ΕΝΟΤΗΤΑ Ι. Ο µοριακός σχεδιασµός της ζωής

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΕΝΟΤΗΤΑ Ι. Ο µοριακός σχεδιασµός της ζωής"

Transcript

1 Stryer: Biochemistry Perm. Fig. # P1 ew Fig. # P1 First Draft: Μέρος ενός σωµατιδίου λιποπρωτεΐνης. Ένα µοντέλο της δοµής της απολιποπρωτεΐνης Α-1 (κίτρινο), το οποίο περιβάλλει φύλλα λιπιδίων. Η απολιποπρωτεΐνη αυτή αποτελεί την κύρια πρωτεϊνική συνιστώσα των σωµατιδίων της λιποπρωτεΐνης υψηλής πυκνότητας (DL) του αίµατος. Τα σωµατίδια αυτά είναι αποτελεσµατικοί µεταφορείς λιπιδίων, διότι η πρωτεϊνική συνιστώσα λειτουργεί ως επιφάνεια επαφής µεταξύ των υδρόφοβων λιπιδικών αλυσίδων και του υδάτινου περιβάλλοντος του αίµατος. [Βασισµένο σε συντεταγµένες που έδωσε ο Stephen arvey.] ΕΝΟΤΗΤΑ Ι Ο µοριακός σχεδιασµός της ζωής

2

3 Πρελούδιο: Η βιοχηµεία και η επαναστατική καταγραφή γονιδιωµάτων ζώντων οργανισµών Σχέση των νόσων µε το γονιδίωµα. Οι µελέτες του ανθρώπινου γονιδιώµατος αποκαλύπτουν τις απαρχές νόσων καθώς και άλλα βιοχηµικά µυστήρια. Τα ανθρώπινα χρωµοσώµατα, αριστερά, περιέχουν τα µόρια DA τα οποία αποτελούν το ανθρώπινο γονιδίωµα. Το σχήµα που προκύπτει από τη χρώση των χρωµοσωµάτων επιτρέπει την ταυτοποίηση συγκεκριµένων περιοχών τους. Στα δεξιά είναι ένα διάγραµµα του ανθρώπινου χρωµοσώµατος 7, στο οποίο η ζώνη q31.2 δείχνεται µε ένα βέλος. Ένα γονίδιο στην περιοχή αυτή κωδικεύει µια πρωτεΐνη η οποία, όταν είναι ελαττωµατική, προκαλεί κυστική ίνωση. [(Αριστερά) Alfred Pasieka/Peter Arnold.] ΚΕΦΑΛΑΙΟ 1 q31.2 GATTATTTAATGATGATTATGGGAGAATGGAG TAGAGGGTAAAAATTAAGAAGTGGAAGAATTTATT TGTTTAGTTTTTGGATTATGTGGAATTAAAG AAAATATTTTGGTGTTTTATGATGAATATAGATAAG AAGGTATAAAGATGAATAGAAGAG Αυτή η αλυσίδα των γραμμάτων A,, G, και Τ είναι μέρος μιας αλληλουχίας DA. Από τότε που αναπτύχθηκαν βιοχημικές τεχνικές προσδιορισμού της αλληλουχίας DA, πριν από 30 και πλέον χρόνια, έχουν προσδιοριστεί όλες οι αλληλουχίες για γονιδιώματα μιας δωδεκάδας οργανισμών και σύντομα αναμένεται ο προσδιορισμός ακόμη περισσότερων τέτοιων αλληλουχιών. Οι πληροφορίες που περιέχονται στις αλληλουχίες αυτές αναμένεται να δώσουν απαντήσεις σε πολλά και συναρπαστικά ερωτήματα. Παραδείγματος χάριν, ποια γονίδια του δονακίου της χολέρας (Vibrio cholerae) το διαφοροποιούν από τους πιο ήπιους συγγενείς του; Πώς ελέγχεται η ανάπτυξη των πολύπλοκων οργανισμών; Ποιες είναι οι σχέσεις μεταξύ των οργανισμών από τη σκοπιά της εξέλιξης; Οι μελέτες προσδιορισμού των αλληλουχιών DA μας έχουν φέρει σε ένα μοναδικής σημασίας σημείο στην ιστορία της βιολογίας και, πράγματι, της ίδιας της ανθρωπότητας. Μια σχεδόν πλήρης ταυτοποίηση της αλληλουχίας του ανθρώπινου γονιδιώματος έχει ήδη επιτευχθεί. Η αλυσίδα των γραμμάτων Α,, G και T με τις οποίες αρχίσαμε αυτό το βιβλίο είναι ένα πολύ μικρό τμήμα της αλληλουχίας του ανθρώπινου γονιδιώματος, το οποίο έχει μήκος τριών δισεκατομμυρίων γραμμάτων. Αν είχε περιληφθεί ολόκληρη η αλληλουχία, η αρχική πρόταση θα έπιανε περισσότερες από μισό εκατομμύριο σελίδες. ΠΕΡΙΓΡΑΜΜΑ 1.1 Το DA καταδεικνύει τη σχέση µεταξύ µορφής και λειτουργίας 1.2 Το ενιαίο των βιοχηµικών διεργασιών είναι το υπόβαθρο της βιολογικής ποικιλοµορφίας 1.3 Οι χηµικοί δεσµοί στη βιοχηµεία 1.4 Βιοχηµεία και ανθρώπινη βιολογία

4 4 ΚΕΦΑΛΑΙΟ 1 Πρελούδιο: Η βιοχηµεία και η επαναστατική καταγραφή γονιδιωµάτων ζώντων οργανισµών Δεν μπορούμε να υπερεκτιμήσουμε τη σημασία αυτής της γνώσης. Χρησιμοποιώντας αυτό το αρχέτυπο για το τί σημαίνει να είναι κανείς άνθρωπος, οι επιστήμονες μπορούν να αρχίσουν τον χαρακτηρισμό αλληλουχιών οι οποίες προβλέπουν την εμφάνιση συγκεκριμένων νόσων και ειδικών φυσικών χαρακτηριστικών. Ένα επακόλουθο της εξέλιξης αυτής θα είναι η ανάπτυξη καλύτερων μέσων για τη διάγνωση και τη θεραπεία νόσων. Τελικά, οι γιατροί θα είναι σε θέση να σχεδιάσουν τρόπους αποτροπής ή αντιμετώπισης των καρδιακών νοσημάτων ή του καρκίνου, οι οποίοι θα λαμβάνουν υπ όψιν και τις ιδιαιτερότητες του κάθε ατόμου. Παρ όλο που ο προσδιορισμός της αλληλουχίας του ανθρώπινου γονιδιώματος είναι ένα τεράστιο βήμα προς την κατανόηση της λειτουργίας των ζώντων οργανισμών, παραμένει να γίνει πάρα πολλή δουλειά. Πού βρίσκονται τα λειτουργικά γονίδια μέσα στην αλληλουχία βάσεων και πώς αλληλεπιδρούν τα γονίδια αυτά μεταξύ τους; Πώς μετατρέπονται οι πληροφορίες που περιέχουν τα γονίδια σε λειτουργικά χαρακτηριστικά του κάθε οργανισμού; Μερικοί από τους στόχους μας στη μελέτη της βιοχημείας είναι να μάθουμε τις έννοιες, τα εργαλεία και τα γεγονότα που θα μας επιτρέψουν να αντιμετωπίσουμε αυτά τα ζητήματα. Ζούμε πράγματι σε μια συναρπαστική εποχή, στην απαρχή μιας καινούργιας περιόδου στη βιοχημεία. 1.1 ΤΟ DA ΚΑΤΑ ΕΙΚΝΥΕΙ ΤΗ ΣΧΕΣΗ ΜΕΤΑΞΥ ΜΟΡΦΗΣ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑΣ Η δομή του DA, συντομογραφίας για το δεοξυριβονουκλεϊκό οξύ, καταδεικνύει μια βασική αρχή που είναι κοινή για όλα τα βιομόρια: τη στενή σχέση μεταξύ δομής και λειτουργίας. Οι αξιοσημείωτες ιδιότητες αυτής της χημικής ουσίας της επιτρέπουν να λειτουργεί ως ένα πολύ αποτελεσματικό και στιβαρό όχημα για την αποθήκευση πληροφοριών. Αρχίζουμε με την εξέταση της ομοιοπολικής δομής του DA και την προέκτασή της στις τρεις διαστάσεις Το DA κατασκευάζεται από τέσσερις δοµικούς λίθους Το DA είναι ένα γραμμικό πολυμερές το οποίο αποτελείται από τέσσερα διαφορετικά μονομερή. Έχει έναν καθορισμένο κορμό από τον οποίο προβάλλουν διάφοροι υποκαταστάτες (Eικόνα 1.1). Ο κορμός δομείται από επαναλαμβανόμενες μονάδες σακχάρου-φωσφορικού. Τα σάκχαρα είναι μόρια δεοξυριβόζης, από την οποία το DA έχει πάρει το όνομά του. Κάθε μόριο δεοξυριβόζης είναι ομοιοπολικά συνδεδεμένο με μία από τέσσερις πιθανές βάσεις: αδενίνη (Α), κυτοσίνη (), γουανίνη (G) και θυμίνη (Τ) A ÂÓ ÓË (A) K ÙÔÛ ÓË () Ô Ó ÓË (G) Ì ÓË (T) Όλες αυτές οι βάσεις είναι επίπεδες, διαφέρουν όμως σημαντικά μεταξύ τους σε άλλα χαρακτηριστικά. Συνεπώς, τα μονομερή του DA αποτελούνται από μια μονάδα σακχάρου-φωσφορικού, με μία από τις τέσσερις βάσεις συνδεδεμένη στο σάκχαρο. Αυτές οι βάσεις είναι δυνατόν να βρίσκονται με οποιαδήποτε σειρά κατά μήκος της αλυσίδας του DA. Η αλληλουχία των βάσεων αυτών είναι ακριβώς εκείνη που απεικονίζεται στην αρχή του κεφαλαίου. Παραδείγ-

5 ÛË 1 ÛË 2 ÛË 3 P P P Î ÚÔ ºˆÛÊÔÚÈÎfi 5 DA: Mορφή και λειτουργία EIKA 1.1 Οµοιοπολική δοµή του DA. Κάθε µονάδα του πολυµερούς αποτελείται από ένα σάκχαρο (δεοξυριβόζη), ένα φωσφορικό ανιόν και µια µεταβλητή βάση που προβάλλει από τον κορµό σακχάρου-φωσφορικού. ματος χάριν, η πρώτη βάση στην αλληλουχία είναι G (γουανίνη), η δεύτερη είναι Α (αδενίνη) κ.ο.κ. Η αλληλουχία των βάσεων κατά μήκος της αλυσίδας του DA αποτελεί τις γενετικές πληροφορίες τις οδηγίες δηλαδή για την παραγωγή συγκεκριμένων πρωτεϊνών, οι οποίες με τη σειρά τους ενορχηστρώνουν τη σύνθεση μιας πλειάδας βιομορίων που συγκροτούν κύτταρα και τελικά οργανισμούς ύο µονές αλυσίδες του DA συνδυάζονται για να σχηµατίσουν τη διπλή έλικα Τα περισσότερα μόρια του DA δεν αποτελούνται από μία αλλά από δύο αλυσίδες (Eικόνα 1.2). Πώς είναι τοποθετημένες αυτές οι δύο αλυσίδες στον χώρο, η μία σε σχέση με την άλλη; Το 1953 οι James Watson και Francis rick βρήκαν τη διάταξη των δύο αλυσίδων και πρότειναν μια λύση για την τριδιάστατη δομή των μορίων του DA. Αυτή η δομή είναι μια διπλή έλικα που αποτελείται από δύο διαπλεκόμενες αλυσίδες σε τέτοια διάταξη ώστε ο κορμός σακχάρου-φωσφορικού να βρίσκεται στο εξωτερικό και οι βάσεις στο εσωτερικό. Το κλειδί στη δομή αυτή είναι ότι οι βάσεις σχηματίζουν συγκεκριμένα ζεύγη βάσεων (bp) τα οποία συγκρατούνται μέσω δεσμών υδρογόνου (Εδάφιο 1.3.1): η αδενίνη ζευγαρώνει με τη θυμίνη (Α Τ) και η γουανίνη με την κυτοσίνη (G ), όπως φαίνεται στην A ÂÓ ÓË (A) 3 Ì ÓË (T) Eικόνα 1.3. Οι δεσμοί υδρογόνου είναι πολύ ασθενέστεροι από τους ομοιοπολικούς δεσμούς, όπως, π.χ., εκείνους άνθρακα-άνθρακα ή άνθρακα-αζώτου, οι οποίοι καθορίζουν τις δομές των συγκεκριμένων βάσεων. Τέτοιοι ασθενείς δεσμοί είναι καθοριστικοί για τα βιοχημικά συστήματα: είναι αρκετά ασθενείς ώστε να μπορούν να διασπαστούν κατά τη διάρκεια μιας βιοχημικής διεργασίας, αλλά είναι αρκετά ισχυροί, όταν υπάρχει πληθώρα από αυτούς σε ένα σύστημα, ώστε να μπορούν να σταθεροποιούν δεδομένες δομές όπως τη διπλή έλικα. Η δομή που προτάθηκε από τους Watson και rick έχει δύο ιδιότητες κεφαλαιώδους σημασίας για τον ρόλο του DA ως του γενετικού υλικού. Πρώτον, η δομή είναι συμβατή με την οποιαδήποτε αλληλουχία βάσεων. Τα ζεύγη βάσεων έχουν ουσιαστικά το ίδιο σχήμα (Eικόνα 1.4) και συνεπώς ταιριάζουν πολύ καλά στο κέντρο της διπλής έλικας. Δεύτερον, λόγω των συγκεκριμένων ζευγών, η αλληλουχία των βάσεων στη μία αλυσίδα καθορίζει απόλυτα την αλληλουχία των βάσεων στην άλλη αλυσίδα. Όπως τόσο χαρακτηριστικά έγραψαν οι Ô Ó ÓË (G) K ÙÔÛ ÓË () EIKA 1.2 Η διπλή έλικα. Η δοµή διπλής έλικας του DA που προτάθηκε από τους Watson και rick. Οι κορµοί σακχάρου-φωσφορικού των δύο αλυσίδων είναι µε µπλε και κόκκινο χρώµα ενώ οι βάσεις είναι µε πράσινο, πορφυρό, πορτοκαλί και κίτρινο. EIKA 1.3 Ζεύγη βάσεων σύµφωνα µε τους Watson και rick. Η αδενίνη ζευγαρώνει µε την θυµίνη (Α Τ) και η γουανίνη µε την κυτοσίνη (G ). Οι διακεκοµµένες γραµµές αντιπροσωπεύουν δεσµούς υδρογόνου. K ÚÈÔ ÔÚÌfi ÎÔÚÌfi ÔÚÌfi K ÚÈÔ ÎÔÚÌfi EIKA 1.4 Ζευγάρωµα βάσεων στο DA. Τα ζεύγη βάσεων Α Τ (µπλε) και G (κόκκινο) φαίνονται το ένα επάνω στο άλλο. Τα ζεύγη βάσεων σύµφωνα µε τους Watson και rick έχουν τις ίδιες συνολικές διαστάσεις και το ίδιο σχήµα, πράγµα που τα επιτρέπει να ταιριάζουν άνετα µέσα στη διπλή έλικα.

6 6 ΚΕΦΑΛΑΙΟ 1 Πρελούδιο: Η βιοχηµεία και η επαναστατική καταγραφή γονιδιωµάτων ζώντων οργανισµών ÂÔ- Û ÓÙÂıÂÈÌ ÓÂ Ï Û Â T A G A G G T G G A T T A T A G Watson και rick, «δεν διέλαθε της προσοχής μας ότι ο συγκεκριμένος σχηματισμός ζευγών (βάσεων) που έχουμε προτείνει, αυτόματα εισηγείται και έναν πιθανό μηχανισμό αντιγραφής του γενετικού υλικού». Άρα, αν η διπλή έλικα του DA χωριστεί σε δύο μονές αλυσίδες, κάθε αλυσίδα μπορεί να λειτουργήσει ως εκμαγείο για την παραγωγή και της δεύτερης αλυσίδας της έλικας μέσω του σχηματισμού συγκεκριμένων ζευγών βάσεων (Eικόνα 1.5). Η τριδιάστατη δομή του DA καταδεικνύει υπέροχα τη στενή σχέση μεταξύ μοριακής δομής και λειτουργίας Το RA είναι το ενδιάµεσο µόριο στη ροή των γενετικών πληροφοριών EIKA 1.5 Αντιγραφή του DA. Αν ένα µόριο DA χωριστεί σε δύο µονές αλυσίδες, κάθε αλυσίδα µπορεί να λειτουργήσει ως εκµαγείο για την παραγωγή και της δεύτερης αλυσίδας. G PÈ fi Ë Ú Î ÏË (U) Ένα σημαντικό νουκλεϊκό οξύ εκτός από το DA είναι το ριβονουκλεϊκό οξύ (RA). Μερικοί ιοί χρησιμοποιούν το RA ως το γενετικό υλικό τους, ενώ ακόμη και οι οργανισμοί που χρησιμοποιούν για τον σκοπό αυτό το DA, πρέπει πρώτα να μετατρέψουν τις γενετικές πληροφορίες σε μορφή RA ώστε αυτές να είναι προσβάσιμες ή λειτουργικές. Δομικά, το RA έχει αρκετές ομοιότητες με το DA. Είναι ένα γραμμικό πολυμερές που αποτελείται από έναν περιορισμένο αριθμό επαναλαμβανόμενων μονομερών, το κάθε ένα από τα οποία αποτελείται από σάκχαρο, φωσφορικό και μια βάση. Το σάκχαρο είναι η ριβόζη αντί της δεοξυριβόζης (γι αυτό και RA) και μία από τις τέσσερις βάσεις είναι η ουρακίλη (U) αντί της θυμίνης (Τ). Σε αντίθεση με το DA, το RA υπάρχει συνήθως ως μονή αλυσίδα, παρ όλο που πολλά τμήματα ενός μορίου RΝΑ μπορεί να είναι δίκλωνα, με την G να ζευγαρώνει κυρίως με την και την Α με την U. Το ζευγάρωμα βάσεων αυτής της μορφής παράγει μόρια RΝΑ με πολύπλοκες δομές και σύνθετες δραστικότητες, συμπεριλαμβανομένης της κατάλυσης. Το RA έχει τρεις βασικούς ρόλους στο κύτταρο. Πρώτον, λειτουργεί ως ενδιάμεσο στη ροή των γενετικών πληροφοριών από το DA στις πρωτεΐνες, τα κατ εξοχήν λειτουργικά μόρια του κυττάρου. Το DA αντιγράφεται σε αγγελιαφόρο RA (mra) και το mra μεταφράζεται σε πρωτεΐνη. Δεύτερον, μόρια RA λειτουργούν ως προσαρμοστές, μεταφράζοντας τις πληροφορίες στην αλληλουχία νουκλεοτιδίων του mra σε πληροφορίες οι οποίες καθορίζουν την αλληλουχία των συστατικών των πρωτεϊνών. Τέλος, μόρια RA είναι σημαντικές λειτουργικές συνιστώσες των μοριακών μηχανών που ονομάζονται ριβοσώματα και επιτελούν τη διεργασία της μετάφρασης. Όπως θα συζητηθεί στο Κεφάλαιο 2, η μοναδική θέση του RA μεταξύ της αποθήκευσης των γενετικών πληροφοριών στο DA και της λειτουργικής έκφρασης των πληροφοριών αυτών ως πρωτεϊνών, καθώς και η δυνατότητά του να συνδυάσει γενετικές και καταλυτικές ικανότητες, αποτελούν ενδείξεις ότι το RΝΑ έπαιξε σημαντικό ρόλο στην εξέλιξη της ζωής Οι πρωτεΐνες, που κωδικεύονται από τα νουκλεϊκά οξέα, επιτελούν τις περισσότερες λειτουργίες του κυττάρου Ένας σημαντικός ρόλος για πολλές αλληλουχίες DA είναι να κωδικεύσουν αλληλουχίες πρωτεϊνών, των εργατριών της κυψέλης που λέγεται κύτταρο, συμμετέχοντας ουσιαστικά σε όλες τις διεργασίες του. Ορισμένες πρωτεΐνες είναι σημαντικά δομικά στοιχεία του κυττάρου, ενώ άλλες είναι ειδικοί καταλύτες (ονομάζονται ένζυμα) που προάγουν την περάτωση χημικών αντιδράσεων. Όπως και τα DA και RA, οι πρωτεΐνες είναι γραμμικά πολυμερή. Είναι όμως αρκετά πιο πολύπλοκες από τα νουκλεϊκά οξέα, αφού αποτελούνται από είκοσι (αντί τέσσερις) διαφορετικούς δομικούς λίθους που ονομάζονται αμινοξέα. Οι λειτουργικές ιδιότητες των πρωτεϊνών, όπως και εκείνες άλλων βιομο-

7 DA: Mορφή και λειτουργία AÏÏËÏÔ ÌÈÓÔÍ ˆÓ AÏÏËÏÔ ÌÈÓÔÍ ˆÓ 2 EIKA 1.6 Αναδίπλωση µιας πρωτεΐνης. Η τριδιάστατη δοµή µιας πρωτεΐνης, ενός γραµµικού πολυµερούς αµινοξέων, καθορίζεται από την αλληλουχία των αµινοξέων της. ρίων καθορίζονται από την τριδιάστατη δομή τους. Οι πρωτεΐνες έχουν μια πολύ σημαντική ιδιότητα: μια πρωτεΐνη αναδιπλώνεται αυθόρμητα σε μια πολύπλοκη και καλά καθορισμένη τριδιάστατη δομή, η οποία υπαγορεύεται απόλυτα από την αλληλουχία αμινοξέων στην αλυσίδα της (Eικόνα 1.6). Η αυθόρμητη αναδίπλωση των πρωτεϊνών αποτελεί τη μετάβαση από τον μονοδιάστατο κόσμο των πληροφοριών που περιέχονται σε αλληλουχίες, στον τριδιάστατο κόσμο της βιολογικής λειτουργίας. Αυτή η αξιοθαύμαστη ικανότητα των πρωτεϊνών να συγκροτούνται σε πολύπλοκες δομές είναι υπεύθυνη για τον καθοριστικό ρόλο τους στη βιοχημεία. Πώς λοιπόν μεταφράζεται μια αλληλουχία βάσεων στο DA σε αλληλουχία αμινοξέων κατά μήκος μιας πρωτεϊνικής αλυσίδας; Θα εξετάσουμε αυτό το ζήτημα λεπτομερώς σε επόμενο κεφάλαιο, το σημαντικό όμως εύρημα είναι ότι τρεις βάσεις κατά μήκος της αλυσίδας DA/RA κωδικεύουν ένα αμινοξύ. Η συγκεκριμένη αντιστοιχία μεταξύ ενός συνδυασμού τριών βάσεων και κάποιου από τα 20 αμινοξέα ονομάζεται γενετικός κώδικας. Όπως η χρήση του DA ως γενετικού υλικού είναι ουσιαστικά καθολική, έτσι και ο γενετικός κώδικας: οι ίδιες αλληλουχίες τριών βάσεων κωδικεύουν τα ίδια αμινοξέα σε όλες τις μορφές της ζωής, από τους μικροοργανισμούς μέχρι τους πολύπλοκους πολυκύτταρους οργανισμούς, όπως είναι ο άνθρωπος. Η γνώση των δομικών και λειτουργικών ιδιοτήτων των πρωτεϊνών είναι τελείως απαραίτητη για την κατανόηση της σημασίας των αλληλουχιών στο ανθρώπινο γονιδίωμα. Παραδείγματος χάριν, η αλληλουχία στην αρχή του κεφαλαίου αυτού αντιστοιχεί σε μια περιοχή του γονιδιώματος που διαφέρει σε άτομα που εμφανίζουν την κληρονομούμενη κυστική ίνωση. Η πιο κοινή μετάλλαξη που προκαλεί κυστική ίνωση είναι η απώλεια τριών διαδοχικών θυμινών από την αλληλουχία του γονιδίου, ώστε να χαθεί ένα αμινοξύ σε μια πρωτεϊνική αλυσίδα μήκους 1480 αμινοξέων. Αυτή η φαινομενικά αθώα διαφορά απώλεια 1 αμινοξέος από σχεδόν 1500 προκαλεί μια κατάσταση που απειλεί τη ζωή του ατόμου-φορέα. Ποια είναι η κανονική λειτουργία της πρωτεΐνης που κωδικεύεται από το γονίδιο αυτό; Ποιες ιδιότητες της πρωτεΐνης αυτής αναιρούνται λόγω αυτού του φαινομενικά αθώου ελαττώματος; Μπορούμε να χρησιμοποιήσουμε τις γνώσεις αυτές για να επινοήσουμε νέες αγωγές κατά της νόσου; Οι ερωτήσεις αυτές ανήκουν στη σφαίρα μελέτης της βιοχημείας. Η γνώση των αλληλουχιών του ανθρώπινου γονιδιώματος θα επιταχύνει τον ρυθμό με τον οποίο γίνονται οι συσχετισμοί μεταξύ αλληλουχιών DA και νόσων καθώς και μεταξύ άλλων ανθρώπινων χαρακτηριστικών. Όμως, οι συσχετισμοί αυτοί θα είναι σχεδόν χωρίς νόημα, αν δεν χρησιμοποιηθεί η απαραίτητη βιοχημική γνώση ώστε να ερμηνευθούν και να γίνει η αρμόζουσα αξιοποίησή τους. Κυστική ίνωση Νόσος που προκαλείται από τη µειωµένη έκκριση υγρού και άλατος από µια µεταφορική πρωτεΐνη που ονοµάζεται ινοκυστικός ρυθµιστής της µεµβρανικής αγωγιµότητας (FTR, cystic fibrosis transmembrane conductance regulator). Ως αποτέλεσµα της βλάβης αυτής παρεµποδίζεται η έκκριση από το πάγκρεας και συσσωρεύεται πηκτή και αφυδατωµένη βλέννα στους πνεύµονες, γεγονός που οδηγεί σε χρόνιες πνευµονικές λοιµώξεις.

8 8 ΚΕΦΑΛΑΙΟ 1 Πρελούδιο: Η βιοχηµεία και η επαναστατική καταγραφή γονιδιωµάτων ζώντων οργανισµών EIKA 1.7 Η ποικιλοµορφία των ζώντων οργανισµών. Οι διαφορετικές µορφολογίες των τριών οργανισµών που φαίνονται στις φωτογραφίες ένα φυτό (ο πράσινος ελλέβορος) και δύο ζώα (ο αχινός και η γάτα) ίσως παραπέµπουν στο ότι δεν έχουν τίποτε κοινό µεταξύ τους. Εµφανίζουν όµως ένα αξιοσηµείωτο κοινό σύνολο βιοχηµικών µηχανισµών που αποτελεί ένδειξη για την κοινή καταγωγή τους. [(Αριστερά και δεξιά) John Dudak/Phototake, (κέντρο) Jeffrey L. Rotman/Peter Arnold.] 1.2 ΤΟ ΕΝΙΑΙΟ ΤΩΝ ΒΙΟΧΗΜΙΚΩΝ ΙΕΡΓΑΣΙΩΝ ΕΙΝΑΙ ΤΟ ΥΠΟΒΑΘΡΟ ΤΗΣ ΒΙΟΛΟΓΙΚΗΣ ΠΟΙΚΙΛΟΜΟΡΦΙΑΣ Η θαυμαστή ποικιλομορφία των ζώντων οργανισμών (Eικόνα 1.7) κρύβει εκπληκτικές ομοιότητες. Η κοινή χρήση του DA και του γενετικού κώδικα από όλους τους οργανισμούς υπογραμμίζει μια από τις εκπληκτικότερες ανακαλύψεις του περασμένου αιώνα συγκεκριμένα ότι οι ζώντες οργανισμοί έχουν αξιοσημείωτες ομοιότητες στο μοριακό επίπεδο. Όλοι οι οργανισμοί δομούνται από παρόμοια μοριακά συστατικά τα οποία εμφανίζουν σχετικά μικρές διαφορές από έναν οργανισμό στον άλλο. Αυτή η ομοιομορφία στο μοριακό επίπεδο αποκαλύπτει ότι όλοι οι οργανισμοί στη Γη έχουν προκύψει από έναν κοινό πρόγονο. Ένας πυρήνας από απαραίτητες βιοχημικές διεργασίες, κοινές για όλους τους οργανισμούς, εμφανίστηκε πολύ νωρίς κατά την εξέλιξη της ζωής. Η ποικιλομορφία των ζώντων οργανισμών στον σύγχρονο κόσμο έχει δημιουργηθεί από εξελικτικές διεργασίες οι οποίες επέδρασαν σε αυτόν τον πυρήνα βιοχημικών διεργασιών για εκατομμύρια, ή ακόμη, δισεκατομμύρια χρόνια. Όπως θα δούμε κατ επανάληψη, η δημιουργία ποικιλομορφίας στους οργανισμούς πολύ συχνά έχει προκύψει από την προσαρμογή των υπαρχόντων βιοχημικών στοιχείων σε καινούργιους ρόλους, παρά από την ανάπτυξη θεμελιακά νέας βιοχημικής τεχνολογίας. Η εκπληκτική ομοιομορφία της ζωής στο μοριακό επίπεδο προσφέρει στον φοιτητή της βιοχημείας μια ιδιαίτερα καθαρή άποψη για την ουσία των βιολογικών διεργασιών, η οποία έχει εφαρμογή σε όλους τους οργανισμούς, από τον άνθρωπο μέχρι και τους απλούστερους μικροοργανισμούς. EIKA 1.8 Το δένδρο της ζωής. Από την ανάλυση των αλληλουχιών βάσεων στο DA, µπορεί να καταρτιστεί µια πιθανή εξελικτική πορεία από ένα κοινό προγονικό κύτταρο σε µια ποικιλία ειδών που υπάρχουν στον σηµερινό κόσµο. Escherichia BAKTPIA EYKAPYA APXAIA Salmonella Bacillus ÕÓıÚˆappleÔ Saccharomyces Zea Με βάση τα βιοχημικά χαρακτηριστικά τους, οι ποικίλοι οργανισμοί στον σύγχρονο κόσμο είναι δυνατόν να χωριστούν σε τρεις θεμελιώδεις ομάδες, που ονομάζονται επικράτειες (domains): τα ευκάρυα (ευκαρυωτικά), τα βακτήρια (πρώην ευβακτήρια) και τα αρχαία (πρώην αρχαιοβακτήρια). Τα ευκάρυα απαρτίζονται από όλους τους μακροσκοπικούς οργανισμούς, συμπεριλαμβανομένου του ανθρώπου, καθώς και από πολλούς μικροσκοπικούς οργανισμούς, όπως είναι οι ζυμομύκητες. Το καθοριστικό χαρακτηριστικό των ευκαρυωτικών οργανισμών είναι η παρουσία ενός πολύ καλά καθορισμένου πυρήνα μέσα σε κάθε κύτταρο. Μονοκύτταροι οργανισμοί που δεν έχουν πυρήνα, όπως π.χ. τα βακτήρια, ονομάζονται προκαρυωτικοί. Οι οργανισμοί αυτοί ταξινομήθηκαν εκ νέου σε δύο χωριστές επικράτειες μετά την ανακάλυψη του arl Woese το 1997 ότι ορισμένοι βακτηριοειδείς οργανισμοί είναι αρκετά διαφορετικοί από τα καλώς χαρακτηρισμένα βακτηριακά είδη. Οι οργανισμοί αυτοί, που θεωρείται σήμερα ότι απέκλιναν αρκετά από τα βακτήρια στην αρχή της εξέλιξης, είναι τα αρχαία. Οι εξελικτικές πορείες από έναν κοινό πρόγονο μέχρι τους σύγχρονους οργανισμούς εί- Methanocuccus Archaeoglobus alobacterium

9 ναι δυνατόν να αναπτυχθούν και να αναλυθούν με βάση τις βιοχημικές πληροφορίες για κάθε οργανισμό. Μια τέτοια πορεία φαίνεται στην Εικόνα 1.8. Εξετάζοντας τη βιοχημεία στο πλαίσιο του δένδρου της ζωής, μπορούμε συχνά να κατανοήσουμε με ποιον τρόπο συγκεκριμένα μόρια ή διεργασίες βοήθησαν οργανισμούς να προσαρμοστούν σε συγκεκριμένους τρόπους ζωής ή περιβάλλοντα. Μπορούμε μάλιστα να θέσουμε το ερώτημα όχι μόνον ποιες βιοχημικές διεργασίες είχαν λάβει χώρα, αλλά και γιατί συγκεκριμένες στρατηγικές εμφανίστηκαν στην πορεία της εξέλιξης. Εκτός από το να αποτελούν πολύτιμα ιστορικά τεκμήρια, οι απαντήσεις σε τέτοια ερωτήματα συχνά παρέχουν σημαντικές πληροφορίες αναφορικά με τη βιοχημεία των σύγχρονων ζώντων οργανισμών. 9 Οι χηµικοί δεσµοί στη βιοχηµεία 1.3 ΟΙ ΧΗΜΙΚΟΙ ΕΣΜΟΙ ΣΤΗ ΒΙΟΧΗΜΕΙΑ Η ουσία των βιολογικών διεργασιών η βάση, δηλαδή, της ομοιότητας των ζώντων οργανισμών είναι στην πιο θεμελιώδη σημασία της οι μοριακές αλληλεπιδράσειςø με άλλα λόγια, οι χημικές διεργασίες που λαμβάνουν χώρα μεταξύ μορίων. Η βιοχημεία είναι η χημεία που εμφανίζεται μέσα στους ζώντες οργανισμούς. Για να κατανοήσουμε πραγματικά τη βιοχημεία πρέπει να κατανοήσουμε τον σχηματισμό των χημικών δεσμών. Κάνουμε εδώ μια ανασκόπηση των δεσμών οι οποίοι είναι σημαντικοί για τις βιοχημικές ουσίες καθώς και τους μετασχηματισμούς των δεσμών αυτών. Οι πιο ισχυροί δεσμοί που υπάρχουν στις βιοχημικές ουσίες είναι οι ομοιοπολικοί δεσμοί, όπως είναι οι δεσμοί μεταξύ των ατόμων που διατηρούν ως ένα μόριο τις αζωτούχες βάσεις της Εικόνας 1.3. Ο ομοιοπολικός δεσμός σχηματίζεται από το μοίρασμα ενός ζεύγους ηλεκτρονίων μεταξύ γειτονικών ατόμων. Ένας συνήθης ομοιοπολικός δεσμός άνθρακα-άνθρακα ( ) έχει μήκος δεσμού 1,54 Å και ενέργεια δεσμού 85 kcal mol 1 (356 kj mol 1 ). Επειδή η ενέργεια αυτή είναι σχετικά μεγάλη, χρειάζεται αρκετή ενέργεια για τη διάσπαση ομοιοπολικών δεσμών. Σε περιπτώσεις που δύο άτομα μοιράζονται περισσότερα του ενός ζεύγη ηλεκτρονίων, σχηματίζονται πολλαπλοί ομοιοπολικοί δεσμοί. Παραδείγματος χάριν, τρεις βάσεις στην Εικόνα 1.3 περιέχουν διπλό δεσμό άνθρακα-οξυγόνου (=). Οι δεσμοί αυτοί είναι ακόμη πιο ισχυροί από τους απλούς δεσμούς, με ενέργεια περίπου 175 kcal mol 1 (732 kj mol 1 ). Για ορισμένα μόρια μπορεί να υπάρξουν περισσότερα του ενός σχήματα ομοιοπολικών δεσμών. Παραδείγματος χάριν, το βενζόλιο μπορεί να γραφτεί κατά δύο ισοδύναμους τρόπους που ονομάζονται δομές συντονισμού. Η πραγματική δομή του βενζολίου είναι η συνισταμένη αυτών των δύο δομών. Κάθε μόριο που μπορεί να γραφτεί ως η συνισταμένη δύο ή περισσότερων δομών συντονισμού περίπου ίδιας ενέργειας η κάθε μία, έχει μεγαλύτερη σταθερότητα από ό,τι μόρια χωρίς πολλαπλές δομές συντονισμού. Άρα, λόγω των δομών συντονισμού το βενζόλιο είναι ασυνήθιστα σταθερό μόριο. ι χημικές αντιδράσεις αφορούν τη διάσπαση και τον σχηματισμό ομοιοπολικών δεσμών. Η ροή ηλεκτρονίων κατά την πορεία μιας αντίδρασης μπορεί να απεικονιστεί με καμπύλα βέλη, μια μέθοδος αναπαράστασης που ονομάζεται «σπρώξιμο βελών». Κάθε βέλος αντιπροσωπεύει ένα ζεύγος ηλεκτρονίων. ÔÌ Û ÓÙÔÓÈÛÌÔ ÙÔ ÂÓ ÔÏ Ô +

10 10 ΚΕΦΑΛΑΙΟ 1 Πρελούδιο: Η βιοχηµεία και η επαναστατική καταγραφή γονιδιωµάτων ζώντων οργανισµών q 1 q 2 fiùë ÂÛÌÔ ÚÔÁfiÓÔ δ δ + δ ÎÙË ÂÛÌÔ ÚÔÁfiÓÔ EIKA 1.9 εσµοί υδρογόνου µε τη συµµετοχή ατόµων αζώτου και οξυγόνου. Φαίνονται οι θέσεις των µερικών φορτίων (δ + και δ ). r Στις αντιστρεπτές αλληλεπιδράσεις µεταξύ των βιοµορίων µεσολαβούν τρία είδη µη οµοιοπολικών δεσµών ι άμεσα αντιστρεπτές μη ομοιοπολικές μοριακές αλληλεπιδράσεις βρίσκονται στο κέντρο του χορού της ζωής. Τέτοιες ασθενείς μη ομοιοπολικές δυνάμεις παίζουν σημαντικούς ρόλους στην πιστή αντιγραφή του DA, την αναδίπλωση των πρωτεϊνών σε περίπλοκα τριδιάστατα σχήματα, την εξειδικευμένη αναγνώριση υποστρωμάτων από ένζυμα και την ανίχνευση μοριακών σημάτων. Πράγματι, όλες οι βιολογικές δομές και διεργασίες εξαρτώνται τόσο από τις μη ομοιοπολικές αλληλεπιδράσεις όσο και από τις ομοιοπολικές. ι τρεις βασικοί μη ομοιοπολικοί δεσμοί είναι οι ηλεκτροστατικές αλληλεπιδράσεις (electrostatic interactions), οι δεσμοί υδρογόνου (hydrogen bonds) και οι αλληλεπιδράσεις van der Waals. Διαφέρουν μεταξύ τους στη διαμόρφωση, την ένταση και την εξειδίκευση. Aκόμη, οι δεσμοί αυτοί επηρεάζονται σημαντικά, αν και με διαφορετικό τρόπο ο κάθε ένας, από την ύπαρξη νερού. Aς δούμε λοιπόν τα χαρακτηριστικά τους. 1. λεκτροστατικές αλληλεπιδράσεις. Mια ηλεκτροστατική αλληλεπίδραση εξαρτάται από τα ηλεκτρικά φορτία των ατόμων. ενέργεια μιας ηλεκτροστατικής αλληλεπίδρασης δίνεται από τον νόμο του oulomb: Ε = kq 1 q 2 /Dr όπου Ε είναι η ενέργεια, q 1 και q 2 είναι τα φορτία των δύο ατόμων (σε μονάδες ηλεκτρονικού φορτίου), r είναι η απόσταση μεταξύ τους (σε angstroms), D είναι η διηλεκτρική σταθερά του μέσου και k μια σταθερά (ίση με 332, για να προκύψει ενέργεια σε kcal mol 1, ή 1389, για να προκύψει ενέργεια σε kj mol 1 ). Άρα η ηλεκτροστατική αλληλεπίδραση μεταξύ δύο ατόμων τα οποία έχουν φορτία +1 και 1 και απέχουν μεταξύ τους 3 Å σε υδάτινο περιβάλλον (όπου η διηλεκτρική σταθερά ισούται με 80), έχει ενέργεια ίση με 1,4 kcal mol 1 (5,9 kj mol 1 ). 2. Δεσμοί υδρογόνου. Οι δεσμοί υδρογόνου είναι σχετικά ασθενείς αλληλεπιδράσεις οι οποίες μολαταύτα είναι κρίσιμες για βιολογικά μακρομόρια όπως είναι οι πρωτεΐνες και το DA. Οι αλληλεπιδράσεις αυτές είναι επίσης υπεύθυνες για πολλές από τις ιδιότητες του νερού οι οποίες το καθιστούν έναν ιδιαίτερα πολυσχιδή διαλύτη. Σε έναν δεσμό υδρογόνου, ένα άτομο υδρογόνου μοιράζεται μεταξύ δύο άλλων σχετικά ηλεκτροαρνητικών ατόμων, όπως π.χ. οξυγόνου και αζώτου. Ο δότης δεσμού υδρογόνου είναι η ομάδα εκείνη που περιέχει τόσο το άτομο υδρογόνου όσο και το άτομο στο οποίο το υδρογόνο είναι πιο σθεναρά δεσμευμένο. Αντίθετα, ο δέκτης δεσμού υδρογόνου είναι το άτομο με την ασθενέστερη δέσμευση στο υδρογόνο (Eικόνα 1.9). ι δεσμοί υδρογόνου είναι ουσιαστικά ηλεκτροστατικές αλληλεπιδράσεις. Το σχετικά πιο ηλεκτροαρνητικό άτομο στο οποίο το υδρογόνο είναι δεσμευμένο ομοιοπολικά έλκει τα ηλεκτρόνια του δεσμού μακριά από το άτομο υδρογόνου, ώστε το τελευταίο να αναπτύσσει μερικώς θετικό φορτίο (δ + ). Άρα μπορεί να αλληλεπιδράσει ηλεκτροστατικά με άτομο το οποίο έχει μερικώς αρνητικό φορτίο (δ ). ι δεσμοί υδρογόνου είναι πολύ ασθενέστεροι από τους ομοιοπολικούς δεσμούς. Οι ενέργειές τους κυμαίνονται από 1-3 kcal mol 1 (4-13 kj mol 1 ) σε σύγκριση με τα περίπου 100 kcal mol 1 (418 kj mol 1 ) για ομοιοπολικό δεσμό άνθρακα-υδρογόνου. Tο μήκος ενός δεσμού υδρογόνου είναι κάπως μεγαλύτερο από εκείνο του ομοιοπολικού δεσμού. Τα μήκη των δεσμών υδρογόνου (από το άτομο υδρογόνου) κυμαίνονται μεταξύ 1,5 και 2,6 Å. Άρα, σε έναν δεσμό υδρογόνου τα δύο άτομα εκτός του ατόμου υδρογόνου έχουν μεταξύ τους απόσταση από 2,4 έως 3,5 Å. ι πιο ισχυροί δεσμοί υδρογόνου έχουν την τάση να είναι σχεδόν ευθείς, δηλαδή τα άτομα του υδρογόνου, του δότη και του δέκτη δεσμού υδρογόνου βρίσκονται σε ευθεία γραμμή.

11 3. Αλληλεπιδράσεις van der Waals. Η βάση των αλληλεπιδράσεων van der Waals είναι το ότι η κατανομή των ηλεκτρονικών φορτίων γύρω από ένα άτομο αλλάζει με την πάροδο του χρόνου. Σε μια δεδομένη στιγμή, η κατανομή του φορτίου δεν είναι απολύτως συμμετρική. Aυτή η πρόσκαιρη ασύμμετρη κατανομή ηλεκτρονικών φορτίων γύρω από ένα άτομο προκαλεί, μέσω ηλεκτροστατικών αλληλεπιδράσεων, μια συμπληρωματική ασυμμετρία στην κατανομή ηλεκτρονίων γύρω από τα γειτονικά του άτομα. συνεπαγόμενη έλξη μεταξύ ενός ζεύγους ατόμων αυξάνεται καθώς αυτά πλησιάζουν, μέχρι να φθάσουν στην απόσταση επαφής van der Waals (Eικόνα 1.10). Σε αποστάσεις μικρότερες από αυτήν αναπτύσσονται πολύ ισχυρές απωστικές δυνάμεις, διότι τα εξωτερικά νέφη των ηλεκτρονίων αλληλοεπικαλύπτονται. ενέργεια που σχετίζεται με την αλληλεπίδραση van der Waals είναι πολύ μικρή. Οι συνήθεις αλληλεπιδράσεις συνεισφέρουν 0,5 έως 1,0 kcal mol 1 (από 2-4 kj mol 1 ) ανά ζεύγος ατόμων. Ωστόσο, όταν οι επιφάνειες δύο μεγάλων μορίων πλησιάζουν, τότε ένας μεγάλος αριθμός ατόμων είναι σε επαφή van der Waals μεταξύ τους, οπότε η προκύπτουσα ενέργεια, αθροιζόμενη για πολλά ζεύγη ατόμων, μπορεί να είναι σημαντική Οι ιδιότητες του νερού επηρεάζουν τις ικανότητες των βιοµορίων για σχηµατισµό δεσµών EÓ ÚÁÂÈ ŒÏÍË ÕappleˆÛË fiùë ÚÔÁfiÓÔ 0 11 Οι χηµικοί δεσµοί στη βιοχηµεία 0,9 Å 2,0 Å 180 ÎÙË ÚÔÁfiÓÔ applefiûù ÛË Âapple Ê van der Waals AapplefiÛÙ ÛË Οι ασθενείς αλληλεπιδράσεις είναι τα κατ εξοχήν μέσα με τα οποία τα μόρια αλληλεπιδρούν μεταξύ τους ένζυμα με τα υποστρώματά τους, ορμόνες με τους υποδοχείς τους, αντισώματα με τα αντιγόνα τους. Η ισχύς και η εξειδίκευση των ασθενών αλληλεπιδράσεων εξαρτώνται σε πολύ μεγάλο βαθμό από τη φύση του μέσου στο οποίο λαμβάνουν χώρα. Ας σημειωθεί ότι η πλειονότητα των βιολογικών αλληλεπιδράσεων λαμβάνουν χώρα στο νερό. Δύο ιδιότητες του νερού είναι ιδιαίτερα σημαντικές από βιολογική άποψη. 1. Tο νερό είναι πολικό μόριο. Tο σχήμα του μορίου είναι τριγωνικό και όχι ευθύγραμμο και, επομένως, υπάρχει ασύμμετρη κατανομή φορτίων. πυρήνας του οξυγόνου έλκει ηλεκτρόνια μακριά από τους πυρήνες του υδρογόνου και αφήνει την περιοχή γύρω από τους πυρήνες θετικά φορτισμένη. Έτσι, το μόριο του ύδατος είναι μια ηλεκτρικά πολωμένη ένωση. EIKA 1.10 Η ενέργεια µιας αλληλεπίδρασης van der Waals κατά την προσέγγιση δύο ατό- µων. Η ενέργεια έχει την πιο ευνοϊκή τιµή όταν η απόσταση µεταξύ των πυρήνων ισούται µε την απόσταση (ακτίνα) επαφής van der Waals. Η προσέγγιση των ατόµων σε απόσταση µικρότερη από αυτήν οδηγεί σε ραγδαία αύξηση της ενέργειας λόγω των απώσεων µεταξύ ηλεκτρονίων Tο νερό έχει πολύ μεγάλη συνοχή. Τα μόρια του ύδατος αλληλεπιδρούν σθεναρά μέσω δεσμών υδρογόνου. Οι αλληλεπιδράσεις αυτές είναι εμφανείς στη δομή του πάγου (Eικόνα 1.11). Η δομή διατηρείται μέσω δικτύων δεσμών υδρογόνου. Tο νερό στην υγρή κατάσταση εμφανίζει παρόμοιες αλληλεπιδράσεις, εξηγώντας έτσι τη συνεκτικότητα του νερού, αν και στην κατάσταση αυτή έχουν διασπαστεί κάποιοι δεσμοί υδρογόνου. Η πολύ υψηλή συνεκτικότητα του νερού επηρεάζει εντυπωσιακά τις αλληλεπιδράσεις μεταξύ μορίων σε υδάτινα διαλύματα. Ποια είναι η επίδραση των ιδιοτήτων του νερού στις ασθενείς αλληλεπιδράσεις που συζητήσαμε στο Εδάφιο 1.3.1; πολικότητα και η δυνατότητα του νερού να σχηματίζει δεσμούς υδρογόνου επιτρέπουν στο μόριο ύδατος να αλληλεπιδρά πολύ εύκολα με άλλα μόρια. Tο νερό είναι ένας εκπληκτικός διαλύτης για πολικά μόρια. λόγος είναι ότι το νερό αποδυναμώνει τις ηλεκτροστατικές δυνάμεις και τους δεσμούς υδρογόνου μεταξύ πολικών μορίων με το να συναγωνίζεται τις θέσεις της μεταξύ τους έλξης. Παραδείγματος χάριν, ας σκεφθούμε τη δράση του νε- EIKA 1.11 οµή του πάγου. εσµοί υδρογόνου (που φαίνονται εδώ ως διακεκοµµένες γραµµές) σχηµατίζονται µεταξύ µορίων ύδατος.

12 12 ΚΕΦΑΛΑΙΟ 1 Πρελούδιο: Η βιοχηµεία και η επαναστατική καταγραφή γονιδιωµάτων ζώντων οργανισµών ρού στη δημιουργία δεσμού υδρογόνου μεταξύ καρβονυλίου και αμιδικής ομάδας. Tο άτομο υδρογόνου ενός μορίου ύδατος μπορεί να αντικαταστήσει το αμιδικό υδρογόνο ως δότης δεσμού υδρογόνου, ενώ το άτομο οξυγόνου του μορίου του ύδατος μπορεί να αντικαταστήσει το καρβονυλικό οξυγόνο ως δέκτης δεσμού υδρογόνου. Eπομένως, ένας ισχυρός δεσμός υδρογόνου μεταξύ μιας ομάδας και μιας ομάδας σχηματίζεται μόνον αν απομακρυνθεί το νερό. Η διηλεκτρική σταθερά του νερού ισούται με 80, άρα το νερό ελαττώνει την ισχύ των ηλεκτροστατικών αλληλεπιδράσεων κατά έναν παράγοντα 80, συγκριτικά με αντίστοιχες αλληλεπιδράσεις υπό κενό. Tο νερό έχει μια ασυνήθιστα υψηλή διηλεκτρική σταθερά λόγω της πολικότητάς του και της ικανότητάς του να σχηματίζει προσανατολισμένα περιβλήματα διαλύτη γύρω από τα ιόντα. Aυτά τα προσανατολισμένα περιβλήματα διαλύτη δημιουργούν δικά τους ηλεκτρικά πεδία που αντιστέκονται στα πεδία που δημιουργούνται από τα ιόντα. Eπομένως, η παρουσία νερού προκαλεί αξιοσημείωτη εξασθένιση των ηλεκτροστατικών έλξεων μεταξύ ιόντων. ύπαρξη της ζωής στη Γη εξαρτάται σημαντικά από την ικανότητα του νερού να διαλύει ένα σύνολο μορίων που χρησιμεύουν ως καύσιμα, δομικά μόρια, καταλύτες και φορείς πληροφοριών. Στο νερό, μπορούν να συνυπάρχουν υψηλές συγκεντρώσεις των μορίων αυτών, τα οποία είναι ελεύθερα να διαχέονται και να συναντώνται. Παρ όλα αυτά, η εξαιρετική διαλυτότητα στο νερό δημιουργεί προβλήματα, διότι εξασθενίζει τις αλληλεπιδράσεις πολικών μορίων. Στα βιολογικά συστήματα, τα προβλήματα αυτά έχουν λυθεί με το να δημιουργηθούν μικροπεριβάλλοντα ελεύθερα νερού, όπου οι πολικές αλληλεπιδράσεις εμφανίζουν τη μέγιστη τιμή. Θα συναντήσουμε πολλά παραδείγματα της σημασίας που έχουν τέτοιες ειδικές κατασκευές για τα πρωτεϊνικά μόρια. Επιπλέον, η παρουσία του νερού με την πολική του φύση επιτρέπει και σε ένα άλλο είδος ασθενών αλληλεπιδράσεων να λάβουν χώρα, εκείνο που ωθεί την αναδίπλωση των πρωτεϊνών (Εδάφιο 1.3.4) και τον σχηματισμό κυτταρικών ορίων (Υποκεφάλαιο 12.4). Η ουσία των αλληλεπιδράσεων αυτών, όπως και όλων των αλληλεπιδράσεων στη βιοχημεία, είναι η ενέργεια. Για να κατανοήσουμε ένα μεγάλο μέρος της βιοχημείας τον σχηματισμό δεσμών, τη μοριακή δομή, την ενζυμική κατάλυση πρέπει να κατανοήσουμε το μέγεθος που λέγεται ενέργεια. Η θερμοδυναμική μάς παρέχει ένα πολύτιμο εργαλείο για να προσεγγίσουμε το θέμα. Θα επανέλθουμε στο θέμα αυτό με περισσότερες λεπτομέρειες όταν εξετάσουμε τα ένζυμα (Κεφάλαιο 8) και τις βασικές έννοιες του μεταβολισμού (Κεφάλαιο 14) Η εντροπία και οι νόµοι της θερµοδυναµικής Το υψηλό επίπεδο οργάνωσης των ζώντων οργανισμών είναι εμφανές και μας αφήνει κατάπληκτους. Η οργάνωση αυτή αρχίζει από το επίπεδο του οργανισμού και φθάνει μέχρι το κυτταρικό και το μοριακό επίπεδο. Πράγματι, οι βιολογικές διεργασίες μπορεί να φαίνονται μαγικές, αφού από τον χαοτικό και ακανόνιστο κόσμο των άψυχων πραγμάτων προκύπτουν καλά καθορισμένες δομές και σχήματα. Ωστόσο, η οργάνωση που είναι εμφανής σε ένα κύτταρο ή

13 ένα μόριο προέρχεται από βιολογικές διεργασίες οι οποίες υπόκεινται στους ίδιους φυσικούς νόμους που διέπουν όλες τις διεργασίες συγκεκριμένα, τους νόμους της θερμοδυναμικής. Πώς μπορούμε να καταλάβουμε τη δημιουργία τάξης εκεί που υπήρχε χάος; Αρχίζουμε σημειώνοντας ότι οι νόμοι της θερμοδυναμικής κάνουν διάκριση μεταξύ ενός συστήματος και του περιβάλλοντός του. Ως σύστημα θεωρούμε την ύλη που βρίσκεται σε μια καλά καθορισμένη περιοχή του χώρου. Η ύλη στο υπόλοιπο σύμπαν θεωρείται ως το περιβάλλον. Σύμφωνα με τον πρώτο νόμο της θερμοδυναμικής, η συνολική ενέργεια ενός συστήματος και του περιβάλλοντός του παραμένει σταθερή. Με άλλα λόγια, η ενέργεια που υπάρχει στο σύμπαν παραμένει σταθερή. Δεν είναι δυνατόν να παραχθεί ενέργεια από το μηδέν, αλλά ούτε και να εκμηδενιστεί μια ποσότητα ενέργειας. Ωστόσο, η ενέργεια μπορεί να έχει διαφορετικές μορφές. Η θερμότητα, παραδείγματος χάριν, είναι μια μορφή ενέργειας. Η θερμότητα είναι η έκφραση της κινητικής ενέργειας που σχετίζεται με την τυχαία κίνηση των μορίων. Εναλλακτικά, η ενέργεια μπορεί να εμφανιστεί ως δυναμική ενέργεια, αναφερόμενη στη δυνατότητα απελευθέρωσης αυτής της ενέργειας λόγω κάποιας διεργασίας. Ας βάλουμε, παραδείγματος χάριν, μια μπάλα στην κορυφή ενός πύργου. Η μπάλα αυτή έχει αξιοσημείωτη δυναμική ενέργεια διότι όταν αφεθεί θα αποκτήσει αρκετή κινητική ενέργεια λόγω της πτώσης της. Σε χημικά συστήματα, η δυναμική ενέργεια έχει σχέση με τη δυνατότητα ατόμων να αντιδράσουν μεταξύ τους. Παραδείγματος χάριν, ένα μείγμα βενζίνης και οξυγόνου έχει μεγάλη δυναμική ενέργεια, διότι η μεταξύ τους αντίδραση παράγει διοξείδιο του άνθρακα και απελευθερώνει ενέργεια ως θερμότητα. Ο πρώτος νόμος της θερμοδυναμικής απαιτεί η ενέργεια που απελευθερώνεται από τον σχηματισμό κάποιων δεσμών να χρησιμοποιηθεί για τη διάσπαση κάποιων άλλων δεσμών, ή να απελευθερωθεί ως θερμότητα, ή να αποθηκευθεί με μια άλλη μορφή ενέργειας. Μια άλλη σημαντική έννοια της θερμοδυναμικής είναι εκείνη της εντροπίας. Η εντροπία είναι ένα μέτρο της τυχαιότητας ή της αταξίας ενός συστήματος. Σύμφωνα με τον δεύτερο νόμο της θερμοδυναμικής, η συνολική εντροπία ενός συστήματος και του περιβάλλοντός του πάντοτε αυξάνεται σε μια αυθόρμητη διεργασία. Εκ πρώτης όψεως, ο νόμος αυτός φαίνεται να αντιβαίνει στην κοινή εμπειρία μας, ιδιαίτερα σε ό,τι αφορά τα βιολογικά συστήματα. Πολλές βιολογικές διεργασίες, όπως είναι η δημιουργία μιας πολύ καλά καθορισμένης δομής, π.χ. ενός φύλλου, που ξεκινά από το διοξείδιο του άνθρακα και άλλες θρεπτικές ουσίες, οπωσδήποτε αυξάνουν την τάξη και μειώνουν την εντροπία. Η εντροπία μπορεί να μειωθεί σε τοπικό επίπεδο κατά τον σχηματισμό τόσο καλά καθορισμένων δομών, ταυτόχρονα όμως η εντροπία στο υπόλοιπο σύμπαν αυξάνεται κατά την ίδια ή μεγαλύτερη ποσότητα, λόγω αυτής της ίδιας της διεργασίας. Ένα παράδειγμα ίσως βοηθήσει στην κατανόηση των νόμων της θερμοδυναμικής στα χημικά συστήματα. Ας πάρουμε ένα δοχείο που περιέχει δύο γραμμομόρια αερίου υδρογόνου στη μία πλευρά του και ένα γραμμομόριο αερίου οξυγόνου στην άλλη (Eικόνα 1.12). Αν απομακρυνθεί το χώρισμα, τα αέρια θα αναμειχθούν αυθόρμητα ώστε να σχηματιστεί ένα ομοιογενές μείγμα. Η διεργασία της ανάμειξης αυξάνει την εντροπία, διότι μια καλά διαχωρισμένη διάταξη αντικαθίσταται από μια ακανόνιστη. 13 Οι χηµικοί δεσµοί στη βιοχηµεία EIKA 1.12 Από την τάξη στην αταξία. Η αυθόρµητη ανάµειξη αερίων ωθείται από την αύξηση της εντροπίας.

14 14 ΚΕΦΑΛΑΙΟ 1 Πρελούδιο: Η βιοχηµεία και η επαναστατική καταγραφή γονιδιωµάτων ζώντων οργανισµών Άλλες διεργασίες μέσα στο σύστημα αυτό μπορούν να μειώσουν την εντροπία σε τοπικό επίπεδο, αυξάνοντάς την όμως σε επίπεδο περιβάλλοντος. Ένας σπινθήρας στο μείγμα υδρογόνου και οξυγόνου πυροδοτεί τη χημική αντίδραση κατά την οποία τα δύο αέρια μετατρέπονται σε υδρατμούς: n 2 2 Αν η θερμοκρασία του συστήματος διατηρηθεί σταθερή, τότε η εντροπία του συστήματος μειώνεται διότι τα τρία γραμμομόρια δύο διαφορετικών αερίων έχουν αντικατασταθεί από δύο γραμμομόρια ενός και μόνον προϊόντος. Το αέριο τώρα αποτελείται από ένα ομοιόμορφο σύνολο μορίων που δεν διακρίνονται μεταξύ τους. Ωστόσο, η αντίδραση απελευθερώνει μια αξιοσημείωτη ποσότητα θερμότητας στο περιβάλλον, η οποία αυξάνει την εντροπία των μορίων του περιβάλλοντος αυξάνοντας την τυχαία κίνησή τους. Η αύξηση της εντροπίας του περιβάλλοντος είναι αρκετή ώστε να επιτρέψει τον αυθόρμητο σχηματισμό υδρατμών από το υδρογόνο και το οξυγόνο (Εικόνα 1.13). EIKA 1.13 Αλλαγές εντροπίας. Όταν το υδρογόνο και το οξυγόνο ενώνονται για τον σχηµατισµό νερού, η εντροπία του συστήµατος µειώνεται, ενώ η εντροπία του σύµπαντος αυξάνεται λόγω της απελευθέρωσης θερµότητας στο περιβάλλον. ÂÚÌfiÙËÙ ÂÚÌfiÙËÙ Η μεταβολή στην εντροπία (ΔS) του περιβάλλοντος θα είναι ευθέως ανάλογη της ποσότητας θερμότητας που έχει μεταφερθεί σε αυτό και αντιστρόφως ανάλογη της θερμοκρασίας του περιβάλλοντος, διότι η εισροή θερμότητας οδηγεί σε μεγαλύτερη αύξηση της εντροπίας σε χαμηλότερες παρά σε υψηλότερες θερμοκρασίες. Στα βιολογικά συστήματα, η Τ (απόλυτη θερμοκρασία σε βαθμούς Kelvin, Κ) θεωρείται σταθερή. Αν ορίσουμε το σύνολο της θερμότητας ενός συστήματος ως ενθαλπία (Η), τότε μπορούμε να εκφράσουμε τη σχέση που συνδέει την εντροπία (S) του περιβάλλοντος με τη μεταφερόμενη σε αυτό θερμότητα και τη θερμοκρασία του, ως μια απλή εξίσωση: S περιβάλλοντος συστήματος T (1) Η ολική μεταβολή εντροπίας καθορίζεται από τη σχέση S ολική S συστήματος S περιβάλλοντος (2) Η αντικατάσταση της ΔS περιβάλλοντος της (2) από τη ΔΗ συστήματος /Τ της (1) μας δίνει S ολική S συστήματος συστήματος T (3) Πολλαπλασιάζοντας και τις δύο πλευρές με Τ έχουμε T S ολική συστήματος T S συστήματος (4) Η συνάρτηση Τ S έχει μονάδες ενέργειας και ονομάζεται ελεύθερη ενέργεια ή ελεύθερη ενέργεια Gibbs, προς τιμήν του Josiah Willard Gibbs ο οποίος επινόησε τη συνάρτηση αυτή το 1878: G συστήματος T S συστήματος (5) Η μεταβολή ελεύθερης ενέργειας, G, θα χρησιμοποιείται σε όλο το βιβλίο για την κατανόηση της ενεργειακής θεώρησης των βιοχημικών αντιδράσεων.

15 Υπενθυμίζουμε ότι ο δεύτερος νόμος της θερμοδυναμικής ορίζει ότι σε κάθε αυθόρμητη αντίδραση η εντροπία του σύμπαντος πρέπει να αυξάνεται. Η εξίσωση (3) δείχνει ότι η εντροπία του σύμπαντος αυξάνεται όταν και μόνο όταν S συστήματος συστήματος /T (6)  ÈappleÏˆÌ ÓÔ Û ÛÙËÌ 15 Οι χηµικοί δεσµοί στη βιοχηµεία Με ανακατανομή των όρων έχουμε Τ S συστήματος > συστήματος, ή ότι η εντροπία θα αυξηθεί όταν και μόνο όταν G συστήματος T S συστήματος 0 (7) Με άλλα λόγια, η μεταβολή της ελεύθερης ενέργειας μιας αντίδρασης πρέπει να είναι αρνητική για να είναι η αντίδραση αυθόρμητη. Η αρνητική μεταβολή της ελεύθερης ενέργειας μιας αντίδρασης συνοδεύεται πάντοτε από αύξηση της εντροπίας του σύμπαντος. Άρα χρειάζεται πάντοτε να ασχοληθούμε με έναν και μόνον όρο, την ελεύθερη ενέργεια ενός συστήματος, για να αποφασίσουμε αν μια αντίδραση μπορεί να λάβει χώρα αυθόρμητα ή όχι. Όλες οι άλλες επιδράσεις των μεταβολών του συστήματος στο σύμπαν έχουν ρυθμιστεί αυτόματα με αυτή και μόνον τη θεώρηση Η αναδίπλωση των πρωτεϊνών µπορεί να γίνει κατανοητή µέσω των µεταβολών ελεύθερης ενέργειας AÓ ÈappleÏˆÌ ÓÔ Û ÛÙËÌ Το πρόβλημα της αναδίπλωσης των πρωτεϊνών καταδεικνύει τη χρησιμότητα της έννοιας της ελεύθερης ενέργειας. Ας πάρουμε ένα σύστημα αποτελούμενο από ένα υδάτινο διάλυμα ξεδιπλωμένων πρωτεϊνικών μορίων (Eικόνα 1.14). Κάθε ξεδιπλωμένο πρωτεϊνικό μόριο μπορεί να έχει μια δική του και μοναδική στερεοδιάταξη, οπότε το όλο σύστημα εμφανίζει μεγάλη αταξία και η εντροπία του συνόλου των μορίων αυτών είναι σχετικά υψηλή. Ωστόσο, κάτω από κατάλληλες συνθήκες, η αναδίπλωση των πρωτεϊνών γίνεται αυθόρμητα. Άρα η εντροπία είτε σε κάποιο άλλο μέρος του συστήματος είτε στο περιβάλλον θα πρέπει να αυξάνεται. Πώς μπορούμε να συμβιβάσουμε τη φαινομενική αντίφαση όπου οι πρωτεΐνες αυθόρμητα αναδιπλώνονται σε κανονικές δομές μεγαλύτερης τάξης και όμως η εντροπία αυξάνεται; Η μείωση της εντροπίας στο σύστημα από την αναδίπλωση των πρωτεϊνών δεν είναι τόσο μεγάλη λόγω των ιδιοτήτων του νερού. Τα μόρια πρωτεΐνης σε ένα υδάτινο διάλυμα αλληλεπιδρούν με μόρια ύδατος μέσω δεσμών υδρογόνου και ιοντικών αλληλεπιδράσεων. Ωστόσο, ορισμένα μόρια, τα οποία ονομάζονται άπολα ή μη πολικά δεν μπορούν να συμμετέχουν σε δεσμούς υδρογόνου ή σε ιοντικές αλληλεπιδράσεις. Οι αλληλεπιδράσεις μεταξύ μη πολικών μορίων και μορίων ύδατος δεν είναι τόσο ευνοούμενες όσο οι αλληλεπιδράσεις μεταξύ των ίδιων των μορίων ύδατος. Τα μόρια ύδατος που είναι σε επαφή με αυτές τις άπολες επιφάνειες σχηματίζουν «κλωβούς» γύρω από τα μη πολικά μόρια, αποκτώντας έτσι μεγαλύτερη τάξη (και συνεπώς μικρότερη εντροπία) από ό,τι μόρια ύδατος ελεύθερα σε διάλυμα. Η συνένωση δύο τέτοιων μη πολικών μορίων απε- EIKA 1.14 Αναδίπλωση πρωτεϊνών. Η αναδίπλωση των πρωτεϊνών αφορά τη µετάπτωση από ένα µεγάλης αταξίας µείγµα ξεδιπλωµένων µορίων σε ένα σχετικά οµοιόµορφο διάλυµα αναδιπλωµένων πρωτεϊνικών µορίων. MË appleôïèîfi ÌfiÚÈÔ MË appleôïèîfi ÌfiÚÈÔ MË appleôïèîfi ÌfiÚÈÔ MË appleôïèîfi ÌfiÚÈÔ EIKA 1.15 Το φαινόµενο της υδροφοβικότητας. Η συσσώρευση µη πολικών οµάδων στο νερό οδηγεί σε αύξηση της εντροπίας λόγω της απελευθέρωσης µορίων ύδατος που αναµειγνύονται µε τα υπόλοιπα µόρια του διαλύτη.

16 16 ΚΕΦΑΛΑΙΟ 1 Πρελούδιο: Η βιοχηµεία και η επαναστατική καταγραφή γονιδιωµάτων ζώντων οργανισµών λευθερώνει κάποια μόρια ύδατος, τα οποία αλληλεπιδρούν ελεύθερα με το υπόλοιπο νερό (Eικόνα 1.15). Άρα τα μη πολικά μόρια έχουν την τάση να συσσωματώνονται σε υδάτινο διάλυμα διότι η εντροπία του νερού αυξάνεται μέσω της απελευθέρωσης μορίων ύδατος. Το φαινόμενο αυτό, που ονομάζεται φαινόμενο της υδροφοβικότητας, προάγει πολλές βιοχημικές διεργασίες. Με ποιον τρόπο προάγει την αναδίπλωση των πρωτεϊνών το φαινόμενο της υδροφοβικότητας; Μερικά από τα αμινοξέα που βρίσκονται στις πρωτεΐνες έχουν μη πολικές ομάδες. Αυτές οι μη πολικές ομάδες έχουν ισχυρή τάση να συνευρίσκονται μεταξύ τους στο εσωτερικό μιας αναδιπλωμένης πρωτεΐνης. Η αυξημένη εντροπία του νερού που προέρχεται από τις αλληλεπιδράσεις αυτών των μη πολικών ομάδων βοηθά να αντισταθμιστεί η απώλεια εντροπίας που προκύπτει από την αναδίπλωση των πρωτεϊνών. Οι υδροφοβικές αλληλεπιδράσεις δεν είναι τα μόνα μέσα για τη σταθεροποίηση των πρωτεϊνικών δομών. Πολλοί ασθενείς δεσμοί, συμπεριλαμβανομένων των δεσμών υδρογόνου και των αλληλεπιδράσεων van der Waals, σχηματίζονται κατά τη διεργασία της αναδίπλωσης των πρωτεϊνών, και ως αποτέλεσμα της διεργασίας αυτής απελευθερώνεται θερμότητα στο περιβάλλον. Παρ όλο που οι αλληλεπιδράσεις αυτές αντικαθιστούν άλλες αλληλεπιδράσεις μεταξύ του νερού και της ξεδιπλωμένης πρωτεΐνης, το καθαρό αποτέλεσμα είναι η απελευθέρωση θερμότητας στο περιβάλλον και συνεπώς μια αρνητική (ευνοούμενη) μεταβολή στην ενθαλπία του συστήματος. Η διεργασία της αναδίπλωσης των πρωτεϊνών μπορεί να λάβει χώρα όταν ο συνδυασμός της εντροπίας που σχετίζεται με το φαινόμενο της υδροφοβικότητας και η μεταβολή ενθαλπίας λόγω των δεσμών υδρογόνου και των αλληλεπιδράσεων van der Waals καταστήσουν τη συνολική ελεύθερη ενέργεια αρνητική. 1.4 ΒΙΟΧΗΜΕΙΑ ΚΑΙ ΑΝΘΡΩΠΙΝΗ ΒΙΟΛΟΓΙΑ Η κατανόηση της βιοχημικής βάσης της λειτουργίας των ζώντων οργανισμών είχε και θα συνεχίσει να έχει ευρύτατες επιδράσεις σε κάθε ανθρώπινη δραστηριότητα. Κατά πρώτον, η βιοχημεία αποτελεί αφ εαυτής ένα όμορφο και συναρπαστικό σύνολο γνώσεων. Σήμερα γνωρίζουμε την ουσία και πολλές λεπτομέρειες των περισσότερων θεμελιωδών διεργασιών της βιοχημείας, όπως π.χ. το πώς ένα μόνο μόριο DA αντιγράφεται για να δημιουργηθούν δύο πανομοιότυπα αντίγραφά του, καθώς και το πώς η αλληλουχία των βάσεων σε ένα μόριο DA καθορίζει την αλληλουχία των αμινοξέων στην πρωτεΐνη που κωδικεύεται από αυτό. Η ικανότητά μας να περιγράψουμε αυτές τις διεργασίες με λεπτομερείς μηχανιστικούς όρους προσφέρει ένα στέρεο χημικό θεμέλιο σε όλες τις άλλες βιολογικές επιστήμες. Επιπλέον, το γεγονός ότι μπορούμε να κατανοήσουμε ουσιαστικές βιολογικές διεργασίες, όπως π.χ. τη μεταβίβαση κληρονομούμενων πληροφοριών ως χημικών δομών και αντιδράσεων, έχει σημαντικές φιλοσοφικές προεκτάσεις. Τί σημαίνει, από βιοχημική άποψη, το να είναι κανείς άνθρωπος; Ποιες είναι οι βιοχημικές διαφορές μεταξύ ενός ανθρώπου, ενός πιθήκου, ενός ποντικού και μιας μύγας; Έχουμε περισσότερες ομοιότητες από ό,τι διαφορές; Κατά δεύτερο λόγο, η βιοχημεία έχει σημαντική επίδραση στην ιατρική και τα συναφή πεδία. Οι μοριακές βλάβες που προκαλούν τη δρεπανοκυτταρική αναιμία, την κυστική ίνωση, την αιμοφιλία και άλλες κληρονομούμενες νόσους έχουν διαλευκανθεί σε βιοχημικό επίπεδο. Ορισμένες από τις μοριακές διεργασίες που οδηγούν στην εμφάνιση του καρκίνου έχουν διευκρινιστεί. Η κατανόηση των υποκείμενων βλαβών ανοίγει την πόρτα για την ανάπτυξη αποτελεσματικών θεραπευτικών αγωγών. Η βιοχημεία καθιστά εφικτό τον χημειοκατευθυνόμενο σχεδιασμό νέων φαρμάκων, συμπεριλαμβανομένων των ειδικών αναστολέων των ενζύμων τα οποία απαιτούνται για την αντιγραφή ιών, όπως π.χ.

17 του ιού της ανθρώπινης ανοσοανεπάρκειας (human immunodeficiency virus, IV). Γενετικά τροποποιημένοι μικροοργανισμοί είναι δυνατόν να χρησιμοποιηθούν σαν «εργοστάσια» για την παραγωγή πολύτιμων πρωτεϊνών, όπως είναι η ινσουλίνη και οι παράγοντες διέγερσης της ανάπτυξης των κυττάρων του αίματος. Η βιοχημεία συνεισφέρει πάρα πολύ στην ανάπτυξη αποτελεσματικών δοκιμασιών για κλινικές διαγνώσεις. Παραδείγματος χάριν, τα αυξημένα επίπεδα ενζυμικών δεικτών στο αίμα αποκαλύπτουν αν ένας ασθενής έπαθε πρόσφατα έμφραγμα του μυοκαρδίου. Ανιχνευτές DA χρησιμοποιούνται για την ακριβή διάγνωση κληρονομούμενων διαταραχών, μολυσματικών νόσων καθώς και του καρκίνου. Η γεωργία επίσης ωφελείται από τις προόδους στη βιοχημεία με την ανάπτυξη πιο αποτελεσματικών και ασφαλέστερων για το περιβάλλον ζιζανιοκτόνων και εντομοκτόνων καθώς και τη δημιουργία γενετικά τροποποιημένων φυτών, τα οποία να είναι, παραδείγματος χάριν, πιο ανθεκτικά σε έντομα. Όλες αυτές οι δραστηριότητες επιταχύνονται λόγω της προόδου στην καταγραφή των γονιδιωμάτων διαφόρων οργανισμών. Τρίτον, οι πρόοδοι στη βιοχημεία επιτρέπουν στους ερευνητές να αντιμετωπίσουν μερικά από τα πιο συναρπαστικά ερωτήματα στη βιολογία και την ιατρική. Πώς προκύπτουν τα τόσο διαφορετικά κύτταρα του ήπατος, των μυών και του εγκεφάλου από το γονιμοποιημένο ωάριο; Πώς λειτουργούν οι αισθήσεις; Ποιες είναι οι μοριακές βάσεις νοητικών διαταραχών όπως η νόσος Aλτσχάιμερ και η σχιζοφρένεια; Πώς διακρίνει το ανοσοποιητικό σύστημα μεταξύ εαυτού και ξένου; Ποιοι είναι οι μοριακοί μηχανισμοί της βραχύχρονης και της μακρόχρονης μνήμης; Οι απαντήσεις στα ερωτήματα αυτά, που φαίνονταν κάποτε τόσο μακρινές, έχουν εν μέρει αποκαλυφθεί και είναι πιθανόν να διασαφηνιστούν πλήρως στο εγγύς μέλλον. Επειδή όλοι οι ζώντες οργανισμοί στη Γη συνδέονται μέσω της κοινής καταγωγής τους, η εξέλιξη παρέχει ένα ισχυρό οργανωτικό πλαίσιο για τη βιοχημεία. Το βιβλίο αυτό έχει οργανωθεί ώστε να δώσει έμφαση στις κοινές βιοχημικές αρχές που αποκαλύπτονται μέσω της εξελικτικής θεώρησης. Αρχίζουμε στο επόμενο κεφάλαιο με μια σύντομη περιδιάβαση, ακολουθώντας την πιθανή εξελικτική πορεία από τον σχηματισμό μερικών ουσιών τις οποίες σήμερα σχετίζουμε με ζώντες οργανισμούς μέσω της εξέλιξης των διεργασιών εκείνων που ήταν απαραίτητες για την ανάπτυξη πολύπλοκων πολυκύτταρων οργανισμών. Το υπόλοιπο μέρος της Ενότητας Ι του βιβλίου εισάγει πλήρως τον φοιτητή στις πιο σημαντικές κατηγορίες βιοχημικών ουσιών, καθώς και στις έννοιες της κατάλυσης και της ρύθμισής της. Η Ενότητα ΙΙ, με τίτλο «Μεταγωγή και αποθήκευση ενέργειας», περιγράφει πώς η ενέργεια των χημικών ουσιών ή του ηλιακού φωτός μετατρέπεται σε χρήσιμες μορφές και πώς ρυθμίζεται η μετατροπή αυτή. Όπως θα δούμε, ένα μικρό σύνολο μορίων, όπως π.χ. η τριφωσφορική αδενοσίνη (ΑΤΡ), λειτουργούν ως νομίσματα ενέργειας τα οποία επιτρέπουν στην ενέργεια που προσλαμβάνεται με οποιονδήποτε τρόπο να χρησιμοποιείται σε μια ποικιλία βιοχημικών διεργασιών. Η ενότητα αυτή του βιβλίου εξετάζει τις σημαντικές πορείες για τη μετατροπή ενέργειας από το περιβάλλον σε μόρια όπως είναι η ΑΤΡ και αποκαλύπτει αρκετές από τις υποκείμενες αρχές. Η Ενότητα ΙΙΙ, με τίτλο «Βιοσύνθεση των μορίων των ζώντων οργανισμών», καταδεικνύει τη χρήση μορίων που συζητήθηκαν στην Ενότητα ΙΙ για τη βιοσύνθεση σημαντικών μοριακών δομικών λίθων, όπως είναι οι βάσεις του DA και τα αμινοξέα, και δείχνει επίσης πώς οι λίθοι αυτοί σχηματίζουν DA, RA και πρωτεΐνες. Στις Ενότητες ΙΙ και ΙΙΙ θα τονίσουμε τη σχέση μεταξύ των αντιδράσεων μέσα σε κάθε πορεία και μεταξύ εκείνων που υπάρχουν σε διαφορετικές πορείες, ώστε να φανεί ο πιθανός τρόπος με τον οποίο μπορεί να συνδυάστηκαν οι αντιδράσεις αυτές στις απαρχές της εξελικτικής ιστορίας για την παραγωγή των απαραίτητων μορίων. Από τη σκοπιά του φοιτητή, η ύπαρξη κοινών στοιχείων σε πολλές πορείες τού επιτρέπει να εφαρμόσει σε νέο πλαίσιο αρχές που έμαθε σε ένα άλλο. Η Ενότητα ΙV, με τίτλο 17 Βιοχηµεία και ανθρώπινη βιολογία

18 18 ΚΕΦΑΛΑΙΟ 1 Πρελούδιο: Η βιοχηµεία και η επαναστατική καταγραφή γονιδιωµάτων ζώντων οργανισµών «Απόκριση σε περιβαλλοντικές αλλαγές», εξερευνά ορισμένους από τους μηχανισμούς που ανέπτυξαν κύτταρα και πολυκύτταροι οργανισμοί ώστε να μπορούν να ανιχνεύσουν και να αποκριθούν σε αλλαγές στο περιβάλλον. Τα θέματα ποικίλλουν από τους γενικούς μηχανισμούς, που είναι κοινοί σε όλους τους οργανισμούς για τη ρύθμιση της γονιδιακής έκφρασης, μέχρι τα αισθητικά συστήματα του ανθρώπου και άλλων πολύπλοκων οργανισμών. Σε πολλές περιπτώσεις, μπορούμε να δούμε σήμερα με ποιον τρόπο αυτά τα πολύπλοκα συστήματα έχουν προκύψει από πορείες οι οποίες υπήρχαν από τις απαρχές της εξελικτικής ιστορίας. Πολλά από τα θέματα της Ενότητας IV συνδέουν τη βιοχημεία με άλλα πεδία, όπως είναι η κυτταρική βιολογία, η ανοσολογία και οι νευροεπιστήμες. Είμαστε τώρα έτοιμοι να αρχίσουμε το ταξίδι μας στη βιοχημεία, εξετάζοντας γεγονότα που συνέβησαν πριν από 3 και πλέον δισεκατομμύρια χρόνια. ΠΑΡΑΡΤΗΜΑ: ΑΠΕΙΚΟΝΙΣΗ MΟΡΙΑΚΩΝ ΟΜΩΝ Οι συγγραφείς βιβλίων βιοχημείας αντιμετωπίζουν το πρόβλημα να απεικονίσουν στο χαρτί τις τρεις διαστάσεις των μορίων. Η αλληλεπίδραση μεταξύ της τριδιάστατης δομής των μορίων και των βιολογικών τους δράσεων θα εξεταστεί διεξοδικά στο βιβλίο αυτό. Για τον σκοπό αυτό θα χρησιμοποιήσουμε συχνά αναπαραστάσεις οι οποίες εξ ανάγκης είναι σε δύο διαστάσεις, όμως δίνουν έμφαση στις τριδιάστατες δομές των μορίων. Στερεοχημικές αναπαραστάσεις Οι περισσότεροι από τους χημικούς τύπους στο βιβλίο αυτό είναι σχεδιασμένοι έτσι ώστε να φανεί, με όσο το δυνατόν μεγαλύτερη ακρίβεια, η γεωμετρική διάταξη των ατόμων στον χώρο, η οποία είναι κρίσιμη για την αντιδραστικότητα των μορίων και τον σχηματισμό χημικών δεσμών. Παραδείγματος χάριν, το άτομο άνθρακα του μεθανίου έχει υβριδοποιημένα ατομικά τροχιακά sp 3, οι κορυφές των οποίων σχηματίζουν ένα κανονικό τετράεδρο, με τις γωνίες να είναι 109,5 ο, ενώ το άτομο άνθρακα της φορμαλδεΰδης έχει υβριδοποιημένα ατομικά τροχιακά sp 2 και γωνίες δεσμών 120 ο. MÂı ÓÈÔ ºÔÚÌ Ï Â Ë Η σωστή στερεοχημεία γύρω από τα άτομα άνθρακα απεικονίζεται με τη βοήθεια σφηνών, ώστε να φαίνεται η κατεύθυνση ενός δεσμού στο ή έξω από το επίπεδο της σελίδας. Μια συμπαγής σφήνα με τη βάση μακριά από το άτομο άνθρακα, σημαίνει δεσμό που έρχεται προς τον αναγνώστη έξω από το επίπεδο της σελίδας. Μια σφήνα που αποτελείται από διακεκομμένες γραμμές και η βάση της είναι δίπλα στο άτομο άνθρακα αντιπροσωπεύει δεσμό που απομακρύνεται από τον αναγνώστη μέσα από το επίπεδο της σελίδας. Οι δύο άλλοι δεσμοί από το άτομο άνθρακα αναπαριστάνονται ως ευθείες γραμμές (Σ.τ.Μ.: και είναι στο επίπεδο της σελίδας). Προβολές Fischer Παρ όλο που οι στερεοχημικές αναπαραστάσεις είναι πιο αντιπροσωπευτικές της πραγματικής δομής ενός μορίου, πολλές φορές δεν είναι εύκολο να τις σχεδιάσουμε γρήγορα. Μια εναλλακτική μέθοδος για την απεικόνιση μορίων με κέντρα τετραεδρικών ανθράκων βασίζεται στη χρήση των προβολών Fischer. Σε μια προβολή Fischer οι δεσμοί στο κεντρικό άτομο άνθρακα απεικονίζονται ως οριζόντιες και κατακόρυφες γραμμές από τα υποκατάστατα άτομα προς το άτομο άνθρακα, το οποίο βρίσκεται στο κέντρο του σταυρού. Συμβατικά, οι οριζόντιοι δεσμοί θεωρούνται ότι προεκτείνονται έξω από το επίπεδο της σελίδας προς τον αναγνώστη, ενώ οι κατακόρυφοι δεσμοί θε- (A) (B) ( ) EIKA 1.16 Μοριακές αναπαραστάσεις. Σύγκριση τριών µοντέλων της ATP: (Α) χωροπληρωτικό, (Β) µε σφαίρες και ράβδους και (Γ) σκελετικό.

19 Παράρτηµα 19 W ωρούνται ότι προεκτείνονται στο επίπεδο της σελίδας και μακριά από τον αναγνώστη. Το γλωσσάριο των ενώσεων που υπάρχει στο τέλος του βιβλίου είναι ένα λεξικό δομών των κυριοτέρων μορίων της βιοχημείας, όπου το κάθε μόριο αναπαριστάνεται σε δύο μορφές: με στερεοχημικά ακριβείς γωνίες δεσμών και ως προβολή Fischer. Για να απεικονίσουμε τη μοριακή αρχιτεκτονική με μεγαλύτερη λεπτομέρεια θα χρησιμοποιήσουμε πέντε τύπους ατομικών μοντέλων: το χωροπληρωτικό μοντέλο, το μοντέλο με σφαίρες και ράβδους, το σκελετικό μοντέλο, τα διαγράμματα κορδέλας και τις απεικονίσεις επιφάνειας (Eικόνα 1.16). Οι πρώτοι τρεις τύποι δείχνουν δομές σε ατομικό επίπεδο. 1. Χωροπληρωτικά μοντέλα (space-filling models). Tα χωροπληρωτικά μοντέλα είναι τα πιο ρεαλιστικά. Tο μέγεθος και η θέση των ατόμων σε ένα χωροπληρωτικό μοντέλο καθορίζονται από την ικανότητά τους να δημιουργούν δεσμούς και από την ακτίνα van der Waals ή απόσταση επαφής (Εδάφιο 1.3.1). Η ακτίνα van der Waals δείχνει πόσο κοντά μπορεί να είναι δύο άτομα τα οποία δεν σχηματίζουν μεταξύ τους ομοιοπολικό δεσμό. Tα χρώματα στα ατομικά μοντέλα είναι συμβατικά: Yδρογόνο = άσπρο Άνθρακας = μαύρο Άζωτο = μπλε W Z X Z X Y X Y Y ÚÔ ÔÏ ÙÂÚÂÔ ËÌÈÎ Fischer appleâèîfióèûë ξυγόνο = κόκκινο Φωσφόρος = πορφυρό Θείο = κίτρινο Tα χωροπληρωτικά μοντέλα για μερικά απλά μόρια δίνονται στην Eικόνα Z W 2. Μοντέλα με σφαίρες και ράβδους (ball-and-stick models). Tα μοντέλα με σφαίρες και ράβδους δεν είναι τόσο ρεαλιστικά όπως τα χωροπληρωτικά, διότι τα άτομα εμφανίζονται σαν σφαίρες με ακτίνα μικρότερη από ό,τι η ακτίνα van der Waals. Πάντως, ο τρόπος δέσμευσης είναι πιο εύκολα κατανοητός, διότι φαίνεται σαφώς με τις ράβδους. Σε μια τέτοια απεικόνιση, το πάχος της ράβδου καθορίζει αν η κατεύθυνση του δεσμού είναι εμπρός ή πίσω από το επίπεδο της σελίδας. Mια πιο πολύπλοκη δομή μπορεί να φανεί σαφέστερα στην απεικόνιση αυτή παρά στο χωροπληρωτικό μοντέλο. 3. Σκελετικά μοντέλα (skeletal models). απλούστερη εικόνα επιτυγχάνεται με το σκελετικό μοντέλο, που δείχνει μόνο το μοριακό πλαίσιο. Στο μοντέλο αυτό τα άτομα δεν φαίνονται, αλλά η θέση τους υπονοείται από τα σημεία ένωσης και τα άκρα των δεσμών. Tα σκελετικά μοντέλα χρησιμοποιούνται συχνά για την απεικόνιση μεγάλων και πολυπλοκότερων δομών. Με την πρόοδο της βιοχημείας έχει δοθεί περισσότερη έμφαση στην απεικόνιση δομών βιολογικών μακρομορίων καθώς και των συμπλόκων τους. Οι δομές αυτές αποτελούνται από χιλιάδες ή και μυριάδες άτομα. Παρ όλο που οι δομές αυτές είναι δυνατόν να απεικονιστούν σε ατομικό επίπεδο, η διασαφήνιση των διάφορων δομικών συσχετισμών είναι πάρα πολύ δύσκολη, λόγω του τεράστιου αριθμού ατόμων. Συνεπώς, έχουν επινοηθεί πιο σχηματικοί τρόποι απεικόνισης διαγράμματα κορδέλας και απεικονίσεις επιφάνειας για την αναπαράσταση βιολογικών μακρομορίων όπου τα άτομα δεν είναι εμφανή (Eικόνα 1.18). 4. Διαγράμματα κορδέλας (ribbon diagramms). Τα διαγράμματα αυτά είναι πολύ σχηματικά και χρησιμοποιούνται συνήθως για να τονιστούν μερικά εντυπωσιακά χαρακτηριστικά της δομής των πρωτεϊνών, όπως π.χ. εκείνο της α-έλικας (σαν στριφτή κορδέλα), της β-πτύχωσης (ένα πλατύ βέλος) και των στροφών (απλές γραμμές), ώστε να παρέχονται απλές και σαφείς όψεις των σχημάτων αναδίπλωσης των πρωτεϊνών. 5. Απεικονίσεις επιφάνειας. Συχνά, οι αλληλεπιδράσεις μεταξύ μακρομορίων λαμβάνουν χώρα μόνο στην επιφάνειά τους. Οι απεικονίσεις επιφάνειας έχουν αναπτυχθεί ώστε να τονιστούν τα χαρακτηριστικά αυτού του μέρους των βιολογικών μακρομορίων. Οι αναπαραστάσεις αυτές απεικονίζουν το συνολικό σχήμα ενός μακρομορίου και είναι δυνατόν να σκιαστούν ή να χρωματιστούν ανάλογα, ώστε να τονιστούν συγκεκριμένα τοπογραφικά χαρακτηριστικά της επιφάνειας του μακρομορίου ή η κατανομή των ηλεκτρικών φορτίων. ÂÚfi ÍÈÎfi ºÔÚÌ Ì ÈÔ β-d- Ï Îfi Ë K ÛÙÂ ÓË 2 3 EIKA Χωροπληρωτικά µοντέλα. Μοριακοί τύποι και χωροπληρωτικές αναπαραστάσεις επιλεγµένων µορίων. 2 2 S + 3

20 20 ΚΕΦΑΛΑΙΟ 1 Πρελούδιο: Η βιοχηµεία και η επαναστατική καταγραφή γονιδιωµάτων ζώντων οργανισµών (A) (B) EIKA 1.18 Εναλλακτικές απεικονίσεις πρωτεϊνικών δοµών. Ένα διάγραµµα κορδέλας (Α), καθώς και µια απεικόνιση επιφάνειας (Β) µιας σηµαντικής πρωτεΐνης του ανοσοποιητικού συστήµατος τονίζουν διαφορετικά χαρακτηριστικά της ίδιας δοµής. ΟΡΟΙ-ΚΛΕΙ ΙΑ δεοξυριβονουκλεϊκό οξύ (DA), 4 διπλή έλικα, 5 ριβονουκλεϊκό οξύ (RA), 6 πρωτεΐνη, 6 αμινοξύ, 6 γενετικός κώδικας, 7 ευκάρυα, 8 βακτήρια, 8 αρχαία, 8 ευκαρυωτικός, 8 προκαρυωτικός, 8 ομοιοπολικός δεσμός, 9 δομή συντονισμού, 9 ηλεκτροστατική αλληλεπίδραση, 10 δεσμός υδρογόνου, 10 αλληλεπίδραση van der Waals, 11 εντροπία, 13 ενθαλπία, 14 ελεύθερη ενέργεια, 15 φαινόμενο υδροφοβικότητας, 16 στερεοχημεία, 18 προβολή Fischer, 18 χωροπληρωτικό μοντέλο, 19 μοντέλο με σφαίρες και ράβδους, 19 σκελετικό μοντέλο, 19 διάγραμμα κορδέλας, 19 απεικόνιση επιφάνειας, 19

1.Μαθησιακοί στόχοι του μαθήματος

1.Μαθησιακοί στόχοι του μαθήματος BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ 1.Μαθησιακοί στόχοι του μαθήματος της ΒΙΟΧΗΜΕΙΑΣ (ΕΤΥ-232) 1)εξοικείωση των φοιτητών με τον μοριακό σχεδιασμό της ζωής 2)εμπέδωση της δομής και λειτουργίας

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Φυσική Στερεών στις Πρωτεΐνες

Φυσική Στερεών στις Πρωτεΐνες Φυσική Στερεών στις Πρωτεΐνες Νίκος Απ. Παπανδρέου Τ.Ε.Ι. Πειραιά Φεβρουάριος 2010 Ένα ελικοϊδές μονοπάτι Χημική δομή μίας πρωτεΐνης Μήκος αλυσίδας ~30 έως ~1000 αµινοξέα Συνολικός αριθµός ατόµων έως ~

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι:

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Για να είναι μια αντίδραση αυθόρμητη, πρέπει η μεταβολή της ελεύθερης ενέργειας της αντίδρασης να είναι αρνητική. Η μεταβολή της

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

Ενέργεια:η ικανότητα επιτέλεσης έργου. Μορφές ενέργειας. η αιτία εµφάνισης φυσικών, χηµικών βιολογικών φαινοµένων

Ενέργεια:η ικανότητα επιτέλεσης έργου. Μορφές ενέργειας. η αιτία εµφάνισης φυσικών, χηµικών βιολογικών φαινοµένων Ενέργεια -Μεταβολισµός Ενέργεια:η ικανότητα επιτέλεσης έργου Μορφές ενέργειας η αιτία εµφάνισης φυσικών, χηµικών βιολογικών φαινοµένων ηλιακή, θερµότητα, χηµική, ηλεκτρική, πυρηνική. κινητική η ενέργεια

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις:

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

Σχ. 1: Τυπική μορφή μοριακού δυναμικού.

Σχ. 1: Τυπική μορφή μοριακού δυναμικού. ΤΕΤΥ - Σύγχρονη Φυσική Κεφ. 6-1 Κεφάλαιο 6. Μόρια Εδάφια: 6.a. Μόρια και μοριακοί δεσμοί 6.b. Κβαντομηχανική περιγραφή του χημικού δεσμού 6.c. Περιστροφή και ταλάντωση μορίων 6.d. Μοριακά φάσματα 6.a.

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας

Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Εκπαιδευτήριο TO ΠΑΓΚΡΗΤΙΟΝ Σχολικό Έτος 2007-2008 Συνθετικές εργασίες στο μάθημα Πληροφορική Τεχνολογία της Β Γυμνασίου: Όψεις της Τεχνολογίας Θέμα: DNA Τμήμα: ΗΥ: Ομάδα: Β2 pc29 Μηλαθιανάκης Μιχάλης

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 Το θέμα που απασχολεί το κεφάλαιο σε όλη του την έκταση είναι ο μεταβολισμός και χωρίζεται σε τέσσερις υποκατηγορίες: 3.1)Ενέργεια και οργανισμοί,

Διαβάστε περισσότερα

ΧΗΜΙΚΟΙ ΔΕΣΜΟΙ. Να δίδουν τον ορισμό του χημικού δεσμού. Να γνωρίζουν τα είδη των δεσμών. Να εξηγούν το σχηματισμό του ιοντικού ομοιοπολικού δεσμού.

ΧΗΜΙΚΟΙ ΔΕΣΜΟΙ. Να δίδουν τον ορισμό του χημικού δεσμού. Να γνωρίζουν τα είδη των δεσμών. Να εξηγούν το σχηματισμό του ιοντικού ομοιοπολικού δεσμού. ΧΗΜΙΚΟΙ ΔΕΣΜΟΙ ΣΤΟΧΟΙ ΜΑΘΗΜΑΤΟΣ Στο τέλος αυτής της διδακτικής ενότητας οι μαθητές θα πρέπει να μπορούν: Να δίδουν τον ορισμό του χημικού δεσμού. Να γνωρίζουν τα είδη των δεσμών Να εξηγούν το σχηματισμό

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

6. ιαμοριακές δυνάμεις

6. ιαμοριακές δυνάμεις 6. ιαμοριακές δυνάμεις ΣΚΟΠΟΣ Σκοπός αυτού του κεφαλαίου είναι να γνωρίσουμε τα είδη των ελκτικών δυνάμεων που αναπτύσσονται μεταξύ των μορίων των ομοιοπολικών ενώσεων και την επίδραση που ασκούν οι δυνάμεις

Διαβάστε περισσότερα

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί Κεφαλαίο 3 ο Μεταβολισμός Ενέργεια και οργανισμοί Η ενέργεια είναι απαρέτητη σε όλους τους οργανισμούς και την εξασφαλίζουν από το περιβάλλον τους.παρόλα αυτά, συνήθως δεν μπορούν να την χρησιμοποιήσουν

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

Εργασία Βιολογίας 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ

Εργασία Βιολογίας 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ Εργασία Βιολογίας Καθηγητής: Πιτσιλαδής Β. Μαθητής: Μ. Νεκτάριος Τάξη: Β'2 Υλικό: Κεφάλαιο 3 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ Την ενέργεια και τα υλικά που οι οργανισμοί εξασφαλίζουν από το περιβάλλον

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών Κεφάλαιο 1: Εισαγωγή 1.1 Μικροοργανισμοί, Μικροβιολογία και Μικροβιολόγοι... 19 1.1.1 Μικροοργανισμοί... 19 1.1.2 Μικροβιολογία... 20 1.1.3 Μικροβιολόγοι... 21 1.2 Σύντομη Ιστορική Εξέλιξη της Μικροβιολογίας...

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Βιοχημεία Βιομορίων Αθήνα 2015 Γενικές Ιδιότητες Ένζυμα : Βιολογικοί Καταλύτες Τα ένζυμα είναι πρωτεϊνικά μόρια Μικρή ομάδα καταλυτικών RNA H

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2006 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2006 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. της Νικολέτας Ε. 1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ)

ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. της Νικολέτας Ε. 1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ) ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ της Νικολέτας Ε. 3ο Κεφάλαιο Περιληπτική Απόδοση 3.1. Ενέργεια και οργανισμοί Όλοι οι οργανισμοί προκειμένου να επιβιώσουν και να επιτελέσουν τις λειτουργίες τους χρειάζονται

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί

3.1 Ενέργεια και οργανισμοί Δημήτρης Η. Β 1 25.3.14 3 Ο Κεφάλαιο 3.1 Ενέργεια και οργανισμοί Η ενέργεια έχει κεντρική σημασία για έναν οργανισμό, γιατί ό,τι και να κάνουμε χρειαζόμαστε ενέργεια. Ο κλάδος της βιολογίας που ασχολείται

Διαβάστε περισσότερα

Οργανική Χημεία. Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες

Οργανική Χημεία. Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες Οργανική Χημεία Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες 1. Καρβονυλικές ενώσεις Καρβονυλική ομάδα C=O σημαντικότερη λειτουργική ομάδα οργανικής χημείας Καρβονυλικές ομάδες βρίσκονται

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες Σχολή: Περιβάλλοντος Τμήμα: Επιστήμης Τροφίμων και Διατροφής Εκπαιδευτής: Χαράλαμπος Καραντώνης Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

Μεταβολή ορισμένων περιοδικών ιδιοτήτων

Μεταβολή ορισμένων περιοδικών ιδιοτήτων Μεταβολή ορισμένων περιοδικών ιδιοτήτων 1. Ερώτηση: Ποια θεωρούνται θεμελιώδη χαρακτηριστικά του ατόμου και γιατί; Θεμελιώδη χαρακτηριστικά του ατόμου είναι: η ατομική ακτίνα, η ενέργεια ιοντισμού και

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Στην περσινή χρονιά έμαθες ότι η Χημεία έχει τη δική της γλώσσα! Στη γλώσσα της Χημείας:

Στην περσινή χρονιά έμαθες ότι η Χημεία έχει τη δική της γλώσσα! Στη γλώσσα της Χημείας: 12 Κεφάλαιο 1ο 1.2 ΟΞΕΑ ΚΑΤΑ ARRHENIUS Που οφείλεται ο όξινος χαρακτήρας; Στην περσινή χρονιά έμαθες ότι η Χημεία έχει τη δική της γλώσσα! Στη γλώσσα της Χημείας: Τα γράμματα είναι τα σύμβολα των χημικών

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ 19-21 -10681 210 3824614 210 3847670 www.irakleitos.gr ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου

Οργανική Χημεία. Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου Οργανική Χημεία Κεφάλαια 12 &13: Φασματοσκοπία μαζών και υπερύθρου 1. Γενικά Δυνατότητα προσδιορισμού δομών με σαφήνεια χρησιμοποιώντας τεχνικές φασματοσκοπίας Φασματοσκοπία μαζών Μέγεθος, μοριακός τύπος

Διαβάστε περισσότερα

Η βιολογική κατάλυση παρουσιάζει παρουσιάζει ορισμένες ορισμένες ιδιαιτερότητες ιδιαιτερότητες σε

Η βιολογική κατάλυση παρουσιάζει παρουσιάζει ορισμένες ορισμένες ιδιαιτερότητες ιδιαιτερότητες σε Η βιολογική κατάλυση παρουσιάζει ορισμένες ιδιαιτερότητες σε σχέση με τη μη βιολογική που οφείλονται στη φύση των βιοκαταλυτών Οι ιδιαιτερότητες αυτές πρέπει να παίρνονται σοβαρά υπ όψη κατά το σχεδιασμό

Διαβάστε περισσότερα

συμπεριφέρεται ως α. βάση. β. οξύ. γ. πρωτονιοδότης. δ. αμφολύτης. Μονάδες 5

συμπεριφέρεται ως α. βάση. β. οξύ. γ. πρωτονιοδότης. δ. αμφολύτης. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΑΝΑΛΥΤΙΚΟ ΩΡΟΛΟΓΙΟ ΠΡΟΓΡΑΜΜΑ (κατά εβδομάδα), ΦΑΣΗ Ι, ΧΕΙΜΕΡΙΝΟ ΕΞΑΜΗΝΟ

ΑΝΑΛΥΤΙΚΟ ΩΡΟΛΟΓΙΟ ΠΡΟΓΡΑΜΜΑ (κατά εβδομάδα), ΦΑΣΗ Ι, ΧΕΙΜΕΡΙΝΟ ΕΞΑΜΗΝΟ ΑΝΑΛΥΤΙΚΟ ΩΡΟΛΟΓΙΟ ΠΡΟΓΡΑΜΜΑ (κατά εβδομάδα), ΦΑΣΗ Ι, ΧΕΙΜΕΡΙΝΟ ΕΞΑΜΗΝΟ ΑΚΑΔΗΜΑΙΚΟ ΕΤΟΣ 2014-2015 Εβδ. Ημερ. Μέρα Ώρα Μάθημα Είδος Μαθήμ. Τίτλος Μαθήματος 1 15/09/2014 Δευτέρα 9.30-11.30 ΕΙΣΑΓΩΓΗ ΣΤΗ ΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016 Ε Λ Λ Η Ν Ι Κ Η ΗΜΟΚΡΑΤΙΑ ΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Θ Ρ Α Κ Η Σ ΠΑΝΕΠΙΣΤΗΜΙΟΥΠΟΛΗ 6 Ο χλµ AΛΕΞ/ΠΟΛΗΣ-ΜΑΚΡΗΣ 68100 ΑΛΕΞΑΝ ΡΟΥΠΟΛΗ Τ Μ Η ΜΑ Ι Α Τ Ρ Ι Κ Η Σ Γ Ρ Α Μ Μ Α Τ Ε Ι Α H E L L E N I C R E P U B L I

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Δρ. Ιωάννης Καλαμαράς, Διδάκτωρ Χημικός. Όλα τα Σωστό-Λάθος της τράπεζας θεμάτων για τη Χημεία Α Λυκείου

Δρ. Ιωάννης Καλαμαράς, Διδάκτωρ Χημικός. Όλα τα Σωστό-Λάθος της τράπεζας θεμάτων για τη Χημεία Α Λυκείου Όλα τα Σωστό-Λάθος της τράπεζας θεμάτων για τη Χημεία Α Λυκείου 1. Το ιόν του νατρίου, 11Νa +, προκύπτει όταν το άτομο του Na προσλαμβάνει ένα ηλεκτρόνιο. Λ, όταν αποβάλλει ένα ηλεκτρόνιο 2. Σε 2 mol NH3

Διαβάστε περισσότερα

ΠΡΟΔΙΑΓΡΑΦΕΣ - ΟΔΗΓΙΕΣ ΔΙΑΜΟΡΦΩΣΗΣ ΘΕΜΑΤΩΝ ΓΙΑ ΤΟ ΜΑΘΗΜΑ

ΠΡΟΔΙΑΓΡΑΦΕΣ - ΟΔΗΓΙΕΣ ΔΙΑΜΟΡΦΩΣΗΣ ΘΕΜΑΤΩΝ ΓΙΑ ΤΟ ΜΑΘΗΜΑ ΠΡΟΔΙΑΓΡΑΦΕΣ - ΟΔΗΓΙΕΣ ΔΙΑΜΟΡΦΩΣΗΣ ΘΕΜΑΤΩΝ ΓΙΑ ΤΟ ΜΑΘΗΜΑ Χημεία Α ΤΑΞΗ ΗΜΕΡΗΣΙΟΥ και Α, Β ΤΑΞΕΙΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ Α ΤΑΞΗ ΗΜΕΡΗΣΙΟΥ και Α ΤΑΞΗ ΕΣΠΕΡΙΝΟΥ ΕΠΑΛ ΚΕΝΤΡΙΚΗ ΕΠΙΣΤΗΜΟΝΙΚΗ ΕΠΙΤΡΟΠΗ ΤΡΑΠΕΖΑΣ

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαια 20 & 21: Καρβοξυλικά οξέα, παράγωγα τους και αντιδράσεις ακυλο υποκατάστασης

Οργανική Χημεία. Κεφάλαια 20 & 21: Καρβοξυλικά οξέα, παράγωγα τους και αντιδράσεις ακυλο υποκατάστασης Οργανική Χημεία Κεφάλαια 20 & 21: Καρβοξυλικά οξέα, παράγωγα τους και αντιδράσεις ακυλο υποκατάστασης 1. Καρβοξυλικά οξέα Σημαντικά ακυλο (-COR) παράγωγα Πλήθος καρβοξυλικών ενώσεων στη φύση, π.χ. οξικό

Διαβάστε περισσότερα

2.3 Είδη χημικών δεσμών: Ιοντικός ομοιοπολικός δοτικός ομοιοπολικός δεσμός.

2.3 Είδη χημικών δεσμών: Ιοντικός ομοιοπολικός δοτικός ομοιοπολικός δεσμός. 2.3 Είδη χημικών δεσμών: Ιοντικός ομοιοπολικός δοτικός ομοιοπολικός δεσμός. 11.1. Ποια είδη χημικών δεσμών γνωρίζετε; Υπάρχουν δύο βασικά είδη χημικών δεσμών: ο ιοντικός ή ετεροπολικός δεσμός και ο ομοιοπολικός

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Μία αλεπού και ένα τσακάλι που ζουν σε ένα οικοσύστημα ανήκουν: Α. Στον ίδιο πληθυσμό Β. Στην

Διαβάστε περισσότερα

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων ΑΝΑΚΟΙΝΩΣΗ Από το Τμήμα Ιατρικής ανακοινώνεται ότι για το ακαδημαϊκό έτος 2014-2015 στο Τμήμα Ιατρικής κατατάσσονται : Οι πτυχιούχου Πανεπιστημίου, Τ.Ε.Ι. ή ισοτίμων προς αυτά, Α.ΣΠΑΙ.Τ.Ε., της Ελλάδος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανολόγων Μηχανικών. Χημεία. Ενότητα 15: Διαλύματα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανολόγων Μηχανικών. Χημεία. Ενότητα 15: Διαλύματα Τμήμα Μηχανολόγων Μηχανικών Χημεία Ενότητα 15: Διαλύματα Αν. Καθηγητής Γεώργιος Μαρνέλλος e-mail: gmarnellos@uowm.gr Τμήμα Μηχανολόγων Μηχανικών Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

Generated by Foxit PDF Creator Foxit Software http://www.foxitsoftware.com For evaluation only. ΑΣΚΗΣΗ ΜΕΤΡΗΣΗ ΤΗΣ ΕΙΔΙΚΗΣ ΘΕΡΜΟΤΗΤΑΣ ΥΓΡΟΥ

Generated by Foxit PDF Creator Foxit Software http://www.foxitsoftware.com For evaluation only. ΑΣΚΗΣΗ ΜΕΤΡΗΣΗ ΤΗΣ ΕΙΔΙΚΗΣ ΘΕΡΜΟΤΗΤΑΣ ΥΓΡΟΥ ΑΣΚΗΣΗ 13 ΜΕΤΡΗΣΗ ΤΗΣ ΕΙΔΙΚΗΣ ΘΕΡΜΟΤΗΤΑΣ ΥΓΡΟΥ ΜΕΡΟΣ ΠΡΩΤΟ ΒΑΣΙΚΕΣ ΘΕΩΡΗΤΙΚΕΣ ΓΝΩΣΕΙΣ 1.1. Εσωτερική ενέργεια Γνωρίζουμε ότι τα μόρια των αερίων κινούνται άτακτα και προς όλες τις διευθύνσεις με ταχύτητες,

Διαβάστε περισσότερα

1.3 Δομικά σωματίδια της ύλης - Δομή ατόμου - Ατομικός αριθμός - Μαζικός αριθμός - Ισότοπα

1.3 Δομικά σωματίδια της ύλης - Δομή ατόμου - Ατομικός αριθμός - Μαζικός αριθμός - Ισότοπα 1.3 Δομικά σωματίδια της ύλης - Δομή ατόμου - Ατομικός αριθμός - Μαζικός αριθμός - Ισότοπα Θεωρία 3.1. Ποια είναι τα δομικά σωματίδια της ύλης; Τα άτομα, τα μόρια και τα ιόντα. 3.2. SOS Τι ονομάζεται άτομο

Διαβάστε περισσότερα