Κυτταρολογική αξιολόγηση καρκινωµάτων πνεύµονα

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Κυτταρολογική αξιολόγηση καρκινωµάτων πνεύµονα"


1 Κυτταρολογική αξιολόγηση καρκινωµάτων πνεύµονα Αικατερίνη Ν. Πολίτη Επίκ. Καθηγήτρια Κυτταρολογίας Αρεταίειο Νοσοκοµείο Ιστορική αναδροµή 1845 Donne: ταυτοποίηση αποφολιδοµένων βρογχικών κυττάρων σε πτύελα 1846 Walshe και 1887 Hampeln:περιγραφή πνευµονικών καρκινικών κυττάρων 1950: µεγάλος αριθµός µελετών µε αναφορές στη δυνατότητα ανίχνευσης και τυποποίησης καρκινωµάτων πνεύµονα 1960: εισαγωγή της διαθωρακικής βιοψίας µε λεπτή βελόνη υπό ακτινοσκοπική καθοδήγηση Αρχές δεκαετίας 80: εισαγωγή της διαβρογχικής βιοψίας µε λεπτή βελόνη µέσω του εύκαµπτου ινοοπτικού βρογχοσκοπίου. 1

2 Η συµβολή της κυτταρολογίας ιάγνωση Σταδιοποίηση Θεραπεία ΚΥΤΤΑΡΟΛΟΓΙΚΗ ΠΡΟΣΕΓΓΙΣΗ Πλεονεκτήµατα : ειδικότητα, ευαισθησία, ταχύτητα, χαµηλό κόστος, ελάχιστα επεµβατική ιπλός ρόλος 1. διάγνωση κακοήθειας 2. καθορισµός ιστολογικού τύπου Ιδιαίτερης σηµασίας ο διαχωρισµός των 2 βασικών ιστολογικών τύπων, καθότι επηρεάζεται η επιλογή θεραπείας Α) Μικροκυτταρικό καρκίνωµα Β) Μη-µικροκυτταρικό καρκίνωµα 2

3 ΙΑΓΝΩΣΤΙΚΗ ΠΡΟΣΕΓΓΙΣΗ Μέθοδοι αποφολιδωτικής κυτταρολογίας = 1. Πτύελα 2. Βρογχικό έκπλυµα 3. Brushing 4. BAL FNA (διαδερµική, διαβρογχική, EUS, EBUS) Cell block Κυτταρολογική εξέταση πλευριτικού, περικαρδιακού υγρού Πτύελα: Αποτελούνται από βλέννη, κυτταρικά και µη κυτταρικά στοιχεία. Συλλογή το πρωί (επί τρεις συνεχείς µέρες). Χρώση Παπανικολάου. Μονιµοποιούνται σε αλκοόλη 50%.Τα πλέον διαγνωστικά πτύελα είναι µετά από βρογχοσκόπηση. Ευαισθησία: 27-41% 1 δείγµα 57-89% 3 δείγµατα έως 96,1% 5 δείγµατα 3

4 4

5 Κυτταρολογία πτυέλων (πλεονεκτήµατα) Εύκολη λήψη αν πρόκειται για αυθόρµητη απόχρεµψη ειγµατισµός πολύ µεγάλης περιοχής Καλά για κεντρικούς όγκους Αξιόπιστη διάγνωση ειδικά των πλακωδών και µικροκυτταρικών καρκινωµάτων (ευαισθησία 70-85%) Η καλύτερη µέθοδος µαζικού ελέγχου 5

6 Κυτταρολογία τυέλων (µειονεκτήµατα) ύσκολη λήψη αν δεν υπάρχει αυθόρµητη απόχρεµψη εν µπορεί να γίνει εντόπιση της αλλοίωσης Χαµηλή ευαισθησία σε περιφερικούς όγκους (50-60%) Οι καλοήθεις όγκοι διαγιγνώσκονται δύσκολα Λιγότερο ακριβής για το αδενοκαρκίνωµα, τους µεταστατικούς όγκους και το λέµφωµα Βρογχοσκόπηση: Εξέλιξη από άκαµπτο σε εύκαµπτο και από εύκαµπτο σε ινοοπτικό βρογχοσκόπιο. Βρογχικές αναρροφήσεις πλύσεις: Στο κατώτερο αναπνευστικό, µε βρογχοσκόπιο ενσταλάξεις 3-5 ml φυσιολογικού ορού και επαναρροφήσεις. Ευαισθησία 61-76% Υλικό ψήκτρας: Με εύκαµπτο ινοοπτικό βρογχοσκόπιο σε πολύ µικρότερους βρόγχους. Ευαισθησία 70-77% 6

7 Κυτταρολογία βρογχικών εκ λυµάτων ( λεονεκτήµατα) Εντόπιση αλλοιώσεων, διάγνωση διαχύτων νόσων και διασποράς Αξιόπιστη διάγνωση κακοηθών όγκων Καλά και για κεντρικές και για περιφερικές αλλοιώσεις Μπορεί να γίνει διάγνωση µικρότερων όγκων Κυτταρολογία βρογχικών εκ λυµάτων (µειονεκτήµατα) υσάρεστη εξέταση για τον ασθενή, χρονοβόρα, µε µικρή θνητότητα εν µπορεί να χρησιµοποιηθεί σαν εξέταση µαζικού ελέγχου Οι καλοήθεις όγκοι σπάνια διαγιγνώσκονται, όπως και οι πολύ περιφερικοί όγκοι 7

8 Εργαλεία διάγνωσης και σταδιοποίησης ιαβρογχική βιοψία µε λεπτή βελόνη (ΤΒΝΑ) ιατοιχωµατική FNA υπό CT (TTNA) ιαβροχική FNA υπό υπερηχογραφική καθοδήγηση (ΕBUS-FNA) FNA υπό διοισοφάγειο υπέρηχο (EUS-FNA) ιαθωρακική FNA υπό CT(ΤΤΝΑ) Περιφερικές αλλοιώσεις Μη επεµβατική µέθοδος εν είναι κατάλληλη για όλες τις αλλοιώσεις (κεντρικές βλάβες και βλάβες κοντά στο διάφραγµα) Επιπλοκές 1. Πνευµοθώρακας 2. Αιµόπτυση και αιµορραγία 3. 4% απαιτούν chest tube insertion Lawrence Shulman et al. Curr Opin Pulm Med 2007;13:

9 ΤΤFNA Ενδείξεις Υποψία καρκίνου πνεύµονα ο οποίος είναι ανεγχείρητος Μεµονωµένος πνευµονικός όγκος και γνωστή κακοήθεια εκτός πνεύµονος Ασθενής που αρνείται διερευνητική θωρακοτοµή σε υποψία καρκίνου πνεύµονος Πολλαπλές πνευµονικές µάζες Μία αδιάγνωστη πνευµονική µάζα Ασθενής που δεν ανταποκρίθηκε στην ενδεδειγµένη αντιφυµατική θεραπεία Υποψία φλεγµονώδους διαδικασίας ιδίως σε ανοσοκατασταλµένους ασθενείς Ασθενής µε υποψία καρκίνου πνεύµονος στον οποίο 5 συνεχή πρωινά από βαθύ βήχα δείγµατα πτυέλων και µία βρογχική έκπλυση και υλικό ψήκτρας ήταν αρνητικά για κακοήθεια. TTFNA Αντενδείξεις Ασθενείς εξασθενηµένοι, µη συνεργάσιµοι, ή µε ανεξέλεγκτο βήχα Ασθενείς µε αιµορραγική διάθεση, που είναι υπό αντιπηκτική αγωγή ή υπάρχει υποψία αγγειακής αλλοίωσης ή πνευµονικής υπέρτασης Ασθενείς µε πιθανή εχινόκοκκο κύστη 9

10 ιαθωρακική FNA υπό CT(ΤΤΝΑ) Περιφερικές αλλοιώσεις Μια µετα-ανάλυση 61 µελετών που εστιάζουν στη χρήση της TTNA για τη διάγνωση περιφερικών καρκινωµάτων του πνεύµονα Μεταξύ 11,279 ασθενών συνολική ευαισθησία 90%, συνολική ειδικότητα 97% αλλοιώσεις >2cm 95% αλλοιώσεις <2cm 91% Rivera MP,Mehta AC. Lung Cancer Guidelines. Chest 2007;132S:

11 ιαθωρακική FNA υπό CT(ΤΤΝΑ) Ποσοστό ψευδώς θετικών < % (υψηλή ειδικότητα και θετική προγνωστική αξία) Ποσοστό ψευδώς αρνητικών µεταξύ 3%-30%* εν έχει θέση σε ασθενή µε περιφερική αλλοίωση και µέτριο έως υψηλό βαθµό υποψίας καρκίνου, ο οποίος φαίνεται να έχει νόσο πρώιµου σταδίου και είναι υποψήφιος για χειρουργείο. * David Ost et al. N ENGL J MED 2003;348: Μόνο τα σαφή στοιχεία ειδικής καλοήθους διάγνωσης µπορούν να αποκλείσουν την κακοήθεια. Οισοφάγος: ένα παράθυρο στο µεσοθωράκιο 11

12 Endoscopic Ultrasound Needle Aspiration (EUS-NA) Ασφαλής, µη επεµβατική, απαιτεί πεπειραµένο ενδοσκόπο. ειγµατισµός λεµφαδένων µεσοθωρακίου κατώτερου πνευµονικού συνδέσµου,οισοφαγικών, υποτροπιδικών και αορτοπνευµονικού παραθύρου Συνολική ευαισθησία 84%, ειδικότητα 99.5% Ποσοστό ψευδώς θετικών 0.4%, ψευδώς αρνητικών 19% Εκτίµηση της παρουσίας άµεσης διήθησης του µεσοθωρακίου. Ευαισθησία 88% και ειδικότητα 98% Ποσοστό ψευδώς θετικών 30%, ψευδώς αρνητικών 1% ιάγνωση µεταστατικών εστιών σε υποδιαφραγµατικές θέσεις Αριστερό επινεφρίδιο, λεµφαδένες κοιλιάς, ήπαρ Detterbeck et al. Lung Cancer Guidelines. Chest

13 EUS FNA: λεονεκτήµατα και εριορισµοί Πιο ευαίσθητη από CT, PET και TB FNA Πιο ευαίσθητη για την αξιολόγηση των λεµφαδένων του οπίσθιου µεσοθωρακίου Σπάνιες επιπλοκές Λιγότερο επεµβατική από τη µεσοθωρακοσκόπηση και την θωρακοσκόπηση Χαµηλότερου κόστους από τη µεσοθωρακοσκόπηση Περιορισµένη χρησιµότητα στην αξιολόγηση της άµεσης διασποράς στο µεσοθωράκιο και των λεµφαδένων του πρόσθιου µεσοθωρακίου EUS FNA: α όδοση συγκριτικά µε CT και PET 13

14 EBUS-FNA EBUS για τον έλεγχο των λεµφαδένων του µεσοθωρακίου Ελέγχει τους άνω µεσοθωρακικούς, ανώτερους και κατώτερους παρατραχειακούς, υποτροπιδικούς και τους λεµφαδένες της πύλης Μετα-ανάλυση 25 δηµοσιεύσεων όπου χρησιµοποιήθηκε EBUS-NA για τη σταδιοποίηση του µεσοθωρακίου (10/25 δεδοµένα κατάλληλα για ανάλυση) Adams K, et al. Thorax 2009; 64: συνολική ευαισθησία 88% συνολική ειδικότητα 100% 14

15 EBUS EUS 15

16 Ενδείξεις EUS-FNA Υποψία ΚΠ, ευµεγέθεις (> 1 cm) λεµφαδένες µεσοθωρακίου# Υποψία ΚΠ, πρωτοπαθής όγκος που γειτνιάζει µε τον οισοφάγο Σταδιοποίηση του µεσοθωρακίου σε ΜΜΚΠ# FDG-PET µεσοθωρακίου θετικό σε (υποψία) ΚΠ# Επανασταδιοποίηση του µεσοθωρακίου µετά την αρχική ΧΜΘ Αποτίµηση της διήθησης του όγκου (T4) σε όγκους κεντρικής εντόπισης Υποψία µεταστατικής νόσου στο µεσοθωράκιο από εξωθωρακικούς όγκους # ενδείξεις και για EBUS-TBNA Μεταστατικό ΠΚ σε αρατραχειακό λεµφαδένα (υλικό EBUS-FNA) 16

17 Παρακέντηση για λήψη λευριτικού υγρού Συµµετοχή του υπεζωκότα παρατηρείται στο 8-15% των ασθενών µε καρκίνο πνεύµονα Θα πρέπει να γίνεται παρακέντηση Η κυτταρολογική εξέταση του πλευριτικού υγρού είναι πιο ευαίσθητη από τη διαδερµική βιοψία του υπεζωκότα (οι µεταστάσεις στον σπλαχνικό υπεζωκότα είναι πιο συχνές) Κυτταρολογία λευριτικού υγρού Η διαγνωστική αξία της κυτταρολογικής εξέτασης κυµαίνεται µεταξύ 62-90% Αυξάνεται µε δεύτερη παρακέντηση (27%) (Mod-Pathol 1994;7:665-8) Η αυξηµένη ποσότητα πλευριτικού υγρού δεν αυξάνει την ευαισθησία 17

18 Α ΕΝΟΚΑΡΚΙΝΩΜΑ χαµηλής διαφοροποίησης πλευριτικό υγρό TTF-1 (+) Κυτταρολογία Φυσιολογικού Αναπνευστικού Συστήµατος Α. Επιθηλιακά κύτταρα --Πλακώδη ( από τη στοµατική κοιλότητα και το φάρυγγα). --Κυλινδρικά ( από το τραχειοβρογχικό δέντρο και, ενίοτε, από το ανώτερο αναπνευστικό ). --Κύτταρα βρογχιολίων. --Κυψελιδικά πνευµονοκύτταρα. Κύτταρα που συλλέγονται µετά από απόχρεµψη ή αναρρόφηση, έχουν εκφυλιστικές αλλοιώσεις. Κύτταρα νωπά µετά από αναρρόφηση µε λεπτή βελόνη δεν παρουσιάζουν εκφυλιστικές αλλοιώσεις. 18

19 19

20 20

21 Β. Μη επιθηλιακά κύτταρα Μακροφάγα ( ή ιστιοκύτταρα ) Η παρουσία τους τεκµηριώνει ότι τα δείγµατα προέρχονται από βαθύτερο σηµείο, τις κυψελίδες. Στρογγυλά ή ωοειδή, µεγέθους µm ή µεγαλύτερα. Κυτταρόπλασµα ηωσινόφιλο ή κυανόφιλο ή αµφίφιλο, µε κοκκία ή µικρά κενοτόπια. Μπορεί να έχουν δύο, τρεις ή και πολλαπλούς πυρήνες, όταν είναι γιγαντοκύτταρα (βρίσκονται σε χρόνιες παθήσεις, φλεγµονώδεις νόσους ή και σε άτοµα χωρίς κλινική νόσο). Επιβιώνουν περίπου 7 ηµέρες στις κυψελίδες, εξέρχονται µέσω του φάρυγγα και είτε καταπίνονται είτε αποχρέµπτονται. Λευκοκύτταρα Πλασµατοκύτταρα: φλεγµονώδης εξεργασία στοµατικής κοιλότητας. Πολυµορφοπύρηνα: σε καπνιστές, πνευµονία. Ηωσινόφιλα ή κρύσταλλοι Charcot - Leyden: αλλεργική αντίδραση. Λεµφοκύτταρα: φυσιολογικά το 10% των βρογχοκυψελιδικών κυττάρων. Βλέννη και άλλα µη κυτταρικά στοιχεία. Σε δείγµατα του κατώτερου αναπνευστικού µπορεί να υπάρχουν και διάφοροι µη ζώντες οργανισµοί και ουσίες 21

22 22

23 Κριτήρια κακοήθειας Κυτταρικά χαρακτηριστικά Αρχιτεκτονική διάταξη Παρουσία µεµονωµένων κυττάρων ή κυτταρικών αθροίσεων «ξένων» στο αντίστοιχο περιβάλλον Κυτταρικά χαρακτηριστικά Πυρήνας 1. Μεγάλο µέγεθος (προσοχή σε µη νεοπλασµατικές καταστάσεις µε αυξηµένη δραστηριότητα π.χ αναγέννηση, επανόρθωση, ΧΜΘ, ακτινοθεραπεία) 2. Αλλοιώσεις της χρωµατίνης (αδρή κοκκίωση, διαυγάσεις, συσσώρευση στην περιφέρεια) 3. Έντονη υπερχρωµασία 4. Πυρήνια (ποικιλία στον αριθµό, το µέγεθος και το σχήµα) 5. Μιτώσεις (άτυπες) 6. Πολυπυρήνωση (µε πολύµορφους πυρήνες) 23

24 Κυτταρικά χαρακτηριστικά Σχέση πυρήνα/κυτταροπλάσµατος (η µεγάλη πυρηνοπλασµατική αναλογία, ιδιαίτερα σε µεγάλα κύτταρα αποτελεί ισχυρό στοιχείο κακοήθειας) ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ Πιο κοινός τύπος καρκίνου στις δυτικές κοινωνίες >, Στενή συσχέτιση µε το κάπνισµα (έτη καπνίσµατος, ηλικία έναρξης, αριθµός τσιγάρων / ηµέρα) Κεντρική εντόπιση, ανάπτυξη από το βρογχικό επιθήλιο, > στους άνω λοβούς Κλινική εικόνα : επίµονος βήχας ± αιµόπτυση Κυτταρολογική διάγνωση : πτύελα + brushing Ιστολογικοί υποτύποι 1. Θηλώδες, 2. ιαυγοκυτταρικό, 3. Μικροκυτταρικό, 4. Βασικοειδές Βαθµός διαφοροποίησης µε ανεξάρτητη προγνωστική αξία 24

25 ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ Κυτταρολογικά διαγνωστικά χαρακτηριστικά (καλά διαφοροποιηµένοι όγκοι) 1. Άφθονα κυρίως µεµονωµένα ή σε οµάδες µε χαλαρή συνοχή πλειόµορφα κύτταρα (πολυγωνικά, στρογγυλά ή επιµήκη) 2. Πλειόµορφοι, υπερχρωµατικοί και συχνά πυκνωτικοί πυρήνες, µε ανώµαλα πυρηνικά όρια 3. Το πυρήνιο και το δίκτυο της χρωµατίνης δεν εµφανίζονται µε ευκρίνεια 4. Πυκνό κερατινοποιούµενο κυτταρόπλασµα (πορτοκαλόχρουν στην χρώση Παπανικολάου «κύτταρα κολοκύθα» 5. Κύτταρα «tadpole» ή γυρινοειδή κύτταρα ( µε παράξενο, επίµηκες, ατρακτοειδές σχήµα ) 6. Συχνά απύρηνα κύτταρα «ghost cells» 7. Συστρεφόµενα νηµάτια κερατίνης (Herxheimer spirals) ή πέρλες κερατίνης 8. Υπόστρωµα µε νέκρωση, φλεγµονή, κοκκώδη συγκρίµµατα Μεσοκυττάριες γέφυρες µπορεί να παρατηρηθούν σε υλικό από FNA και brushing ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ Κυτταρολογικά διαγνωστικά χαρακτηριστικά (µέτριας / χαµηλής διαφοροποίησης όγκοι) 1. αριθµoύ µεµονωµένων κακοηθών κυττάρων 2. > µεγέθους υπερχρωµατικός πυρήνας µε διακριτό πυρήνιο 3. Τραχύ και κοκκώδες δίκτυο χρωµατίνης 4. Κυανόφιλο κυτταρόπλασµα (µε χρώση Παπανικολάου) 5. Συχνά διατάσσονται σε πυκνές οµάδες ( εικόνα brushing) 6. Κερατινοποίηση παρατηρείται σπάνια (εστιακή) ή καθόλου Στους όγκους χαµηλής διαφοροποίησης η οριστική διάγνωση του πλακώδους καρκινώµατος µπορεί µερικές φορές να είναι πολύ δύσκολη συνιστάται η διάγνωση θετικό για κακοήθεια / εικόνα µη µικροκυτταρικού καρκινώµατος 25

26 ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ ΑΝΟΣΟΚΥΤΤΑΡΟΧΗΜΕΙΑ HMWK (34BE12) CK 5/6 (+) P63 CEA TTF-1 CK 7, 20 (-) CD56, συναπτοφυσίνη, χρωµογρανίνη / Επιθηλιακές αλλοιώσεις από ΧΜΘ, ΑΚΘ Ιογενείς λοιµώξεις Αναγέννηση / αποκατάσταση Άτυπη πλακώδης µετάπλαση Πλακώδη καρκινώµατα από το ανώτερο αναπνευστικό ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ 26



29 ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ Herxheimer spiral ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ ghost cells πολυπύρηνο κακόηθες κύτταρο 29

30 ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ "cell in cell" πέρλες κερατίνης ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ Περιφερική κερατινοποίηση / brushing 1000x 30

31 ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ brushing 400x ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ FNA cell block H&E 31

32 ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ χαµηλής διαφοροποίησης / πτύελα ΠΛΑΚΩ ΕΣ ΚΑΡΚΙΝΩΜΑ χαµηλής διαφοροποίησης / brushing 32

33 ΠΡΟ ΙΗΘΗΤΙΚΕΣ ΑΛΛΟΙΩΣΕΙΣ Υπάρχουν πρόδροµες αλλοιώσεις του βρογχικού και αναπνευστικού επιθηλίου, οι οποίες προηγούνται του καρκινώµατος και παρουσιάζουν σταδιακά µια εξελικτική πορεία προς διηθητικό καρκίνο. Η πιθανότητα εµφάνισης καρκίνου σχετίζεται µε το βαθµό της κυτταρικής ατυπίας, ο οποίος καθορίζεται µε βάση την πυρηνική εικόνα και το δείκτη N/C 1. Βασική υπερπλασία πλακώδης µετάπλαση άτυπη πλακώδης µετάπλαση 3-4 χρόνια δυσπλασία (ήπια, µέτρια, σοβαρή) in situ πλακώδες καρκίνωµα 6-24 µήνες! Αλλοίωση που αποφολιδώνει καρκινικά κύτταρα και είναι ακτινολογικά εµφανής = ΙΗΘΗΤΙΚΗ ΠΡΟ ΙΗΘΗΤΙΚΕΣ ΑΛΛΟΙΩΣΕΙΣ υπερπλασία πνευµονοκυττάρων άτυπη αδενωµατώδης υπερπλασία αδενοκαρκίνωµα διάχυτη ιδιοπαθής πνευµονική νευροενδοκρινική υπερπλασία καρκινοειδείς όγκοι ΑΑΥ = άτυπα κροσσωτά κυλινδρικά κύτταρα µε µεγάλους υπερχρωµατικούς πυρήνες, ενίοτε µε εµφανές πυρήνιο και αδρό δίκτυο χρωµατίνης 33

34 Άτυπη αδενωµατώδης υπερπλασία ιάχυτη ιδιοπαθής πνευµονική νευροενδοκρινική υπερπλασία 34

35 ΠΡΟ ΙΗΘΗΤΙΚΕΣ ΑΛΛΟΙΩΣΕΙΣ Πλακώδης µετάπλαση Άτυπη πλακώδης µετάπλαση ΑΤΥΠΗ ΠΛΑΚΩ ΗΣ ΜΕΤΑΠΛΑΣΗ Προκαρκινωµατώδης αλλοίωση Παρουσία άτυπων πλακωδώς µεταπλασθέντων κυττάρων πρέπει να αναφέρεται παρακολούθηση του ασθενούς 35

36 ΠΡΟ ΙΗΘΗΤΙΚΕΣ ΑΛΛΟΙΩΣΕΙΣ υσπλαστικές αλλοιώσεις In situ πλακώδες καρκίνωµα Παρουσία κυρίως µεµονωµένων καλά διαφοροποιηµένων πλακωδών κυττάρων µε ανώµαλους υπερχρωµατικούς πυρήνες, Ν/C, ηωσινόφιλο κυτταρόπλασµα Πλακώδες καρκίνωµα in situ 36

37 ΑΝΑΓΕΝΝΗΣΗ ΚΑΙ ΑΠΟΚΑΤΑΣΤΑΣΗ 1. Επίπεδες οµάδες κυττάρων µε καλή συνοχή 2. υσδιάκριτα κυτταρικά όρια 3. Μεγάλοι στρογγυλοί πυρήνες µε οµαλή πυρηνική µεµβράνη 4. Χρωµατίνη µε οµοιόµορφη κατανοµή 5. ιακριτά πυρήνια, οµοιόµορφα σε σχήµα και µέγεθος 6. Παρουσία πολυπύρηνων, µιτώσεων, καρυόρρηξης ΜΕΤΑΚΤΙΝΙΚΕΣ ΑΛΛΟΙΩΣΕΙΣ ΑΚΘ µπορεί να προκαλέσει εικόνες σοβαρής ατυπίας Κύριο χαρακτηριστικό = κυτταροµεγαλία Αλλοιώσεις πλακωδών κυττάρων 1. µεγέθους κυττάρου και αντίστοιχη µεγέθους πυρήνα, 2. Πολυπυρήνωση, 3. Πυρήνες υπερ- ή υποχρωµατικοί, ενίοτε µε κενοτόπια, πτυχές, λεπτοκοκκώδη όψη χρωµατίνης, 4. ιακριτά πυρήνια, 5. Πυκνό, συχνά κενοτοπιώδες κυτταρόπλασµα, 6. Άτυπη πλακώδη µετάπλαση. Αλλοιώσεις κροσσωτών κυλινδρικών κυττάρων 1. Έντονη µεγέθους όλων των κυτταρικών δοµών, 2. Πολυπυρήνωση, 3. Αντιδραστικού τύπου αλλοιώσεις, 4. Μερικές φορές παρουσία οµάδων άτυπων κυττάρων bizarre giant cells - χωρίς καλή οργάνωση, µε µεγάλους σκουρόχρωµους πυρήνες και διακριτά πυρήνια εντός ρυπαρού υποστρώµατος (νεκρωτικό υλικό, λευκοκύτταρα, κυτταρικά συγκρίµµατα). 37

38 ΜΕΤΑΚΤΙΝΙΚΕΣ ΑΛΛΟΙΩΣΕΙΣ Αλλοιώσεις πλακωδών κυττάρων Αλλοιώσεις κροσσωτών κυλινδρικών ΜΕΤΑΚΤΙΝΙΚΕΣ ΑΛΛΟΙΩΣΕΙΣ Μετακτινικές αλλοιώσεις σε πτύελα µπορεί να παρατηρηθούν έως και µήνες µετά το πέρας της θεραπείας! δ/δ υπολειµµατικό πλακώδες καρκίνωµα ΚΑΝΟΝΑΣ ιάγνωση καρκίνου µόνο όταν καρκινικά κύτταρα χωρίς αλλοιώσεις από την θεραπεία εντοπίζονται τουλάχιστον 6 εβδοµάδες µετά το πέρας της θεραπείας 38

39 Α ΕΝΟΚΑΡΚΙΝΩΜΑ Σε πολλές χώρες ο πλέον συνήθης ιστολογικός τύπος Η συχνότητα εµφάνισης αυξάνεται, ιδιαίτερα στις γυναίκες, σε µη-καπνιστές και σε πρώην καπνιστές Κυρίως περιφερική, αλλά και κεντρική εντόπιση, ανάπτυξη από το αναπνευστικό επιθήλιο (τελικά βρογχιόλια), συχνά σε έδαφος ίνωσης (ουλή ή διάχυτη διάµεση ίνωση) Κλινική εικόνα : ασυµπτωµατική ή θωρακικό άλγος, δύσπνοια ± αιµόπτυση Κυτταρολογική διάγνωση : FNA, BAL Ιστολογικοί υποτύποι 1. Μικτό, 2. Θηλώδες, 3. Συµπαγές µε παραγωγή βλέννης, 4. Κυψελιδικό, 5. Βρογχιολοκυψελιδικό (BAC) Α ΕΝΟΚΑΡΚΙΝΩΜΑ Κυτταρολογικά διαγνωστικά χαρακτηριστικά (πτύελα και βρογχικό έκπλυµα) 1. Αθροίσεις µεγάλων, στρογγυλών ή πολυγωνικών κυττάρων 2. 3D θηλώδης ή σφαιρική διαµόρφωση των οµάδων 3. Μεγάλος, έκκεντρος, πλειόµορφος πυρήνας 4. Πυρηνικά έγκλειστα από εγκόλπωση του κυτταροπλάσµατος στον πυρήνα 5. Μεγάλο πυρήνιο και λεπτοκοκκώδης χρωµατίνη 6. Άφθονο, κενοτοπιώδες, βασεόφιλο κυτταρόπλασµα 7. ιήθηση των καρκινικών κυττάρων από λευκοκύτταρα 39

40 Α ΕΝΟΚΑΡΚΙΝΩΜΑ Κυτταρολογικά διαγνωστικά χαρακτηριστικά (FNA, ψήκτρα) 1. Θηλώδεις ή επίπεδες οµάδες από αρκετά στρογγυλά, πολυγωνικά ή και κυλινδρικά κύτταρα µε απουσία κροσσών 2. Απουσία αρχιτεκτονικού προτύπου "honey comb" 3. Στρογγυλευµένος, συχνά έκκεντρος πυρήνας και N/C 4. Προεξέχον πυρήνιο 5. Άφθονο κενοτοπιώδες κυτταρόπλασµα (παραγωγή βλέννης) 6. Καθαρό ή βλεννώδες υπόστρωµα ΒΡΟΓΧΙΟΛΟΚΥΨΕΛΙ ΙΚΟ Α ΕΝΟΚΑΡΚΙΝΩΜΑ Ανάπτυξη καρκινικών κυττάρων κατά µήκος προϋπαρχουσών κυψελιδικών δοµών, χωρίς στοιχεία διήθησης στρώµατος, αγγείων, υπεζωκότα Καλή πρόγνωση, ειδικά για µονήρεις µάζες Κυτταρολογική διάγνωση : BAL 2 υποτύποι Α) βλεννοεκκριτικό BAC (χαµηλού βαθµού κακοήθειας) Β) µη βλεννοεκκριτικό BAC (διαφοροποίηση πνευµονοκυττάρων τύπου ΙΙ ή κυττάρων Clara) 40

41 ΒΡΟΓΧΙΟΛΟΚΥΨΕΛΙ ΙΚΟ Α ΕΝΟΚΑΡΚΙΝΩΜΑ Κυτταρολογικά διαγνωστικά χαρακτηριστικά Α) βλεννοεκκριτικό BAC 1. Μικροτεµαχίδια µε κυµατιστά όρια ή µεµονωµένα κύτταρα µε βλεννώδη κενοτόπια στο κυτταρόπλασµα 2. Οµοιογενείς, στρογγυλοί πυρήνες µε έντονο πυρήνιο Β) µη βλεννοεκκριτικό BAC Καλά οριζόµενες θηλώδεις οµάδες από µικρά στρογγυλά ή κυβοειδή κύτταρα µε ελάχιστο κυτταρόπλασµα, µέτρια υπερχρωµατικό πυρήνα και 1-2 µικρά πυρήνια Α ΕΝΟΚΑΡΚΙΝΩΜΑ ΑΝΟΣΟΚΥΤΤΑΡΟΧΗΜΕΙΑ CK7 TTF-1 (+) EMA CEA Napsin A CK20, CK 5/6 (-) ΚΥΤΤΑΡΟΧΗΜΕΙΑ PAS, PAS D (+) / Αντιδραστικού τύπου αλλοιώσεις ΑΑΥ Σωµάτια Creola Κοκκιωµατώδεις φλεγµονές Ατυπία κυψελιδικών ΜΦ Αµάρτωµα Φλεγµονώδης ψευδοόγκος Μεταστατικά αδενοκαρκινώµατα Μεσοθηλιώµατα Βλεννoεκκριτικό BAC είναι TTF-1(-) και συχνά CK20 (+) 41



44 ιαφορική διάγνωση Αντιδραστικά πνευµονοκύτταρα τύπου ΙΙ (BAL, BE, FNA) σε αλλοιώσεις που προκαλούν τραυµατισµό στο επιθήλιο των κυψελίδων (οργανούµενη πνευµονία, έµφρακτα, ARDS, AIDS, χορήγηση οξυγόνου) ΑΝΤΙ ΡΑΣΤΙΚΑ ΠΝΕΥΜΟΝΟΚΥΤΤΑΡ Α ΤΥΠΟΥ ΙΙ Τα αντιδραστικά πνευµονοκύτταρα µπορεί να εµφανίσουν διάφορες εκφυλιστικού τύπου αλλοιώσεις των πυρήνων = µεγάλοι, υπερχρωµατικοί, ανώµαλοι αλλά οµοιόµορφοι και συχνά πολλαπλοί µε διακριτό πυρήνιο δ/δ αδενοκαρκίνωµα 44

45 Α ΕΝΟΚΑΡΚΙΝΩΜΑ δ/δ ατυπία πνευµονοκυττάρων τύπου ΙΙ ΥΠΕΡΠΛΑΣΙΑ ΚΑΛΥΚΟΕΙ ΩΝ ΚΥΤΤΑΡΩΝ Συχνά η πρώιµη αντίδραση σε ερεθισµό, χρόνια φλεγµονή, αλλεργία αριθµού και µικρή µεγέθους καλυκοειδών κυττάρων Μεµονωµένα ή σε οµάδες (brushing, ΕBUS-FNA) πάντα σε στενή σχέση µε τα κυλινδρικά κροσσωτά κύτταρα ιάταση του κυττάρου από 1 µεγάλο βλεννώδες κενοτόπιο και απώθηση του πυρήνα στη βάση δ/δ βλεννώδες καρκίνωµα, BAC 45


47 ΒΡΟΓΧΙΟΛΟΚΥΨΕΛΙ ΙΚΟ Α ΕΝΟΚΑΡΚΙΝΩΜΑ βλεννοεκκριτικό BAC ΥΠΕΡΠΛΑΣΙΑ ΒΡΟΓΧΙΚΩΝ ΚΥΤΤΑΡΩΝ (ΣΩΜΑΤΙΑ CREOLA) Σε χρόνιες φλεγµονές, άσθµα, ιογενείς πνευµονίες, ADRS 3D αποφολιδούµενα µικροτεµαχίδια µε θηλώδη διαµόρφωση Εξωτερικά = κροσσωτά ή/και καλυκοειδή κύτταρα Εσωτερικά = µικρά οµοιόµορφα βασικά ή ενδιάµεσα κύτταρα Μικροί οµοιόµορφοι πυρήνες µε µικρό πυρήνιο δ/δ αδενοκαρκίνωµα 47

48 Α ΕΝΟΚΑΡΚΙΝΩΜΑ nuclear holes δ/δ σωµάτια Creola ΒΡΟΓΧΙΟΛΟΚΥΨΕΛΙ ΙΚΟ Α ΕΝΟΚΑΡΚΙΝΩΜΑ BAL Μη βλεννοεκκριτικό BAC βλεννοεκκριτικό BAC 48

49 ΒΡΟΓΧΙΟΛΟΚΥΨΕΛΙ ΙΚΟ Α ΕΝΟΚΑΡΚΙΝΩΜΑ Μη βλεννοεκκριτικό BAC ΜΕΓΑΛΟΚΥΤΤΑΡΙΚΟ ΚΑΡΚΙΝΩΜΑ Πρόκειται για αδιαφοροποίητο καρκίνωµα, το οποίο δεν παρουσιάζει κυτταρολογικά χαρακτηριστικά πλακώδους ή αδενικής διαφοροποίησης Η διάγνωσή του γίνεται δια αποκλεισµού Αποτελεί 10% των καρκίνων του πνεύµονα, µε > συχνότητα εµφάνισης σε καπνιστές Συχνότερα περιφερικής εντόπισης Ιστολογικά = διάχυτη παρουσία επίπεδων, µικρών, στρογγυλών οµάδων από µεγάλα κύτταρα µε αφρώδη πυρήνα και προεξέχον πυρήνιο Ιστολογικοί υποτύποι 1. Γιγαντοκυτταρικό ( 2%), 2. Τύπου βασικών κυττάρων, 3. Λεµφοεπιθηλιοειδές, 4. ιαυγοκυτταρικό, 5. Με ραβδοειδή φαινότυπο, 6. Μεγαλοκυτταρικό νευροενδοκρινές καρκίνωµα ( 3%) 49

50 ΜΕΓΑΛΟΚΥΤΤΑΡΙΚΟ ΚΑΡΚΙΝΩΜΑ Κυτταρολογικά διαγνωστικά χαρακτηριστικά (πτύελα και brushing) 1. Πλειόµορφος πληθυσµός µεγάλων, αδιαφοροποίητων, µεµονωµένων κυττάρων 2. Οµάδες µε έλλειψη οργάνωσης και κυτταρικής συνοχής 3. Ποικίλου σχήµατος κυτταρόπλασµα, συχνά ασαφώς ορισµένο µε παρουσία µικρών, κόκκινων εγκλείστων 4. Υψηλή πυρηνοπλασµατική αναλογία 5. Ανώµαλος, µεγάλος, πλειόµορφος πυρήνας µε διαυγάσεις της χρωµατίνης και πολλαπλά διακριτά πυρήνια 6. Πολυπύρηνα γιγαντοκύτταρα 7. Συχνά παρουσία ενδοκυτταροπλασµατικών ουδετερόφιλων, µιτώσεων και νεκρωτικό υπόστρωµα ΜΕΓΑΛΟΚΥΤΤΑΡΙΚΟ ΚΑΡΚΙΝΩΜΑ Γιγαντοκυτταρικό καρκίνωµα µεµονωµένα, πολύ µεγάλα, συχνά πολυπύρηνα κύτταρα µε παράξενες πυρηνικές µορφές και πολύ µεγάλα πυρήνια / LCNEC Αλλοιώσεις από ΧΜΘ, ΑΚΘ Εκφυλισµένα µακροφάγα Μεγαλοκυτταρικό µη-hodgkin λέµφωµα Μελάνωµα Μεταστατικό καρκίνωµα Σάρκωµα 50

51 ΜΕΓΑΛΟΚΥΤΤΑΡΙΚΟ ΚΑΡΚΙΝΩΜΑ Αδιαφοροποίητο µεγαλοκυτταρικό καρκίνωµα Η&Ε ΜΕΓΑΛΟΚΥΤΤΑΡΙΚΟ ΚΑΡΚΙΝΩΜΑ νεκρωτικό µεγαλοκυτταρικό καρκίνωµα 51



54 ΜΕΓΑΛΟΚΥΤΤΑΡΙΚΟ ΚΑΡΚΙΝΩΜΑ πτύελα / νέκρωση ΜΕΓΑΛΟΚΥΤΤΑΡΙΚΟ ΚΑΡΚΙΝΩΜΑ γιγαντοκυτταρικό καρκίνωµα 54

55 ΜΕΓΑΛΟΚΥΤΤΑΡΙΚΟ ΚΑΡΚΙΝΩΜΑ γιγαντοκυτταρικό καρκίνωµα / υλικό ψήκτρας ΟΓΚΟΙ ΤΥΠΟΥ ΣΙΕΛΟΓΟΝΩΝ Α ΕΝΩΝ Συναντώνται σπάνια στους πνεύµονες και αναπτύσσονται από τους υποβλεννογόνιους αδένες της τραχείας και των βρόγχων Αναπτύσσονται ως πολυποειδείς µάζες, που καλύπτονται από το υπερκείµενο αναπνευστικό επιθήλιο κυτταρολογική πτυέλων αρνητική 2 κύριοι ιστολογικοί τύποι 1. Αδενοκυστικό καρκίνωµα, 2. Βλεννοεπιδερµοειδές καρκίνωµα Κυτταρολογική διάγνωση : brushing, FNA 55

56 19/5/2014 ΟΓΚΟΙ ΤΥΠΟΥ ΣΙΕΛΟΓΟΝΩΝ Α ΕΝΩΝ Αδενοκυστικό καρκίνωµα < 1%, 4η-5η δεκαετία Χωρίς σύνδεση µε κάπνισµα 90% τραχεία Μικρά, οµοιόµορφα επιθηλιακά κύτταρα σε κύλινδρους ή σφαίρες µε ήπια εµφάνιση, σκούρους στρογγυλούς πυρήνες και ελάχιστο κυτταρόπλασµα Αφορίζουν κυστικούς χώρους µε άµορφο υαλοειδές περιεχόµενο Βλεννοεπιδερµοειδές καρκίνωµα < 1%, < 30 έτη 90% κύριοι βρόγχοι Παρουσία µίγµατος πλακωδών, βλεννωδών, και διαµέσων κυττάρων Συχνά crush artifact Οι όγκοι υψηλού βαθµού κακοηθείας παρουσιάζουν αδιαφοροποίητα κύτταρα µε σηµαντική πυρηνική ατυπία Α ΕΝΟΚΥΣΤΙΚΟ ΚΑΡΚΙΝΩΜΑ 56



59 Πτύελα: τα καρκινικά κύτταρα εµφανίζονται µεµονωµένα ή σε οµάδες και γραµµοειδείς δοµές εντός βλέννης και νεκρωτικού υποστρώµατος. Βρογχικό έκπλυµα: περισσότερες οµάδες σε σχέση µε τα πτύελα,σχηµατίζονται στίχοι κυττάρων µε το χαρακτηριστικό «καλούπωµα» (molding των πυρήνων, εναγκαλισµός) FNA :ποικίλη αναλογία µεµονωµένων κυττάρων και ιστοτεµαχίων µε νεκρωτικό υπόστρωµα και αποπτωτικά σώµατα 59

60 Μικρά κύτταρα (από ελαφρώς µεγαλύτερα έως τριπλάσια του µεγέθους των ώριµων λεµφοκυττάρων) Molding των πυρήνων Νεκρωτικό υπόστρωµα Όχι εµφανές πυρήνιο Μιτώσεις Παραπυρηνικά µπλε σωµάτια-είναι το ελάχιστο κυτταρόπλασµα που απεικονίζεται ως στρογγυλή ανοιχτή µπλε οµοιογενής σφαίρα γύρω από τον πυρήνα CD 56 (δείκτης κυτταρικής µεµβράνης) Συναπτοφυσίνη (δείκτης σχετιζόµενος µε µικρά κυστίδια) Χρωµογρανίνη Α (δείκτης σχετιζόµενος µε εκκριτικά κοκκία) TTF-1 (ο θυρεοειδικός µεταγραφικός παράγων εκφράζεται σε ποσοστό 90%) CEA 60

61 61


63 Υπερπλασία των εφεδρικών κυττάρων (molding των πυρήνων, µικρότερο µέγεθος και µεγαλύτερη συνοχή) Λεµφοκυτταρική υπερπλασία (δεν σχηµατίζουν κυτταρικές οµάδες,κυρίως µεµονωµένα,µικρότερο µέγεθος) Τυπικό καρκινοειδές ή grade I NEC (απουσία molding πυρήνων, νέκρωσης στο υπόστρωµα και µιτωτικής δραστηριότητας) Άτυπο καρκινοειδές ή grade II NEC (µικρότερος ο αριθµός µιτώσεων) Άλλοι τύποι καρκινωµάτων όπως πλακώδες καρκίνωµα και αδενοκαρκίνωµα µε µικροκυτταρική εµφάνιση (όχι molding των πυρήνων,υφή χρωµατίνης,εµφανές πυρήνιο) ΥΠΕΡΠΛΑΣΙΑ ΒΑΣΙΚΩΝ (ΕΦΕ ΡΙΚΩΝ) ΚΥΤΤΑΡΩΝ Άωρα αρχέγονα πολυδύναµα κύτταρα Ελάχιστο κυανόφιλο κυτταρόπλασµα Μικροί οβάλ βαθυχρωµατικοί πυρήνες Αποφολιδώνονται σε χρόνιους ερεθισµούς Απουσία νέκρωσης, µιτώσεων, ρυπαρού υποστρώµατος και µεµονωµένων κυττάρων δ/δ µικροκυτταρικό καρκίνωµα 63




67 Καρκινοειδές (χρωµογρανίνη +) 67

68 68

69 69

70 Στρογγυλός πυρήνας,οµοιόµορφος µε κοκκιώδη χρωµατίνη Νέκρωση στο υπόστρωµα Το κυτταρόπλασµα είναι κενοτοπιώδες και ποικίλει από λίγο έως αρκετό LCNEC (χρωµογρανίνη +) 70

71 Η διαφορική διάγνωση γίνεται µε το LCUC (Large Cell Undifferentiated Carcinoma) Είναι αδιαφοροποίητο µη µικροκυτταρικό καρκίνωµα χωρίς τα χαρακτηριστικά πλακώδους ή αδενικής διαφοροποίησης και αντιπροσωπεύει το 9 % όλων των καρκίνων του πνεύµονα. ιαγνωστικές παγίδες 71

72 1. Κλινική εικόνα Α ουσία σαφούς µάζας ή ασθενής µε έντονη συµ τωµατολογία Γενικός κανόνας: οι ασθενείς µε ΚΠ συνήθως δεν παρουσιάζουν έντονα συµπτώµατα Γενικός κανόνας: είµαστε επιφυλακτικοί στη διάγνωση κακοήθειας, επί απουσίας σαφούς µάζας Το BAC µπορεί µερικές φορές να εκδηλωθεί σαν πύκνωση τύπου πνευµονίας και συχνά θεραπεύεται αρχικά σαν πνευµονία η οποία δεν λύεται 2. Κυτταροβρίθεια υλικού µικρή κυτταροβρίθεια Γενικός κανόνας: είµαστε επιφυλακτικοί στη διάγνωση κακοήθειας, σε ένα υποκυτταρικό υλικό, εκτός και αν υπάρχουν σαφέστατα στοιχεία κακοήθειας Καλοήθεις ή αντιδραστικές αλλοιώσεις µπορεί κάποιες φορές να είναι κυτταροβριθείς 72

73 3. Υπόστρωµα φλεγµονώδες/καθαρό Γενικός κανόνας: είµαστε επιφυλακτικοί στη διάγνωση κακοήθειας όταν το υπόστρωµα των επιχρισµάτων είναι καθαρό ή επισκιάζεται από φλεγµονώδη κύτταρα Αµφότερες, καλοήθεις και κακοήθεις αλλοιώσεις µπορεί να έχουν φλεγµονώδες υπόστρωµα 4. Αλληλοεπικαλυπτόµενα κυτταροµορφολογικά χαρακτηριστικά Γενικός κανόνας: είµαστε επιφυλακτικοί στη διάγνωση κακοήθειας, αν πρώτα δεν λάβουµε υπόψη και αποκλείσουµε οποιαδήποτε καλοήθη αλλοίωση θα µπορούσε να µιµηθεί καρκίνωµα Η εξοικείωση µε τις καλοήθεις αλλοιώσεις που µπαίνουν στη δδ είναι θεµελιώδης 73

74 δ ρωτο αθούς /µεταστατικού καρκινώµατος Κλινικές πληροφορίες και απεικονιστικά δεδοµένα Ειδικές χρώσεις εν είναι πάντα εφικτή Γυναίκα 78 ετών, µη καπνίστρια Αριστερά µαστεκτοµή για αδενοκαρκίνωµα µαστού το : νοµισµατοειδής αλλοίωση 1.5cm στον άνω λοβό του δεξιού πνεύµονα FNA report: καλά διαφοροποιηµένο αδενοκαρκίνωµα, πιθανόν µεταστατικό από το µαστό. ΧΜΘ Πολύ καλή φυσική κατάσταση χωρίς συµπτωµατολογία από το αναπνευστικό 2009: αλλοίωση 3.5cm στον άνω δεξιό λοβό FNA 74

75 75

76 76

77 77

78 78

79 79

80 Κυτταρολογική διάγνωση Θετικό για κακοήθεια Πρωτοπαθές αδενοκαρκίνωµα πνεύµονα µε βρογχιολοκυψελιδικό πρότυπο ανάπτυξης 80

81 81

82 82

83 83

84 Γυναίκα, 63 ετών, µη καπνίστρια Υστερεκτοµή λόγω αδενοκαρκινώµατος ενδοµητρίου καλής διαφοροποίησης (stage I) πριν 18 µήνες Πολύ καλή φυσική κατάσταση CT scan: 2 αλλοιώσεις, 1.8 cm και 0.7 cm στον µέσο και κάτω λοβό του δεξιού πνεύµονα, αντίστοιχα FNA της µεγαλύτερης αλλοίωσης 84

85 85

86 86

87 87

88 88

89 Κυτταρολογική διάγνωση Καλά διαφοροποιηµένο αδενοκαρκίνωµα πιθανόν µεταστατικό από το ενδοµήτριο (σύµφωνα µε το κλινικό ιστορικό) Σχόλιο: το βρογχιολοκυψελιδικό καρκίνωµα δεν µπορεί να αποκλεισθεί. 89

90 90

91 Ιστολογική διάγνωση Μη βλεννοεκκριτικό, πολυεστιακό βρογχιολοκυψελιδικό καρκίνωµα Συνήθεις µέθοδοι ανάλυσης του EGFR status GGCGGGCCAAACTGCTGGGTGCG EGFR mutation status by gene sequencing Έλεγχος του αριθµού των αντιγράφων του γονιδίου του EGFR (FISH ή CISH) Πρωτεϊνική έκφραση του EGFR µε ανοσοκυτταροχηµεία (IHC) 91

92 Κυτταρολογική προσέγγιση ΚΠ πλεονεκτήµατα Ταχύτητα, χαµηλό κόστος, ελάχιστα επεµβατική, ειδικότητα, ευαισθησία ιάγνωση κακοήθειας / σταδιοποίηση Ακριβής στη δδ ΜΚΠ/ΜΜΚΠ Ακριβής στη δδ ιστολογικών υποτύπων καλά διαφοροποιηµένων ΜΜΚΠ Ακριβής στη δδ µεταστατικού/πρωτοπαθούς ΚΠ σε συνδυασµό µε την ανοσοκυτταροχηµεία υνατότητα προσδιορισµού του µοριακού προφίλ του όγκου εξατοµίκευση θεραπείας Κυτταρολογική προσέγγιση ΚΠ Περιορισµοί δ άτυπου καρκινοειδούς/µικροκυτταρικού καρκινώµατος δ χαµηλής διαφοροποίησης ΜΜΚΠ (στις περιπτώσεις που το υλικό δεν επαρκεί για ειδικές χρώσεις ή τα αποτελέσµατά τους είναι ατελέσφορα) Σαφής διάγνωση βρογχιολοκυψελιδικού καρκινώµατος 92

93 ευχαριστώ 93


ΚΥΤΤΑΡΟΛΟΓΙΑ ΠΝΕΥΜΟΝΑ ΚΥΤΤΑΡΟΛΟΓΙΑ ΠΝΕΥΜΟΝΑ Nίκη Μάργαρη Ιατρός Κυτταρολόγος Επιστημονικός Συνεργάτης Εργαστηρίου Διαγνωστικής Κυτταρολογίας Π.Γ.Ν. «ΑΤΤΙΚΟΝ» Πέτρος Καρακίτσος Καθηγητής Κυτταρολογίας Εργαστήριο Διαγνωστικής

Διαβάστε περισσότερα


ΠΑΘΟΓΕΝΕΙΑ ΚΑΙ ΙΣΤΟΛΟΓΙΚΟΙ ΤΥΠΟΙ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΠΝΕΥΜΟΝΑ ΠΑΘΟΓΕΝΕΙΑ ΚΑΙ ΙΣΤΟΛΟΓΙΚΟΙ ΤΥΠΟΙ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΠΝΕΥΜΟΝΑ Χρ.Τσοµπανίδου Παθολογοανατόµος Συντονίστρια Διευθύντρια Νοσοκοµείο Θεσ/νίκης «Άγιος Δηµήτριος» προέρχονται από το φυσιολογικό επιθήλιο µε την

Διαβάστε περισσότερα

Iστοπαθολογία νευροενδοκρινικών όγκων πνεύμονος. Δ Ροντογιάννη

Iστοπαθολογία νευροενδοκρινικών όγκων πνεύμονος. Δ Ροντογιάννη Iστοπαθολογία νευροενδοκρινικών όγκων πνεύμονος Δ Ροντογιάννη Νευρώνες ΚΝΣ C Κύτταρα Θυρεοειδούς Κύτταρα παραθυρεοειδών αδένων Μεμονωμένα κύτταρα βρογχικού βλεννογόνου και βλεννογόνουγεσ ΔΙΑΧΥΤΟ ΝΕΥΡΟΕΝΔΟΚΡΙΝΙΚΟ

Διαβάστε περισσότερα

ΜΗ ΜΙΚΡΟΚΥΤΤΑΡΙΚΟΣ ΚΑΡΚΙΝΟΣ ΠΝΕΥΜΟΝΑ Ιστοπαθολογία- Μοριακή διαγνωστική. Δ Ροντογιάννη

ΜΗ ΜΙΚΡΟΚΥΤΤΑΡΙΚΟΣ ΚΑΡΚΙΝΟΣ ΠΝΕΥΜΟΝΑ Ιστοπαθολογία- Μοριακή διαγνωστική. Δ Ροντογιάννη ΜΗ ΜΙΚΡΟΚΥΤΤΑΡΙΚΟΣ ΚΑΡΚΙΝΟΣ ΠΝΕΥΜΟΝΑ Ιστοπαθολογία- Μοριακή διαγνωστική Δ Ροντογιάννη Die Cellularpathologie by Rudolf Virchow in 1858..Cells are the progeny of other cells and diseases are diseases of

Διαβάστε περισσότερα

Πανεπιστήμιο Θεσσαλίας Τμήμα Ιατρικής Εργαστήριο Ακτινολογίας Ιατρικής Απεικόνισης

Πανεπιστήμιο Θεσσαλίας Τμήμα Ιατρικής Εργαστήριο Ακτινολογίας Ιατρικής Απεικόνισης Πανεπιστήμιο Θεσσαλίας Τμήμα Ιατρικής Εργαστήριο Ακτινολογίας Ιατρικής Απεικόνισης Διδάσκοντες Ιωάννης Β. Φεζουλίδης Καθηγητής Μαριάννα Βλυχού Αναπλ. Καθηγήτρια Έφη Καψαλάκη Αναπλ. Καθηγήτρια Αικατερίνη

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΥΠΕΡΠΛΑΣΙΑ ΤΟΥ ΕΝΔΟΜΗΤΡΙΟΥ ΚΑΛΠΑΚΤΣΙΔΟΥ ΒΑΚΙΑΝΗ ΜΑΧΗ ΥΠΕΡΠΛΑΣΙΑ ΤΟΥ ΕΝΔΟΜΗΤΡΙΟΥ ΚΑΛΠΑΚΤΣΙΔΟΥ ΒΑΚΙΑΝΗ ΜΑΧΗ Ανωορρηκτικοί κύκλοι Εξωγενή οιστρογόνα Σύνδρομο πολυκυστικών ωοθηκών Παχυσαρκία Όγκοι ωοθηκών Εφηβία Παραγωγική ηλικία Κλιμακτήριο εμμηνόπαυση ΥΠΕΡΠΛΑΣΙΑ

Διαβάστε περισσότερα

Γιάννης Καλομενίδης Πνευμονολόγος. Β Πνευμονολογική Κλινική Ιατρική Σχολή Αθηνών Νοσοκομείο «Αττικόν»

Γιάννης Καλομενίδης Πνευμονολόγος. Β Πνευμονολογική Κλινική Ιατρική Σχολή Αθηνών Νοσοκομείο «Αττικόν» Μονήρης Πνευμονικός Όζος Γιάννης Καλομενίδης Πνευμονολόγος Β Πνευμονολογική Κλινική Ιατρική Σχολή Αθηνών Νοσοκομείο «Αττικόν» ΟΡΙΣΜΟΙ Όζος: σφαιρική ή ωοειδής σκίαση με σαφή όρια, 3 εκ, περιβαλλόμενη από

Διαβάστε περισσότερα

ΟΓΚΟΙ ΤΗΣ ΑΣΤΡΟΚΥΤΤΑΡΙΚΗΣ ΓΛΟΙΑΣ. Θωµάς Ζαραµπούκας. Αν. Καθ. Παθολογικής Ανατοµικής. Ιατρική Σχολή Α.Π.Θ.

ΟΓΚΟΙ ΤΗΣ ΑΣΤΡΟΚΥΤΤΑΡΙΚΗΣ ΓΛΟΙΑΣ. Θωµάς Ζαραµπούκας. Αν. Καθ. Παθολογικής Ανατοµικής. Ιατρική Σχολή Α.Π.Θ. ΟΓΚΟΙ ΤΗΣ ΑΣΤΡΟΚΥΤΤΑΡΙΚΗΣ ΓΛΟΙΑΣ Θωµάς Ζαραµπούκας Αν. Καθ. Παθολογικής Ανατοµικής Ιατρική Σχολή Α.Π.Θ. Όγκοι της Αστροκυτταρικής Γλοίας Πιλοκυτταρικό αστροκύτωµα Πιλοµυξοειδές αστροκύτωµα Πλειόµορφο ξανθοαστροκύτωµα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Όγκοι των Όρχεων. Α. Κιζιρίδου, Αναπ.. Διευθύντρια Παθολογοανατομικού Τμήματος A.Ν.Θ.Θεαγένειο

Όγκοι των Όρχεων. Α. Κιζιρίδου, Αναπ.. Διευθύντρια Παθολογοανατομικού Τμήματος A.Ν.Θ.Θεαγένειο Όγκοι των Όρχεων Α. Κιζιρίδου, Αναπ.. Διευθύντρια Παθολογοανατομικού Τμήματος A.Ν.Θ.Θεαγένειο ΙΣΤΟΛΟΓΙΚΗ ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΟΓΚΩΝ ΤΟΥ ΟΡΧΕΩΣ ΑΠΟ ΓΕΝΝΗΤΙΚΑ ΚΥΤΤΑΡΑ (WHO 2004) Όγκοι ενός ιστολογικού τύπου (αμιγείς

Διαβάστε περισσότερα

Επίδραση θεραπειών στον καλοήθη και κακοήθη προστατικό ιστό. Θ. Γεωργιάδης Επιμελητής A, ΔΘΚΑ ΥΓΕΙΑ

Επίδραση θεραπειών στον καλοήθη και κακοήθη προστατικό ιστό. Θ. Γεωργιάδης Επιμελητής A, ΔΘΚΑ ΥΓΕΙΑ Επίδραση θεραπειών στον καλοήθη και κακοήθη προστατικό ιστό Θ. Γεωργιάδης Επιμελητής A, ΔΘΚΑ ΥΓΕΙΑ Προεγχειρητικός ανδρογονικός αποκλεισμός LHRH αγωνιστές (μερικός ) ή και μη στεροειδές αντιανδρογόνο (πλήρης

Διαβάστε περισσότερα

Ακανθοκυτταρικό καρκίνωμα κατωτέρου γεννητικού συστήματος θήλεος. Μαρία Σωτηροπούλου Νοσοκομείο Αλεξάνδρα

Ακανθοκυτταρικό καρκίνωμα κατωτέρου γεννητικού συστήματος θήλεος. Μαρία Σωτηροπούλου Νοσοκομείο Αλεξάνδρα Ακανθοκυτταρικό καρκίνωμα κατωτέρου γεννητικού συστήματος θήλεος Μαρία Σωτηροπούλου Νοσοκομείο Αλεξάνδρα Ακανθοκυτταρικό καρκίνωμα αιδοίου Σπάνιο, 1,5 ανά 100 000 γυναίκες στις ΗΠΑ Τρειςομάδεςγυναικών:

Διαβάστε περισσότερα

Η ανίχνευση νεφρικών όγκων αυξάνει περίπου κατα 1% κατ' έτος. Η τυχαία ανεύρεση μικρών όγκων είναι σήμερα η πλειονότητα των νεφρικών όγκων.

Η ανίχνευση νεφρικών όγκων αυξάνει περίπου κατα 1% κατ' έτος. Η τυχαία ανεύρεση μικρών όγκων είναι σήμερα η πλειονότητα των νεφρικών όγκων. Ενδείξεις και περιορισμοί στη διαδερμική βιοψία των νεφρικών μαζών Αδαμόπουλος Βασίλειος Md.- FEBU Επιμ.Β' Γ.Ν.Καβάλας- Ουρολογική Κλινική Το Πρόβλημα... Η ανίχνευση νεφρικών όγκων αυξάνει περίπου κατα

Διαβάστε περισσότερα

VIN (Ενδοεπιθηλιακή νεοπλασία αιδοίου)

VIN (Ενδοεπιθηλιακή νεοπλασία αιδοίου) VIN (Ενδοεπιθηλιακή νεοπλασία αιδοίου) Διαφορές μεταξύ τραχήλου και αιδοίου Κύτταρο-στόχος: κυρίως πλακώδες δεν υπάρχει εκτεθειμένος πολυδύναμος πληθυσμός, όπως στον τράχηλο Σχετιζόμενοι HPV: κυριαρχούν

Διαβάστε περισσότερα

Μονήρης πνευμονικός όζος. Ζογλοπίτης Φ. Μονάδα Βρογχοσκοπήσεων Νοσοκομείο Παπανικολάου

Μονήρης πνευμονικός όζος. Ζογλοπίτης Φ. Μονάδα Βρογχοσκοπήσεων Νοσοκομείο Παπανικολάου Μονήρης πνευμονικός όζος Ζογλοπίτης Φ. Μονάδα Βρογχοσκοπήσεων Νοσοκομείο Παπανικολάου Το κλινικό πρόβλημα. 0,09-0,2% ΜΠΟ σε α/αήct, 3-6% κακοήθεις. Πρόσφατες, 7% των εθελοντών, 76%

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΧΑΤΖΟΠΟΥΛΟΥ))ΑΦΡΟΔΙΤΗ) ΕΙΔΙΚΟΣ)ΠΝΕΥΜΟΝΟΛΟΓΟΣ)) ΔΡΑΜΑ) ) Μάρτιος))2013) ΧΑΤΖΟΠΟΥΛΟΥ))ΑΦΡΟΔΙΤΗ) ΕΙΔΙΚΟΣ)ΠΝΕΥΜΟΝΟΛΟΓΟΣ)) ΔΡΑΜΑ) ) Μάρτιος))2013) ΜΟΝΗΡΗΣ'ΠΝΕΥΜΟΝΙΚΟΣ'ΟΖΟΣ'.' ΟΡΙΣΜΟΣ' Μονήρης(,(καλώς((αφοριζόμενη(,(σφαιρική( ακτινογραφική(σκίαση(διαμέτρου(( (3(cm( Περιβάλλεται(πλήρως(από(υγιή(πνευμονικό(ιστό(

Διαβάστε περισσότερα

ΙΦΝΕ (ΕΚ, ν.crohn, απροσδιόριστη) Συνήθεις λοιμώδεις, παρατεταμένες συστηματικές, αφροδισιακές-παρασιτικές, ιογενείς λοιμώξεις Φάρμακα και τοξίνες

ΙΦΝΕ (ΕΚ, ν.crohn, απροσδιόριστη) Συνήθεις λοιμώδεις, παρατεταμένες συστηματικές, αφροδισιακές-παρασιτικές, ιογενείς λοιμώξεις Φάρμακα και τοξίνες ΦΛΕΓΜΟΝΩΔΗ ΝΟΣΗΜΑΤΑ Π.Ε ΙΦΝΕ (ΕΚ, ν.crohn, απροσδιόριστη) Συνήθεις λοιμώδεις, παρατεταμένες συστηματικές, αφροδισιακές-παρασιτικές, ιογενείς λοιμώξεις Φάρμακα και τοξίνες (ΜΣΑΦ κ.ά) Ισχαιμική Μετακτινική

Διαβάστε περισσότερα

ΑΛΛΟΙΩΣΕΙΣ ΑΔΕΝΙΚΩΝ ΚΥΤΤΑΡΩΝ ΤΡΑΧΗΛΟΥ ΜΗΤΡΑΣ. Μαρία Παπαευθυμίου Διευθύντρια Κυτταρ/κού Τμήματος Νοσοκομείο "Αλεξάνδρα"

ΑΛΛΟΙΩΣΕΙΣ ΑΔΕΝΙΚΩΝ ΚΥΤΤΑΡΩΝ ΤΡΑΧΗΛΟΥ ΜΗΤΡΑΣ. Μαρία Παπαευθυμίου Διευθύντρια Κυτταρ/κού Τμήματος Νοσοκομείο Αλεξάνδρα ΑΛΛΟΙΩΣΕΙΣ ΑΔΕΝΙΚΩΝ ΚΥΤΤΑΡΩΝ ΤΡΑΧΗΛΟΥ ΜΗΤΡΑΣ Μαρία Παπαευθυμίου Διευθύντρια Κυτταρ/κού Τμήματος Νοσοκομείο "Αλεξάνδρα" ΤΑΞΙΝΟΜΗΣΗ ΑΔΕΝΙΚΩΝ ΑΛΛΟΙΩΣΕΩΝ ΤΡΑΧΗΛΟΥ ΜΗΤΡΑΣ (Σύστημα Bethesda 2001) 1) Άτυπα αδενικά

Διαβάστε περισσότερα


ΠΡΟΚΑΡΚΙΝΩΜΑΤΩΔΕΙΣ ΑΛΛΟΙΩΣΕΙΣ ΤΟΥ ΠΑΓΚΡΕΑΤΟΣ ΠΡΟΚΑΡΚΙΝΩΜΑΤΩΔΕΙΣ ΑΛΛΟΙΩΣΕΙΣ ΤΟΥ ΠΑΓΚΡΕΑΤΟΣ Ελένη Σπανίδου-Καρβούνη Καρβούνη, FRCPC Παθολογοανατόμος Αρεταίειο Νοσοκομείο Προκαρκινωματώδεις αλλοιώσεις του παγκρέατος Παγκρεατική Ενδοεπιθηλιακή Νεοπλασία

Διαβάστε περισσότερα

Nίκη Μάργαρη. Ιατρός Κυτταρολόγος Επιστημονικός Συνεργάτης Εργαστηρίου Διαγνωστικής Κυτταρολογίας Π.Γ.Ν. «ΑΤΤΙΚΟΝ»

Nίκη Μάργαρη. Ιατρός Κυτταρολόγος Επιστημονικός Συνεργάτης Εργαστηρίου Διαγνωστικής Κυτταρολογίας Π.Γ.Ν. «ΑΤΤΙΚΟΝ» Nίκη Μάργαρη Ιατρός Κυτταρολόγος Επιστημονικός Συνεργάτης Εργαστηρίου Διαγνωστικής Κυτταρολογίας Π.Γ.Ν. «ΑΤΤΙΚΟΝ» 2007 NCI Thyroid FNA State of the Science Conference guidelines Bethesda System for Reporting

Διαβάστε περισσότερα

Μονήρης πνευμονικός όζος. Σταύρος Μ. Τρύφων MD, PhD, FCCP, Διευθυντής ΕΣΥ Πνευμονολόγος Γ. Ν. «Γ. Παπανικολάου» Θεσ/νίκη

Μονήρης πνευμονικός όζος. Σταύρος Μ. Τρύφων MD, PhD, FCCP, Διευθυντής ΕΣΥ Πνευμονολόγος Γ. Ν. «Γ. Παπανικολάου» Θεσ/νίκη Μονήρης πνευμονικός όζος Σταύρος Μ. Τρύφων MD, PhD, FCCP, Διευθυντής ΕΣΥ Πνευμονολόγος Γ. Ν. «Γ. Παπανικολάου» Θεσ/νίκη Συμβουλευτικές υπηρεσίες-honorarium Aspen Marathon Cyprus Astra Zeneca Elpen GSK

Διαβάστε περισσότερα


ΣΥΓΧΡΟΝΕΣ KYΤΤΑΡΟΛΟΓΙΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΠΝΕΥΜΟΝΑ- ΣΥΓΧΡΟΝΕΣ KYΤΤΑΡΟΛΟΓΙΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΠΝΕΥΜΟΝΑ- Angel Test. Μια αναίµακτη ανέξοδη «µνηµονιακή» διαγνωστική προσέγγιση στον καρκίνο του πνεύµονα Δρ. Βαλερή Ρ-Μ., Επιµελήτρια Α Κυτταρολογικό

Διαβάστε περισσότερα

ΚΑΡΚΙΝΟΣ ΠΝΕΥΜΟΝΑ. Παπαξοΐνης Γεώργιος Παθολόγος Ογκολόγος

ΚΑΡΚΙΝΟΣ ΠΝΕΥΜΟΝΑ. Παπαξοΐνης Γεώργιος Παθολόγος Ογκολόγος ΚΑΡΚΙΝΟΣ ΠΝΕΥΜΟΝΑ Παπαξοΐνης Γεώργιος Παθολόγος Ογκολόγος 1 2 3 4 5 ΚΑΡΚΙΝΟΣ ΠΝΕΥΜΟΝΟΣ ΑΙΤΙΟΛΟΓΙΚΟΙ ΠΑΡΑΓΟΝΤΕΣ Τροποποιήσιµοι παράγοντες Κάπνισµα Παθητικό κάπνισµα Καρκινογόνα του επαγγελµατικού περιβάλλοντος

Διαβάστε περισσότερα

Παθολογία Σαλπίγγων. Ηβη Αρβανίτη

Παθολογία Σαλπίγγων. Ηβη Αρβανίτη Παθολογία Σαλπίγγων Ηβη Αρβανίτη Κακοήθεις Επιθηλιακοί Όγκοι Πρωτοπαθές καρκίνωμα ο όγκος πρέπει να βρίσκεται μέσα στον αυλό ή στο κωδωνικό άκρο η μήτρα και η ωοθήκη ή να μην έχουν όγκο ή να είναι ξεκάθαρα

Διαβάστε περισσότερα

ΠΑΘΗΣΕΙΣ ΜΑΖΙΚΟΥ ΑΔΕΝΑ. Τριανταφυλλιά Κολέτσα Λέκτορας

ΠΑΘΗΣΕΙΣ ΜΑΖΙΚΟΥ ΑΔΕΝΑ. Τριανταφυλλιά Κολέτσα Λέκτορας ΠΑΘΗΣΕΙΣ ΜΑΖΙΚΟΥ ΑΔΕΝΑ Τριανταφυλλιά Κολέτσα Λέκτορας ΕΓΠΠΑ, Α.Π.Θ. Μαστός Λοβοί: εκβάλουν στη θηλή με γαλακτοφόρο πόρο. Διακλαδιζόμενοι πόροι κατάληξη-λοβιακές λοβιακές μονάδες. Λοβιακή μονάδα: αποτελείται

Διαβάστε περισσότερα

Ρ. Κωτακίδου Αναπλ. Διευθύντρια Γ.Ν.Θ. «Γ.Γεννηματάς»

Ρ. Κωτακίδου Αναπλ. Διευθύντρια Γ.Ν.Θ. «Γ.Γεννηματάς» Ρ. Κωτακίδου Αναπλ. Διευθύντρια Γ.Ν.Θ. «Γ.Γεννηματάς» Θεσσαλονίκη 8 Ιανουαρίου 2007 Προδιηθητικές επίπεδο ενδοεπιθηλιακό καρκίνωμα δυσπλασία Ο όρος «ουροθηλιακή ενδοεπιθηλιακή νεοπλασία» (urothelial intraepithelial

Διαβάστε περισσότερα

Κλινικοακτινολογική Εικόνα Φυματίωσης. Μ.Τουμπής Πνευμονολόγος ΓΝΝΘΑ

Κλινικοακτινολογική Εικόνα Φυματίωσης. Μ.Τουμπής Πνευμονολόγος ΓΝΝΘΑ Κλινικοακτινολογική Εικόνα Φυματίωσης Μ.Τουμπής Πνευμονολόγος ΓΝΝΘΑ Δύσκολη Διάγνωση της φυματίωσης Μη ειδικά συμπτώματα και σημεία Αρνητική δερμοαντίδραση φυματίνης Ατυπα ή απόντα απεικονιστικά ευρήματα

Διαβάστε περισσότερα

Νέα Ταξινόμηση Αδενοκαρκινώματος του Πνεύμονα. Δημήτρης Χατζημπούγιας Dr. Med., Msc

Νέα Ταξινόμηση Αδενοκαρκινώματος του Πνεύμονα. Δημήτρης Χατζημπούγιας Dr. Med., Msc Νέα Ταξινόμηση Αδενοκαρκινώματος του Πνεύμονα Δημήτρης Χατζημπούγιας Dr. Med., Msc WHO 2015 rγιατι? WHO 2004 Σύγκριση παλαιάς νέας ταξινόμησης WHO 2004 WHO 2015 Αδενοκαρκίνωμα (ΑΚΠ) ΑΚΠ μικτού

Διαβάστε περισσότερα

Ιστολογικά χαρακτηριστικά χαρακτηριστικά ΚΟΕΝ Ποικίλη µορφολογία Ατρακτόµορφα κύτταρα µε ποικίλο ηωσινόφιλο κυτταρόπλασµα,κυµατοειδείς πυρήνες Τύπου

Ιστολογικά χαρακτηριστικά χαρακτηριστικά ΚΟΕΝ Ποικίλη µορφολογία Ατρακτόµορφα κύτταρα µε ποικίλο ηωσινόφιλο κυτταρόπλασµα,κυµατοειδείς πυρήνες Τύπου Ιστολογικά χαρακτηριστικά χαρακτηριστικά ΚΟΕΝ Ποικίλη µορφολογία Ατρακτόµορφα κύτταρα µε ποικίλο ηωσινόφιλο κυτταρόπλασµα,κυµατοειδείς πυρήνες Τύπου ινοσαρκώµατος εσµιδωτό πρότυπα ανάπτυξης Ιστολογικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Λεμφώματα πνεύμονα (συνέχεια) Πηνελόπη Κορκολοπούλου Επ. Καθηγήτρια Εργαστήριο Παθολογικής Ανατομικής Πανεπιστημίου Αθηνών

Λεμφώματα πνεύμονα (συνέχεια) Πηνελόπη Κορκολοπούλου Επ. Καθηγήτρια Εργαστήριο Παθολογικής Ανατομικής Πανεπιστημίου Αθηνών Λεμφώματα πνεύμονα (συνέχεια) Πηνελόπη Κορκολοπούλου Επ. Καθηγήτρια Εργαστήριο Παθολογικής Ανατομικής Πανεπιστημίου Αθηνών Αγγειοκεντρική ανοσοϋπερπλαστική νόσος / λέμφωμα πνεύμονος ΕΒV B T/NΚ Λεμφωματώδης

Διαβάστε περισσότερα

Πέτρος Καρακίτσος. Καθηγητής Εργαστήριο Διαγνωστικής Κυτταρολογίας Ιατρικής Σχολής Παμεπιστημίου Αθηνών Πανεπιστημιακό Γενικό Νοσοκομείο «ΑΤΤΙΚΟΝ»

Πέτρος Καρακίτσος. Καθηγητής Εργαστήριο Διαγνωστικής Κυτταρολογίας Ιατρικής Σχολής Παμεπιστημίου Αθηνών Πανεπιστημιακό Γενικό Νοσοκομείο «ΑΤΤΙΚΟΝ» Πέτρος Καρακίτσος Καθηγητής Εργαστήριο Διαγνωστικής Κυτταρολογίας Ιατρικής Σχολής Παμεπιστημίου Αθηνών Πανεπιστημιακό Γενικό Νοσοκομείο «ΑΤΤΙΚΟΝ» Αναπαραγωγιμότητα Αντικειμενοποίηση Εφαρμογή τεχνικών:

Διαβάστε περισσότερα

Ανατομία - Φυσιολογία

Ανατομία - Φυσιολογία ΦΥΣΙΟ ΠΝΕΥΜΩΝ Ανατομία - Φυσιολογία Φυσιολογική α/α Ακτινοανατομία Ακτινοανατομία Αγγειογραφία πνευμονικών αρτηριών Β ρ ο γ χ ο γ ρ α φ ί α Πύκνωση Αντικατάσταση του αέρα των κυψελίδων από υλικό, συνήθως

Διαβάστε περισσότερα

ΑΠΕΙΚΟΝΙΣΗ ΘΩΡΑΚΟΣ Κατευθυντήριες οδηγίες. Ι.ΠΑΠΑΗΛΙΟΥ Διευθυντής Τμήματος Αξονικής Τομογραφίας Κωσταντοπούλειο Νοσοκομείο «η Αγία Όλγα»

ΑΠΕΙΚΟΝΙΣΗ ΘΩΡΑΚΟΣ Κατευθυντήριες οδηγίες. Ι.ΠΑΠΑΗΛΙΟΥ Διευθυντής Τμήματος Αξονικής Τομογραφίας Κωσταντοπούλειο Νοσοκομείο «η Αγία Όλγα» ΑΠΕΙΚΟΝΙΣΗ ΘΩΡΑΚΟΣ Κατευθυντήριες οδηγίες Ι.ΠΑΠΑΗΛΙΟΥ Διευθυντής Τμήματος Αξονικής Τομογραφίας Κωσταντοπούλειο Νοσοκομείο «η Αγία Όλγα» ΑΠΕΙΚΟΝΙΣΗ ΘΩΡΑΚΑ ΑΚΤΙΝΟΓΡΑΦΙΑ ΑΞΟΝΙΚΗ ΤΟΜΟΓΡΑΦΙΑ ΜΑΓΝΗΤΙΚΗ ΤΟΜΟΓΡΑΦΙΑ

Διαβάστε περισσότερα


ΛΕΜΦΑ ΕΝΙΚΟ ΛΕΜΦΩΜΑ ΟΡΙΑΚΗΣ ΖΩΝΗΣ ΙΣΤΟΛΟΓΙΚΗ ΕΙΚΟΝΑ ΛΕΜΦΑ ΕΝΙΚΟ ΛΕΜΦΩΜΑ ΟΡΙΑΚΗΣ ΖΩΝΗΣ ΙΣΤΟΛΟΓΙΚΗ ΕΙΚΟΝΑ Μικρά ή µεσαίου µεγέθους λεµφοειδή κύτταρα Πυρήνες στρογγυλοί ή ανωµάλου σχήµατος (µονοκυτταροειδείς ή σαν κεντροκύτταρα) ιαυγές κυτταρόπλασµα ΛΕΜΦΑ

Διαβάστε περισσότερα


ΠΝΕΥΜΟΝΟΛΟΓΙΚΑ ΠΡΟΒΛΗΜΑΤΑ ΠΟΥ ΧΡΗΖΟΥΝ ΕΙΔΙΚΗΣ ΑΚΤΙΝΟΛΟΓΙΚΗΣ ΕΡΜΗΝΕΙΑΣ. Σταυρούλα Μπουσμουκίλια Δ/ντρια Β Πνευμονολογικής κλινικής Γ.Ν. ΠΝΕΥΜΟΝΟΛΟΓΙΚΑ ΠΡΟΒΛΗΜΑΤΑ ΠΟΥ ΧΡΗΖΟΥΝ ΕΙΔΙΚΗΣ ΑΚΤΙΝΟΛΟΓΙΚΗΣ ΕΡΜΗΝΕΙΑΣ Σταυρούλα Μπουσμουκίλια Δ/ντρια Β Πνευμονολογικής κλινικής Γ.Ν. Καβάλας Ηαπλήα/α θώρακα Είναι το αρχικό απεικονιστικό εργαλείο του

Διαβάστε περισσότερα


ΑΝΑΠΝΕΥΣΤΙΚΟ ΣΥΣΤΗΜΑ ΠΑΘΗΣΕΙΣ ΜΕΣΟΘΩΡΑΚΙΟΥ Α. Δ. ΓΟΥΛΙΑΜΟΣ ΑΝΑΠΝΕΥΣΤΙΚΟ ΣΥΣΤΗΜΑ ΠΑΘΗΣΕΙΣ ΜΕΣΟΘΩΡΑΚΙΟΥ Α. Δ. ΓΟΥΛΙΑΜΟΣ Ορισμός : Μεσοθωράκιο είναι ο εξωυπεζωκοτικός χώρος που παρεμβάλλεται μεταξύ των πνευμόνων Περιλαμβάνει την καρδιά και τα μεγάλα αγγεία, το περικάρδιο,

Διαβάστε περισσότερα

ιάγνωση και Θεραπεία Άρης Πολύζος Παθολόγος Ογκολόγος Καθηγητής Πανεπιστηµίου Αθηνών Λαϊκό Νοσοκοµείο Αθήνα Επιδηµιολογία -Αιτιοπαθογένεια Α) Κάπνισµα:Ένοχο για το 85-90% των καρκίνων πνεύµονος x 30vs

Διαβάστε περισσότερα


ΠΝΕΥΜΟΝΙΚΗ ΑΓΓΕΙΪΤΙΣ ΚΑΙ ΚΟΚΚΙΩΜΑΤΩΣΗ ΠΝΕΥΜΟΝΙΚΗ ΑΓΓΕΙΪΤΙΣ ΚΑΙ ΚΟΚΚΙΩΜΑΤΩΣΗ Πνευμονική αγγειίτις και κοκκιωμάτωση είναι ένας περιγραφικός όρος που χαρακτηρίζεται από κυτταρική διήθηση του τοιχώματος των αγγείων (αγγειίτις) με καταστροφή και

Διαβάστε περισσότερα

ιατρική θωρακοσκόπηση: Συσχετίζονται µε την ιστολογική διάγνωση ;

ιατρική θωρακοσκόπηση: Συσχετίζονται µε την ιστολογική διάγνωση ; Ταξινόµηση των ευρηµάτων στην ιατρική θωρακοσκόπηση: Συσχετίζονται µε την ιστολογική διάγνωση ; Φ. Εµµανουήλ 1,. Ροντογιάννη, 2 Ρ.Τριγγίδου 3,. Χιώτης 4, Μ. Στρατίκη 4, Κ.Κοντογιάννη 1, Ν.Κουφός 1, Σ.Γεννηµατά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η παγκόσμια οργάνωση υγείας συνιστά την κατάταξη σε 4 βασικούς ιστολογικούς τύπους: καρκίνωμα μεταβατικού επιθηλίου, καρκίνωμα πλακώδους

Η παγκόσμια οργάνωση υγείας συνιστά την κατάταξη σε 4 βασικούς ιστολογικούς τύπους: καρκίνωμα μεταβατικού επιθηλίου, καρκίνωμα πλακώδους ΚΑΡΚΙΝΟΣ ΟΥΡΟΔΟΧΟΥ ΚΥΣΤΕΩΣ ΣΥΧΝΟΤΗΤΑ ΚΑΡΚΙΝΟΥ ΟΥΡΟΔΟΧΟΥ ΚΥΣΤΕΩΣ. Είναι ο τέταρτος πιο συχνός καρκίνος της στον Δυτικό κόσμο. Η μέση ηλικία κατά την διάγνωση είναι τα 60 με 65 έτη.είναι πιο συχνός στους

Διαβάστε περισσότερα

Πέτρος Καρακίτσος. Καθηγητής Εργαστήριο Διαγνωστικής Κυτταρολογίας Ιατρικής Σχολής Παμεπιστημίου Αθηνών

Πέτρος Καρακίτσος. Καθηγητής Εργαστήριο Διαγνωστικής Κυτταρολογίας Ιατρικής Σχολής Παμεπιστημίου Αθηνών Πέτρος Καρακίτσος Καθηγητής Εργαστήριο Διαγνωστικής Κυτταρολογίας Ιατρικής Σχολής Παμεπιστημίου Αθηνών Οσφυϊκή παρακέντηση στο μεσοσπονδύλιο διάστημα 3ου-4ου σπονδύλου Η σπονδυλική στήλη σε παράλληλη θέση

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΚΑΡΚΙΝΟΣ ΤΟΥ ΠΝΕΥΜΟΝΑ ΚΑΡΚΙΝΟΣ ΤΟΥ ΠΝΕΥΜΟΝΑ Μάθημα 7ο ΕΠΙΔΗΜΙΟΛΟΓΙΚΑ ΣΤΟΙΧΕΙΑ Ο πληθυσμός της Ευρώπης το 2004 ήταν 456 εκατομμύρια σχεδόν το 7% του συνολικού πληθυσμού της γης. Ο καρκίνος αποτελεί την μεγαλύτερη αιτία νοσηρότητας

Διαβάστε περισσότερα

ΑΝΤΖΕΛ ΤΕΣΤ. Μια εύκολη, φθηνή και αναίµακτη διαγνωστική µέθοδος. ΚΟΚΚΙΝΗΣ ΦΟΙΒΟΣ ΠΑΝΑΓΙΩΤΗΣ ΠΝΕΥΜΟΝΟΛΟΓΟΣ Συντ. Διευθυντής Γ.Ν.

ΑΝΤΖΕΛ ΤΕΣΤ. Μια εύκολη, φθηνή και αναίµακτη διαγνωστική µέθοδος. ΚΟΚΚΙΝΗΣ ΦΟΙΒΟΣ ΠΑΝΑΓΙΩΤΗΣ ΠΝΕΥΜΟΝΟΛΟΓΟΣ Συντ. Διευθυντής Γ.Ν. ΑΝΤΖΕΛ ΤΕΣΤ Μια εύκολη, φθηνή και αναίµακτη διαγνωστική µέθοδος ΚΟΚΚΙΝΗΣ ΦΟΙΒΟΣ ΠΑΝΑΓΙΩΤΗΣ ΠΝΕΥΜΟΝΟΛΟΓΟΣ Συντ. Διευθυντής Γ.Ν. ΤΡΙΚΑΛΩΝ Η διαγνωστική απόδοση του βρογχοσκοπίου στον καρκίνο του πνεύµονα!

Διαβάστε περισσότερα

Συχνότητα. Άντρες Γυναίκες 5 1. Νεαρής και μέσης ηλικίας

Συχνότητα. Άντρες Γυναίκες 5 1. Νεαρής και μέσης ηλικίας Η αιτιολογία της πάθησης είναι άγνωστη, αν και έχει μεγάλη σχέση με το κάπνισμα καθώς το 90% των ασθενών είναι ενεργείς καπνιστές Συχνότητα Άντρες Γυναίκες 5 1 Νεαρής και μέσης ηλικίας Στο 60% των περιπτώσεων

Διαβάστε περισσότερα

Καρκίνος πνεύμονα. Ενότητα 9: Καρκίνος πνεύμονα

Καρκίνος πνεύμονα. Ενότητα 9: Καρκίνος πνεύμονα Καρκίνος πνεύμονα Ενότητα 9: Καρκίνος πνεύμονα Κωνσταντίνος Σπυρόπουλος, Καθηγητής Κυριάκος Καρκούλιας, Επίκουρος Καθηγητής Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Σταδιοποίηση Συστήματα

Διαβάστε περισσότερα

ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ. Χριστίνα Βουρλάκου Γ.Ν.Α. «Ο Ευαγγελισμός»

ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ. Χριστίνα Βουρλάκου Γ.Ν.Α. «Ο Ευαγγελισμός» ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ Χριστίνα Βουρλάκου Γ.Ν.Α. «Ο Ευαγγελισμός» ΜΑΚΡΟΣΚΟΠΙΚΗ ΑΝΑΤΟΜΙΑ Μαλακά, επίπεδα, υποστρόγγυλα ή νεφροειδούς σχήματος όργανα. Σπάνια πολυλοβωτά Καστανόφαιη κιτρινόφαιη χροιά λιπώδης

Διαβάστε περισσότερα

OΓΚΟΙ Κ.Ν.Σ OΓΚΟΙ Κ.Ν.Σ. Σ. Μπαρµπάνης


Διαβάστε περισσότερα


ΠΑΡΟΥΣΙΑΣΗΠΕΡΙΣΤΑΤΙΚΟΥ Διαφορικήδιάγνωση ΠΑΡΟΥΣΙΑΣΗΠΕΡΙΣΤΑΤΙΚΟΥ Διαφορικήδιάγνωση Γ ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ Ειδικευόμενη: Σοφία Κραββαρίτη Επιμελητής: Εμμανουήλ Ανδρεάδης Διευθυντής: Γεώργιος Μουσούλης ΚΛΙΝΙΚΑ ΕΥΡΗΜΑΤΑ Ταχύπνοια: αναπνοές >30/min

Διαβάστε περισσότερα

ΜΟΝΗΡΗΣ ΠΝΕΥΜΟΝΙΚΟΣ ΟΖΟΣ ΜΟΝΗΡΗΣ ΠΝΕΥΜΟΝΙΚΟΣ ΟΖΟΣ. Αίτια Στρατηγικές Διαχείρισης. Εκτίµηση Πιθανότητας Κακοήθειας. Αλγόριθµος αντιµετώπισης

ΜΟΝΗΡΗΣ ΠΝΕΥΜΟΝΙΚΟΣ ΟΖΟΣ ΜΟΝΗΡΗΣ ΠΝΕΥΜΟΝΙΚΟΣ ΟΖΟΣ. Αίτια Στρατηγικές Διαχείρισης. Εκτίµηση Πιθανότητας Κακοήθειας. Αλγόριθµος αντιµετώπισης ΜΟΝΗΡΗΣ ΠΝΕΥΜΟΝΙΚΟΣ ΟΖΟΣ ΤΣΑΓΚΟΥΛΗ ΣΟΦΙΑ Πνευµονολόγος Επιστ. Συνεργάτης Πανεπιστηµίου Αθηνών Ογκολογική Μονάδα, Γ ΠΠ, ΝΝΘΑ «ΣΩΤΗΡΙΑ» Αίτια Στρατηγικές Διαχείρισης Εκτίµηση Πιθανότητας Κακοήθειας Αλγόριθµος

Διαβάστε περισσότερα

Κλέωντας Αθανάσιος Ειδικευόμενος Ιατρός Θωρακοχειρουργικής Κλινικής (Επιστημονικός Συνεργάτης Πνευμονολογικής Ογκολογικής Κλινικής)

Κλέωντας Αθανάσιος Ειδικευόμενος Ιατρός Θωρακοχειρουργικής Κλινικής (Επιστημονικός Συνεργάτης Πνευμονολογικής Ογκολογικής Κλινικής) Κλέωντας Αθανάσιος Ειδικευόμενος Ιατρός Θωρακοχειρουργικής Κλινικής (Επιστημονικός Συνεργάτης Πνευμονολογικής Ογκολογικής Κλινικής) ΘΕΑΓΕΝΕΙΟ Αντικαρκινικό Νοσοκομείο Θεσσαλονίκη Copyright Ατομικό Ιστορικό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Στην περισσότερο επιτυχημένη αντιμετώπιση του καρκίνου έχει συμβάλλει σημαντικά η ανακά-λυψη και εφαρμογή των καρκινι-κών δεικτών.

Στην περισσότερο επιτυχημένη αντιμετώπιση του καρκίνου έχει συμβάλλει σημαντικά η ανακά-λυψη και εφαρμογή των καρκινι-κών δεικτών. Όλες μαζί οι μορφές καρκίνου αποτελούν, παγκοσμίως τη δεύτερη αιτία θανάτου μετά από τα καρδιαγγειακά νοσήματα. Τα κρούσματα συνεχώς αυξάνονται και σε πολλές αναπτυγμένες χώρες αποτελεί την πρώτη αιτία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΛΕΜΦΩΜΑ HODGKIN. Τριανταφυλλιά Κολέτσα Λέκτορας Εργαστήριο Γενικής Παθολογίας και Παθολογικής Ανατομικής, ΑΠΘ

ΛΕΜΦΩΜΑ HODGKIN. Τριανταφυλλιά Κολέτσα Λέκτορας Εργαστήριο Γενικής Παθολογίας και Παθολογικής Ανατομικής, ΑΠΘ ΛΕΜΦΩΜΑ HODGKIN Τριανταφυλλιά Κολέτσα Λέκτορας Εργαστήριο Γενικής Παθολογίας και Παθολογικής Ανατομικής, ΑΠΘ Ταξινόμηση λεμφωμάτων- Βασικές αρχές Στην ταξινόμηση WHO: Λαμβάνονται υπόψη μορφολογικά, ανοσοϊστοχημικά,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015. Ορισμοί-Κατάταξη-Ιστολογία. Δ Ροντογιάννη

TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015. Ορισμοί-Κατάταξη-Ιστολογία. Δ Ροντογιάννη TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015 Ορισμοί-Κατάταξη-Ιστολογία Δ Ροντογιάννη Νευροενδοκρινή νεοπλάσματα Ταξινόμηση Βιολογικοί δείκτες Μοριακή Παθολογία Νευροενδοκρινή νεοπλάσματα Ταξινόμηση

Διαβάστε περισσότερα

ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος. Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας

ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος. Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας H.M. Παράγοντες κινδύνου καρκινώματος τραχήλου Ηλικία κατά την πρώτη

Διαβάστε περισσότερα

Φ. Πατακιούτα-Μπούκαλη Συντονίστρια Διευθύντρια Παθολογοανατομικού Τμήματος Α.Ν.Θ Θεαγένειο. Καστοριά 19/12/15

Φ. Πατακιούτα-Μπούκαλη Συντονίστρια Διευθύντρια Παθολογοανατομικού Τμήματος Α.Ν.Θ Θεαγένειο. Καστοριά 19/12/15 Φ. Πατακιούτα-Μπούκαλη Συντονίστρια Διευθύντρια Παθολογοανατομικού Τμήματος Α.Ν.Θ Θεαγένειο Καστοριά 19/12/15 Εισαγωγή (1) Ο καρκίνος του πνεύμονα αποτελεί το συχνότερο καρκίνο παγκοσμίως (12.6% όλων των

Διαβάστε περισσότερα

Ενδείξεις μέτρησης εκπνεομένου NO στα παιδιά

Ενδείξεις μέτρησης εκπνεομένου NO στα παιδιά Ενδείξεις μέτρησης εκπνεομένου NO στα παιδιά Ε.Παρασκάκης Eπικ. Καθηγητής Παιδιατρικής Μονάδα Αναπνευστικών Νοσημάτων Παίδων Παιδιατρική Κλινική Πανεπιστημίου Θράκης ΕΙΣΑΓΩΓΗ Η παρακολούθηση αρκετών αναπνευστικών

Διαβάστε περισσότερα

Πανεπιστήμιο Θεσσαλίας Τμήμα Ιατρικής Εργαστήριο Ακτινολογίας Ιατρικής Απεικόνισης

Πανεπιστήμιο Θεσσαλίας Τμήμα Ιατρικής Εργαστήριο Ακτινολογίας Ιατρικής Απεικόνισης Πανεπιστήμιο Θεσσαλίας Τμήμα Ιατρικής Εργαστήριο Ακτινολογίας Ιατρικής Απεικόνισης Διδάσκοντες Ιωάννης Β. Φεζουλίδης Καθηγητής Μαριάννα Βλυχού Αναπλ. Καθηγήτρια Έφη Καψαλάκη Αναπλ. Καθηγήτρια Αικατερίνη

Διαβάστε περισσότερα

Κακοήθης Υπεζωκοτική Συλλογή 10 κρίσιµα ερωτήµατα

Κακοήθης Υπεζωκοτική Συλλογή 10 κρίσιµα ερωτήµατα Κακοήθης Υπεζωκοτική Συλλογή 10 κρίσιµα ερωτήµατα Γιάννης Καλοµενίδης Επίκουρος Καθηγητής Πνευµονολογίας ΕΚΠΑ Νοσοκοµείο «Αττικόν» Κακοήθης υπεζωκοτική συλλογή Η πιο συχνή αιτία εξιδρωµατικής ΥΣ µετά την

Διαβάστε περισσότερα

Ο ΡΟΛΟΣ ΤΗΣ MEDICAL THORACOSCOPY ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΠΝΕΥΜΟΝΑ. Πιλιλίτσης Λεωνίδας Ειδικός πνευμονολόγος Γ.Ν.Λαμίας

Ο ΡΟΛΟΣ ΤΗΣ MEDICAL THORACOSCOPY ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΠΝΕΥΜΟΝΑ. Πιλιλίτσης Λεωνίδας Ειδικός πνευμονολόγος Γ.Ν.Λαμίας Ο ΡΟΛΟΣ ΤΗΣ MEDICAL THORACOSCOPY ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΠΝΕΥΜΟΝΑ Πιλιλίτσης Λεωνίδας Ειδικός πνευμονολόγος Γ.Ν.Λαμίας ΙΣΤΟΡΙΚΗ ΑΝΑΔΡΟΜΗ Ο όρος θωρακοσκόπηση εισήχθη από τον Hans Christian Jacobaeus περίπου πριν

Διαβάστε περισσότερα

Φυματίωση με νέα «πρόσωπα»

Φυματίωση με νέα «πρόσωπα» Φυματίωση με νέα «πρόσωπα» Φιλίππου Δ., Τιτόπουλος Ηρ., Κωνσταντίνου Ελ., Οικονόμου Δ. Πνευμονολογική & Θωρακοχειρουργική Κλινική Ιατρικό Διαβαλκανικό Κέντρο, Θεσσαλονίκη περιστατικό 1 στοιχεία ασθενούς

Διαβάστε περισσότερα

Οι σκοποί της Εταιρείας μας είναι επιστημονικοί και κοινωνικοί και αφορούν στην:

Οι σκοποί της Εταιρείας μας είναι επιστημονικοί και κοινωνικοί και αφορούν στην: Ο καρκίνος του μαστού αποτελεί τη συχνότερη νεοπλασματική νόσο που προσβάλλει τις γυναίκες, με αρνητικές επιπτώσεις όχι μόνο για την ίδια την ασθενή, αλλά και για το οικογενειακό και φιλικό της περιβάλλον.

Διαβάστε περισσότερα

Κων/να Παναγιωτοπούλου. Επιμ. Α Παθολογοανατομικού Εργαστηρίου. Γ.Ν.Ν.Θ «Γ. Γεννηματάς»

Κων/να Παναγιωτοπούλου. Επιμ. Α Παθολογοανατομικού Εργαστηρίου. Γ.Ν.Ν.Θ «Γ. Γεννηματάς» Κων/να Παναγιωτοπούλου Επιμ. Α Παθολογοανατομικού Εργαστηρίου. Γ.Ν.Ν.Θ «Γ. Γεννηματάς» ΟΓΚΟΙ ΝΕΦΡΟΥ ΠΑΙ ΙΚΗΣ ΗΛΙΚΙΑΣ ΟΓΚΟΙ ΝΕΦΡΟΥ ΠΑΙΔΙΚΗΣ ΗΛΙΚΙΑΣ Εάν σας ρωτήσουν : Ένα παιδάκι γνωστό μου χειρουργήθηκε

Διαβάστε περισσότερα



Διαβάστε περισσότερα


18. ΚΑΡΚΙΝΟΣ ΕΝΔΟΜΗΤΡΙΟΥ 18. ΚΑΡΚΙΝΟΣ ΕΝΔΟΜΗΤΡΙΟΥ Ο καρκίνος του ενδομητρίου είναι η συχνότερη μορφή γυναικολογικού καρκίνου στις ΗΠΑ ( 6% όλων των νεοδιαγνωσθέντων καρκίνων στις γυναίκες). Η πρόγνωση είναι σχετικά καλή καθώς

Διαβάστε περισσότερα


ΕΝΔΟΒΡΟΓΧΙΚΗ ΒΡΑΧΥΘΕΡΑΠΕΙΑ ΣΤΟΝ ΚΑΡΚΙΝΟ ΠΝΕΥΜΟΝΟΣ. 2,Β.Αναστασάκος2, ΕΝΔΟΒΡΟΓΧΙΚΗ ΒΡΑΧΥΘΕΡΑΠΕΙΑ ΣΤΟΝ ΚΑΡΚΙΝΟ ΠΝΕΥΜΟΝΟΣ. Κ. Παπαλλά 1, Δ. Μπισιρτζόγλου2, Αθ. Ζέτος 2,Β.Αναστασάκος2, 2Γ. Ιωαννίδου 1, 2Δ. Ξεσφύγγη 1, Μ.Πλόχωρου1,Μ.Καραβαλλάκης 1 Ι.Τσαλαφουτας 1 Γ. Πολίτης

Διαβάστε περισσότερα

Προληπτική Μαστογραφία Ανακαλύπτοντας το DCIS. Ιωάννης Θ. Νατσιόπουλος Ειδικός Χειρουργός Μαστού

Προληπτική Μαστογραφία Ανακαλύπτοντας το DCIS. Ιωάννης Θ. Νατσιόπουλος Ειδικός Χειρουργός Μαστού Προληπτική Μαστογραφία Ανακαλύπτοντας το DCIS Ιωάννης Θ. Νατσιόπουλος Ειδικός Χειρουργός Μαστού Ductal Carcinoma in Situ Πορογενές καρκίνωμα in Situ In Situ = επί τόπου Τοπικό πορογενές καρκίνωμα; Ductal

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ιστολογία και νεοπλάσματα επιδιδυμίδας, σπερματικού τόνου, σπερματοδόχων κύστεων και ορχικών περιβλημάτων

Ιστολογία και νεοπλάσματα επιδιδυμίδας, σπερματικού τόνου, σπερματοδόχων κύστεων και ορχικών περιβλημάτων Ιστολογία και νεοπλάσματα επιδιδυμίδας, σπερματικού τόνου, σπερματοδόχων κύστεων και ορχικών περιβλημάτων Ελένη Παπακωνσταντίνου Παθολογοανατόμος, Επιμελήτρια Β Γ.Ν. Ελευσίνας «Θριάσιο» ΟΡΧΙΚΑ ΠΕΡΙΒΛΗΜΑΤΑ

Διαβάστε περισσότερα

Company LOGO. Νευροενδοκρινείς Όγκοι του Θύµου Αδένα Τζαβές Ιωάννης Ειδικευόµενος Ιατρός Ενδοκρινολογικού Τµήµατος Ε.Α.Ν.Π.

Company LOGO. Νευροενδοκρινείς Όγκοι του Θύµου Αδένα Τζαβές Ιωάννης Ειδικευόµενος Ιατρός Ενδοκρινολογικού Τµήµατος Ε.Α.Ν.Π. Company LOGO Νευροενδοκρινείς Όγκοι του Θύµου Αδένα Τζαβές Ιωάννης Ειδικευόµενος Ιατρός Ενδοκρινολογικού Τµήµατος Ε.Α.Ν.Π. "ΜΕΤΑΞΑ " αδένα Θύµος αδένας Νευροενδοκρινείς Όγκοι του Θύµου Δοµή του Θύµου Φλοιός

Διαβάστε περισσότερα


ΜΕΤΑΤΡΑΥΜΑΤΙΚΗ ΨΕΥ ΟΚΥΣΤΗ ΠΝΕΥΜΟΝΑ ΜΕΤΑΤΡΑΥΜΑΤΙΚΗ ΨΕΥ ΟΚΥΣΤΗ ΠΝΕΥΜΟΝΑ Παρουσίαση περιστατικού Ονόµατα: Α.Γιακαµόζης, Β.Βουτσάς, Θ.Λαζαρίδης,, Β.Ράντου, Π.Κοντού, Α.Ιωαννίδου, Ι Φρανσές, Μ.Μπιτζάνη ΑΜΕΘ Γ.Ν.Θ. «Γ. Παπανικολάου» ΕΙΣΑΓΩΓΗ

Διαβάστε περισσότερα

Η αναρροφητική βιοψία των όρχεων (FNA) στην ανδρική υπογονιμότητα. Νεώτερα δεδομένα

Η αναρροφητική βιοψία των όρχεων (FNA) στην ανδρική υπογονιμότητα. Νεώτερα δεδομένα Η αναρροφητική βιοψία των όρχεων (FNA) στην ανδρική υπογονιμότητα. Νεώτερα δεδομένα Παπανικολάου Αθανάσιος Αναπληρωτής Διευθυντής ΕΣΥ Ιπποκράτειο Νοσοκομείο Θεσσαλονίκης Η αναρροφητική βιοψία των όρχεων

Διαβάστε περισσότερα


21. ΚΑΡΚΙΝΟΣ ΤΟΥ ΜΑΣΤΟΥ 21. ΚΑΡΚΙΝΟΣ ΤΟΥ ΜΑΣΤΟΥ ΕΠΙΔΗΜΙΟΛΟΓΙΑ Ο καρκίνος του μαστού είναι ο πιο συχνός καρκίνος της γυναίκας. Η επίπτωση παγκόσμια είναι περίπου 89 περιστατικά/100.000 γυναίκες ενώ αναφέρονται 800.000 νέα περιστατικά

Διαβάστε περισσότερα

Χειρουργική αντιμετώπιση μη μικροκυτταρικού Ca πνεύμονα. Μαδέσης Αθανάσιος Επιμελητής Α Καρδιοθωρακοχειρουργικής

Χειρουργική αντιμετώπιση μη μικροκυτταρικού Ca πνεύμονα. Μαδέσης Αθανάσιος Επιμελητής Α Καρδιοθωρακοχειρουργικής Χειρουργική αντιμετώπιση μη μικροκυτταρικού Ca πνεύμονα Μαδέσης Αθανάσιος Επιμελητής Α Καρδιοθωρακοχειρουργικής Κλινικής Γ.Ν.Ν.Γ.Παπανικολάου Καρκίνος Πνεύμονα Πρώτη αιτία θανάτου από καρκίνο στις ΗΠΑ

Διαβάστε περισσότερα

Καθηγητής Επίκουρη Καθηγήτρια. Επίκουρη Καθηγήτρια. Ακτινολόγος

Καθηγητής Επίκουρη Καθηγήτρια. Επίκουρη Καθηγήτρια. Ακτινολόγος Πανεπιστήμιο Θεσσαλίας Ιατρική Σχολή Εργαστήριο Ακτινολογίας Ιατρικής Απεικόνισης Μέλη ΔΕΠ Ιωάννης Φεζουλίδης, Μαριάννα Βλυχού, Έφη Καψαλάκη, Χρήστος Ρούντας Καθηγητής Επίκουρη Καθηγήτρια Επίκουρη Καθηγήτρια

Διαβάστε περισσότερα

Διάγνωση καρκίνου του πνεύμονα Ενότητα 1: Ογκολογία πνεύμονα. Κυριάκος Καρκούλιας, Επίκουρος Καθηγητής Σχολή Επιστημών Υγείας Τμήμα Ιατρικής

Διάγνωση καρκίνου του πνεύμονα Ενότητα 1: Ογκολογία πνεύμονα. Κυριάκος Καρκούλιας, Επίκουρος Καθηγητής Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Διάγνωση καρκίνου του πνεύμονα Ενότητα 1: Ογκολογία πνεύμονα Κυριάκος Καρκούλιας, Επίκουρος Καθηγητής Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Εισαγωγή Ο καρκίνος του πνεύμονα αποτελεί σημαντικό αίτιο θνητότητας

Διαβάστε περισσότερα

ΣΤΟΜΑΤΟΛΟΓΙΑ στόμα Η Στοματολογία αποτελεί σημαντικό μέρος της Παθολογίας

ΣΤΟΜΑΤΟΛΟΓΙΑ στόμα Η Στοματολογία αποτελεί σημαντικό μέρος της Παθολογίας ΣΤΟΜΑΤΟΛΟΓΙΑ Αν και το στόμα αποτελεί μικρό τμήμα του σώματος είναι στόχος πολυάριθμων νόσων, τοπικών και συστηματικών Νοσήματα βλεννογόνου στόματος Νοσήματα χειλέων Νοσήματα σιαλογόνων αδένων Νοσήματα

Διαβάστε περισσότερα

ΜΗ ΝΕΟΠΛΑΣΜΑΤΙΚΕΣ AΛΛΟΙΩΣΕΙΣ ΘΥΡΕΟΕΙΔΟΥΣ. Αγγελική Μπουσιώτου Επιμελήτρια Α Παθολογοανατομικό Τμήμα Ιπποκρατείου Νοσοκομείου Αθηνών.

ΜΗ ΝΕΟΠΛΑΣΜΑΤΙΚΕΣ AΛΛΟΙΩΣΕΙΣ ΘΥΡΕΟΕΙΔΟΥΣ. Αγγελική Μπουσιώτου Επιμελήτρια Α Παθολογοανατομικό Τμήμα Ιπποκρατείου Νοσοκομείου Αθηνών. ΜΗ ΝΕΟΠΛΑΣΜΑΤΙΚΕΣ AΛΛΟΙΩΣΕΙΣ ΘΥΡΕΟΕΙΔΟΥΣ Αγγελική Μπουσιώτου Επιμελήτρια Α Παθολογοανατομικό Τμήμα Ιπποκρατείου Νοσοκομείου Αθηνών. ΑΝΑΤΟΜΙΑ ΘΥΡΕΟΕΙΔΟΥΣ (1) Δύο πλάγιοι λοβοί συνδεόμενοι με λεπτό ισθμό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κατευθυντήριες οδηγίες στη διερεύνηση της χρόνιας πνευμονοπάθειας στα παιδιά

Κατευθυντήριες οδηγίες στη διερεύνηση της χρόνιας πνευμονοπάθειας στα παιδιά Κατευθυντήριες οδηγίες στη διερεύνηση της χρόνιας πνευμονοπάθειας στα παιδιά 2012 Ελπίδα Χατζηαγόρου Παιδοπνευµονολογική Μονάδα Ιπποκράτειο Νοσοκοµείο Αριστοτέλειο Πανεπιστήµιο Θεσσαλονίκης Χρόνια πνευµονοπάθεια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Όρχεις -Χειρισμός παρασκευάσματος -Εισαγωγή στους όγκους. Α.. Κιζιρίδου, Αναπ. Διευθύντρια Παθολογοανατομικού Τμήματος A.Ν.Θ.

Όρχεις -Χειρισμός παρασκευάσματος -Εισαγωγή στους όγκους. Α.. Κιζιρίδου, Αναπ. Διευθύντρια Παθολογοανατομικού Τμήματος A.Ν.Θ. Όρχεις -Χειρισμός παρασκευάσματος -Εισαγωγή στους όγκους Α.. Κιζιρίδου, Αναπ. Διευθύντρια Παθολογοανατομικού Τμήματος A.Ν.Θ.Θεαγένειο Περιγραφική Ανατομική 2 αδένες με σχήμα δαμάσκηνου διαστ.5χ3χ2.5 Κρέμονται

Διαβάστε περισσότερα

Κουμανίδου Χρυσούλα Συντονίστρια Διευθύντρια

Κουμανίδου Χρυσούλα Συντονίστρια Διευθύντρια Κουμανίδου Χρυσούλα Συντονίστρια Διευθύντρια Καλοήθη Κακοήθη Συγγενές Φλεγμονώδες Αγγειακό Νεοπλαστικό Διόγκωση Ιστορικό Κλινική εικόνα Ηλικία Εντόπιση Ατελής σύγκλειση τμήματος του θυρεογλωσσικού πόρου

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Αναπνευστική βρογχιολίτιδα-διάμεση διάμεση πνευμονία (RB( RB- ILD) Αποφολιδωτική διάμεση πνευμονία(dip) Σπύρος Α Παπίρης

Αναπνευστική βρογχιολίτιδα-διάμεση διάμεση πνευμονία (RB( RB- ILD) Αποφολιδωτική διάμεση πνευμονία(dip) Σπύρος Α Παπίρης Αναπνευστική βρογχιολίτιδα-διάμεση διάμεση πνευμονία (RB( RB- ILD) Αποφολιδωτική διάμεση πνευμονία(dip) Σπύρος Α Παπίρης Μαθήματα Πνευμονολογίας-Αθήνα Μάρτιος 2006 DIP RB-ILD Κατάταξη των διάμεσων παρεγχυματικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μιχαήλ Νικ. Πατσίκας

Μιχαήλ Νικ. Πατσίκας Απεικονιστική διερεύνηση του πλευριτικού και μεσοπνευμόνιου χώρου Μιχαήλ Νικ. Πατσίκας κτηνίατρος - ιατρός Αναπληρωτής Καθηγητής Ακτινολογίας Κτηνιατρική Σχολή Α.Π.Θ. Διπλωματούχος Ευρωπαϊκού Κολεγίου

Διαβάστε περισσότερα

φυσιολογικό δέρμα - 1

φυσιολογικό δέρμα - 1 φυσιολογικό δέρμα -1 Επιδερμίδα (επιθήλιο, εξωδερμική προέλευση) Α Α Α Μ θηλώδες χόριο (επιπολής) ακανθωτή στιβάδα βασική στιβάδα χόριο Μ = Μελανοκύτταρο (νευροεξωδερμική προέλευση, νευρική ακρολοφία)

Διαβάστε περισσότερα



Διαβάστε περισσότερα