έκκρισης και της χορήγησης ορµονών έχει θεραπευτική αξία. Mέχρι τώρα οι ορµόνες αυτές έχουν περιορισµένη κλινική χρήση εξαιτίας των µικρών ποσοτήτων φυσικών ανθρώπινων ορµονών που είναι διαθέσιµες, καθώς επίσης και της µικρής δραστικότητας ορµονών της υπόφυσης που αποµονώνονται από άλλα είδη. Λόγω της πολύπλοκης µοριακής δοµής µερικές µόνον ορµόνες έχουν συντεθεί. Hέκκριση τους ρυθµίζεται από τις ρυθµιστικές ορµόνες του υποθάλαµου.

7 Pυθµιστικές ορµόνες του υποθάλαµου και έλεγχος δράσης της αδενοϋπόφυσης. H ρύθµιση της σύνθεσης και έκκρισης ορµονών της αδενοϋπόφυσης ελέγχεται από τον υποθάλαµο µέσο µικρών πεπτιδικών ορµονών ή άλλων µη καλά χαρακτηρισµένων παραγόντων. Oι ενώσεις αυτές µεταβιβάζονται µέσο του υποθαλαµικού-αδενοϋποφυσικού πυλαίου συστήµατος και δρουν σε ειδικούς υποδοχείς διεγείροντας ή αναστέλλοντας την έκκριση ορµονών της αδενοϋπόφυσης. Μερικοί από αυτούς τους ρυθµιστικούς παράγοντες έχουν αποµονωθεί και χαρακτηρισθεί καλά: 1. O ρυθµιστικός παράγοντας έκκρισης γοναδοτροφινών (Gonadoprin-releasing hormone, GnRH) είναι ένα δεκαπεπτίδιο που διεγείρει την έκκριση της FSH και της LH. 2 O ρυθµιστικός παράγοντας έκκρισης αυξητικής ορµόνης (Growth hormone releasing hormone, GH-RH) είναι πεπτίδιο που αποτελείται από 40 αµινοξέα. 3 O ρυθµιστικός παράγοντας αναστολής έκκρισης αυξητικής ορµόνης(growth hormone inhibiting hormone, GH-RIH) είναι ένα τετραδεκαπεπτίδιο που έχει βρεθεί στα κύτταρα του γαστρεντερικού συστήµατος, όπου αναστέλλει την έκκριση της γαστρίνης, της πεψίνης, του γαστρικού οξέος, της σεκριτίνης και της χολεκυστοκινίνης. Στο πάγκρεας ο παράγοντας αυτός αναστέλλει την έκκριση ινσουλίνης και του γλυκογόνου. 4 O ρυθµιστικός παράγοντας έκκρισης θυροτροπίνης (Thyrotropin-releasing hormone, TRH) είναι ένα τριπεπτίδιο που διεγείρει την έκκριση της θυροτροπίνης. 5 O ρυθµιστικός παράγοντας έκκρισης κορτικοτρόπων ορµονών (Corticotropinreleasing hormone, CRH) είναι πεπτίδιο µε 41 αµινοξέα που ελέγχει την έκκριση της ACTH. 6. O παράγοντας έκκρισης προλακτίνης (Prolactin-releasing factor, PRF) και 7. O παράγοντας αναστολής έκκρισης προλακτίνης (Prolactin-inhibiting factor, PIF) H κύρια διαγνωστική χρήση των υποθαλαµικών παραγόντων συνίσταται στην επαγωγή έκκρισης ορµονών της αδενοϋπόφυσης. Όταν δεν παρατηρείται αύξηση στην έκκριση ορµονών της µετά από εξωγενή χορήγηση ρυθµιστικών παραγόντων σηµαίνει ότι υπάρχει κάποιο λειτουργικό πρόβληµα στην αδενοϋπόφυση.

8 Tα ανάλογα του παράγοντα έκκρισης γοναδοτρόπων ορµονών έχουν µικρή δράση, λόγω της ευαισθησίας τους σε πρωτεάσες. Aυτά που κυκλοφορούν στο εµπόριο είναι: 1. Gonadorelin hydrochloride (Factrel ) 2. Leuprolide acetate (Lypron ) 3. Naforelin acetate Oι κλινικές εφαρµογές τους αφορούν: α) ιέγερση της υπόφυσης και χορηγούνται για την επαγωγή της ωρίµανσης του ωαρίου, την κρυπτοορχία, τον υπογοναδοτροπικό υπογοναδισµό και την καθυστερηµένη εφηβεία. β) Aναστολή της υπόφυσης και χορηγούνται για την αντιµετώπιση της πρόωρης εφηβείας ενδοµητρίωσης, πολυκιστίτιδας, ορµονοεξαρτώµενων νεοπλασιών και για αντισύλληψη. Συνθετικά ανάλογα του GnRH παράγοντα έχουν σχηµατισθεί µετά από δοµικές αλλαγές του αρχικού δεκαπεπτιδίου. Tα προϊόντα έχουν αγωνιστική ή ανταγωνιστική δράση. Eίναι λιγότερο ευαίσθητα σε πρωτεόλυση και έχουν µεγαλύτερη συγγένεια µε τους υποδοχείς του GnRH. Eνδοφλέβια έγχυση 150 µgτου GnRH προκαλεί διπλασιασµό των επιπέδων γοναδοτροφινών FSH και LH µέσα σε 30 λεπτά. Oρµόνες της υπόφυσης. Στον πρόσθιο λοβό εκκρίνονται η ωοθυλακιοτρόπος ορµόνη (Folliclestimulating hormone, FSH), η ωχρινοποιητική ορµόνη (Luteinizing hormone, LH), η αυξητική ορµόνη (Growth hormone, GH), η προλακτίνη (Prolactin, LTH), η επινεφριδοφλοιοτρόπος ορµόνη (Adrenocorticotropic hormone, ACTH), και η θυρεοειδοτρόπος ορµόνη (Thyrotropin-stimulating hormone, TSH). Στον ενδιάµεσο λοβό εκκρίνεται η ορµόνη που διεγείρει τα µελανοκύτταρα, (Melanocyte stimulating hormone,msh)και στον τον οπίσθιο λοβό εκκρίνονται η αντιδιουρητική ορµόνη βασοπρεσσίνη (Vasopressin, ADH) και η οκυτοκίνη.

9 Oρµόνες του πρόσθιου λοβού: H ωοθυλακιοτρόπος ορµόνη (FSH) είναι µια γλυκοπρωτεΐνη µε µοριακό βάρος 32kDa. Eκκρίνεται κατά τη διάρκεια σχηµατισµού του ωοθυλακίου και είναι απαραίτητη για την αύξηση και ωρίµανσή του. Στους άνδρες η FSH είναι υπεύθυνη για την ωρίµανση των αναπαραγωγικών στοιχείων, διεγείρει τη σπερµατογένεση καθώς επίσης και την παραγωγή των πρωτεϊνών στις οποίες δεσµεύονται τα ανδρογόνα. H FSH αντιδρά µε ειδικούς υποδοχείς σε κυτταροπλασµατικές µεµβράνες, τόσο στις ωοθήκες όσο και στους όρχεις. H δέσµευση αυτή ενεργοποιεί την αδενυλοκυκλάση µε αποτέλεσµα την παραγωγή κυκλικού AMP, το οποίο συνδέεται µε αύξηση της βιοσύνθεσης στεροειδών. Σε περίπου 15% των ζευγαριών παρατηρείται στειρότητα σε κάποια φάση της αναπαραγωγικής τους ζωής. Ολοένα και συχνότερα η στειρότητα µπορεί να αντιµετωπιστεί µε τεχνικές υποβοηθούµενης αναπαραγωγής, όπως η in-vivo γονιµοποίηση, µεταφορά γαµετών στο εσωτερικών των σαλπίγγων, και η ενδοκυτταροπλασµατική έγχυση σπερµατοζωαρίων. Η αγωγή µε γοναδοτροφίνες για την αύξηση του αριθµού των ωοθυλακίων, είναι µια κοινή πρακτική σε όλες αυτές τις τεχνικές. Ένα σηµαντικό πρόβληµα της γυναικείας στειρότητας είναι η χρόνια αναστολή της ωορρηξίας. Οι ασθενείς που πάσχουν από αυτή τη νόσο, λαµβάνουν επίσης γοναδοτροφίνες προκειµένου να επιτευχθεί ανάπτυξη ενός µόνου ωοθυλακίου. Σκευάσµατα περιέχοντα γοναδοτροφίνες για την αντιµετώπιση της στειρότητας, προέρχονται κατά κανόνα από ούρα γυναικών µετά την εµµηνόπαυση. Τέτοια σκευάσµατα περιέχουν ωοθυλακιοτρόπο ορµόνη (FSH), αλλά εµφανίζουν καθαρότητα µικρότερη από 5% και περιέχουν κατ ανάγκη και ωχρινοποιητική ορµόνη (LH) ως πρόσµειξη. Η τεχνολογία του ανασυνδυασµένου DNA επέτρεψε την επαναλήψιµη παραγωγή παρασκευασµάτων περιεχόντων FSH, υψηλής καθαρότητας και εξειδικευµένης δράσης καθώς και την αποφυγή προσµείξεων από τα ούρα. Η ανασυνδυασµένη FSH παράγεται σε κύτταρα ωοθυλακίου από κινέζικα χάµστερ, στο γενετικό υλικό των οποίων, εισήχθησαν τα γονίδια που κωδικοποιούν τις δυο υποµονάδες της ανθρώπινης FSH. Μετά τις διαδικασίες αποµόνωσης, λαµβάνεται προϊόν υψηλής καθαρότητας (περιεκτικότητα τουλάχιστο 97%) και οµοιότητας προς τη φυσική FSH, ενώ αποφεύγεται η δράση της LH.

10 Επί του παρόντος διατίθενται δυο ιδιοσκευάσµατα περιέχοντα ανασυνδυασµένη FSH. Αυτά είναι τα Gonal-F, που παρασκευάζεται από την Ares-Serono και το Puregon, που παρασκευάζεται από την NV-Organon. Οι αρχές έχουν ορίσει δυο διεθνή ονόµατα για τις αντίστοιχες δραστικές ουσίες των φαρµάκων των περιεχόντων ανασυνδυασµένη FSH (ωοθυλακιοτρόπος Α, για τo Gonal-F και ωοθυλακιοτρόπος B, για το Puregon ). Συνεπώς τα δυο ιδιοσκευάσµατα θα πρέπει να θεωρούνται παρόµοια, αλλά όχι πανοµοιότυπα σκευάσµατα. Καθώς περιέχουν διαφορετικά δραστικά συστατικά. Ο πρωταρχικός ρόλος της γλυκοπρωτεϊνης FSH είναι η ρύθµιση της ωρίµανσης του ωοθυλακίου στα θήλεα άτοµα. Στόχος της ορµόνης είναι οι FSH υποδοχείς, στην επιφάνεια των κοκκωδών κυττάρων, που περιβάλλουν το ωοκύτταρο. Η FSH δρα συνεργιστικά µε τα οιστρογόνα και την LH για τη διέγερση της αναπαραγωγής των κυττάρων, µε αποτέλεσµα την ωρίµανση του ωοθυλακίου. Έτσι εξηγείται γιατί η µειωµένη ενδογενής παραγωγή FSH µπορεί να προκαλέσει στειρότητα. Η FSH κατατάσσεται σε µια ευρύτερη οµάδα δοµικά όµοιων γλυκοπρωτεϊνών, στην οποία περιλαµβάνεται η ωχρινοποιητική ορµόνη (LH), η χοριονική γοναδοτρόπος (CG) και η θυρεοειδοτρόπος ορµόνη (TSH). Καθεµία από τις παραπάνω ορµόνες έχει µορφή διµερούς και αποτελείται από δυο συνδεδεµένες, γλυκοπρωτεινικής φύσης, υποµονάδες, γνωστές ως α και β. Η α υποµονάδα είναι πανοµοιότυπη σε όλες τις ορµόνες και είναι η β υποµονάδα που προσδίδει τον ιδιαίτερο βιολογικό ρόλο στην κάθε πρωτεΐνη. Οι γλυκοπρωτεϊνικές υποµονάδες της FSH αποτελούνται από δυο πολυπεπτιδικές αλυσίδες, στις οποίες συνδέονται πλευρικές αλυσίδες σακχάρων. Συγκεκριµένα η σύνδεση γίνεται στις θέσεις Asn-52 και Asn-78 της α υποµονάδας και στις θέσεις Asn-7 και Asn-24 στη β υποµονάδα. Η α και η β υποµονάδα αποτελούνται από 92 και 111 αµινοξέα αντίστοιχα. Η γλυκοπρωτεϊνη FSH έχει µοριακό βάρος περίπου 35 kda. Προκειµένου το παρασκεύασµα της FSH να εµφανίζει βιολογική δράση, θα πρέπει οι δυο υποµονάδες να έχουν την κατάλληλη τρισδιάστατη διµερή πρωτεϊνική δοµή και να έχουν υποστεί τις αναγκαίες τροποποιήσεις µετά την µετάφραση.

11 Σχήµα: τρισδιάστατη δοµή της ωοθυλακιοτρόπου ορµόνης Η σύνδεση των υποµονάδων και η γλυκοσυλίωση, λαµβάνουν χώρα ενδοκυττάρια, στο σύστηµα Golgi και το ενδοπλασµατικό δίκτυο. Από τη γλυκοσυλίωση προκύπτουν διάφορες ισόµορφες πρωτεΐνες οι οποίες διαφέρουν στη σύσταση της πλευρικής αλυσίδας σακχάρων. Οι πλευρικές αυτές αλυσίδες είναι αναγκαίες για τη βιολογική δράση της FSH καθώς 1) επηρεάζουν τη σύνδεση της FSH µε τον υποδοχέα της, 2) διαδραµατίζουν σηµαντικό ρόλο στην ενδοκυττάρια µεταφορά του µηνύµατος στο κύτταρο στόχο της FSH και 3) επηρεάζουν το χρόνο παραµονής στο πλάσµα της ορµόνης. Η ανασυνδυασµένη FSH περιέχει περίπου 36% κατά βάρος υδατάνθρακες. Η υδατανθρακική πλευρική αλυσίδα αποτελείται από µανόζη, φουκόζη, Ν-ακέτυλογλυκοζαµίνη, γαλακτόζη και σιαλικό οξύ. Από δοµική ανάλυση, µε χρήση φασµατοσκοπίας 1 Η-NMR, των ολιγοσακχαριτών που αποµονώθηκαν µε ενζυµατική διάσπαση της οωθυλακιοτρόπου β, προκύπτει ότι οι διαφορές µε τη φυσική FSH είναι µικρές. Για παράδειγµα απουσιάζουν µόρια Ν-ακετυλογλυκοζαµίνης, στο ανασυνδυασµένο µόριο, επειδή τα κύτταρα των χάµστερ, στα οποία γίνεται η παραγωγή της FSH δε διαθέτουν τα απαιτούµενα ένζυµα για την εισαγωγή αυτών των υπολοίπων. Επιπρόσθετα, οι υδατανθρακικές πλευρικές αλυσίδες της ανασυνδυασµένης FSH περιέχουν µόρια σιαλικού οξέος τα οποία συνδέονται αποκλειστικά µε α 2-3 δεσµούς, ενώ στην φυσιολογική ορµόνη υπάρχουν και µόρια σιαλικού οξέος συνδεδεµένα µε α 1-6 δεσµούς. Όλες οι πλευρικές αλυσίδες σακχάρων που εντοπίστηκαν στην ανασυνδυασµένη FSH είναι σύµπλοκα, που φυσιολογικά ανευρίσκονται σε άλλες φυσιολογικές ανθρώπινες γλυκοπρωτεϊνες.

12 Τα γονίδια που κωδικοποιούν τις α και β υποµονάδες της ανθρώπινης FSH εισήχθησαν σε πλασµίδια, ώστε να επιτευχθεί επαρκής µεταφορά στο κύτταρα δέκτες. Τα πλασµίδια αυτά περιείχαν επίσης εκκινητήρες, που µπορούν να κατευθύνουν την εισαγωγή των ξένων γονιδίων στα κύτταρα δέκτες. Ως κύτταρα δέκτες επιλέχθηκαν τα κύτταρα από ωαρίων κινέζικων χάµστερ (CHO κύτταρα), επειδή είναι εύκολο να γίνει εισαγωγή ξένου DNA στα κύτταρα αυτά και έχουν τη δυνατότητα να παράγουν γλυκοσυλιωµένες πρωτεϊνες. Επιπλέον µπορούν να αναπτυχθούν σε κυτταρικές καλλιέργειες, σε µεγάλη κλίµακα. Προκειµένου να δηµιουργηθεί µια σειρά κυττάρων, σε θέση να παράγουν ανθρώπινη FSH, η NV- Organon, παρασκευάστρια εταιρία του Puregon, χρησιµοποίησε έναν µόνο φορέα DNA, που περιείχε τις αλληλουχίες για τα γονίδια και των δυο υποµονάδων. Στην Ares-Serono, παρασκευάστρια του Gonal-f, χρησιµοποιήθηκαν δυο διαφορετικοί φορείς, ένας για το γονίδιο της κάθε υποµονάδας. Μετά την µεταφορά του γενετικού υλικού, αποµονώθηκε ένα γενετικά σταθερό, τροποποιηµένο κύτταρο, το οποίο παρήγαγε βιολογικά δραστική FSH. Στη σειρά CHO κυττάρων, που χρησιµοποιήθηκε για την παραγωγή του Puregon, βρέθηκε ότι περιείχαν αντίγραφα των γονιδίων ανά κύτταρο. Για τη δηµιουργία της κύριας τράπεζας κυττάρων (master cell bank MCB), πανοµοιότυπα κυτταρικά παρασκευάσµατα του επιλεγµένου κλώνου αποθηκεύονται σε ξεχωριστά φιαλίδια σε ιδιαίτερα χαµηλές θερµοκρασίες (-78 C). Στη συνέχεια, δηµιουργείται µια λειτουργική τράπεζα κυττάρων (working cell bank WCB), µε πολλαπλασιασµό κυττάρων που λαµβάνονται από ένα µόνο φιαλίδιο της MCB. Η προκύπτουσα κυτταρική καλλιέργεια διαµοιράζεται σε φιαλίδια, τα οποία επίσης αποθηκεύονται σε χαµηλές θερµοκρασίες. Κάθε φορά που απαιτείται παραγωγή της FSH, γίνεται καλλιέργεια κυττάρων, που λαµβάνονται από ένα ή περισσότερα φιαλίδια της MCB. Τόσο η ωοθυλακιοτρόπος α, όσο και η ωοθυλακιοτρόπος β αποµονώνονται από το υπερκείµενο υγρό κυτταρικών καλλιεργειών, το οποίο συλλέγεται σε βιοαντιδραστήρες, όπου CHO κύτταρα παράγουν ανασυνδυασµένη FSH. Η ανάπτυξη των κυττάρων αυτών ευνοείται, όταν γίνεται πάνω σε ορισµένες επιφάνειες, µε αποτέλεσµα τα CHO κύτταρα να καλλιεργούνται πάνω σε µικρο-φορείς. Ο

13 βιοαντιδραστήρας εφοδιάζεται µε θρεπτικό υλικό που ευνοεί την ανάπτυξη των κυττάρων για χρονική περίοδο που µπορεί να διαρκέσει µέχρι και τρεις µήνες. Οι διαδικασίες για τον καθαρισµό και την αποµόνωση των δυο προϊόντων ανασυνδυασµένης FSH είναι διαφορετικές. Στην περίπτωση του Puregon, ακολουθείται µια διαδικασία που περιλαµβάνει διάφορες χρωµατογραφικές µεθόδους, όπως η χρωµατογραφία ανταλλαγής ιόντων, η υδρόφοβη χρωµατογραφία και η χρωµατογραφία αποκλεισµού µεγέθους. Η ανασυνδυασµένη FSH στην περίπτωση του Gonal-F, παραλαµβάνεται µε µια παρόµοια διεργασία αποτελούµενη από πέντε στάδια, κατά τα οποία χρησιµοποιούνται χρωµατογραφικές µέθοδοι, περιέχει όµως και ένα πρόσθετο στάδιο ανοσοσυγγένειας, κατά το οποίο χρησιµοποιούνται µονοκλωνικά αντισώµατα έναντι της FSH ποντικιού. Και στις δυο παραγωγικές διαδικασίες, το κάθε στάδιο καθαρισµού ελέγχεται διεξοδικά, ώστε να επιτευχθεί η οµοιοµορφία µεταξύ των διαφόρων παρτίδων του καθαρού προϊόντος. Όπως ήδη αναφέρθηκε, η FSH απαντά σε πολλές διαφορετικές µοριακές µορφές, µε πανοµοιότυπη δοµή όσο αφορά στις πολυπεπτιδικές αλυσίδες, αλλά διαφορές στη δοµή των ολιγοσακχαριτών και ειδικά στο βαθµό της τελικής γλυκοσυλίωση. Αυτές οι ισοορµόνες µπορούν να αποµονωθούν χρησιµοποιώντας chromatofocusing ή ισοηλεκτρικού εστιασµού, χάρη στο διαφορετικό ισοηλεκτρικό σηµείο (pι) που εµφανίζουν, όπως αποδείχθηκε για την ωοθυλακιοτρόπο β. Κατά κανόνα αναµένεται κατανοµή των ισοορµονών της FSH µεταξύ των τιµών pι 6 και 4. Προκειµένου να ληφθούν πληροφορίες για τη δοµή των α και β υποµονάδων, οι δυο υποµονάδες διαχωρίζονται µε χρήση υγρής χρωµατογραφίας υψηλής απόδοσης αντίστροφης φάσης και κατεργάζονται, ώστε να αποδεσµεύσουν τις Ν-ενωµένες υδατανθρακικές πλευρικές αλυσίδες. Κλάσµατα µε χαµηλές τιµές pι (όξινα κλάσµατα), χαρακτηρίζονται από υψηλή συγκέντρωση τρι- και τέτρα-σιαλοολιγοσακχαριτών και χαµηλή συγκέντρωση ουδέτερων και µονο-σιαλοολιγοσακχαριτών. Για κλάσµατα µε υψηλή τιµή pι διαπιστώθηκε το αντίστροφο. Οι πλευρικές υδατανθρακικές αλυσίδες των β-υποµονάδων φαίνεται να είναι εντονότερα διακλαδισµένες και να περιέχουν µεγαλύτερες ποσότητες σιαλικού οξέος, συγκριτικά µε τις υδατανθρακικές αλυσίδες των α-υποµονάδων. Οι ισοορµόνες µε χαµηλό pι της ωοθηλακιοτρόπου β έχουν υψηλή αναλογία σιαλικού οξέος/γαλακτόζη και είναι

14 πλούσιες σε τρι- και τετραµερο Ν-ενωµένες υδατανθρακικές πλευρικές αλυσίδες, σε σύγκριση µε τις πλευρικές αλυσίδες των ισοορµονών υψηλού pι. Βιολογικές ιδιότητες των ισοορµονών της ανασυνδυασµένης FSH Ένα σκεύασµα που περιέχει FSH, µπορεί να χαρακτηριστεί µε τέσσερις διαφορετικές µεθόδους, καθεµία εκ των οποίων παρουσιάζει ιδιαίτερα πλεονεκτήµατα. Η µέθοδος µε τη χρήση αντισωµάτων στηρίζεται στην αναγνώριση δοµών, χαρακτηριστικών της FSH και παρέχει ένα σχετικό µέγεθος για την ποσότητα της FSH. Η µέθοδος µε τη σύνδεση σε υποδοχείς παρέχει πληροφορίες σχετικά µε την ιδιαίτερη διαµόρφωση για αλληλεπίδραση µε τον FSH υποδοχέα. Από µελέτες σύνδεσης χρησιµοποιώντας µεµβράνες από όρχεις βοοειδών, προέκυψε, ότι η δραστικότητα των FSH ισοµορφών της ωοθυλακιοτρόπου β χαµηλού pι είναι µειωµένη συγκριτικά µε εκείνη των ισοορµονών µε υψηλό pι. Με τις in-vitro δοκιµασίες, προσδιορίζεται η ικανότητα της FSH να διαµεσολαβεί µηνύµατα στα κύτταρα στόχους (η ενδογενής δραστικότητα). Η in-vitro δραστικότητα, όπως προσδιορίστηκε σε κύτταρα Sertoli ποντικών, επίσης µειώνεται σε ισοµορφές χαµηλού pι. Η in-vivo δοκιµασία παρέχει τη συνολική βιοδραστικότητα ενός σκευάσµατος FSH. Η δραστικότητα καθορίζεται από τον αριθµό των µορίων, το χρόνο παραµονής στο πλάσµα, τη δυνατότητα σύζευξης µε τον υποδοχέα και τη διαµεσολάβηση µηνυµάτων. Απρόσµενα, σε αντίθεση µε τα αποτελέσµατα που προκύπτουν κατά τη µελέτη της σύνδεσης µε τον υποδοχέα και τις in-vitro δοκιµασίες, η in-vivo βιολογική δράση των ισοµορφών, όπως προσδιορίστηκε σε ποντίκια, αυξάνεται µέχρι και είκοσι φορές, όταν το pι των ισοµορφών µειώνεται από 5,49 σε 4,27. Τα αποτελέσµατα αυτά καταδεικνύουν ότι οι βασικές ισοορµόνες, εµφανίζουν τη µέγιστη δυνατότητα σύνδεσης µε τους υποδοχείς και διαµεσολάβησης µηνυµάτων, όµως οι όξινες ισοορµόνες είναι οι πιο δραστικές µορφές σε in-vivo συνθήκες.

15 FSH Φαρµακοκινητική συµπεριφορά των ισοµορφών της ανασυνδυασµένης H φαρµακοκινητική συµπεριφορά της ωοθυλακιοτρόπου β και των ισοορµονών αυτής, µελετήθηκε σε σκυλιά της ράτσας Beagle, στα οποία χορηγήθηκαν ενδοµυικά κλάσµατα ισοορµονών της FSH, καθένα µε διαφορετική τιµή pι. Με την ελάττωση της τιµής του pι από 5,49 (αλκαλικά) σε 4,27 (όξινα), παρατηρήθηκε ελάττωση του ρυθµού κάθαρσης. Ανάµεσα στο πιο όξινο και το πιο αλκαλικό κλάσµα των ισοορµονών της FSH υπολογίστηκε µια διαφορά µεγαλύτερη από το διπλάσιο στο χρόνο ηµίσειας κάθαρσης. O ρυθµός απορρόφησης των δυο πιο όξινων µορφών ήταν ο υψηλότερος από το ρυθµό απορρόφησης όλων των άλλων ισοµορφών. Ο ρυθµός κάθαρσης παρασκευάσµατος της ωοθυλακιοτρόπου β, που αποτελεί µείγµα των κλασµάτων όλων των ισοορµονών, αντιστοιχεί µε το κέντρο του προφίλ των ισοορµονών. Κατά συνέπεια, για τα κλάσµατα ισοορµονών της ωοθυλακιοτρόπου β υπάρχει σαφής συσχέτιση ανάµεσα στην τιµή του pι και τη φαρµακοκινητική συµπεριφορά. Η αύξηση της οξύτητας οδηγεί στην αύξηση της έκτασης της απορρόφησης και του χρόνου ηµίσειας κάθαρσης, αλλά και σε µείωση του ρυθµού κάθαρσης. Φαρµακευτικά παρασκευάσµατα Φάρµακα πρωτεϊνικής µορφής φέρονται κατά κανόνα σε λυοφιλοποιηµένη µορφή, εξαιτίας της περιορισµένης τους σταθερότητας σε υδατικά διαλύµατα. Επίσης παρασκευάσµατα περιέχοντα FSH ξηραίνονται εν ψυχρώ. ιατίθενται σε διάφορες µορφές και µε διαφορετική ισχύ. Η ωοθυλακιοτρόπος α µορφοποιείται µε έκδοχα τη σουκρόζη (προστατευτικό κατά τη λυοφιλοποίηση), µονόξινο και δισόξινο φωσφορικό νάτριο, φωσφορικό οξύ και καυστικό νάτριο (για ρύθµιση του ph). Η ωοθυλακιοτρόπος β µορφοποιείται µε σουκρόζη, κιτρικό νάτριο (σταθεροποιητικό), polysorbate 20 (προστατευτικό κατά τη λυοφιλοποίηση και παράγοντας για την αποφυγή απωλειών κατά την προσρόφηση) και υδροχλωρικό οξύ/καυστικό νάτριο (για τη ρύθµιση του ph).

16 Σκευάσµατα ανασυνδυασµένης FSH διακρίνονται για την υψηλή τους καθαρότητα (τουλάχιστο 97%) από σκευάσµατα περιέχοντα FSH αποµονωµένη από ούρα τα οποία έχουν καθαρότητα µικρότερη από 5%. Οι καθαρές πρωτεΐνες είναι, όµως, σχετικά ασταθείς και δύσκολο να κατεργαστούν. Εξαιτίας της µεγάλης τους τάσης να προσκολλούνται στο γυαλί και σε πολυµερή, αναµένονται σηµαντικές απώλειες της δραστικότητας εξαιτίας της προσρόφησης. Κατά συνέπεια η δραστικότητα των παρασκευασµάτων ανασυνδυασµένης FSH, λυοφιλοποιήθηκαν µε συµβατικό τρόπο µπορεί να είναι µικρότερη από 100%. Η προσφάτως αναπτυχθείσα φαρµακοτεχνική µορφή των λυοσφαίρων και της αντίστοιχης διεργασίας, επέτρεψε τη λήψη λυοφιλοποιηµένων παρασκευασµάτων περιεχόντων FSH, στα οποία η απώλεια δραστικότητας είναι περιορισµένη. Οι λυόσφαιρες είναι παγωµένες σταγόνες υδατικού διαλύµατος, οι οποίες λυοφιλοποιούνται στο σύνολό τους και ακολούθως τοποθετούνται σε αµπούλες. Σε σύγκριση µε τα συµβατικά παρασκευάσµατα, που λαµβάνονται µε την εν ψυχρώ ξήρανση ενός ιζήµατος, οι λυόσφαιρες εµφανίζουν πλεονεκτήµατα, όπως η αυξηµένη οµοιοµορφία δόσης, η µειωµένη προσρόφηση στα γυάλινα τοιχώµατα των φυαλιδίων, η άµεση διαλυτοποίηση και στην περίπτωση της FSH, η βελτιωµένη σταθερότητα. Σκευάσµατα περιέχοντα ανασυνδυασµένη FSH µπορούν να διατηρηθούν για δυο χρόνια στα φυαλίδια µέσα στα οποία διατίθενται και σε θερµοκρασίες µικρότερες από 30 C, µε την προϋπόθεση, ότι προστατεύονται από την άµεση ηλιακή ακτινοβολία και δεν καταψύχονται. Κλινική θεώρηση Τα δυο ιδιοσκευάσµατα, που περιέχουν ανασυνδυασµένη FSH, ενδείκνυνται σε δυο κυρίως περιπτώσεις. Η πρώτη θεραπευτική εφαρµογή είναι η αντιµετώπιση της αναστολής της ωορρηξίας ( συµπεριλαµβανοµένης και της πολυκυστικής νόσου των ωαρίων) σε γυναίκες που δεν αποκρίνονται στην κιτρική κλοµιφαίνη. Η δεύτερη θεραπευτική εφαρµογή είναι η υπερ-διέγερση των ωαρίων προκειµένου να επαχθεί ο σχηµατισµός πολλαπλών ωοθυλάκιων σε προγράµµατα ιατρικά υποβοηθούµενης γονιµοποίησης, όπως η in-vivo γονιµοποίηση (IVF) και η µεταφορά εµβρύου.

17 Στη στειρότητα που οφείλεται σε αναστολή της ωοθυλακιορηξίας, η αγωγή µε FSH αποσκοπεί στην ανάπτυξη ενός µόνου ωοθυλακίου, ενώ στην IVF η αγωγή αποσκοπεί στην ανάπτυξη πολλών ωοθυλακίων. Για την αντιµετώπιση της αναστολής της ωοθυλακιορηξίας συνίσταται η χορήγηση Puregon σε δόσεις 50IU/d για 7 έως 14 ηµέρες και η βαθµιαία αύξηση της δόσης µε βήµατα της τάξης των 50IU, σε περίπτωση που δε λαµβάνεται η επιθυµητή απόκριση. Αυτή η βαθµιαία αύξηση προτιµάται, προκειµένου να αποφευχθεί η ανάπτυξη πολλών ωοθυλακίων και η πρόκληση συνδρόµου ωαριακής υπερδιέγερσης (µια σοβαρή κατάσταση ανεπιθύµητης διέγερσης). Το πιο συχνά εφαρµοζόµενο πρωτόκολλο στην IVF, περιλαµβάνει καταστολή αρχικά των ενδογενών επιπέδων των γοναδοτροπινών µε χορήγηση ενός αγωνιστή της GnRH (ρυθµιστικός παράγοντας της έκκρισης των γοναδοτροπινών). Συνίσταται η έναρξη της αγωγής µε Puregon, µε χορήγηση IU, ανασυνδυασµένης FSH, ακολουθούµενα από δόσεις συντήρησης, µεγέθους IU. Η διαθεσιµότητα περίσσειας ωοκυττάρων επιτρέπει την γονιµοποίηση 2-3 εµβρύων. Παρόµοια πρωτόκολλα χορήγησης, συνίστανται για το Gonal-F. Tα επίπεδα της FSH στο πλάσµα δεν συσχετίζονται µε τη φαρµακολογική απόκριση, όπως αυτή εκφράζεται µε την παραγωγή οιστραδιόλης, την απόκριση ιοχιµβίνης ή την ανάπτυξη ωοθυλακίων. Επιπρόσθετα, παρατηρούνται µεγάλες διακυµάνσεις στην ιδιαίτερη απόκριση του κάθε ατόµου σε µια συγκεκριµένη δόση ανασυνδυασµένης FSH. Από τη διαπίστωση αυτή, γίνεται εύκολα αντιληπτή η σηµασία της εξατοµίκευσης της δόσης και του πρωτοκόλλου χορήγησης γενικότερα, κατά την αγωγή µε ανασυνδυασµένη FSH. Η ωοθυλακιοτρόπος β έχει χρόνο ηµίσειας κάθαρσης της τάξης των 40 ωρών. Συνεπώς η σταθεροποιηµένη κατάσταση για την ωοθυλακιοτρόπο β επιτυγχάνεται µετά από τέσσερις ηµερήσιες δόσεις. Στη σταθεροποιηµένη κατάσταση, η συγκέντρωση της κυκλοφορούσας ανοσοδραστικής FSH είναι περίπου 1,5-2,5 φορές µεγαλύτερη από εκείνη που λαµβάνεται µετά από χορήγηση µιας δόσης. Αυτή η αύξηση είναι σχετική µε την επίτευξη αποτελεσµατικών συγκεντρώσεων της FSH στο πλάσµα. Η ωοθυλακιοτρόπος β µπορεί αν χορηγηθεί δια της ενδοµυϊκής ή της υποδόριας οδού, απουσία προσµείξεων να επιτύχει αυξηµένη τοπική ανοχή. Η βιοδιαθεσιµότητα κατά τη χορήγηση δια µέσου αυτών των οδών είναι περίπου 77%.

18 Η χορήγηση των παρασκευασµάτων ωοθυλακιοτρόπου β υψηλής καθαρότητας δεν πρέπει να γίνεται απαραίτητα από υγειονοµικό προσωπικό, αλλά ο ίδιος ο ασθενής ή άτοµα του οικογενειακού περιβάλλοντος µπορούν να βοηθούνστη χορήγηση. Σε έναν µεγάλο αριθµό ασθενών που χορηγήθηκε ωοθυλακιοτρόπος β δεν παρατηρήθηκε ανάπτυξη αντισωµάτων έναντι της ανασυνδυασµένης FSH, ή άλλων πρωτεϊνών προερχόµενων από τα CHO κύτταρα. ιαφορές από σκευάσµατα περιέχοντα FSH αποµονωµένη από ούρα Κατά την IVF, η αγωγή µε ωοθυλακιοτρόπο β είναι πιο αποτελεσµατική από την αγωγή µε FSH αποµονωθείσα από τα ούρα, καθώς περισσότερα ωοθυλάκια, ωοκύτταρα, έµβρυα και εγκυµοσύνες επιτυγχάνονται µε χαµηλότερη συνολική δόση ανασυνδυασµένης FSH, σε συντοµότερο διάστηµα αγωγής. Κατά την αγωγή ασθενών που πάσχουν από στειρότητα, λόγω αναστολής της ωορρηξίας, λαµβάνονται τα ίδια αποτελέσµατα, είτε χορηγηθεί ωοθυλακιοτρόπος β είτε χρησιµοποιηθεί FSH που αποµονώνεται από τα ούρα. Ωστόσο, όταν χρησιµοποιείται ωοθυλακιοτρόπος β απαιτείται µικρότερη δόση και η διάρκεια της θεραπείας είναι µικρότερη. Ωχρινοποιητική ορµόνη H ωχρινοποιητική ορµόνη (LH) είναι µια γλυκοπρωτεΐνη µε µοριακό βάρος 30kDa. Eκκρίνεται από την αδενοϋπόφυση κατά τη διάρκεια σχηµατισµού του ωοθυλακίου. Tα επίπεδα της LH αυξάνονται πριν την ωορρηξία. Kατά την ανάπτυξη του ωοθυλακίου δρα σε συνεργασία µε την FSH. H LH στις γυναίκες προκαλεί ωχρινοποίηση του ωοθυλακίου και το σχηµατισµό του ωχρού σωµατίου (corpus lutem), ενώ στους άνδρες συµµετέχει στη σπερµατογένεση. Oι ορµόνες του πρόσθιου λοβού δεν είναι διαθέσιµες σε µεγάλες ποσότητες και οι αντίστοιχες που προέρχονται από ζώα δεν είναι συµβατές µε το ανθρώπινο ανοσοποιητικό σύστηµα. Yποκατάστατα της FSH που αναφέρθηκαν παραπάνω και της LH είναι η HMG (menotropin pergonal) (human menopausal gonadotrophin) που αποµονώνεται από τα ούρα γυναικών στο στάδιο της εµµηνόπαυσης. Xορηγείται για 9-12ηµέρες (75 IU τη φορά) µε σκοπό την προετοιµασία των ωοθηκών. Στην

19 συνέχεια χορηγείται η HCG (human chorionic gonadotropin), η οποία έχει δράση παρόµοια µε αυτής της LH. Στο 75% των ασθενών παρατηρείται ωρίµανση του ωαρίου και σε 25-50% των περιπτώσεων αυτών το ωάριο γονιµοποιείται επιτυχώς. H HCG αποµονώνεται από ούρα εγκύων γυναικών και κυκλοφορεί στο εµπόριο µε τις ονοµασίες Follutein, Glukor, Profus s. Αυξητική ορµόνη (GH) H αυξητική ορµόνη (GH) (σωµατοτροπίνη) είναι µία πρωτεΐνη µε µοριακό βάρος 21,5 kda. Pυθµίζει τη φυσιολογική (γραµµική) αύξηση του σώµατος. Aυξάνει τη σύνθεση της θειικής χονδροϊτίνης και του κολλαγόνου, διεγείρει τη λιπόλυση και την παραγωγή ελεύθερων λιπαρών οξέων, αυξάνει την γλυκόζη στο αίµα και προκαλεί κατακράτηση του αζώτου, του καλίου και του φωσφόρου. Oµηχανισµός δράσης της είναι άγνωστος αλλά πιθανολογείται ότι διεγείρει ειδικούς αυξητικούς παράγοντες οι οποίοι καλούνται somatomedines. Aνθρώπινη GH (Asellactin ) χορηγείται για τη θεραπευτική αντιµετώπιση του νανισµού. H συνθετική GH είναι εξίσου δραστική. Xορηγείται 2-3 φορές την εβδοµάδα (2 IU την φορά) και η αναµενόµενη αύξηση του ύψους είναι 2,5 cm ανά εξάµηνο. Σε περιπτώσεις ακροµεγαλίας που οφείλεται κυρίως σε υπερέκκριση GH χορηγείται βρωµοκρυπτίνη (Parlodel ) που ενώ φυσιολογικά αυξάνει την έκκριση της GH, στην συγκεκριµένη ασθένεια την ελαττώνει. Η hgh αποµονώθηκε και ταυτοποιήθηκε για πρώτη φορά στα τέλη του 1950 από εκχυλίσµατα υποθαλάµου που λήφθηκαν από πτώµατα ή άτοµα που υπέστησαν υποφυσεκτοµή. Η πρώτη κλινική χρήση αυτής της αποµονωµένης από τον υποθάλαµο hgh για την διέγερση την ανάπτυξης σε παιδιά µε µειωµένη λειτουργία του υποθαλάµου, έλαβε χώρα το Από το 1959 έως το 1985 για τις κλινικές µελέτες χρησιµοποιούνταν κυρίως hgh που αποµονωνόταν από την υπόφυση (pit-hgh). Η hgh κλωνοποιήθηκε για πρώτη φορά το Ανασυνδυασµένη hgh (rhgh) χρησιµοποιήθηκε για πρώτη φορά το Η εισαγωγή της rhgh συνέπεσε µε την παρατήρηση, ότι σε ορισµένους ασθενείς που χορηγούνταν hgh αποµονωµένη από την υπόφυση, αναπτύσσονταν η νόσος Creutzfeld-Jakob, µια νευροεκφυλιστική νόσος που οδηγεί στο θάνατο. Το γεγονός

20 ότι τα σκευάσµατα της hgh που χορηγήθηκαν σε άτοµα προκάλεσαν την ανάπτυξη της ιατρογενούς Creutzfeld-Jakob, οδήγησε στην άµµεση απόσυρση από την κυκλοφορία των παρασκευασµάτων που περιείχαν hgh αποµονωµένη από την υπόφυση. Περισσότερα από 100 άτοµα προσβλήθηκαν και αναµένονται ακόµη περισσότερα λαµβανωµένου υπ όψιν ότι η περίοδος επώασης της ασθένειας ξεπερνά και τα 25 έτη ανάλογα µε την δόση που δέχθηκε το άτοµο και ότι περισσότερα από χίλια άτοµα είχαν ήδη χρησιµοποιήσει µολυσµένα σκευάσµατα. Αρχικά η ανασυνδυασµένη hgh (rhgh), παραγόταν σε βακτήρια (E.Coli) και σε αντίθεση µε την ενδογενή hgh, περιείχε µια Ν-τελική οµάδα µεθειονίνης. Προϊόντα περιέχοντα την κανονική ακολουθία αµινοξέων παρήχθησαν στη συνέχεια, τόσο σε βακτήρια, όσο και σε κύτταρα θηλαστικών. οµή της hgh και ισοορµόνες. Η κύρια µορφή της hgh που διατίθεται στο εµπόριο, είναι µια µηγλυκοσυλιωµένη πρωτεΐνη, αποτελούµενη από 191 υπόλοιπα αµινοξέων, συνδεόµενων µε δισουλφιδικούς δεσµούς, ώστε να σχηµατίζονται δυο πεπτιδικοί βρόγχοι. Το µοριακό βάρος της πρωτεΐνης αυτής ανέρχεται σε 22kDa.Η τρισδιάστατη δοµή της hgh περιέχει 4 αντιπαράλληλες περιοχές α-ελίκων Σχήµα: Τρισδιάστατη δοµή της αυξητικής ορµόνης

11. ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ

11. ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ 11. ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ Στον ανθρώπινο οργανισμό υπάρχουν δύο είδη αδένων, οι εξωκρινείς και οι ενδοκρινείς. Οι εξωκρινείς (ιδρωτοποιοί αδένες, σμηγματογόνοι αδένες κ.ά.) εκκρίνουν το προϊόν τους στην επιφάνεια

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

Αύξηση & Ανάπτυξη. Υπερπλασία: αύξηση του αριθµού των κυττάρων & Υπερτροφία : αύξηση του µεγέθους των κυττάρων

Αύξηση & Ανάπτυξη. Υπερπλασία: αύξηση του αριθµού των κυττάρων & Υπερτροφία : αύξηση του µεγέθους των κυττάρων Αύξηση & Ανάπτυξη Αύξηση Κυτταρική διαίρεση και καθαρή πρωτεϊνική σύνθεση & Ανάπτυξη Αύξηση διαστάσεων (ανάστηµα) Αύξηση οστών (σπονδυλική στήλη και κάτω άκρα) Αύξηση σκελετικού µυ Αύξηση σπλάχνων Υπερπλασία:

Διαβάστε περισσότερα

ΑΥΞΗΤΙΚΗ ΟΡΜΟΝΗ, ΙΝΣΟΥΛΙΝΟΜΙΜΗΤΙΚΟΣ ΑΥΞΗΤΙΚΟΣ ΠΑΡΑΓΟΝΤΑΣ-Ι ΚΑΙ ΑΣΚΗΣΗ

ΑΥΞΗΤΙΚΗ ΟΡΜΟΝΗ, ΙΝΣΟΥΛΙΝΟΜΙΜΗΤΙΚΟΣ ΑΥΞΗΤΙΚΟΣ ΠΑΡΑΓΟΝΤΑΣ-Ι ΚΑΙ ΑΣΚΗΣΗ MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΑΥΞΗΤΙΚΗ ΟΡΜΟΝΗ, ΙΝΣΟΥΛΙΝΟΜΙΜΗΤΙΚΟΣ ΑΥΞΗΤΙΚΟΣ ΠΑΡΑΓΟΝΤΑΣ-Ι ΚΑΙ ΑΣΚΗΣΗ ΘΑΝΑΣΗΣ ΤΖΙΑΜΟΥΡΤΑΣ, Ph.D., C.S.C.S Η αυξητική

Διαβάστε περισσότερα

ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ

ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ Γυναικεία Ορµονικά Προφίλ (για την αναπαραγωγική και περιεµµηνοπαυσιακή ηλικία) Οι ωοθήκες βρίσκονται στο δεξιό και αριστερό τµήµα της πυελική κοιλότητας, πλησίον της µήτρας και

Διαβάστε περισσότερα

Βασικές Αρχές Ενδοκρινολογίας

Βασικές Αρχές Ενδοκρινολογίας Βασικές Αρχές Ενδοκρινολογίας Εισαγωγικό μάθημα Νικόλαος Κατσιλάμπρος Καθηγητής Παθολογίας Πανεπιστημίου Αθηνών σε συνεργασία με την ιατρό και υποψήφια διδάκτορα Χρυσή Χ. Κολιάκη Η Ενδοκρινολογία είναι

Διαβάστε περισσότερα

ΦΥΣΙΟΛΟΓΙΑ ΕΝΔΟΚΡΙΝΩΝ ΑΔΕΝΩΝ. Εμμ. Μ. Καραβιτάκης Παιδίατρος

ΦΥΣΙΟΛΟΓΙΑ ΕΝΔΟΚΡΙΝΩΝ ΑΔΕΝΩΝ. Εμμ. Μ. Καραβιτάκης Παιδίατρος ΦΥΣΙΟΛΟΓΙΑ ΤΩΝ ΕΝΔΟΚΡΙΝΩΝ ΑΔΕΝΩΝ Εμμ. Μ. Καραβιτάκης Παιδίατρος ΕΝ ΟΚΡΙΝΟΛΟΓΙΑ κλάδος της ιατρικής ο οποίος ασχολείται µε τις ασθένειες του ενδοκρινολογικού συστήµατος. το ενδοκρινολογικό σύστηµα αποτελείται

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΜΕΤΑΒΟΛΙΣΜΟΣ ΝΗΣΤΙΚΟΥ ΚΑΙ ΤΡΑΦΕΝΤΟΣ ΟΡΓΑΝΙΣΜΟΥ Tον ανθρώπινο µεταβολισµό το χαρακτηρίζουν δύο στάδια. Tοπρώτοείναιηκατάστασητουοργανισµούµετά

ΜΕΤΑΒΟΛΙΣΜΟΣ ΝΗΣΤΙΚΟΥ ΚΑΙ ΤΡΑΦΕΝΤΟΣ ΟΡΓΑΝΙΣΜΟΥ Tον ανθρώπινο µεταβολισµό το χαρακτηρίζουν δύο στάδια. Tοπρώτοείναιηκατάστασητουοργανισµούµετά ΜΕΤΑΒΟΛΙΣΜΟΣ ΝΗΣΤΙΚΟΥ ΚΑΙ ΤΡΑΦΕΝΤΟΣ ΟΡΓΑΝΙΣΜΟΥ Tον ανθρώπινο µεταβολισµό το χαρακτηρίζουν δύο στάδια. Tοπρώτοείναιηκατάστασητουοργανισµούµετά απόκάποιογεύµα, οπότετοαίµαείναιπλούσιοσε θρεπτικές ύλες από

Διαβάστε περισσότερα

ΑΝΑΠΑΡΑΓΩΓΙΚΟ. 2. (α) Ποια μέρη του γεννητικού συστήματος του άνδρα δείχνουν οι αριθμοί 1-8 στο σχήμα;

ΑΝΑΠΑΡΑΓΩΓΙΚΟ. 2. (α) Ποια μέρη του γεννητικού συστήματος του άνδρα δείχνουν οι αριθμοί 1-8 στο σχήμα; ΑΝΑΠΑΡΑΓΩΓΙΚΟ 1. (α) Τι αντιπροσωπεύουν οι αριθμοί 1-6 στο σχήμα; (β) Εξηγήστε τι είναι τα ωοθυλάκια και ποιος είναι ο ρόλος τους. (γ) Σε ποιο μέρος του γεννητικού συστήματος της γυναίκας αρχίζει η ανάπτυξη

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα

Φλοιοτρόπος ορμόνη ή Κορτικοτροπίνη (ACTH) και συγγενή πεπτίδια

Φλοιοτρόπος ορμόνη ή Κορτικοτροπίνη (ACTH) και συγγενή πεπτίδια ΕΠΙΝΕΦΡΙΔΙΑ Φλοιοτρόπος ορμόνη ή Κορτικοτροπίνη (ACTH) και συγγενή πεπτίδια 39 αμινοξέα Μ.Β. 4500 προοπιομελανοκορτίνη(pomc) 1. κορτικοτροπίνη (ACTH), 2. β λιποτροφίνη (β LPH), 3. γ λιποτροφίνη (γ LPH),

Διαβάστε περισσότερα

Υποθάλαµος & Υπόφυση Η υπόφυση και ο υποθάλαµος σχηµατίζουν µια λειτουργική µονάδα

Υποθάλαµος & Υπόφυση Η υπόφυση και ο υποθάλαµος σχηµατίζουν µια λειτουργική µονάδα Υποθάλαµος & Υπόφυση Η υπόφυση και ο υποθάλαµος σχηµατίζουν µια λειτουργική µονάδα Ρυθµίζουν το µεταβολισµό του ύδατος την έκκριση γάλακτος την αναπαραγωγή τη γαλουχία την αύξηση και εκκριτική δραστηριότητα

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑ ΜΑΘΗΤΗ-ΜΑΘΗΤΡΙΑΣ:... 1. Το πιο κάτω σχεδιάγραμμα δείχνει ανθρώπινο σπερματοζωάριο.

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑ ΜΑΘΗΤΗ-ΜΑΘΗΤΡΙΑΣ:... 1. Το πιο κάτω σχεδιάγραμμα δείχνει ανθρώπινο σπερματοζωάριο. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΑΝΑΠΑΡΑΓΩΓΗ ΗΜΕΡΟΜΗΝΙΑ:... ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ ΤΜΗΜΑ:... ΑΡ. ΜΑΘΗΤΗ-ΜΑΘΗΤΡΙΑΣ:... ΟΝΟΜΑ ΜΑΘΗΤΗ-ΜΑΘΗΤΡΙΑΣ:... 1. Το πιο κάτω σχεδιάγραμμα δείχνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΜΕΣΟΘΕΡΑΠΕΙΑ ΕΝΕΣΙΜΗ ΤΟΠΙΚΗ ΘΕΡΑΠΕΙΑ

ΜΕΣΟΘΕΡΑΠΕΙΑ ΕΝΕΣΙΜΗ ΤΟΠΙΚΗ ΘΕΡΑΠΕΙΑ ΜΕΣΟΘΕΡΑΠΕΙΑ ΕΝΕΣΙΜΗ ΤΟΠΙΚΗ ΘΕΡΑΠΕΙΑ ΜΕΣΟΘΕΡΑΠΕΙΑ Αυτό σημαίνει ότι χρησιμοποιούμε μόνο ενέσιμα φάρμακα και μόνο στο σημείο που πάσχει. ΜΕΣΟΘΕΡΑΠΕΙΑ Ξεκίνησε στη λογική του γιατί να μη χορηγήσω ένα αντιφλεγμονώδες

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2015

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2015 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2015 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ Contents ΕΝΟΤΗΤΑ 2: ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ... 3 ΕΝΟΤΗΤΑ 3: ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΝΖΥΜΑ... 16 ΕΝΟΤΗΤΑ

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 8 Ο ΚΕΦΑΛΑΙΟ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ 5ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΙΛΙΟΥ 1 8. Εφαρμογές της Βιοτεχνολογίας στην Ιατρική Φαρμακευτικές πρωτεΐνες Τι είναι οι φαρμακευτικές

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΑ ΦΥΣΙΟΛΟΓΙΑΣ

ΜΑΘΗΜΑΤΑ ΦΥΣΙΟΛΟΓΙΑΣ ΜΑΘΗΜΑΤΑ ΦΥΣΙΟΛΟΓΙΑΣ ΓΕΝΝΗΤΙΚΟ ΣΥΣΤΗΜΑ KAI ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ Νικόλαος Χ. Σύρμος ANAΠΑΡΑΓΩΓΗ Ο άνθρωπος αναπαράγεται με αμφιγονική αναπαραγωγή. Δύο γαμετικά κύτταρα,το ωάριο (θηλυκό)

Διαβάστε περισσότερα

ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ

ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ 1. ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ Cetrotide 0,25 mg κόνις και διαλύτης για ενέσιμο διάλυμα 2. ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ Κάθε φιαλίδιο περιέχει 0,25

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ

ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ ΚΕΦΑΛΑΙΟ 12. ΑΝΑΠΑΡΑΓΩΓΗ Δομή και λειτουργία του αναπαραγωγικού συστήματος 1. Να ονομάσετε τις αριθμημένες δομές του παρακάτω σχήματος. Βλέπε εικ. 12.1 της σ. 219 του βιβλίου του μαθητή. 2. Να ενώσετε

Διαβάστε περισσότερα

ΕΠΙΝΕΦΡΙΔΙΑ ΚΟΡΤΙΖΟΛΗ

ΕΠΙΝΕΦΡΙΔΙΑ ΚΟΡΤΙΖΟΛΗ ΕΠΙΝΕΦΡΙΔΙΑ ΚΟΡΤΙΖΟΛΗ Μεταβολισμός της κορτιζόλης Η κορτιζόλη μεταβολίζεται στο ήπαρ. Στην συνέχεια οι μεταβολίτες συζευγνύνται με γλυκουρονιδικές και θειικές ομάδες, γίνονται υδατοδιαλυτά, εισέρχονται

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Ovitrelle 250 μικρογραμμάρια/0,5 ml ενέσιμο διάλυμα σε προγεμισμένη σύριγγα

Ovitrelle 250 μικρογραμμάρια/0,5 ml ενέσιμο διάλυμα σε προγεμισμένη σύριγγα 1. ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ Ovitrelle 250 μικρογραμμάρια/0,5 ml ενέσιμο διάλυμα σε προγεμισμένη σύριγγα 2. ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ Χοριακή γοναδοτροπίνη άλφα* 250 μικρογραμμάρια σε 0,5

Διαβάστε περισσότερα

Θέματα Αναπαραγωγικής Υγείας στην Προεφηβεία & Εφηβεία. Φλώρα Μπακοπούλου Παιδίατρος Εφηβικής Ιατρικής

Θέματα Αναπαραγωγικής Υγείας στην Προεφηβεία & Εφηβεία. Φλώρα Μπακοπούλου Παιδίατρος Εφηβικής Ιατρικής Θέματα Αναπαραγωγικής Υγείας στην Προεφηβεία & Εφηβεία Φλώρα Μπακοπούλου Παιδίατρος Εφηβικής Ιατρικής Ενήβωση - Εφηβεία Puberty - Adolescence Puberty vs. Adolescence Ενήβωση vs. Εφηβεία 12-15 y 12- >>15

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

Εφαρμογές αρχών φαρμακολογίας

Εφαρμογές αρχών φαρμακολογίας Εφαρμογές αρχών φαρμακολογίας Χριστίνα Δάλλα Λέκτορας Φαρμακολογίας Ιατρική Σχολή, Πανεπιστήμιο Αθηνών cdalla@med.uoa.gr www.med.uoa.gr/pharmacology Ισχύς (potency) ενός φαρμάκου (συνήθως εκφράζεται σε

Διαβάστε περισσότερα

Διαταραχές της έμμηνης ρύσης Από το σύμπτωμα στην αιτιολογία και την αντιμετώπιση

Διαταραχές της έμμηνης ρύσης Από το σύμπτωμα στην αιτιολογία και την αντιμετώπιση Α Μαιευτική - Γυναικολογική Κλινική ΑΠΘ Ιατρική Σχολή Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Διαταραχές της έμμηνης ρύσης Από το σύμπτωμα στην αιτιολογία και την αντιμετώπιση Δημήτριος Γ. Γουλής Ενδοκρινολόγος

Διαβάστε περισσότερα

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ Μικροβιολογικό & Ερευνητικό Εργαστήριο Καθ έξιν Αποβολές Οι καθ 'έξιν αποβολές είναι μια ασθένεια σαφώς διακριτή από τη στειρότητα, και που ορίζεται ως δύο ή περισσότερες αποτυχημένες

Διαβάστε περισσότερα

Ρύθµιση της λειτουργίας των όρχεων

Ρύθµιση της λειτουργίας των όρχεων 25 Ρύθµιση της λειτουργίας των όρχεων Ι. ΗΛΙΑΣ, M. ΑΛΕΞΙΟΥ Τμήμα Ενδοκρινολογίας Διαβήτη και Μεταβολισμού Νοσοκομείo «Έλενα Βενιζέλου», Αθήνα ρύθμιση της λειτουργίας των όρχεων γίνεται στο επίπεδο του

Διαβάστε περισσότερα

ΟΙ ΕΠΕΝΕΡΓΕΙΕΣ ΚΑΙ ΟΙ ΜΗΧΑΝΙΣΜΟΙ ΔΡΑΣΕΩΣ

ΟΙ ΕΠΕΝΕΡΓΕΙΕΣ ΚΑΙ ΟΙ ΜΗΧΑΝΙΣΜΟΙ ΔΡΑΣΕΩΣ ΟΙ ΕΠΕΝΕΡΓΕΙΕΣ ΚΑΙ ΟΙ ΜΗΧΑΝΙΣΜΟΙ ΔΡΑΣΕΩΣ ΤΩΝ ΟΡΜΟΝΩΝ Κωνσταντίνος Καλλαράς Ιατρός Παθολόγος Καθηγητής Φυσιολογίας Εργαστήριο Πειραματικής Φυσιολογίας Ιατρικής Σχολής Α.Π.Θ. Γενικές έννοιες Ενδοκρινής έκκριση

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006 Μάθηµα: ΒΙΟΛΟΓΙΑ Ηµεροµηνία και ώρα εξέτασης: ευτέρα, 5 Ιουνίου 2006 7.30 π.µ.

Διαβάστε περισσότερα

3/12/2014. Εξωσωµατική γονιµοποίηση (IVF) Πτωχές Απαντήτριες. Αίτια πτωχής απάντησης ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ

3/12/2014. Εξωσωµατική γονιµοποίηση (IVF) Πτωχές Απαντήτριες. Αίτια πτωχής απάντησης ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΛΕΥΘΕΡΙΑΔΗΣ Δ. ΝΙΚΟΛΑΟΣ Μοριακός Βιολόγος & Γενετιστής ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Μεταπτυχιακό Πρόγραµµα Σπουδών «Κλινική Φαρµακολογία και Θεραπευτική» Επιβλέπουσα: ΚΟΥΤΛΑΚΗ ΝΙΚΟΛΕΤΑ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΥΞΗΤΙΚΗ ΟΡΜΟΝΗ, ΙΝΣΟΥΛΙΝΟΜΙΜΗΤΙΚΟΣ ΑΥΞΗΤΙΚΟΣ ΠΑΡΑΓΟΝΤΑΣ-Ι ΚΑΙ ΑΣΚΗΣΗ

ΑΥΞΗΤΙΚΗ ΟΡΜΟΝΗ, ΙΝΣΟΥΛΙΝΟΜΙΜΗΤΙΚΟΣ ΑΥΞΗΤΙΚΟΣ ΠΑΡΑΓΟΝΤΑΣ-Ι ΚΑΙ ΑΣΚΗΣΗ MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΑΥΞΗΤΙΚΗ ΟΡΜΟΝΗ, ΙΝΣΟΥΛΙΝΟΜΙΜΗΤΙΚΟΣ ΑΥΞΗΤΙΚΟΣ ΠΑΡΑΓΟΝΤΑΣ-Ι ΚΑΙ ΑΣΚΗΣΗ ΘΑΝΑΣΗΣ ΤΖΙΑΜΟΥΡΤΑΣ, Ph.D., C.S.C.S Λειτουργίες

Διαβάστε περισσότερα

[Version 7.2, 12/2008] ΠΑΡΑΡΤΗΜΑ Ι ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ

[Version 7.2, 12/2008] ΠΑΡΑΡΤΗΜΑ Ι ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ [Version 7.2, 12/2008] ΠΑΡΑΡΤΗΜΑ Ι ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ 1 1. ΟΝΟΜΑΣΙΑ ΤΟΥ ΚΤΗΝΙΑΤΡΙΚΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ Vitamin AD3E, ενέσιμο διάλυμα 2. ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ Δραστικό(ά)

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΜΕΡΟΣ Α' ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΕΞΕΤΑΣΕΙΣ ΓΙΑ ΤΑ ΑΝΩΤΕΡΑ ΚΑΙ ΑΝΩΤΑΤΑ ΕΚΠΑΙΔΕΥΤΙΚΑ ΙΔΡΥΜΑΤΑ Μάθημα: ΒΙΟΛΟΓΙΑ Ημερομηνία και ώρα

Διαβάστε περισσότερα

ΡΥΘΜΙΣΗ ΤΟΥ ΜΕΤΑΒΟΛΙΣΜΟΥ ΤΩΝ ΛΙΠΟΕΙ ΩΝ

ΡΥΘΜΙΣΗ ΤΟΥ ΜΕΤΑΒΟΛΙΣΜΟΥ ΤΩΝ ΛΙΠΟΕΙ ΩΝ ΡΥΘΜΙΣΗ ΤΟΥ ΜΕΤΑΒΟΛΙΣΜΟΥ ΤΩΝ ΛΙΠΟΕΙ ΩΝ Η επιβίωση των ζώντων οργανισµών οφείλεται εκτός των άλλων και στην ικανότητά τους να ρυθµίζουν την αποθήκευση και την κινητοποίηση της ενέργειας για το µεταβολισµότους.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΜΕΤΑΜΟΣΧΕΥΣΗ ΝΕΦΡΟΥ. Λειτουργία των νεφρών. Συμπτώματα της χρόνιας νεφρικής ανεπάρκειας

ΜΕΤΑΜΟΣΧΕΥΣΗ ΝΕΦΡΟΥ. Λειτουργία των νεφρών. Συμπτώματα της χρόνιας νεφρικής ανεπάρκειας ΜΕΤΑΜΟΣΧΕΥΣΗ ΝΕΦΡΟΥ Η χρόνια νεφρική ανεπάρκεια είναι η προοδευτική, μη αναστρέψιμη μείωση της νεφρικής λειτουργίας, η οποία προκαλείται από βλάβη του νεφρού ποικίλης αιτιολογίας. Η χρόνια νεφρική ανεπάρκεια

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

(dietary fiber, nonnutritive fiber)

(dietary fiber, nonnutritive fiber) KΥΤΤΑΡΙΝΗ - ΦΥΤΙΚΕΣ ΙΝΕΣ Στα τρόφιμα, παράλληλα με τους υδατάνθρακες που πέπτονται στον ανθρώπινο οργανισμό (δηλαδή που υδρολύονται, απορροφώνται και μεταβολίζονται κατά τα γνωστά), υπάρχουν και υδατάνθρακες

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΟΙ ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ ΚΑΙ Η ΡΥΘΜΙΣΗ ΤΟΥ ΑΣΒΕΣΤΙΟΥ

ΟΙ ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ ΚΑΙ Η ΡΥΘΜΙΣΗ ΤΟΥ ΑΣΒΕΣΤΙΟΥ ΟΙ ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ ΚΑΙ Η ΡΥΘΜΙΣΗ ΤΟΥ ΑΣΒΕΣΤΙΟΥ ΔΗΜΗΤΡΗΣ Ε. ΚΟΥΤΣΟΝΙΚΟΛΑΣ ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΦΥΣΙΟΛΟΓΙΑΣ(ΧΕΙΡΟΥΡΓΟΣ ΠΑΙΔΩΝ) ΙΑΤΡΙΚΗ ΣΧΟΛΗ Α.Π.Θ ΟΙ ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ ΑΝΑΤΟΜΙΚΑ ΚΑΙ ΙΣΤΟΛΟΓΙΚΑ

Διαβάστε περισσότερα

1. ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ. Orgalutran 0,25 mg/ 0,5 ml, ενέσιμο διάλυμα 2. ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ

1. ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ. Orgalutran 0,25 mg/ 0,5 ml, ενέσιμο διάλυμα 2. ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ 1. ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ Orgalutran 0,25 mg/ 0,5 ml, ενέσιμο διάλυμα 2. ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ Κάθε προγεμισμένη σύριγγα περιέχει 0,25 mg γκανιρελίξη σε 0,5 ml υδατικού διαλύματος.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

BITAMINEΣ Ένας σημαντικός σταθμός στη διαιτολογία ήταν η ανακάλυψη, στις πρώτες δεκαετίες του εικοστού αιώνα, των βιταμινών και του σημαντικού ρόλου

BITAMINEΣ Ένας σημαντικός σταθμός στη διαιτολογία ήταν η ανακάλυψη, στις πρώτες δεκαετίες του εικοστού αιώνα, των βιταμινών και του σημαντικού ρόλου BITAMINEΣ Ένας σημαντικός σταθμός στη διαιτολογία ήταν η ανακάλυψη, στις πρώτες δεκαετίες του εικοστού αιώνα, των βιταμινών και του σημαντικού ρόλου αυτών στον οργανισμό. Οι βιταμίνες κατατάσσονται στην

Διαβάστε περισσότερα

Πεπτικός σωλήνας Κύρια λειτουργία του είναι η εξασφάλιση του διαρκούς ανεφοδιασμού του οργανισμού με νερό, ηλεκτρολύτες και θρεπτικά συστατικά.

Πεπτικός σωλήνας Κύρια λειτουργία του είναι η εξασφάλιση του διαρκούς ανεφοδιασμού του οργανισμού με νερό, ηλεκτρολύτες και θρεπτικά συστατικά. Πεπτικός σωλήνας Κύρια λειτουργία του είναι η εξασφάλιση του διαρκούς ανεφοδιασμού του οργανισμού με νερό, ηλεκτρολύτες και θρεπτικά συστατικά. Στον πεπτικό σωλήνα πραγματοποιείται ο τεμαχισμός της τροφής

Διαβάστε περισσότερα

Ηεξέλιξη της πολυκυτταρικότητας

Ηεξέλιξη της πολυκυτταρικότητας ΚΥΤΤΑΡΙΚΗ ΕΠΙΚΟΙΝΩΝΙΑ Τα κύτταρα επικοινωνούν µεταξύ τους και µε το περιβάλλον προκειµένου να συντονίζουν τις λειτουργίες που απαιτούνται για την αύξηση, ανάπτυξη και λειτουργία ενός οργανισµού Η επικοινωνία

Διαβάστε περισσότερα

ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ

ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ TC RA 2400 OS S2 (REF 2.0) ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ 1. ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ Pregnyl 1.500, 5.000 IU κόνις και διαλύτης για ενέσιμο διάλυμα 2. ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός

Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός αποικοδόµησης τωναµινοξέων. Με αυξηµένο ρυθµός αποικοδόµησης αµινοξέων

Διαβάστε περισσότερα

Στοιχειώδεις παθολογικές μεταβολές του Γεννητικού Συστήματος

Στοιχειώδεις παθολογικές μεταβολές του Γεννητικού Συστήματος Στοιχειώδεις παθολογικές μεταβολές του Γεννητικού Συστήματος του Θήλεος ΠΑΡΟΥΣΙΑΣΕΙΣ ΜΑΘΗΜΑΤΩΝ ΟΙΚΟΝΟΜΟΠΟΥΛΟΣ ΙΩΑΝΝΗΣ Προσοχή: Οι παρουσιάσεις μαθημάτων αποτελούν βοήθημα παρακολούθησης των παραδόσεων

Διαβάστε περισσότερα

AMINOPLASMAL HEPA-10%

AMINOPLASMAL HEPA-10% AMINOPLASMAL HEPA-10% ΠΕΡΙΛΗΨΗ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ 1.ΕΜΠΟΡΙΚΗ ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ Αminoplasmal Hepa 10% 2.ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ Τα 1000ml διαλύματος περιέχουν: L-Isoleucin

Διαβάστε περισσότερα

16η ΕΤΗΣΙΑΕΙΔΙΚΗ ΣΥΝΟΔΟΣ

16η ΕΤΗΣΙΑΕΙΔΙΚΗ ΣΥΝΟΔΟΣ ΕΛΛΗΝΙΚΗ ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΕΤΑΙΡΕΙΑ 16η ΕΤΗΣΙΑΕΙΔΙΚΗ ΣΥΝΟΔΟΣ 8 9 ΙΟΥΝΙΟΥ 2002 ΔΗΜΟΤΙΚΟ ΘΕΑΤΡΟ ΠΕΙΡΑΙΑ 1 ΗχρήσητωνGnRH αναλόγων στην Υποβοηθούμενη Αναπαραγωγή Αλέξανδρος Δ. Τζεφεράκος ΜΟΝΑΔΑ ΑΝΑΠΑΡΑΓΩΓΙΚΗΣ

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΜΕΤΑΒΟΛΙΣΜΟΣ ΛΙΠΩΝ- Λίπη και αθηροσκλήρυνση. Μεσογειακή ίαιτα. Λίπη και αθηροσκλήρυνση: Ο ρόλος της άσκησης

Θέµατα ιάλεξης ΜΕΤΑΒΟΛΙΣΜΟΣ ΛΙΠΩΝ- Λίπη και αθηροσκλήρυνση. Μεσογειακή ίαιτα. Λίπη και αθηροσκλήρυνση: Ο ρόλος της άσκησης MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΜΕΤΑΒΟΛΙΣΜΟΣ ΛΙΠΩΝ- ΠΡΩΤΕΪΝΩΝ Θέµατα ιάλεξης Ο ρόλος της διατροφής στην εµφάνιση ασθενειών της καρδιάς Επίδραση

Διαβάστε περισσότερα

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη Ατυπία Υπερπλασία- Δυσπλασία Κίττυ Παυλάκη Jeanne Calment Κάπνιζε µέχρι τα 117 Πέθανε στα 122 Η σωστή λειτουργία των οργανισµών απαιτεί τη δυνατότητα προσαρµογής των κυττάρων και κατά συνέπεια και των

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ ΝΑΤΡΙΟ ΑΝΘΡΑΚΙΚΟ ΟΞΙΝΟ/DEMO Ενέσιμο διάλυμα 4% και 8%

ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ ΝΑΤΡΙΟ ΑΝΘΡΑΚΙΚΟ ΟΞΙΝΟ/DEMO Ενέσιμο διάλυμα 4% και 8% ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ ΝΑΤΡΙΟ ΑΝΘΡΑΚΙΚΟ ΟΞΙΝΟ/DEMO Ενέσιμο διάλυμα 4% και 8% 1. ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ Νάτριο Ανθρακικό Όξινο/DEMO (Sodium Bicarbonate/DEMO) 2. ΠΟΙΟΤΙΚΗ

Διαβάστε περισσότερα

ΑΠΕΙΚΟΝΙΣΗΣ ΤΩΝ ΟΓΚΩΝ

ΑΠΕΙΚΟΝΙΣΗΣ ΤΩΝ ΟΓΚΩΝ 2. ΜΕΤΑΒΟΛΙΚΟ ΜΟΝΤΕΛΟ ΑΠΕΙΚΟΝΙΣΗΣ ΤΩΝ ΟΓΚΩΝ Οι όγκοι χαρακτηρίζονται από πολλαπλές αλλαγές του μεταβολισμού. Η χαρακτηριστική μεταβολική λειτουργία μπορεί να μετρηθεί in vivo με τη βοήθεια ενός ραδιοσημασμένου

Διαβάστε περισσότερα

Νοσος Cushing Μάθετε περισσότερα

Νοσος Cushing Μάθετε περισσότερα Journalist Handbook 1 Πληροφορίες για Δημοσιογράφους Νοσος Cushing Μάθετε περισσότερα Νοσος Cushing 3 TΙ ΕΙΝΑΙ Η ΝΟΣΟΣ CUSHING; Πριν μιλήσουμε για τη Νόσο Cushing, θα πρέπει να κατανοήσουμε την ασθένεια

Διαβάστε περισσότερα

Η μεταφορά των φαρμάκων γίνεται με παθητική διάχυση ή με ενεργητική μεταφορά.

Η μεταφορά των φαρμάκων γίνεται με παθητική διάχυση ή με ενεργητική μεταφορά. ΣΗΜΕΙΩΣΕΙΣ ΓΕΝΙΚΗΣ ΦΑΡΜΑΚΟΛΟΓΙΑΣ ΤΙ ΕΙΝΑΙ ΦΑΡΜΑΚΟ. Φάρμακο λέμε οποιαδήποτε ουσία που όταν χορηγηθεί στον άνθρωπο, τα ζώα ή τα φυτά με συγκεκριμένο τρόπο και σε συγκεκριμένη δόση έχει θεραπευτικό αποτέλεσμα.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΙΟΝΤΟΣ EVATON Β 12 Επικαλυμένα με λεπτό υμένιο δισκία (200+250+1.5) mg

ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΙΟΝΤΟΣ EVATON Β 12 Επικαλυμένα με λεπτό υμένιο δισκία (200+250+1.5) mg ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΙΟΝΤΟΣ EVATON Β 12 Επικαλυμένα με λεπτό υμένιο δισκία (200+250+1.5) mg 1. ΕΜΠΟΡΙΚΗ ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΙΟΝΤΟΣ: EVATON B 12 2. ΠΟΙΟΤΙΚΗ & ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ :

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2006 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2006 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΥΠΟΓΟΝΙΜΟΤΗΤΑ ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ ΛΕΚΤΟΡΑΣ Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ: ΚΑΘ. Α.

ΥΠΟΓΟΝΙΜΟΤΗΤΑ ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ ΛΕΚΤΟΡΑΣ Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ: ΚΑΘ. Α. ΥΠΟΓΟΝΙΜΟΤΗΤΑ ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ ΛΕΚΤΟΡΑΣ Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ: ΚΑΘ. Α. ΑΝΤΣΑΚΛΗΣ ΥΠΟΓΟΝΙΜΟΤΗΤΑ Η ανικανότητα σύλληψης μετά από ένα χρόνο σεξουαλικών

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Ποια η χρησιμότητα των πρωτεϊνών;

Ποια η χρησιμότητα των πρωτεϊνών; ΠΡΩΤΕΪΝΕΣ Τι είναι οι πρωτεϊνες; Η ονομασία πρωτεϊνες προέρχεται από το ρήμα πρωτεύω και σημαίνει την εξαιρετική σημασία που έχουν οι πρωτεϊνες για την υγεία του ανθρώπινου σώματος. Από την εποχή των Ολυμπιακών

Διαβάστε περισσότερα

Μεταβολισμός του γλυκογόνου. Μεταβολισμός των υδατανθράκων κατά την άσκηση. Από που προέρχεται το μυϊκό και ηπατικό γλυκογόνο;

Μεταβολισμός του γλυκογόνου. Μεταβολισμός των υδατανθράκων κατά την άσκηση. Από που προέρχεται το μυϊκό και ηπατικό γλυκογόνο; Μεταβολισμός των υδατανθράκων κατά την άσκηση Μεταβολισμός του γλυκογόνου Το γλυκογόνο είναι ο αφθονότερος υδατάνθρακας των ζώων Το γλυκογόνο αποθηκεύεται κυρίως στο ήπαρ (3-7% κατά βάρος) και στους μύες

Διαβάστε περισσότερα

ΙΣΤΟΙ Ως προς τη µορφή και τη λειτουργία τους. Κυτταρική διαφοροποίηση.

ΙΣΤΟΙ Ως προς τη µορφή και τη λειτουργία τους. Κυτταρική διαφοροποίηση. ΙΣΤΟΙ 1. Τα κύτταρα που αποτελούν τον οργανισµό µας, διακρίνονται σε διάφορους τύπους, παρά το γεγονός ότι όλα, τελικώς, προέρχονται από το ζυγωτό, δηλαδή το πρώτο κύτταρο µε το οποίο ξεκίνησε η ζωή µας.

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΠΕΡΙΛΗΨΗ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ (SmPC) NEPHROTECT. 1. ΕΜΠΟΡΙΚΗ ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΙΟΝΤΟΣ Nephrotect, διάλυµα για έγχυση

ΠΕΡΙΛΗΨΗ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ (SmPC) NEPHROTECT. 1. ΕΜΠΟΡΙΚΗ ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΙΟΝΤΟΣ Nephrotect, διάλυµα για έγχυση ΠΕΡΙΛΗΨΗ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ (SmPC) NEPHROTECT 1. ΕΜΠΟΡΙΚΗ ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΙΟΝΤΟΣ Nephrotect, διάλυµα για έγχυση 2. ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ 1000 ml περιέχουν: L-isoleucine

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΠΑΡΑΡΤΗΜΑ Ι ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ

ΠΑΡΑΡΤΗΜΑ Ι ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ ΠΑΡΑΡΤΗΜΑ Ι ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ 1 1. ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ Puregon 50 IU/0,5 ml ενέσιμο διάλυμα 2. ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ Ένα φιαλίδιο περιέχει 50 IU ανασυνδυασμένης

Διαβάστε περισσότερα

Μήπως έχω µεγαλακρία; Πώς θα το καταλάβω;

Μήπως έχω µεγαλακρία; Πώς θα το καταλάβω; Μήπως έχω µεγαλακρία; Πώς θα το καταλάβω; MegalakriaBroshure.indd 1 17/11/2010 1:27:39 μμ Η Πανελλήνια Ένωση Σπανίων Παθήσεων (Π.Ε.Σ.ΠΑ) είναι ο μόνος φορέας, μη κερδοσκοπικό σωματείο, συλλόγων ασθενών

Διαβάστε περισσότερα

ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ

ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ ΠΛΗΡΟΦΟΡΙΕΣ ΓΙΑ ΑΣΘΕΝΕΙΣ Μετεµµηνοπαυσιακό Ορµονικό Προφίλ Εµµηνόπαυση καλείται η παύση της εµµήνου ρύσης µιας γυναίκας και σηµατοδότηση το τέλος της δυνατότητας τεκνοποίησης µε φυσιολογικό τρόπο. Αποτελεί

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

12. ΑΝΑΠΑΡΑΓΩΓΗ - ΑΝΑΠΤΥΞΗ

12. ΑΝΑΠΑΡΑΓΩΓΗ - ΑΝΑΠΤΥΞΗ 12. ΑΝΑΠΑΡΑΓΩΓΗ - ΑΝΑΠΤΥΞΗ Η αναπαραγωγή είναι μία χαρακτηριστική λειτουργία, η μόνη που δεν είναι απαραίτητη για την επιβίωση του ίδιου του οργανισμού αλλά για τη διαιώνιση του είδους. Η αναπαραγωγή στον

Διαβάστε περισσότερα