Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΕΝΔΙΑΦΕΡΟΥΣΑ ΠΕΡΙΠΤΩΣΗ CASE REPORT ΣΠΛΑΧΝΙΚΗ ΛΕΪΣΜΑΝΙΑΣΗ: ΠΕΡΙΓΡΑΦΗ ΠΕΡΙΠΤΩΣΕΩΝ ΚΑΙ ΑΝΑΣΚΟΠΗΣΗ ΤΗΣ ΒΙΒΛΙΟΓΡΑΦΙΑΣ VISCERAL LEISHMANIASIS: REPORT OF 7 CASES AND REVIEW OF THE LITERATURE Χαραλαμπάκη Νικολέτα Charalampaki Nikoletta 1, Τσιβεριώτης Κωνσταντίνος Tsiveriotis Konstantinos 1, Ζάμπου Αικατερίνη Zambou Katerina 1, Γιαννοπούλου Παναγιώτα Giannopoulou Panagiota 1, Κυράτσα Άννα Kyratsa Anna 1, Υφαντής Ευστάθιος Yfantis Efstathios 2, Αντωνίου Μαρία Antoniou Maria 3, Τρίκκα-Γραφάκου Ελευθερία Trikka-Graphakos Eleftheria 1 1 Μικροβιολογικό Εργαστήριο, ΓΝΕ «Θριάσιο». Laboratory of Microbiology, Thriassio Hospital. 2 Αιματολογικό Εργαστήριο, ΓΝΕ «Θριάσιο». Laboratory of Hematology, Thriassio Hospital. 3 Εργαστήριο Κλινικής Βακτηριολογίας, Παρασιτολογίας, Ζωονόσων και Γεωγραφικής Ιατρικής, Ιατρική Σχολή Πανεπιστημίου Κρήτης. Laboratory of Clinical Bacteriology, Parasitology, Zoonoses and Geographical Medicine, Medical School, University of Crete. ΥΠΕΥΘΥΝΟΣ ΑΛΛΗΛΟΓΡΑΦΙΑΣ ADDRESS FOR CORRESPONDANCE Κωνσταντίνος Τσιβεριώτης (Επιμελητής Β ) Konstantinos Tsiveriotis Μικροβιολογικό Εργαστήριο, ΓΝΕ «Θριάσιο» Department of Microbiology, Thriassio Hospital Μαγούλα , Magoula Τ: Τ: E: E: ΠΕΡΙΛΗΨΗ SUMMARY Η σπλαχνική λεϊσμανίαση είναι μια συστηματική παρασιτική νόσος που μεταδίδεται στον άνθρωπο με το δήγμα μολυσμένων φλεβοτόμων. Ενδημεί στη Μεσόγειο, την Μέση Ανατολή, την Αφρική, την Βόρεια Αμερική και την Ινδία. Παρακάτω περιγράφονται επτά περιπτώσεις σπλαχνικής λεϊσμανίασης που παρουσιάστηκαν στο νοσοκομείο μας τα τελευταία 5 χρόνια ( ). Το παρατεινόμενο εμπύρετο, η ηπατοσπληνομεγαλία, η απώλεια βάρους, η αναιμία, η πανκυτταροπενία, η υπεργαμμασφαιριναιμία και η αύξηση της C-αντιδρώσας πρωτεΐνης (CRP) ήταν τα κυριότερα ευρήματα. Για την εργαστηριακή διερεύνηση των περιστατικών χρησιμοποιήθηκαν συμβατικές μέθοδοι (οστεομυελική βιοψία, έμμεσος ανοσοφθορισμός, ηλεκτροσυναίρεση και ειδική καλλιέργεια), που ήταν θετικές σε έξι, έξι, Visceral leishmaniasis (VL), a systemic protozoan disease transmitted by phlebotomine sandflies, is endemic in areas of Mediterranean, Middle East, India, Africa and South America. In the present Case Report, we report 7 cases of VL diagnosed in our hospital during the last 5 years ( ). Prolonged fever, splenomegaly, hepatomegaly, weight loss, anemia, pancytopenia, hypergammaglobulinemia and an elevated CRP level were the main features of the disease. Diagnosis was made through conventional methods (bone marrow aspiration, indirect immunofluorescence, electrosyneresis, culture), which were positive in six, six, six and five cases respectively, as well as using polymerase chain reaction (PCR) which was positive in all seven cases. In conclusion, 23

2 ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΠΤΩΣΕΩΝ ΣΠΛΑΧΝΙΚΗΣ ΛΕΪΣΜΑΝΙΑΣΗΣ ΤΟΜΟΣ 57 / ΤΕΥΧΟΣ 2 έξι και πέντε από τις επτά περιπτώσεις, καθώς και η αντίδραση αλυσιδωτής πολυμεράσης (PCR) που ήταν θετική σε όλες τις περιπτώσεις ασθενών. Συμπερασματικά, η εκτίμηση των κλινικών δεδομένων και ο συνδυασμός εργαστηριακών εξετάσεων, συμβατικών και νεότερων, συμβάλλει στην έγκαιρη διάγνωση και την άμεση έναρξη θεραπευτικής αγωγής. assessment of clinical data and the combination of conventional and newer laboratory methods contribute to accurate diagnosis and prompt treatment. KEYWORDS Visceral leishmaniasis, diagnosis,conventional methods, PCR ΛΕΞΕΙΣ ΚΛΕΙΔΙΑ Σπλαχνική λεϊσμανίαση, Διάγνωση, Συμβατικές μέθοδοι, PCR ΕΙΣΑΓΩΓΗ Η λεϊσμανίαση είναι μια παρασιτική νόσος που οφείλεται στο ενδοκυττάριο παράσιτο του γένους Leishmania (οικ. Trypanosomatidae). Το παράσιτο μεταδίδεται κυρίως από ζώα (συνηθέστερα σκύλους και τρωκτικά) στον άνθρωπο, με το δήγμα μολυσμένων φλεβοτόμων. Συνολικά 21 διαφορετικά είδη Λεϊσμάνιας έχουν αναγνωρισθεί ως παθογόνα για τον άνθρωπο, προκαλώντας κυρίως τρεις μορφές της νόσου: τη δερματική, τη βλεννογονοδερματική και τη σπλαχνική λεϊσμανίαση (Kala-azar). Η σπλαχνική, που είναι η πιο σοβαρή μορφή, έχει παγκοσμίως ετήσια επίπτωση και θνητότητα πάνω από περιπτώσεις. 1 Η νόσος ενδημεί στις Μεσογειακές χώρες γύρω από τη λεκάνη της Μεσογείου, την Αφρική, την Ινδική χερσόνησο, τη Νότια Αμερική και τη Μέση Ανατολή. 2 Οι κυριότεροι παράγοντες που συμβάλλουν στην εξάπλωσή της είναι η μετανάστευση, ο τουρισμός, η οικονομική ανάπτυξη, η αστικοποίηση, οι κλιματικές μεταβολές και η ανοσοκαταστολή. 3 Η Ελλάδα είναι χώρα ενδημική για τη λεϊσμανίαση. Σύμφωνα, όμως, με τα στοιχεία του ΚΕΕΛΠΝΟ, 4 ο αριθμός των κρουσμάτων που καταγράφεται ετησίως στη χώρα μας είναι μικρός, χωρίς να διαφαίνεται κάποια σαφής τάση μεταβολής της δηλούμενης επίπτωσης τα τελευταία χρόνια. Έτσι, για τα έτη , η μέση ετήσια επίπτωση της νόσου ήταν 0,5 κρούσματα ανά πληθυσμού και ο μέσος αριθμός κρουσμάτων ήταν κατ έτος 47. Ωστόσο, υπάρχουν αναφορές για αυξημένο αριθμό κρουσμάτων τόσο από την Βόρεια Ελλάδα, όσο και από την Κρήτη, όπου η επίπτωση της σπλαχνικής λεϊσμανίασης έχει ανέλθει στα 7 περιστατικά το χρόνο σε έναν πληθυσμό ατόμων, τα τελευταία 4 χρόνια ( ). 5, 6 Κατά την ίδια χρονική περίοδο σημαντική είναι η αναφορά από την Κρήτη στην οποία τονίζεται η δερματική λεϊσμανίαση από Leishmania tropica ΜΟΝ-300 ως αναδυόμενη νόσος (3 περιστατικά/ έτος). 6 Επιπλέον, στην Κρήτη παρατηρείται αύξηση της οροθετικότητας των σκύλων τα τελευταία χρόνια. 7 Οι αναφορές αυτές σε συνδυασμό με την ενδεχόμενη υποδήλωση του νοσήματος, την πιθανότητα παρουσίας του παρασίτου σε μεγαλύτερο ποσοστό του πληθυσμού χωρίς κλινικές εκδηλώσεις νόσου και το γεγονός ότι η Λεϊσμάνια αποτελεί ένα από τα συχνότερα ευκαιριακά παθογόνα σε ασθενείς με AIDS καθιστούν τη λεϊσμανίαση μια νόσο που χρήζει ιδιαίτερης προσοχής. Στην παρούσα εργασία περιγράφονται επτά περιπτώσεις ασθενών με σπλαχνική λεϊσμανίαση, (πέντε ενηλίκων και δυο παιδιών), που νοσηλεύθηκαν στο νοσοκομείο μας, τα τελευταία πέντε χρόνια ( ), και ακολουθεί σύντομη ανασκόπηση της βιβλιογραφίας. ΠΕΡΙΓΡΑΦΗ ΠΕΡΙΠΤΩΣΕΩΝ Πρώτη περίπτωση Άνδρας 69 ετών, ελληνικής καταγωγής, κάτοικος Ελευσίνας Αττικής, προσήλθε στο νοσοκομείο μας τον Ιανουάριο του 2007, λόγω παρατεινόμενου εμπύρετου (έως 39 C) και κακουχίας από τριμήνου. Ο ασθενής είχε ελεύθερο ατομικό αναμνηστικό, δεν ανέφερε πρόσφατο ταξίδι, ενώ σημαντική ήταν η καθημερινή του ενασχόληση με τη φροντίδα αδέσποτων ζώων. Από την αντικειμενική εξέταση διαπιστώθηκε ωχρότητα και ηπατοσπληνομεγαλία, ενώ δεν ψηλαφήθηκαν λεμφαδένες. Από τον αιματολογικό έλεγχο διαπιστώθηκαν: WBC: 6.100/mm 3, Ht: 35.3%, PLT: /mm 3. Ο βιοχημικός έλεγχος δεν ανέδειξε αξιόλογα ευρήματα πλην μιας ελαφρώς ελαττωμένης τιμής της αλβουμίνης (3,37 gr/dl) και μιας αύξησης της C-αντιδρώσας 24

3 VOL 57 / ISSUE 2 CASES REPORT, VISCERAL LEISHMANIASIS πρωτεΐνης (CRP: 50mg/dl). Το υπερηχογράφημα άνω κοιλίας επιβεβαίωσε την ύπαρξη ηπατοσπληνομεγαλίας. dl), αύξηση των ολικών λευκωμάτων (11,39 g/dl), υπεργαμμασφαιριναιμία και αύξηση της CRP: 72mg/dl. Δεύτερη περίπτωση Γυναίκα ηλικίας 70 ετών, ελληνικής καταγωγής, κάτοικος Αθηνών, προσήλθε στα εξωτερικά ιατρεία του νοσοκομείου μας τον Απρίλιο του 2007 αιτιώμενη καταβολή δυνάμεων και εμπύρετο (έως 38,5 Ο C) από μηνός. Η ασθενής ανέφερε την παρουσία σκύλου στο σπίτι, ενώ δεν είχε ταξιδέψει πρόσφατα στην Ελλάδα ή το εξωτερικό. Το κύριο εύρημα κατά την αντικειμενική εξέταση ήταν η σπληνομεγαλία, η οποία επιβεβαιώθηκε αργότερα και υπερηχογραφικά. Ο εργαστηριακός έλεγχος έδειξε λευκοπενία (WBC: 3000/mm 3 ), αναιμία (Ht: 30%), θρομβοπενία (PLT: /mm 3 ), αύξηση των ηπατικών δεικτών (SGOT: 72 U/L, SGPT: 65 U/L, ALP:183 U/L, ολική χολερυθρίνη: 2,06 mg/dl, άμεση χολερυθρίνη: 1,19mg/dl), καθώς και ήπια αύξηση της CRP (20 mg/dl). Με τη μέθοδο της ανοσοκαθήλωσης διαπιστώθηκε υπεργαμμασφαιριναιμία. Τρίτη περίπτωση Άνδρας 28 ετών, πακιστανικής καταγωγής, κάτοικος Ασπροπύργου Αττικής, προσήλθε στο νοσοκομείο μας τον Ιούλιο του 2007 με παρατεινόμενο εμπύρετο (έως 39 C) από εξαμήνου. Ο ασθενής ανέφερε ταξίδι στο Πακιστάν προ εξαμήνου και καθημερινή επαφή με αδέσποτα ζώα. Κατά την αντικειμενική εξέταση παρατηρήθηκαν πολλαπλά δήγματα εντόμων στα άνω και κάτω άκρα του ασθενούς και ηπατοσπληνομεγαλία, η οποία επιβεβαιώθηκε υπερηχογραφικά. Τα κυριότερα εργαστηριακά ευρήματα ήταν: WBC: 3.300/ mm 3, Ht: 35,7%, PLT: / mm 3, αύξηση των ηπατικών ενζύμων (SGOT: 175U/L, SGPT: 149U/L, ALP: 122U/L), υπεργαμμασφαιριναιμία και αυξημένη CRP: 55mg/dl. Τέταρτη περίπτωση Άνδρας 68 ετών, Ελληνικής καταγωγής, κάτοικος Ελευσίνας, προσήλθε στο τμήμα επειγόντων περιστατικών του νοσοκομείου μας το Νοέμβριο του 2007 αναφέροντας καταβολή δυνάμεων, απώλεια βάρους και κακουχία από τριμήνου. Ο ασθενής έπασχε από αλκοολική κίρρωση, ενώ σημαντική ήταν η καθημερινή του επαφή με αδέσποτους σκύλους. Κατά την αντικειμενική εξέταση διαπιστώθηκαν: πυρετός (38,6 C), ευαισθησία αριστερού και δεξιού υποχονδρίου και ηπατοσπληνομεγαλία, η οποία ήταν συμβατή με τον υπερηχογραφικό έλεγχο. Ο εργαστηριακός έλεγχος έδειξε: WBC:1300/ mm 3, Ht: 24%, PLT: / mm 3, ήπια αύξηση της ολικής χολερυθρίνης (1,55mg/ Πέμπτη περίπτωση Άνδρας 19 χρονών, Ελληνικής καταγωγής, κάτοικος Σκύρου, προσήλθε στο νοσοκομείο τον Ιανουάριο του 2012, αναφέροντας εμπύρετο έως 40 Ο C από δεκαημέρου. Ο ασθενής δεν ανέφερε επαφή με σκύλους, ούτε κάποιο ταξίδι το τελευταίο χρονικό διάστημα. Η αντικειμενική εξέταση ανέδειξε ηπατοσπληνομεγαλία. Από τον εργαστηριακό αιματολογικό έλεγχο διαπιστώθηκαν: WBC: 2.900/ mm 3, Ht: 25.5%, PLT: / mm 3. Ο βιοχημικός έλεγχος δεν ανέδειξε αξιόλογα ευρήματα πλην μιας αύξησης των ολικών λευκωμάτων (9.12 g/dl) και της CRP (110mg/dl). Έκτη περίπτωση Αγόρι 20 μηνών, αθίγγανος, αλβανικής καταγωγής, κάτοικος Ασπροπύργου, προσήλθε στο τμήμα επειγόντων περιστατικών του νοσοκομείου μας τον Ιούνιο του 2008, με αναφερόμενο εμπύρετο έως 38,5 Ο C και κοιλιακό άλγος από δεκαημέρου. Η φυσική εξέταση του ασθενούς δεν ανέδειξε ιδιαίτερα ευρήματα. Ο αιματολογικός έλεγχος έδειξε WBC: 4.400/ mm 3, Ht: 20.9%, PLT: / mm 3. Ο βιοχημικός έλεγχος ήταν εντός φυσιολογικών ορίων πλην της αυξημένης τιμής της CRP (45mg/dl). Το υπερηχογράφημα άνω κοιλίας έδειξε σπληνομεγαλία. Έβδομη περίπτωση Κορίτσι 2 ετών, αθίγγανη, αλβανικής καταγωγής, κάτοικος Ζεφυρίου Αττικής, διακομίσθηκε στο εξωτερικό Παιδιατρικό ιατρείο του νοσοκομείου μας τον Απρίλιο του 2008 λόγω εμπύρετου από μηνός έως 40 Ο C. Η ασθενής εμφάνιζε όψη πάσχοντος και ευαισθησία κατά την ψηλάφηση της κοιλιακής χώρας. Τα εργαστηριακά ευρήματα εισαγωγής ήταν WBC: 4.300/ mm 3, Ht: 18,5%, PLT: / mm 3, SGOT: 43 U/L, ALP: 133 U/L, CRP: 80 mg/dl. Το υπερηχογράφημα άνω κοιλίας έδειξε ηπατοσπληνομεγαλία. Εξέλιξη νόσου και διαγνωστική διαδικασία Σε όλες τις ανωτέρω περιπτώσεις με την υποψία λεϊσμανίασης οι ασθενείς υποβλήθηκαν στο νοσοκομείο μας σε βιοψία μυελού των οστών και σε ορολογικό έλεγχο με τη μέθοδο του έμμεσου ανοσοφθορισμού. Παράλληλα και προ της έναρξης της θεραπευτικής αγωγής, δείγματα περιφερικού αίματος εστάλησαν στο εργαστήριο Κλινικής Βακτηριολογίας, Παρασιτολογίας, Ζωονόσων και Γεωγραφικής Ιατρικής του Πανεπιστημίου της 25

4 ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΠΤΩΣΕΩΝ ΣΠΛΑΧΝΙΚΗΣ ΛΕΪΣΜΑΝΙΑΣΗΣ ΤΟΜΟΣ 57 / ΤΕΥΧΟΣ 2 Κρήτης, όπου ελέγχθηκαν με τη μέθοδο της ηλεκτροσυναίρεσης καθώς και με καλλιέργεια και PCR για την παρουσία και τον προσδιορισμό του είδους των παρασίτων. Η οστεομυελική βιοψία ήταν θετική σε όλες τις περιπτώσεις εκτός από την πρώτη. Τα μυελικά παρασκευάσματα εξετάσθηκαν στο μικροσκόπιο για την παρουσία αμαστιγωτών μορφών. Οι αμαστιγωτές μορφές είχαν στρογγυλό ή ωοειδές σχήμα, μέγεθος 2 3 μm και ανευρίσκονταν συνήθως μέσα σε μονοκύτταρα ή μακροφάγα Με τη χρώση Giemsa το κυτταρόπλασμα τους χρωματιζόταν ανοιχτό γαλάζιο, ενώ ο πυρήνας και ο κινητοπλάστης τους ερυθρός ή ιώδης. Για την ανίχνευση των ειδικών IgG αντισωμάτων εφαρμόστηκε σε όλα τα δείγματα ορού των ασθενών έμμεσος ανοσοφθορισμός με αντιγόνο Leishmania infantum (Vircell Microbiologist, Santa Fe, Granada, 18320, Spain), σύμφωνα με τις οδηγίες του κατασκευαστή. Η εκτίμηση των αποτελεσμάτων έγινε σε μικροσκόπιο φθορισμού σε σύγκριση με το θετικό και τον αρνητικό μάρτυρα. Τίτλος αντισωμάτων 1: 40 θεωρήθηκε θετικός για τη νόσο. Με εξαίρεση τον πρώτο ασθενή, οι υπόλοιποι ασθενείς είχαν αυξημένο τίτλο αντισωμάτων IgG. Ο τίτλος κυμάνθηκε από 1:400 έως 1:2560. Η τεχνική της ηλεκτροσυναίρεσης (Εικ. 1), εφαρμόστηκε σε όλα τα δείγματα των ασθενών και ήταν θετική σε όλες τις περιπτώσεις, εκτός από την πρώτη. Η μέθοδος αυτή χρησιμοποιείται για τον ποιοτικό προσδιορισμό αντισωμάτων και αποτελεί στην ουσία βελτίωση της μεθόδου της διπλής ανοσοδιάχυσης, η οποία στηρίζεται στην αντίθετη ηλεκτροφορητική μετακίνηση του αντιγόνου και του αντισώματος, όταν αυτά τοποθετούνται σε άγαρ και εφαρμόζεται ηλεκτρικό πεδίο. Συμβάλλει ουσιαστικά τόσο στην εξακρίβωση ενεργού νόσου (εμφάνιση του ειδικού τόξου 4/24 που είναι ειδικό για Λεϊσμανίαση), καθώς και στην παρακολούθηση της αποτελεσματικότητας της θεραπευτικής αγωγής (η ειδικότητα του τόξου 4/24 χάνεται μετά από μερικές εβδομάδες επιτυχούς θεραπευτικής αγωγής). Για την απομόνωση του παρασίτου διενεργήθηκαν ειδικές καλλιέργειες αίματος, οι οποίες ήταν θετικές σε όλα εκτός από τα δυο πρώτα περιστατικά. Το θρεπτικό υλικό που χρησιμοποιήθηκε ήταν το διφασικό υλικό Novy-McNeal-Nicolle (ΝΝΝ medium) με επικάλυψη RPMI. Τα δείγματα επωάστηκαν στους 22 Ο C για χρονικό διάστημα 3 4 εβδομάδων και ελέγχονταν εβδομαδιαίως για ανάπτυξη των προμαστιγωτών μορφών με την χρήση μικροσκοπίου αντίθεσης φάσης (Εικ. 2). Με την ανάλυση των ισοενζύμων των προμαστιγωτών μορφών έγινε ο προσδιορισμός του είδους και η τυποποίηση των παρασίτων. Τα στελέχη που απομονώθηκαν ήταν Leishmania infantum MON-98 και MON-1. ΕΙΚΟΝΑ 1 Η τεχνική της ηλεκτροσυναίρεσης με το χαρακτηριστικό τόξο 4/24. Απεικονίζονται από πάνω προς τα κάτω ο αρνητικός μάρτυρας, ο θετικός μάρτυρας και θετικός ορός. (Αρχείο Εργαστηρίου Κλινικής Βακτηριολογίας, Παρασιτολογίας, Ζωονόσων και Γεωγραφικής Ιατρικής, Ιατρική Σχολή Πανεπιστημίου Κρήτης). ΕΙΚΟΝΑ 2 Παράσιτο Leishmania κατά το προμαστιγωτό στάδιο, μορφή την οποία συναντάμε στις καλλιέργειες στους 26Ο C και στο σώμα του φλεβοτόμου. (Αρχείο Εργαστηρίου Κλινικής Βακτηριολογίας, Παρασιτολογίας, Ζωονόσων και Γεωγραφικής Ιατρικής, Ιατρική Σχολή Πανεπιστημίου Κρήτης). Για την ανίχνευση του DNA του παρασίτου στο αίμα των ασθενών εφαρμόστηκε η τεχνική της PCR, όπως αυτή περιγράφεται στην βιβλιογραφία. 8 Χρησιμοποιήθηκαν οι εκκινητές Τ2 (5 CGGCTTCGCACCATGCGGTG 3 ) και Β4 (5 ACATCCCTGCCACAT- ACGC 3 ) που ενισχύουν δυο διαφορετικές περιοχές του DNA του κινητοπλάστη της Leishmania spp. Για την εκχύλιση του DNA χρησιμοποιήθηκε το QIAamp DNA Blood Mini kit (Qiagen, Hilden,, 40724, Germany). Η PCR ήταν θετική σε όλες τις περιπτώσεις. Όλοι οι ασθενείς τέθηκαν σε αγωγή με λιποσωμική αμφοτερικίνη Β, σε δοσολογία 2 4mg/kg ημερησίως (συνολική δόση 26

5 VOL 57 / ISSUE 2 CASES REPORT, VISCERAL LEISHMANIASIS 15 21mg/kg), η οποία είχε πολύ καλά αποτελέσματα. Κανένας ασθενής δεν παρουσίασε υποτροπή της νόσου μέχρι σήμερα. ΣΥΖΗΤΗΣΗ Η λεϊσμανίαση ενδημεί σε χώρες της Μεσογείου, όπου κυρίως απαντάται το είδος L. infantum, το οποίο μεταδίδεται στον άνθρωπο με το δήγμα μολυσμένων φλεβοτόμων από τον σκύλο, και προκαλεί κυρίως τη σπλαχνική και σπάνια τη δερματική μορφή της νόσου. 5, 9 Ωστόσο, στα πλαίσια της παγκοσμιοποίησης, στην Ευρώπη τα τελευταία χρόνια, έχουν εισαχθεί και εξωτικά είδη, γεγονός που χρήζει ιδιαίτερης προσοχής. Έτσι, στην Κύπρο έχουν περιγραφεί περιστατικά σπλαχνικής και δερματικής λεϊσμανίασης από L. donovani. 9, 10 Στην Ελλάδα η σπλαχνική είναι η συχνότερη μορφή λεϊσμανίασης. 4 Ο χρόνος επώασης κυμαίνεται συνήθως από 2 έως 6 μήνες και τα κύρια κλινικά χαρακτηριστικά της νόσου, όπως φαίνεται και στα περιστατικά που περιγράφονται, είναι το παρατεινόμενο εμπύρετο, η απώλεια βάρους, η καχεξία, η ηπατοσπληνομεγαλία, και η αναιμία. Τα συχνότερα εργαστηριακά ευρήματα είναι η παγκυτταροπενία, η υπολευκωματιναιμία, η υπεργαμμασφαιριναιμία, η αύξηση των ηπατικών ενζύμων και της CRP. Η νόσος έχει συχνά χρόνια εξέλιξη και μπορεί να οδηγήσει στον θάνατο χωρίς θεραπεία. 11 Οι κυριότερες αιτίες θανάτου είναι οι δευτεροπαθείς βακτηριακές λοιμώξεις, η μαζική 1, 11 αιμορραγία και η σοβαρή αναιμία. Οι κυριότερες μέθοδοι που έχουν χρησιμοποιηθεί για την εργαστηριακή διάγνωση της λεϊσμανίασης είναι η μικροσκοπική εξέταση υλικών βιοψίας, ο ορολογικός έλεγχος για ανίχνευση αντισωμάτων, η ανίχνευση αντιγόνων του παρασίτου, η καλλιέργεια, ο ενοφθαλμισμός σε πειραματόζωα και οι μοριακές μέθοδοι. Μια ιδανική μέθοδος πρέπει να χαρακτηρίζεται από υψηλή ευαισθησία και ειδικότητα, δεδομένου ότι η νόσος είναι δυνητικά θανατηφόρος και κλινικά πρέπει να διαφοροδιαγνωσθεί από άλλα νοσήματα όπως μεταξύ άλλων ελονοσία, τυφοειδή πυρετό, λέμφωμα και λευχαιμία. Καθ ότι τα περισσότερα αντιλεϊσμανιακά φάρμακα είναι τοξικά, η ιδανική διαγνωστική μέθοδος θα πρέπει επίσης να διακρίνει την οξεία νόσο από την ασυμπτωματική έκθεση και να αξιολογεί την ανταπόκριση στην φαρμακευτική αγωγή. Τέλος, θα πρέπει να μην είναι ιδιαίτερα δαπανηρή, χρονοβόρος και πολύπλοκη, ώστε να μπορεί να εφαρμόζεται και σε εργαστήρια χωρίς εξειδικευμένο εξοπλισμό, δεδομένου ότι η νόσος συνήθως αφορά πληθυσμούς χαμηλού κοινωνικοοικονομικού επιπέδου σε αναπτυσσόμενες χώρες. Η εξέταση υλικού βιοψίας μυελού των οστών, σπληνός, ήπατος ή λεμφαδένων, ύστερα από χρώση με Giemsa παραμένει η πιο συνηθισμένη μέθοδος αναζήτησης των αμαστιγωτών μορφών, της μορφής με την οποία απαντάται το παράσιτο στους ιστούς. Η μέθοδος αυτή απαιτεί εμπειρία και επιμονή του εξεταστή, ο οποίος θα πρέπει να εξετάζει το σχήμα (στρογγυλό ή ωοειδές), το μέγεθος (2 4 μm) και τα εσωτερικά οργανίδια του παρασίτου (πυρήνας και κινητοπλάστης). 12 Η ειδικότητα της μεθόδου είναι υψηλή, αλλά η ευαισθησία ποικίλει και είναι μεγαλύτερη για δείγματα βιοψίας σπληνός (93 99%) και μικρότερη για τον μυελό των οστών (52 85%), τους λεμφαδένες (52 58%) και το ήπαρ (40%). 12, 13 Η παρακέντηση των οργάνων και η λήψη βιοψιών προϋποθέτουν επεμβατικούς χειρισμούς που είναι επώδυνοι και εγκυμονούν σοβαρούς κινδύνους, όπως η μαζική αιμορραγία στην περίπτωση της βιοψίας σπληνός. Ωστόσο, σε συγκεκριμένα εξειδικευμένα κέντρα, όπου υπάρχει έμπειρο προσωπικό και κατάλληλος εξοπλισμός, η μικροσκοπική εξέταση του υλικού παρακέντησης σπληνός εφαρμόζεται και για την παρακολούθηση της πορείας της νόσου. Η εκτίμηση του παρασιτικού φορτίου γίνεται με τη χρησιμοποίηση λογαριθμικής κλίμακας και οι τιμές κυμαίνονται από 0 (κανένα παράσιτο στα 1000 πεδία) έως +6 (>100 παράσιτα ανά οπτικό πεδίο). 12 Μια άλλη μέθοδος που χαρακτηρίζεται από υψηλή ευαισθησία είναι η καλλιέργεια των ιστικών δειγμάτων (μυελός οστών, σπλήνας, ήπαρ, λεμφαδένες) σε ειδικά θρεπτικά υλικά. Τέτοια είναι τα διφασικά ΝΝΝ και Tobies, στα οποία οι αμαστιγωτές μορφές μετατρέπονται σε προμαστιγωτές και τα μονοφασικά Shneider s, M199 και Grace s, που χρησιμοποιούνται για τoν πολλαπλασιασμό του αριθμού των παρασίτων. Στην παρούσα μελέτη χρησιμοποιήθηκε το διφασικό υλικό ΝΝΝ. O διαχωρισμός των διαφόρων ειδών Leishmania μπορεί να γίνει είτε με την ανάλυση των ισοενζύμων των προμαστιγωτών μορφών, όπως έγινε στην παρούσα μελέτη, είτε με τη χρήση μονοκλωνικών αντισωμάτων. 3, 5 Ωστόσο, η καλλιέργεια ενέχει τον κίνδυνο της επιμόλυνσης, και είναι δαπανηρή και χρονοβόρος (3 4 εβδομάδες) γι αυτό και εφαρμόζεται επί αποτυχίας των άλλων μεθόδων, ή συμπληρωματικά με αυτές, κυρίως σε εξειδικευμένα εργαστήρια. 3 Παρομοίως, ο ενοφθαλμισμός του παρασίτου σε πειραματόζωα hamster (Cricetus cricetus) απαιτεί μεγάλο χρονικό διάστημα (2 3 μήνες). 3 Έχουν αναπτυχθεί αρκετές τεχνικές ανίχνευσης αντιλεϊσμανιακών αντισωμάτων στον ορό, όπως ο έμμεσος ανοσοφθορισμός, η ELISA, η έμμεση αιμοσυγκόλληση, η τεχνική της ηλεκτροσυναίρεσης και η Western blot, ωστόσο η ορολογική διάγνωση με όλες τις παραπάνω μεθόδους έχει δυο σημαντικά 27

6 ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΠΤΩΣΕΩΝ ΣΠΛΑΧΝΙΚΗΣ ΛΕΪΣΜΑΝΙΑΣΗΣ ΤΟΜΟΣ 57 / ΤΕΥΧΟΣ 2 μειονεκτήματα. Πρώτον, τα επίπεδα των αντισωμάτων παραμένουν ανιχνεύσιμα για αρκετά χρόνια μετά τη θεραπεία και έτσι δεν μπορεί να γίνει η διάκριση παλαιάς από πρόσφατη λοίμωξη. Δεύτερον, ένας σημαντικός αριθμός ατόμων που διαμένουν σε ενδημικές περιοχές βρίσκονται θετικοί για αντι-λεϊσμανιακά αντισώματα χωρίς να έχουν ιστορικό σπλαχνικής λεϊσμανίασης, λόγω ασυμπτωματικής έκθεσης. Συνεπώς οι ορολογικές μέθοδοι συνήθως χρησιμοποιούνται σε συνδυασμό με άλλες μεθόδους για τη διάγνωση της σπλαχνικής λεϊσμανίασης. 1 Στην παρούσα μελέτη ο ορολογικός έλεγχος περιελάμβανε έμμεσο ανοσοφθορισμό και την τεχνική της ηλεκτροσυναίρεσης. Ο έμμεσος ανοσοφθορισμός ανιχνεύει αντισώματα που εμφανίζονται στα αρχικά στάδια της λοίμωξης και εξαφανίζονται 6 με 9 μήνες μετά τη θεραπεία. Η παραμονή των αντισωμάτων σε χαμηλούς τίτλους αποτελεί ένδειξη υποτροπής της νόσου. Η μέθοδος έχει ευαισθησία 96% και ειδικότητα 98%. 13 Ομοίως, η τεχνική της ηλεκτροσυναίρεσης χαρακτηρίζεται από υψηλή ευαισθησία και ειδικότητα (>98%), συμβάλλει, δε, τόσο στη διάγνωση της νόσου, όσο και στην παρακολούθηση της αποτελεσματικότητας της θεραπευτικής αγωγής και εφαρμόζεται σε κέντρα αναφοράς. Μια άλλη ευρέως χρησιμοποιούμενη μέθοδος είναι η ELISA. Η διαγνωστική της ακρίβεια εξαρτάται από τα αντιγόνα που χρησιμοποιούνται. Τέτοια είναι το διαλυτό κυτταροπλασματικό αντιγόνο (CSA) και διάφορα αντιγόνα που παράγονται με τεχνολογία ανασυνδυασμένου DNA όπως το rgbp από L. donovani, το rorff από L. infantum και τα rgp63, rk9, rk26, rk39 από L. chagasi. 12, 14 Τα πλέον υποσχόμενα αποτελέσματα έχει δώσει το αντιγόνο rk39 με ευαισθησία και ειδικότητα 100% και 96%, αντίστοιχα. 13 Τα αντισώματα έναντι rk39 συσχετίζονται άμεσα με την ενεργό νόσο, μπορούν να χρησιμοποιηθούν για εκτίμηση της ανταπόκρισης στη θεραπεία, πρόβλεψη της κλινικής υποτροπής. Επιπλέον, έχουν μεγάλη διαγνωστική αξία σε ασθενείς με AIDS. Τα τελευταία χρόνια έχει αναπτυχθεί ανοσοχρωματογραφική μέθοδος ανίχνευσης αντισωμάτων έναντι του αντιγόνου rk39 που χρησιμοποιεί ταινίες. Η μέθοδος αυτή είναι απλή (απαιτείται μια σταγόνα αίμα), σύντομη (δίνει αποτέλεσμα σε 15 λεπτά) και έχει υψηλή ευαισθησία (98 100%) και ειδικότητα (81 96%). 13 Μια άλλη απλή δοκιμασία είναι η δοκιμασία άμεσης συγκόλλησης (DAT), μια ημιποσοτική μέθοδος κατά την οποία ο ορός του ασθενούς σε υποδιπλάσιες αραιώσεις επωάζεται σε πλάκα, μαζί με κεγχρωσμένες προμαστιγωτές μορφές L. donovani. Αν ο ορός του ασθενούς περιέχει ειδικά αντισώματα έναντι του παρασίτου, μετά από 18 ώρες παρατηρείται συγκόλληση, ορατή με γυμνό οφθαλμό. Η μέθοδος έχει ευαισθησία και ειδικότητα 95% και 86%, αντίστοιχα. 13 Η ανοσοχρωματογραφία και η δοκιμασία άμεσης συγκόλλησης είναι οι κυριότερες μέθοδοι που χρησιμοποιούνται σε αναπτυσσόμενες χώρες (Ινδία, Αφρική). 13, 15 Στη διάγνωση μπορεί να συμβάλλει επίσης η ανίχνευση αντιγόνων του παρασίτου στα ούρα (τμήματα πολυπεπτιδίων 72 75kDa και 123kDa). Η συγκέντρωση του αντιγόνου συσχετίζεται ισχυρά με το παρασιτικό φορτίο, η μέθοδος έχει υψηλή ειδικότητα και μπορεί να εφαρμοσθεί και σε ανοσοκατασταλμένους ασθενείς, όπου η παραγωγή αντισωμάτων είναι διαταραγμένη. Τα τελευταία χρόνια έχει αναπτυχθεί μια δοκιμασία συγκόλλησης σωματιδίων latex (KATEX) για την ανίχνευση ενός άλλου λεϊσμανιακού αντιγόνου, ενός χαμηλού μοριακού βάρους υδατάνθρακα, στα ούρα ασθενών. Η μέθοδος είναι πολλά υποσχόμενη, δεδομένου ότι σύμφωνα με τις πρώτες μελέτες η ειδικότητά της είναι 100% και η ευαισθησία της κυμαίνεται από 68 έως 100%. 12 Η μοριακή διάγνωση, κυρίως η PCR, βρίσκει ιδιαίτερη εφαρμογή στη διάγνωση της σπλαχνικής λεϊσμανίασης. Η PCR, που εφαρμόζεται σε ποικιλία κλινικών δειγμάτων, μπορεί να ανιχνεύσει το παράσιτο πριν την εμφάνιση συμπτωμάτων, παρέχει τη δυνατότητα παρακολούθησης της ανταπόκρισης στη θεραπεία, αναγνώρισης υποτροπών, ταυτοποίησης σε επίπεδο είδους, έχει δε ιδιαίτερη διαγνωστική αξία σε ανοσοκατεσταλμένους ασθενείς. Έχουν περιγραφεί πολλές PCR με ποικίλη διαγνωστική αξία οι οποίες χρησιμοποιούν διάφορους εκκινητές με στόχους το rrna (18s rrna, ssu rrna), το DNA του κινητοπλάστη, ή άλλες αλληλουχίες του γονιδιώματος του παρασίτου (περιοχή ITS, περιοχές γονιδίων β-τουμπουλίνης, gp63 κ.α). 12 Τα τελευταία χρόνια έχουν αναπτυχθεί τεχνικές PCR πραγματικού χρόνου, που καθιστούν δυνατή την εκτίμηση του παρασιτικού φορτίου και απαιτούν ελάχιστη ποσότητα δείγματος. 13,16 Στην παρούσα μελέτη η PCR απέβη θετική και στις επτά περιγραφείσες περιπτώσεις, ενώ αξίζει να αναφερθεί ότι η οριστική διάγνωση της λεϊσμανίασης στην πρώτη περίπτωση τέθηκε μόνο με βάση την PCR, καθ όσον ο έλεγχος με όλες τις υπόλοιπες μεθόδους απέβη αρνητικός. Άλλωστε και η αναφερόμενη στη βιβλιογραφία ευαισθησία της PCR σε περιφερικό αίμα κυμαίνεται από 70 έως 100%. 13 Από τις συμβατικές μεθόδους η οστεομυελική βιοψία, ο έμμεσος ανοσοφθορισμός και η ηλεκτροσυναίρεση απέβησαν θετικές σε έξι από τα επτά περιστατικά, ενώ η καλλιέργεια σε πέντε από τα επτά. Σύμφωνα με μια πρόσφατη συγκριτική μελέτη μεταξύ PCR και συμβατικών μικροβιολογικών μεθόδων διάγνωσης, η ευαισθησία της PCR 28

7 VOL 57 / ISSUE 2 CASES REPORT, VISCERAL LEISHMANIASIS ήταν 99% σε δείγματα αίματος και 96% σε δείγματα μυελού των οστών ενώ εκείνη της καλλιέργειας 76%, της μικροσκοπικής εξέτασης μυελού των οστών 90% και του ορολογικού ελέγχου 86%. 17 Είναι λοιπόν προφανής η ανάγκη χρησιμοποίησης συνδυασμού μικροβιολογικών εξετάσεων στη διαγνωστική προσέγγιση της λεϊσμανίασης. Η λεϊσμανίαση είναι μια ιάσιμη νόσος. Η θεραπεία της βασίζεται στη χρήση των αντι-λεϊσμανιακών φαρμάκων και την αντιμετώπιση όλων των συνοδών διαταραχών, όπως οι δευτεροπαθείς λοιμώξεις, η αναιμία και η υποθρεψία. Τα πρώτα φάρμακα που χρησιμοποιήθηκαν ήταν οι ενώσεις του πεντασθενούς αντιμονίου, οι οποίες όμως χορηγούνται παρεντερικά, έχουν παρενέργειες (αρρυθμία, παγκρεατίτιδα, αρθραλγία, κοιλιακός πόνος) και απαιτούν μακροχρόνια χορήγηση. 1, 11 Η ανάπτυξη αντοχής σε αυτά τα φάρμακα οδήγησε σε άλλα εναλλακτικά φάρμακα, όπως η αμφοτερικίνη Β, η οποία γρήγορα αντικαταστάθηκε σε Ευρώπη και Αμερική από την λιποσωμική αμφοτερικίνη Β, που γίνεται καλύτερα ανεκτή αν και με μεγαλύτερο κόστος. 1, 11 Ο Παγκόσμιος Οργανισμός Υγείας (WHO) ανακοίνωσε το 2007 μια μεγάλη μείωση της τιμής του φαρμάκου με στόχο την χρησιμοποίησή του και σε αναπτυσσόμενες χώρες. 1 Νεώτερα φάρμακα για τη θεραπεία της σπλαχνικής νόσου είναι η μιλτεφοσίνη και η σιταμακίνη, τα οποία χορηγούνται από του στόματος, αλλά έχουν σημαντικές παρενέργειες και η παρομομυκίνη, μια αμινογλυκοσίδη η οποία σε πρόσφατες κλινικές μελέτες εμφάνισε υψηλή αποτελεσματικότητα και ασφάλεια. 1,11 Η δερματική μορφή της νόσου, ανάλογα με την έκτασή της και το είδος του παρασίτου που την προκαλεί, μπορεί να αντιμετωπισθεί είτε με τοπική (παρομομυκίνη, κρυοθεραπεία) είτε με συστηματική (πενταμιδίνη, φλουκοναζόλη, κετοκοναζόλη, μιλτεφοσίνη, ενώσεις πεντασθενούς αντιμονίου) αγωγή. Συμπερασματικά, η λεϊσμανίαση είναι μια νόσος που ενδημεί στη χώρα μας. Απαιτείται εγρήγορση τόσο των κλινικών όσο και των εργαστηριακών ιατρών τόσο για τη διάγνωση των αυτόχθονων κρουσμάτων L. infantum, όσο και για τον εντοπισμό αναδυόμενων εξωτικών ειδών. Η συνεκτίμηση των κλινικών δεδομένων και των εργαστηριακών ευρημάτων, που προκύπτουν από συνδυασμό εξετάσεων, συμβάλλει στην έγκαιρη διάγνωση, την άμεση έναρξη θεραπευτικής αγωγής και την καλή έκβαση της νόσου. ΒΙΒΛΙΟΓΡΑΦΙΑ 1 Chappuis F, Sundar S, Hailu A, Ghalib H, Rijal S, Peeling RW, et al. Visceral leishmaniasis: what are the needs for diagnosis, treatment and control? Nat Rev Microbiol. 2007; 5: World Health Organization. Leishmaniasis, who.int/leishmaniasis//en/ 3 Sundar S, and Rai M. Laboratory diagnosis of visceral leishmaniasis. Clin Diagn Lab Immunol ; 9: Κέντρο ελέγχου και πρόληψης νοσημάτων (ΚΕΕΛΠΝΟ). κατάλογοςνοσημάτων/λ.aspx (Ιανουάριος 2011). 5 Κανσουζίδου-Κανακούδη Α. Λεϊσμανίαση-Μία παλιά νόσος με νέα δεδομένα. Εφαρμ. Κλιν. Μικρ. Εργαστ. Διαγν. 2006; 11: Christodoulou V, Antoniou M, Ntais P, Messaritakis I, Ivovic V, Dedet JP, et al. Re-emergence of visceral and cutaneous leishmaniasis in the Greek island of Crete. Vector Borne Zoonotic Dis ;12: Antoniou M, Messaritakis I, Christodoulou V, Ascoksilaki I, Kanavakis N, Sutton AJ, et al. Increasing incidence of zoonotic visceral leishmaniasis on Crete, Greece. Emerg Infect Dis. 2009; 15: Minodier P, Piarroux R, Gambarelli F, Joblet C, Dumon H. Rapid identification of causative species in patients with Old World leishmaniasis. J Clin Microbiol 1997; 35: Ready PD. Leishmaniasis emergence in Europe. Euro Surveill ;15: Antoniou M, Haralambous C, Mazeris A, Pratlong F, Dedet JP, Soteriadou K. Leishmania donovani leishmaniasis in Cyprus. Lancet Infect Dis. 2009; 9: Piscopo TV, and Azzopardi C. Leishmaniasis. Postgrad Med J. 2007; 83: Singh S. New developments in diagnosis of leishmaniasis. Indian J Med Res. 2006; 123: Srivastava P, Dayama A, Mehrotra S, Sundar S. Diagnosis of visceral leishmaniasis. Trans R Soc Trop Med Hyg. 2011;105: Maalej IA, Chenik M, Louzir H, Ben Salah A, Bahloul C, Amri F, et al. Comparative evaluation of ELISAs based on ten recombinant or purified Leishmania antigens for the serodiagnosis of Mediterranean visceral leishmaniasis. Am J Trop Med Hyg. 2003; 68:

8 ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΠΤΩΣΕΩΝ ΣΠΛΑΧΝΙΚΗΣ ΛΕΪΣΜΑΝΙΑΣΗΣ ΤΟΜΟΣ 57 / ΤΕΥΧΟΣ 2 15 Singh DP, Goyal RK, Singh RK, Sundar S, Mohapatra TM. In search of an ideal test for diagnosis and prognosis of kala-azar. J Health Popul Nutr. 2010; 28: Wortmann G, Hochberg L, Houng HH, Sweeney C, Zapor M, Aronson N, et al. Rapid identification of Leishmania complexes by a real-time PCR assay. Am J Trop Med Hyg. 2005; 73: Antinori S, Calattini S, Longhi E, Bestetti G, Piolini R, Magni C, et al. Clinical use of polymerase chain reaction performed on peripheral blood and bone marrow samples for the diagnosis and monitoring of visceral leishmaniasis in HIV-infected and HIV-uninfected patients: a singlecenter, 8-year experience in Italy and review of the literature. Clin Infect Dis ; 44:

Τµήµα Επιδηµιολογικής Επιτήρησης και Παρέµβασης

Τµήµα Επιδηµιολογικής Επιτήρησης και Παρέµβασης Τµήµα Επιδηµιολογικής Επιτήρησης και Παρέµβασης ΕΠΙΔΗΜΙΟΛΟΓΙΚΑ ΣΤΟΙΧΕΙΑ ΓΙΑ ΤΗ ΛΕΪΣΜΑΝΙΑΣΗ ΣΤΗΝ ΕΛΛΑΔΑ (ΣΥΣΤΗΜΑ ΥΠΟΧΡΕΩΤΙΚΗΣ ΔΗΛΩΣΗΣ ΝΟΣΗΜΑΤΩΝ) Κύρια σημεία Η δηλούμενη επίπτωση της λεϊσμανίασης στην Ελλάδα

Διαβάστε περισσότερα

ΤΣΑΚΜΑΚΙΔΗΣ ΓΙΑΝΝΗΣ. Κτηνίατρος, Υποψήφιος Διδάκτωρ Εργαστήριο Παρασιτολογίας και Παρασιτικών Νοσημάτων Τμήμα Κτηνιατρικής, Α.Π.Θ.

ΤΣΑΚΜΑΚΙΔΗΣ ΓΙΑΝΝΗΣ. Κτηνίατρος, Υποψήφιος Διδάκτωρ Εργαστήριο Παρασιτολογίας και Παρασιτικών Νοσημάτων Τμήμα Κτηνιατρικής, Α.Π.Θ. ΤΣΑΚΜΑΚΙΔΗΣ ΓΙΑΝΝΗΣ Κτηνίατρος, Υποψήφιος Διδάκτωρ Εργαστήριο Παρασιτολογίας και Παρασιτικών Νοσημάτων Τμήμα Κτηνιατρικής, Α.Π.Θ. Ενδημική σε 98 χώρες (35 με μικτές με HIV μολύνσεις) 12 εκατ. κρούσματα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Εργαστηριακή Διάγνωση της HIV λοίμωξης Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Διάγνωση της HIV λοίμωξης Από το 1985 και μέχρι σήμερα η διαγνωστική διαδικασία

Διαβάστε περισσότερα

Μαστιγοφόρα του αίματος και των ιστών. Οικογένεια: Τρυπανοσωμιδών Τάξη: Κινητοπλαστιδίων Γένη: Leishmania Trypanosoma

Μαστιγοφόρα του αίματος και των ιστών. Οικογένεια: Τρυπανοσωμιδών Τάξη: Κινητοπλαστιδίων Γένη: Leishmania Trypanosoma Μαστιγοφόρα του αίματος και των ιστών Οικογένεια: Τρυπανοσωμιδών Τάξη: Κινητοπλαστιδίων Γένη: Leishmania Trypanosoma Τροφοζωίτης Μορφές των παρασίτων Leishmania: 35 είδη 21-30 στον άνθρωπο Σπλαχνική, ή

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Σύνοψη της προσέγγισης ασθενούς με πανκυτταροπενία. Ιατρικό Τμήμα Πανεπιστημίου Πατρών Απαρτιωμένη διδασκαλία στην Αιματολογία Αργύρης Συμεωνίδης

Σύνοψη της προσέγγισης ασθενούς με πανκυτταροπενία. Ιατρικό Τμήμα Πανεπιστημίου Πατρών Απαρτιωμένη διδασκαλία στην Αιματολογία Αργύρης Συμεωνίδης Σύνοψη της προσέγγισης ασθενούς με πανκυτταροπενία Ιατρικό Τμήμα Πανεπιστημίου Πατρών Απαρτιωμένη διδασκαλία στην Αιματολογία Αργύρης Συμεωνίδης Αρχική κλινική προσέγγιση Συμπτωματικός ή μη συμπτωματικός

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Οξεία μυελογενής λευχαιμία

Οξεία μυελογενής λευχαιμία Οξεία μυελογενής λευχαιμία Γενικά στοιχεία Ταξινόμηση και τύποι Ενδείξεις και συμπτώματα Αίτια πρόκλησης Διάγνωση Παρουσίαση και επαναστόχευση από Βικιπαίδεια Οξεία μυελογενής λευχαιμία : Ζήσου Ιωάννης

Διαβάστε περισσότερα

Επιδημιολογικά δεδομένα νοσημάτων που μεταδίδονται με διαβιβαστές στην Ελλάδα

Επιδημιολογικά δεδομένα νοσημάτων που μεταδίδονται με διαβιβαστές στην Ελλάδα Καταπολέμηση κουνουπιών και δημόσια υγεία: Η επίδραση της κλιματικής αλλαγής, 10 Δεκ 2015 Επιδημιολογικά δεδομένα νοσημάτων που μεταδίδονται με διαβιβαστές στην Ελλάδα Δανάη Περβανίδου Γραφείο Νοσημάτων

Διαβάστε περισσότερα


Διαβάστε περισσότερα

ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 31/12/2011)

ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 31/12/2011) ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ & ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ (ΚΕ.ΕΛ.Π.ΝΟ.) ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 31/12/2011) 1 Το καλοκαίρι

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ερμηνεία αποτελεσμάτων ηλεκτροφόρησης πρωτεϊνών ορού. Μιχάλης Μιχαήλ MD, PhD Αιματολόγος Γ. Ν Λευκωσίας

Ερμηνεία αποτελεσμάτων ηλεκτροφόρησης πρωτεϊνών ορού. Μιχάλης Μιχαήλ MD, PhD Αιματολόγος Γ. Ν Λευκωσίας Ερμηνεία αποτελεσμάτων ηλεκτροφόρησης πρωτεϊνών ορού Μιχάλης Μιχαήλ MD, PhD Αιματολόγος Γ. Ν Λευκωσίας Περίγραμμα Τι είναι η Η/Φ πρωτεϊνών Πότε πρέπει να ζητάμε την Η/Φ Πως ερμηνεύονται τα αποτελέσματα

Διαβάστε περισσότερα

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp.

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. 5 ο Πανελλήνιο Συνέδριο Ιατρικής Βιοπαθολογίας Η εφαρμογή μοριακών

Διαβάστε περισσότερα

ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων

ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ 15/10/2015 Πέμπτη ( Ηλεκτρονικά) 16.00 18.00 Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων Γενική επισκόπηση μεθόδων που χρησιμοποιούνται

Διαβάστε περισσότερα

Εμβόλιο Ηπατίτιδας Β

Εμβόλιο Ηπατίτιδας Β Εμβόλιο Ηπατίτιδας Β ΤΙ ΧΡΕΙΑΖΕΤΑΙ ΝΑ ΓΝΩΡΙΖΕΤΕ Είστε σίγουροι πως έχετε πάρει τα κατάλληλα μέτρα για να προστατευτείτε από την ηπατίτιδα Β; ΕΝΗΜΕΡΩΣΟΥ! ΕΜΒΟΛΙΑΣΟΥ! ΠΡΟΣΤΑΤΕΥΣΟΥ! ΕΜΒΟΛΙΟ ΗΠΑΤΙΤΙΔΑΣ Β Γνωρίζετε

Διαβάστε περισσότερα

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Δ. Ιακωβίδης Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Νέα διαγνωστικά μέσα για τη λανθάνουσα φυματίωση Η στοχευμένη δοκιμασία δερματικής φυματινοαντίδρασης

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας

ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας Ε. ΠΕΤΕΙΝΑΚΗ Aναπληρώτρια Καθηγήτρια Μικροβιολογίας Διευθύντρια Εργαστηρίου Μικροβιολογίας ΜΙΚΡΟΒΙΟΛΟΓΙΑ φάση της κλινικής ιατρικής Η μικροβιολογία

Διαβάστε περισσότερα


ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ Dr Α. Μεντής, Ιατρός Βιοπαθολόγος, Κλινικός Μικροβιολόγος ιευθυντής ιαγνωστικού Τμήματος ιευθυντής Εργαστηρίου Ιατρικής Μικροβιολογίας ιευθυντής Εθνικού Εργαστηρίου

Διαβάστε περισσότερα


ΘΡΟΜΒΩΤΙΚΗ ΘΡΟΜΒΟΠΕΝΙΚΗ ΠΟΡΦΥΡΑ ΜΕ ΑΤΥΠΗ ΣΥΜΠΤΩΜΑΤΟΛΟΓΙΑ ΠΟΡΦΥΡΑ ΜΕ ΑΤΥΠΗ 1 Παθολογική Κλινική Νοσοκομείου Ξάνθης, 2 Τμήμα Επειγόντων Περιστατικών Νοσοκομείου Ξάνθης, 3Αιματολογική Κλινική Νοσοκομείου Αλεξανδρούπολης ΕΙΣΑΓΩΓΗ Η θρομβωτική θρομβοπενική πορφύρα

Διαβάστε περισσότερα

κλινική και εργαστηριακή προσέγγιση των νοσημάτων του Τ. Ράλλης Καθηγητής Παθολογίας Ζώων Συντροφιάς, Τμήμα Κτηνιατρικής, ΑΠΘ

κλινική και εργαστηριακή προσέγγιση των νοσημάτων του Τ. Ράλλης Καθηγητής Παθολογίας Ζώων Συντροφιάς, Τμήμα Κτηνιατρικής, ΑΠΘ Τι είναι κοινό και τι όχι κατά την κλινική και εργαστηριακή προσέγγιση των νοσημάτων του ήπατος στο σκύλο και στη γάτα Τ. Ράλλης Καθηγητής Παθολογίας Ζώων Συντροφιάς, Τμήμα Κτηνιατρικής, ΑΠΘ Η γάτα δεν

Διαβάστε περισσότερα

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης Κύρια σημεία Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης ΕΠΙΔΗΜΙΟΛΟΓΙΚΑ ΔΕΔΟΜΕΝΑ ΓΙΑ ΤΗ ΣΙΓΚΕΛΛΩΣΗ ΣΤΗΝ ΕΛΛΑΔΑ 2004-2011 (ΣΥΣΤΗΜΑ ΥΠΟΧΡΕΩΤΙΚΗΣ ΔΗΛΩΣΗΣ ΝΟΣΗΜΑΤΩΝ) - Η δηλούμενη επίπτωση της σιγκέλλωσης

Διαβάστε περισσότερα

ΣΤΟΙΧΕΙΑ ΝΟΣΟΛΟΓΙΑΣ ΣΠΛΑΧΝΙΚΗ ΛΕΪΣΜΑΝΙΑΣΗ 1. Αιτιολογικοίπαράγοντες L. donovani L. infantum L. amazonensis (λεκάνη Αµαζονίου, Βραζιλία) L. tropica (Μέση Ανατολή, Ινδία, ανατολική Ευρώπη, υτική Ασία) L.

Διαβάστε περισσότερα

Βασικές αρχές Ιατρικής Μικροβιολογίας

Βασικές αρχές Ιατρικής Μικροβιολογίας Σελίδες 1 έως 5 ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Για τους φοιτητές Β εξαμήνου ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΤΜΗΜΑΤΟΣ Παν/κό έτος 2011-2012 Ύλη αποτελεί η θεματολογία των μαθημάτων (αμφιθεάτρου, εργαστηρίων, φροντιστηρίων)

Διαβάστε περισσότερα

Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία

Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΥΓΙΕΙΝΗΣ ΚΑΙ ΕΠΙΔΗΜΙΟΛΟΓΙΑΣ Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία Μάρκα Ανδριανή Ιατρός,

Διαβάστε περισσότερα

Οξεία μονοαρθρίτιδα. 2 ο Κλινικό Σεμινάριο Εσωτερικής Παθολογίας Οκτ 2015, Πάτρα

Οξεία μονοαρθρίτιδα. 2 ο Κλινικό Σεμινάριο Εσωτερικής Παθολογίας Οκτ 2015, Πάτρα Οξεία μονοαρθρίτιδα 2 ο Κλινικό Σεμινάριο Εσωτερικής Παθολογίας Οκτ 2015, Πάτρα Δαούσης Δημήτρης Επίκουρος καθηγητής Παθολογίας/Ρευματολογίας Ιατρική Σχολή Πανεπιστημίου Πατρών Γενικώς η ρευματολογία είναι

Διαβάστε περισσότερα

Αιμόλυση σε παιδί 8 ετών

Αιμόλυση σε παιδί 8 ετών Αιμόλυση σε παιδί 8 ετών Ε.Μανταδακης 1, Ζ.Μπεζιργιαννίδου 2, Γ.Μαρτίνης 2, Α Χατζημιχαήλ 1 1. Πανεπιστημιακή Παιδιατρική Κλινική, Π.Γ.Ν. Αλεξανδρούπολης 2. Κέντρο Αιμοδοσίας, Π.Γ.Ν. Αλεξανδρούπολης Παρουσίαση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τμήμα Παρεμβάσεων σε Χώρους Παροχής Υγείας. Γραφείο Ταξιδιωτικής Ιατρικής. Ελονοσία και ταξίδι

Τμήμα Παρεμβάσεων σε Χώρους Παροχής Υγείας. Γραφείο Ταξιδιωτικής Ιατρικής. Ελονοσία και ταξίδι Ελονοσία και ταξίδι 1 Η ελονοσία είναι η πιο σοβαρή παρασιτική λοίμωξη και σημαντικό αίτιο θανάτου παγκόσμια. Σύμφωνα με εκτιμήσεις του Παγκόσμιου Οργανισμού Υγείας, 300-500 εκατομμύρια άτομα προσβάλλονται

Διαβάστε περισσότερα

Οικογενησ Μεσογειακοσ Πυρετοσ

Οικογενησ Μεσογειακοσ Πυρετοσ www.printo.it/pediatric-rheumatology/gr/intro Οικογενησ Μεσογειακοσ Πυρετοσ Έκδοση από 2016 2. ΔΙΑΓΝΩΣΗ ΚΑΙ ΘΕΡΑΠΕΙΑ 2.1 Πως μπαίνει η διάγνωση; Γενικά ακολουθείται η παρακάτω προσέγγιση: Κλινική υποψία:

Διαβάστε περισσότερα


ΣΥΝΗΘΕΙΣ ΠΑΘΗΣΕΙΣ ΘΥΡΕΟΕΙΔΟΥΣ Οι όζοι του θυρεοειδούς είναι συχνοί και αποτελούν το συχνότερο ενδοκρινολογικό πρόβλημα σε πολλές χώρες. Οι πιθανότητες ότι κάποιος θα ανακαλύψει έναν τουλάχιστον όζο θυρεοειδούς είναι 1 στις 10 ενώ σε

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΡΓΑΣΤΗΡΙΑΚΗ ΠΡΟΣΕΓΓΙΣΗ ΣΤΗ ΤΑΞΙΔΙΩΤΙΚΗ ΙΑΤΡΙΚΗ Ν.ΒΑΚΑΛΗΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΠΡΟΣΕΓΓΙΣΗ ΣΤΗ ΤΑΞΙΔΙΩΤΙΚΗ ΙΑΤΡΙΚΗ Ν.ΒΑΚΑΛΗΣ Η εργαστηριακή διερεύνηση σε ταξιδιώτη που επιστρέφει καθοδηγείται από : Τις κλινικές εκδηλώσεις (πυρετός, διάρροια,δερματίτιδες...) Την ανοσολογική

Διαβάστε περισσότερα

Πρόταση: καινούργιος ευρωπαϊκός ορισμός κρούσματος για ηπατίτιδα Β

Πρόταση: καινούργιος ευρωπαϊκός ορισμός κρούσματος για ηπατίτιδα Β ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ & ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ (ΚΕ.ΕΛ.Π.ΝΟ.) ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Αλλαγή του ορισμού κρούσματος της Ηπατίτιδας Β και C Δήλωση των περιστατικών χρόνιας ηπατίτιδας Το ECDC προτείνει

Διαβάστε περισσότερα


ΧΕΙΡΟΥΡΓΙΚΗ ΑΝΤΙΜΕΤΩΠΙΣΗ ΣΥΝΔΡΟΜΟΥ FOURNIER ΣΕ ΑΣΘΕΝΗ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΣΥΝΔΡΟΜΟΥ FOURNIER Β ΚΛΙΝΙΚΗ, ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΑΘΗΝΩΝ «ΚΑΤ, 1 Η οξεία γαγγραινώδης φλεγμονή του οσχέου με επέκταση στο περίνεο (σύνδρομο FOURNIER) αποτελεί μια σπάνια νόσο που εμφανίζεται συχνότερα σε

Διαβάστε περισσότερα

Διάγνωση λανθάνουσας φυματίωσης. Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ

Διάγνωση λανθάνουσας φυματίωσης. Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ Διάγνωση λανθάνουσας φυματίωσης 1 Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ Τι είναι η λανθανουσα φυματική λοίμωξη (ΛΦ)? 2 Υποκλινική νόσος ΛΦ είναι η παρουσία M. tuberculosis

Διαβάστε περισσότερα

Ι. Βλαχογιαννάκος, Γ. Β. Παπαθεοδωρίδης, Γ.Ν. Νταλέκος, Α. Αλεξοπούλου, Χ. Τριάντος, Ε. Χολόγκιτας, Ι. Κοσκίνας


Διαβάστε περισσότερα


ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ Χρυσούλα Νικολάου Μονοκλωνικές ελεύθερες ελαφρές αλύσεις Οι μονοκλωνικές ελεύθερες ελαφρές αλύσεις οι οποίες είναι γνωστές ως πρωτεΐνη Bence

Διαβάστε περισσότερα

ΠΝΕΥΜΟΝΙΑ. Γ. Λ. Δαΐκος, M.D. Ιατρική Σχολή ΕΚΠΑ, Λαϊκό Νοσοκομείο. Δεκέμβριος 2014

ΠΝΕΥΜΟΝΙΑ. Γ. Λ. Δαΐκος, M.D. Ιατρική Σχολή ΕΚΠΑ, Λαϊκό Νοσοκομείο. Δεκέμβριος 2014 ΠΝΕΥΜΟΝΙΑ Γ. Λ. Δαΐκος, M.D. Ιατρική Σχολή ΕΚΠΑ, Λαϊκό Νοσοκομείο Δεκέμβριος 2014 Επιδημιολογία Η πνευμονία είναι η έκτη κατά σειρά αιτία θανάτου Επίπτωση: 500-1000 περιπτώσεις /100.000 Στη χώρα μας υπολογίζεται

Διαβάστε περισσότερα

ΛΕΥΧΑΙΜΙΕΣ. Λ.Β. Αθανασίου

ΛΕΥΧΑΙΜΙΕΣ. Λ.Β. Αθανασίου ΛΕΥΧΑΙΜΙΕΣ Λ.Β. Αθανασίου ΟΡΙΣΜΟΙ Λευχαιμίες Κακοήθη νεοπλάσματα των πρόδρομων αιμοκυττάρων του μυελού των oστών. Ατελής διαφοροποίηση οδηγεί σε πολλαπλασιασμό μη ώριμων (και μη λειτουργικών) κυττάρων.

Διαβάστε περισσότερα

Διαγνωστική προσέγγιση ασθενούς με ποσοτικές διαταραχές αιμοπεταλίων- Θρομβοκυττάρωση

Διαγνωστική προσέγγιση ασθενούς με ποσοτικές διαταραχές αιμοπεταλίων- Θρομβοκυττάρωση Διαγνωστική προσέγγιση ασθενούς με ποσοτικές διαταραχές αιμοπεταλίων- Θρομβοκυττάρωση Διαγνωστική προσέγγιση ασθενούς με θρομβοκυττάρωση Εισαγωγή Αριθμός ΑΜΠ 450x10 9 /L γενικά αποδεκτός ως θρομβοκυττάρωση

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 2/2013 (7-13 Ιανουαρίου 2013)

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 2/2013 (7-13 Ιανουαρίου 2013) Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 2/2013 (7-13 Ιανουαρίου 2013) Η επιτήρηση της γρίπης για την περίοδο 2012-2013 σε Ευρωπαϊκό επίπεδο και στην Ελλάδα ξεκίνησε την εβδομάδα

Διαβάστε περισσότερα


ΕΡΓΑΣΤΗΡΙΟ ΣΠΕΡΜΑΤΟΛΟΓΙΑΣ Γ. ΛΥΜΠΕΡΟΠΟΥΛΟΣ ΕΡΓΑΣΤΗΡΙΟ ΣΠΕΡΜΑΤΟΛΟΓΙΑΣ Γ. ΛΥΜΠΕΡΟΠΟΥΛΟΣ Εφαρμογή σύγχρονων μεθόδων διάγνωσης των προβλημάτων στον τομέα της ανδρικής γονιμότητας Λεωφ. Κηφισίας 46 115 26 Αθήνα (2ος όροφος) Τηλ: 210 6452 172, 210 6400

Διαβάστε περισσότερα

Μήπως έχω λέμφωμα; Πώς θα το καταλάβω;

Μήπως έχω λέμφωμα; Πώς θα το καταλάβω; Πώς θα το καταλάβω; Το λέμφωμα είναι δυνητικά ιάσιμη νόσος Μήπως έχω λέμφωμα; Η έγκαιρη διάγνωση, σώζει ζωές Ο οδηγός αυτός έχει γραφτεί για να σας εφοδιάσει με πληροφορίες και συμβουλές, ώστε να αξιολογήσετε

Διαβάστε περισσότερα

- Ποιά εικόνα παρουσιάζει η νόσος;

- Ποιά εικόνα παρουσιάζει η νόσος; Ηπατίτιδα είναι μία νόσος που χαρακτηρίζεται από βλάβη ενός ζωτικού οργάνου που είναι το ήπαρ, η σοβαρότητα της οποίας εξαρτάται από την αιτία που την προκαλεί, από την γενική κατάσταση του ατόμου και

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΣΑΛΜΟΝΕΛΛΩΣΗ Ασθένεια που προκαλείται από τα είδη του γένους Salmonella,, Salmonella Προσβάλλει όλα τα ζωικά είδη και Χαρακτηρίζεται από ένα ή συνδυασμό από τα ακόλουθα τρία συμπτώματα: σηψαιμία,, οξεία

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Β Προπαιδευτική Παθολογική Κλινική ΓΝΘ Ιπποκράτειο Άννα Βαρουκτσή,Ειδικ/νη Παθολογίας

Β Προπαιδευτική Παθολογική Κλινική ΓΝΘ Ιπποκράτειο Άννα Βαρουκτσή,Ειδικ/νη Παθολογίας Β Προπαιδευτική Παθολογική Κλινική ΓΝΘ Ιπποκράτειο Άννα Βαρουκτσή,Ειδικ/νη Παθολογίας ΠΑΡΟΥΣΑ ΝΟΣΟΣ Ασθενής 32 ετών εμφανίζει εμπύρετο ως 39 από 2-3 εβδομάδων προ της εισαγωγής. Συνοδά: μυαλγίες, εμετοί

Διαβάστε περισσότερα

Στην τρέχουσα παρουσίαση δεν υφίσταται σύγκρουση συμφερόντων

Στην τρέχουσα παρουσίαση δεν υφίσταται σύγκρουση συμφερόντων Δοκιμασίες κοπράνων Γιώργος Χουλιάρας, Παιδογαστρεντερολόγος, Πανεπιστημιακός Υπότροφος, Υπεύθυνος Ενδοσκοπήσεων & Ιατρείου Ιδιοπαθών Φλεγμονωδών Nοσημάτων του Εντέρου Μονάδα Γαστρεντερολογίας και Διατροφής

Διαβάστε περισσότερα

Φυματίωση με νέα «πρόσωπα»

Φυματίωση με νέα «πρόσωπα» Φυματίωση με νέα «πρόσωπα» Φιλίππου Δ., Τιτόπουλος Ηρ., Κωνσταντίνου Ελ., Οικονόμου Δ. Πνευμονολογική & Θωρακοχειρουργική Κλινική Ιατρικό Διαβαλκανικό Κέντρο, Θεσσαλονίκη περιστατικό 1 στοιχεία ασθενούς

Διαβάστε περισσότερα



Διαβάστε περισσότερα


YΠΟΤΡΟΠΙΑΖΟΥΣΕΣ ΘΡΟΜΒΩΣΕΙΣ ΩΣ ΠΡΩΤΗ ΕΚΔΗΛΩΣΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΠΝΕΥΜΟΝΟΣ. Μ.Γκάμπρα 1, Ε.Μεταξά 1. Δ.Παπαδοπούλου 1, Δ.Μιχαηλίδης 1, 1 Παθολογική Κλινική Νοσοκομείου Ξάνθης, 2 Τμήμα Επειγόντων Περιστατικών Νοσοκομείου Ξάνθης, 3Ογκολογική Κλινική Νοσοκομείου Αλεξανδρούπολης ΕΙΣΑΓΩΓΗ Η εν τω βάθει φλεβοθρόμβωση είναι μια συνήθης επιπλοκή

Διαβάστε περισσότερα

Λοιμώδης Διάρροια (( Υπεύθυνος: Γ Πετρίκκος, Συνεργάτης:Σ Τσιόδρας)

Λοιμώδης Διάρροια (( Υπεύθυνος: Γ Πετρίκκος, Συνεργάτης:Σ Τσιόδρας) Λοιμώδης Διάρροια (( Υπεύθυνος: Γ Πετρίκκος, Συνεργάτης:Σ Τσιόδρας) Ο όρος «διάρροια» αναφέρεται στη μεταβολή των κενώσεων του εντέρου, η οποία χαρακτηρίζεται από αύξηση του περιεχομένου των κενώσεων σε

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.1 Έκθεση ερευνητικού έργου Υπεύθυνος φορέας: Πανεπιστήμιο Λάρισα,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΞΕΙΑ ΠΥΕΛΟΝΕΦΡΙΤΙΔΑ ΠΥΕΛΟΝΕΦΡΙΤΙΔΑ ΟΞΕΙΑ ΠΥΕΛΟΝΕΦΡΙΤΙΔΑ Πυελονεφρίτιδα είναι η φλεγμονή του νεφρικού παρεγχύματος και της νεφρικής πυέλου. Η διάγνωση τίθεται με βάση τα σημεία και τα συμπτώματα. Πόνος στην πλάτη, στο πλευρό

Διαβάστε περισσότερα


TOXOPLASMA LEISHMANIA COXIELLA RICKETTSIA. Καλλέργη Κωνσταντίνα ΟΡΟΛΟΓΙΚΗ ΙΑΓΝΩΣH TOXOPLASMA LEISHMANIA COXIELLA RICKETTSIA Καλλέργη Κωνσταντίνα Τοξοπλάσμωση-κατηγορίες λοίμωξης Λοίμωξη σε ανοσοεπαρκή άτομα Λοίμωξη κατά τη διάρκεια της κύησης Συγγενής λοίμωξη Πρωτολοίμωξη

Διαβάστε περισσότερα

ΝΟΣΗΜΑΤΑ ΣΥΜΠΤΩΜΑΤΑ ΤΡΟΠΟΙ ΜΕΤΑΔΟΣΗΣ ΔΙΑΓΝΩΣΗ/ΘΕΡΑΠΕΙΑ ΧΛΑΜΥΔΙΑ Αιτία : βακτήρια Πρόληψη : Η χρήση προφυλακτικού Μειώνει τον κίνδυνο μετάδοσης

ΝΟΣΗΜΑΤΑ ΣΥΜΠΤΩΜΑΤΑ ΤΡΟΠΟΙ ΜΕΤΑΔΟΣΗΣ ΔΙΑΓΝΩΣΗ/ΘΕΡΑΠΕΙΑ ΧΛΑΜΥΔΙΑ Αιτία : βακτήρια Πρόληψη : Η χρήση προφυλακτικού Μειώνει τον κίνδυνο μετάδοσης ΝΟΣΗΜΑΤΑ ΣΥΜΠΤΩΜΑΤΑ ΤΡΟΠΟΙ ΜΕΤΑΔΟΣΗΣ ΔΙΑΓΝΩΣΗ/ΘΕΡΑΠΕΙΑ ΧΛΑΜΥΔΙΑ Αιτία : βακτήρια Πρόληψη : Η χρήση προφυλακτικού Μειώνει τον κίνδυνο μετάδοσης Αυξημένες εκκρίσεις από τα γεννητικά όργανα ή τον πρωκτό.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ενημέρωση για κρούσμα ελονοσίας στην Ελλάδα, Ιούνιος 2012

Ενημέρωση για κρούσμα ελονοσίας στην Ελλάδα, Ιούνιος 2012 ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ & ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ (ΚΕ.ΕΛ.Π.ΝΟ.) ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Ενημέρωση για κρούσμα ελονοσίας στην Ελλάδα, Ιούνιος 2012 1 Κρούσμα ελονοσίας με ενδείξεις εγχώριας μετάδοσης,

Διαβάστε περισσότερα

ΠΑΡΑΣΙΤΑ ΝΕΑ ΔΕΔΟΜΕΝΑ. Ν. Βακάλης Εθνική Σχολή Δημόσιας Υγείας


Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 5/2013 (28 Ιανουαρίου - 2 Φεβρουαρίου 2013)

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 5/2013 (28 Ιανουαρίου - 2 Φεβρουαρίου 2013) Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 5/2013 (28 Ιανουαρίου - 2 Φεβρουαρίου 2013) Η επιτήρηση της γρίπης για την περίοδο 2012-2013 σε Ευρωπαϊκό επίπεδο και στην Ελλάδα ξεκίνησε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΣΘΕΝΗΣ ΜΕ ΠΑΓΚΥΤΤΑΡΟΠΕΝΙΑ ΚΑΙ ΠΥΡΕΤΟ. Απαρτιωμένη διδασκαλία στην Αιματολογία 2014

ΑΣΘΕΝΗΣ ΜΕ ΠΑΓΚΥΤΤΑΡΟΠΕΝΙΑ ΚΑΙ ΠΥΡΕΤΟ. Απαρτιωμένη διδασκαλία στην Αιματολογία 2014 ΑΣΘΕΝΗΣ ΜΕ ΠΑΓΚΥΤΤΑΡΟΠΕΝΙΑ ΚΑΙ ΠΥΡΕΤΟ Απαρτιωμένη διδασκαλία στην Αιματολογία 2014 Ιστορικά ασθενών με σύνδρομα μυελικής ανεπάρκειας 1 ο ιστορικό: Ανδρας 65 ετών με ήπιο σακχαρώδη διαβήτη από 5-ετίας παρουσιάζει

Διαβάστε περισσότερα

Σοφία Λουκά 3 ο Έτος Τμήμα Νοσηλευτικής Σχολή Επιστημών Υγείας Τεχνολογικό Πανεπιστήμιο Κύπρου

Σοφία Λουκά 3 ο Έτος Τμήμα Νοσηλευτικής Σχολή Επιστημών Υγείας Τεχνολογικό Πανεπιστήμιο Κύπρου Νευροβλάστωμα Σοφία Λουκά 3 ο Έτος Τμήμα Νοσηλευτικής Σχολή Επιστημών Υγείας Τεχνολογικό Πανεπιστήμιο Κύπρου Ορισμός: Κακοήθες νεόπλασμα το οποίο προέρχεται από αρχέγονα εξωδερμικά κύτταρα (νευροβλάστες)

Διαβάστε περισσότερα

Κανένα για αυτήν την παρουσίαση. Εκπαιδευτικές-ερευνητικές-συμβουλευτικές επιχορηγήσεις την τελευταία διετία: Abbvie,Novartis, MSD, Angelini,

Κανένα για αυτήν την παρουσίαση. Εκπαιδευτικές-ερευνητικές-συμβουλευτικές επιχορηγήσεις την τελευταία διετία: Abbvie,Novartis, MSD, Angelini, Κανένα για αυτήν την παρουσίαση Εκπαιδευτικές-ερευνητικές-συμβουλευτικές επιχορηγήσεις την τελευταία διετία: Abbvie,Novartis, MSD, Angelini, 2 Κυκλοσπορίνη-θεραπευτικές ενδείξεις 3 Θεραπεία σοβαρών μορφών

Διαβάστε περισσότερα

Συστολική καρδιακή ανεπάρκεια και µυοκαρδίτιδα

Συστολική καρδιακή ανεπάρκεια και µυοκαρδίτιδα Συστολική καρδιακή ανεπάρκεια και µυοκαρδίτιδα Αγγελής Αθανάσιος Ά Πανεπιστηµιακή Καρδιολογική Κλινική Ιπποκράτειο ΓΝΑ Ιστορικό εργαστηριακό προφίλ! Αθλητής, 17 ετών από 4ηµέρου αναφέρει εµπύρετο, οπισθοστερνικό

Διαβάστε περισσότερα

Δεκαπεντάλεπτη προετοιμασία του φοιτητή, για την παρακολούθηση του μαθήματος του καρκίνου του προστάτη.

Δεκαπεντάλεπτη προετοιμασία του φοιτητή, για την παρακολούθηση του μαθήματος του καρκίνου του προστάτη. Δεκαπεντάλεπτη προετοιμασία του φοιτητή, για την παρακολούθηση του μαθήματος του καρκίνου του προστάτη. Καρκίνος του προστάτη Επιδημιολογία: Αποτελεί τον συχνότερα διαγνωσμένο καρκίνο στον άνδρα. 186.320

Διαβάστε περισσότερα

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης Επιδημία λοίμωξης από κολοβακτηρίδιο που παράγει Shigaτοξίνη (STEC), Γερμανία, Μάϊος 2011 1. Εισαγωγή Ο όρος «κολοβακτηρίδια που παράγουν Shiga-τοξίνη (STEC)», χρησιμοποιείται για να περιγράψει μια ομάδα

Διαβάστε περισσότερα

Άνδρας 45 ετών παραπέμπεται από Κ.Υ. λόγω ανεύρεσης χαμηλής τιμής PLT (10.000/mm³)

Άνδρας 45 ετών παραπέμπεται από Κ.Υ. λόγω ανεύρεσης χαμηλής τιμής PLT (10.000/mm³) Άνδρας 45 ετών παραπέμπεται από Κ.Υ. λόγω ανεύρεσης χαμηλής τιμής PLT (10.000/mm³) Στο Κ.Υ. προσήλθε για υδαρείς διαρροϊκές κενώσεις με συνοδό εμπύρετο έως 39,5 C, με ρίγος από διημέρου. Α/Α: ελεύθερο

Διαβάστε περισσότερα


ΕΛΛΗΝΙΚΗ ΑΓΓΕΙΟΧΕΙΡΟΥΡΓΙΚΗ ΕΤΑΙΡΕΙΑ ΕΝΗΜΕΡΩΤΙΚΟ ΦΥΛΛΑΔΙΟ ΑΝΕΥΡΥΣΜΑ ΤΗΣ ΚΟΙΛΙΑΚΗΣ ΑΟΡΤΗΣ ΑΝΕΥΡΥΣΜΑ ΚΟΙΛΙΑΚΗΣ ΑΟΡΤΗΣ Κάθε χρόνο περίπου 200.000 νέοι ασθενείς διαγιγνώσκονται με Ανεύρυσμα Κοιλιακής Αορτής. Είναι γνωστό επίσης, ότι η ρήξη του Ανευρύσματος Κοιλιακής Αορτής οδηγεί σε ποσοστό τουλάχιστον

Διαβάστε περισσότερα

Ορθολογική χρήση κοινών εργαστηριακών παραμέτρων στην παιδιατρική πράξη: ASTO

Ορθολογική χρήση κοινών εργαστηριακών παραμέτρων στην παιδιατρική πράξη: ASTO Ορθολογική χρήση κοινών εργαστηριακών παραμέτρων στην παιδιατρική πράξη: ASTO Πολυξένη Πρατσίδου-Γκέρτση Πανεπιστημιακός Υπότροφος ΑΠΘ στην Παιδιατρική Ρευματολογία Α Παιδιατρική Κλινική ΑΠΘ Περίγραμμα

Διαβάστε περισσότερα

Σεξουαλικά µεταδιδόµενα νοσήµατα και AIDS στους εφήβους. Χαράλαµπος Ανταχόπουλος 3 η Παιδιατρική Κλινική ΑΠΘ

Σεξουαλικά µεταδιδόµενα νοσήµατα και AIDS στους εφήβους. Χαράλαµπος Ανταχόπουλος 3 η Παιδιατρική Κλινική ΑΠΘ Σεξουαλικά µεταδιδόµενα νοσήµατα και AIDS στους εφήβους Χαράλαµπος Ανταχόπουλος 3 η Παιδιατρική Κλινική ΑΠΘ Εφηβική ηλικία και σεξουαλικά µεταδιδόµενα νοσήµατα (STDs) Έναρξη σεξουαλικής ζωής Έλλειψη προφυλάξεων

Διαβάστε περισσότερα

Το θωρακικό άλγος, όχι σπάνιο

Το θωρακικό άλγος, όχι σπάνιο Προσέγγιση του παιδιού με θωρακικό άλγος Steven M. Selbst, MD Pediatr Clin N Am 57 (2010) 1221 1234 Παρουσίαση : Νίκος Α. Καρανταγλής Επιστημονικός Συνεργάτης Γ ΠΔ Α.Π.Θ. 10/01/2011 www.pd3.gr Το θωρακικό

Διαβάστε περισσότερα

Παρουσίαση ανοσοαιματολογικής εικόνας εγκύου και εμβρύου νεογνού με αιμολυτική νόσο από anti-d

Παρουσίαση ανοσοαιματολογικής εικόνας εγκύου και εμβρύου νεογνού με αιμολυτική νόσο από anti-d Παρουσίαση ανοσοαιματολογικής εικόνας εγκύου και εμβρύου νεογνού με αιμολυτική νόσο από anti-d Ε. Λυδάκη, Αιματολόγος, επιμ Α Υπηρεσία αιμοδοσίας ΠΑΓΝΗ Γυναίκα, έγκυος, 37 ετών, Α (-), Kell (-) (σύζυγος

Διαβάστε περισσότερα


ΕΠΙΠΛΑΚΕΙΣΑ ΟΠΙΣΘΟΠΕΡΙΤΟΝΑΪΚΗ ΚΥΣΤΗ : ΠΕΡΙΓΡΑΦΗ ΠΕΡΙΠΤΩΣΕΩΣ ΚΥΣΤΗ : ΠΕΡΙΓΡΑΦΗ Θεοδοσίου Αικατερίνη¹, Βαρσάμης Νικόλαος¹, Σαλβερίδης Νικόλαος¹, Ταβλαρίδης Θεόδωρος¹, Σουφτάς Βασίλειος², Χρισ 1. Α Χειρουργική Κλινική, Γενικό Νοσοκομείο Καβάλας 2. Μονάδα Επεμβατικής

Διαβάστε περισσότερα

ΔΕΙΚΤΕΣ ΗΠΑΤΙΚΗΣ ΛΕΙΤΟΥΡΓΙΑΣ. Λ.Β. Αθανασίου Παθολογική Κλινική, Τμήμα Κτηνιατρικής, Π.Θ.

ΔΕΙΚΤΕΣ ΗΠΑΤΙΚΗΣ ΛΕΙΤΟΥΡΓΙΑΣ. Λ.Β. Αθανασίου Παθολογική Κλινική, Τμήμα Κτηνιατρικής, Π.Θ. ΔΕΙΚΤΕΣ ΗΠΑΤΙΚΗΣ ΛΕΙΤΟΥΡΓΙΑΣ Λ.Β. Αθανασίου Παθολογική Κλινική, Τμήμα Κτηνιατρικής, Π.Θ. ΔΕΙΚΤΕΣ ΗΠΑΤΙΚΗΣ ΛΕΙΤΟΥΡΓΙΑΣ Δείκτες βλάβης ηπατοκυττάρων Δείκτες χολόστασης Δείκτες ηπατικής δυσλειτουργίας ΔΕΙΚΤΕΣ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο E M E D N L C SCIENCES BIOMEDICAL E N T E R Kέντρο Μέντελ για Βιοιατρικές Επιστήμες Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο Βασίλειος Τάνος MD PhD www.mendelcenter.org Picture taken from leaflet

Διαβάστε περισσότερα

Παρασκευή, 11 Απριλίου 2014

Παρασκευή, 11 Απριλίου 2014 Παρασκευή, 11 Απριλίου 2014 09.00-11.00 ΠΡΟΣΕΛΕΥΣΗ - ΕΓΓΡΑΦΕΣ 10.00-12.10 ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΣΦΑΛΗΣ ΠΡΟΕΤΟΙΜΑΣΙΑ ΕΙΔΙΚΩΝ ΟΜΑΔΩΝ ΤΑΞΙΔΙΩΤΩΝ ΑΝΟΣΟΚΑΤΕΣΤΑΛΜΕΝΟΣ ΤΑΞΙΔΙΩΤΗΣ 10.00-10.20 Ανοσοκατασταλτικά και Βιολογικοί

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πρόγραμμα εξειδίκευσης στη λοιμωξιολογία στη Γʹ Παιδιατρική Κλινική ΑΠΘ

Πρόγραμμα εξειδίκευσης στη λοιμωξιολογία στη Γʹ Παιδιατρική Κλινική ΑΠΘ 1 Πρόγραμμα εξειδίκευσης στη λοιμωξιολογία στη Γʹ Παιδιατρική Κλινική ΑΠΘ Υπεύθυνοι για την εκπαίδευση των εξειδικευομένων είναι οι: Εμμανουήλ Ροηλίδης, Καθηγητής Παιδιατρικής Λοιμωξιολογίας Χαράλαμπος

Διαβάστε περισσότερα

Αιμορραγικός πυρετός Ebola

Αιμορραγικός πυρετός Ebola Αιμορραγικός πυρετός Ebola Επιστημονική Συνάντηση SOS Ιατρών 29/11/2014 Φώτιος Π. Πετρόπουλος MD, MHA Ειδικός Παθολόγος Δεν υπάρχει καμία οικονομική ή άλλη εξάρτηση του ομιλούντος που να μπορεί να επηρεάσει

Διαβάστε περισσότερα

Οικογενησ Μεσογειακοσ Πυρετοσ

Οικογενησ Μεσογειακοσ Πυρετοσ www.printo.it/pediatric-rheumatology/gr/intro Οικογενησ Μεσογειακοσ Πυρετοσ Έκδοση από 2016 1. ΤΙ ΕΙΝΑΙ Ο ΟΙΚΟΓΕΝΗΣ ΜΕΣΟΓΕΙΑΚΟΣ ΠΥΡΕΤΟΣ 1.1 Τι είναι; Ο Οικογενής Μεσογειακός Πυρετός (ΟΜΠ) είναι ένα γενετικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Διαχείριση της βιοχημικής υποτροπής στον καρκίνο του προστάτη

Διαχείριση της βιοχημικής υποτροπής στον καρκίνο του προστάτη Μωυσίδης Κυριάκος Λέκτορας Ουρoλογίας Β ουρολογική κλινική του Α.Π.Θ. Διευθυντής Καθηγητής Ε. Ιωαννίδης Διαχείριση της βιοχημικής υποτροπής στον καρκίνο του προστάτη Καρκίνος του προστάτη Yπάρχει κάποια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Eβδομάδα 3/2017 (16 22 Ιανουαρίου 2017)

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Eβδομάδα 3/2017 (16 22 Ιανουαρίου 2017) Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Eβδομάδα 3/2017 (16 22 Ιανουαρίου 2017) Η επιτήρηση της γρίπης για την περίοδο 2016-2017 σε Ευρωπαϊκό επίπεδο και στην Ελλάδα ξεκίνησε την εβδομάδα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Αποφασίζοντας βάσει της αποτελεσματικότητας: η αξιολόγηση της ιατρικής τεχνολογίας

Αποφασίζοντας βάσει της αποτελεσματικότητας: η αξιολόγηση της ιατρικής τεχνολογίας Αποφασίζοντας βάσει της αποτελεσματικότητας: η αξιολόγηση της ιατρικής τεχνολογίας Χρήστος Λιονής Καθηγητής Γενικής Ιατρικής και Πρωτοβάθμιας Φροντίδας Υγείας Τμήμα Ιατρικής Πανεπιστήμιο Κρήτης Η αναφορά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


25. RHESUS (Rh) ANOΣΟΠΟΙΗΣΗ Η Rh ανοσοποίηση οφείλεται σε εμβρυο-μητρική μετάγγιση (ΕΜΜ), όπου ποσότητα Rh θετικού εμβρυϊκού αίματος εισέρχεται στη μητρική κυκλοφορία Rh αρνητικής εγκύου και δημιουργούνται αντισώματα κατά του παράγοντα

Διαβάστε περισσότερα

Συχνότητα. Άντρες Γυναίκες 5 1. Νεαρής και μέσης ηλικίας

Συχνότητα. Άντρες Γυναίκες 5 1. Νεαρής και μέσης ηλικίας Η αιτιολογία της πάθησης είναι άγνωστη, αν και έχει μεγάλη σχέση με το κάπνισμα καθώς το 90% των ασθενών είναι ενεργείς καπνιστές Συχνότητα Άντρες Γυναίκες 5 1 Νεαρής και μέσης ηλικίας Στο 60% των περιπτώσεων

Διαβάστε περισσότερα


ΜΗΠΩΣ ΕΧΩ ΛΕΜΦΩΜΑ; ΠΩΣ ΘΑ ΤΟ ΚΑΤΑΛΑΒΩ; ΜΗΠΩΣ ΕΧΩ ΛΕΜΦΩΜΑ; ΠΩΣ ΘΑ ΤΟ ΚΑΤΑΛΑΒΩ; Με την επιστημονική συνεργασία της Αιματολογικής Μονάδας, Γ Πανεπιστημιακή Παθολογική Κλινική, Ιατρική Σχολή Πανεπιστημίου Αθηνών Με την ευγενική χορηγία της Roche

Διαβάστε περισσότερα