Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΕΝΔΙΑΦΕΡΟΥΣΑ ΠΕΡΙΠΤΩΣΗ CASE REPORT ΣΠΛΑΧΝΙΚΗ ΛΕΪΣΜΑΝΙΑΣΗ: ΠΕΡΙΓΡΑΦΗ ΠΕΡΙΠΤΩΣΕΩΝ ΚΑΙ ΑΝΑΣΚΟΠΗΣΗ ΤΗΣ ΒΙΒΛΙΟΓΡΑΦΙΑΣ VISCERAL LEISHMANIASIS: REPORT OF 7 CASES AND REVIEW OF THE LITERATURE Χαραλαμπάκη Νικολέτα Charalampaki Nikoletta 1, Τσιβεριώτης Κωνσταντίνος Tsiveriotis Konstantinos 1, Ζάμπου Αικατερίνη Zambou Katerina 1, Γιαννοπούλου Παναγιώτα Giannopoulou Panagiota 1, Κυράτσα Άννα Kyratsa Anna 1, Υφαντής Ευστάθιος Yfantis Efstathios 2, Αντωνίου Μαρία Antoniou Maria 3, Τρίκκα-Γραφάκου Ελευθερία Trikka-Graphakos Eleftheria 1 1 Μικροβιολογικό Εργαστήριο, ΓΝΕ «Θριάσιο». Laboratory of Microbiology, Thriassio Hospital. 2 Αιματολογικό Εργαστήριο, ΓΝΕ «Θριάσιο». Laboratory of Hematology, Thriassio Hospital. 3 Εργαστήριο Κλινικής Βακτηριολογίας, Παρασιτολογίας, Ζωονόσων και Γεωγραφικής Ιατρικής, Ιατρική Σχολή Πανεπιστημίου Κρήτης. Laboratory of Clinical Bacteriology, Parasitology, Zoonoses and Geographical Medicine, Medical School, University of Crete. ΥΠΕΥΘΥΝΟΣ ΑΛΛΗΛΟΓΡΑΦΙΑΣ ADDRESS FOR CORRESPONDANCE Κωνσταντίνος Τσιβεριώτης (Επιμελητής Β ) Konstantinos Tsiveriotis Μικροβιολογικό Εργαστήριο, ΓΝΕ «Θριάσιο» Department of Microbiology, Thriassio Hospital Μαγούλα , Magoula Τ: Τ: E: E: ΠΕΡΙΛΗΨΗ SUMMARY Η σπλαχνική λεϊσμανίαση είναι μια συστηματική παρασιτική νόσος που μεταδίδεται στον άνθρωπο με το δήγμα μολυσμένων φλεβοτόμων. Ενδημεί στη Μεσόγειο, την Μέση Ανατολή, την Αφρική, την Βόρεια Αμερική και την Ινδία. Παρακάτω περιγράφονται επτά περιπτώσεις σπλαχνικής λεϊσμανίασης που παρουσιάστηκαν στο νοσοκομείο μας τα τελευταία 5 χρόνια ( ). Το παρατεινόμενο εμπύρετο, η ηπατοσπληνομεγαλία, η απώλεια βάρους, η αναιμία, η πανκυτταροπενία, η υπεργαμμασφαιριναιμία και η αύξηση της C-αντιδρώσας πρωτεΐνης (CRP) ήταν τα κυριότερα ευρήματα. Για την εργαστηριακή διερεύνηση των περιστατικών χρησιμοποιήθηκαν συμβατικές μέθοδοι (οστεομυελική βιοψία, έμμεσος ανοσοφθορισμός, ηλεκτροσυναίρεση και ειδική καλλιέργεια), που ήταν θετικές σε έξι, έξι, Visceral leishmaniasis (VL), a systemic protozoan disease transmitted by phlebotomine sandflies, is endemic in areas of Mediterranean, Middle East, India, Africa and South America. In the present Case Report, we report 7 cases of VL diagnosed in our hospital during the last 5 years ( ). Prolonged fever, splenomegaly, hepatomegaly, weight loss, anemia, pancytopenia, hypergammaglobulinemia and an elevated CRP level were the main features of the disease. Diagnosis was made through conventional methods (bone marrow aspiration, indirect immunofluorescence, electrosyneresis, culture), which were positive in six, six, six and five cases respectively, as well as using polymerase chain reaction (PCR) which was positive in all seven cases. In conclusion, 23

2 ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΠΤΩΣΕΩΝ ΣΠΛΑΧΝΙΚΗΣ ΛΕΪΣΜΑΝΙΑΣΗΣ ΤΟΜΟΣ 57 / ΤΕΥΧΟΣ 2 έξι και πέντε από τις επτά περιπτώσεις, καθώς και η αντίδραση αλυσιδωτής πολυμεράσης (PCR) που ήταν θετική σε όλες τις περιπτώσεις ασθενών. Συμπερασματικά, η εκτίμηση των κλινικών δεδομένων και ο συνδυασμός εργαστηριακών εξετάσεων, συμβατικών και νεότερων, συμβάλλει στην έγκαιρη διάγνωση και την άμεση έναρξη θεραπευτικής αγωγής. assessment of clinical data and the combination of conventional and newer laboratory methods contribute to accurate diagnosis and prompt treatment. KEYWORDS Visceral leishmaniasis, diagnosis,conventional methods, PCR ΛΕΞΕΙΣ ΚΛΕΙΔΙΑ Σπλαχνική λεϊσμανίαση, Διάγνωση, Συμβατικές μέθοδοι, PCR ΕΙΣΑΓΩΓΗ Η λεϊσμανίαση είναι μια παρασιτική νόσος που οφείλεται στο ενδοκυττάριο παράσιτο του γένους Leishmania (οικ. Trypanosomatidae). Το παράσιτο μεταδίδεται κυρίως από ζώα (συνηθέστερα σκύλους και τρωκτικά) στον άνθρωπο, με το δήγμα μολυσμένων φλεβοτόμων. Συνολικά 21 διαφορετικά είδη Λεϊσμάνιας έχουν αναγνωρισθεί ως παθογόνα για τον άνθρωπο, προκαλώντας κυρίως τρεις μορφές της νόσου: τη δερματική, τη βλεννογονοδερματική και τη σπλαχνική λεϊσμανίαση (Kala-azar). Η σπλαχνική, που είναι η πιο σοβαρή μορφή, έχει παγκοσμίως ετήσια επίπτωση και θνητότητα πάνω από περιπτώσεις. 1 Η νόσος ενδημεί στις Μεσογειακές χώρες γύρω από τη λεκάνη της Μεσογείου, την Αφρική, την Ινδική χερσόνησο, τη Νότια Αμερική και τη Μέση Ανατολή. 2 Οι κυριότεροι παράγοντες που συμβάλλουν στην εξάπλωσή της είναι η μετανάστευση, ο τουρισμός, η οικονομική ανάπτυξη, η αστικοποίηση, οι κλιματικές μεταβολές και η ανοσοκαταστολή. 3 Η Ελλάδα είναι χώρα ενδημική για τη λεϊσμανίαση. Σύμφωνα, όμως, με τα στοιχεία του ΚΕΕΛΠΝΟ, 4 ο αριθμός των κρουσμάτων που καταγράφεται ετησίως στη χώρα μας είναι μικρός, χωρίς να διαφαίνεται κάποια σαφής τάση μεταβολής της δηλούμενης επίπτωσης τα τελευταία χρόνια. Έτσι, για τα έτη , η μέση ετήσια επίπτωση της νόσου ήταν 0,5 κρούσματα ανά πληθυσμού και ο μέσος αριθμός κρουσμάτων ήταν κατ έτος 47. Ωστόσο, υπάρχουν αναφορές για αυξημένο αριθμό κρουσμάτων τόσο από την Βόρεια Ελλάδα, όσο και από την Κρήτη, όπου η επίπτωση της σπλαχνικής λεϊσμανίασης έχει ανέλθει στα 7 περιστατικά το χρόνο σε έναν πληθυσμό ατόμων, τα τελευταία 4 χρόνια ( ). 5, 6 Κατά την ίδια χρονική περίοδο σημαντική είναι η αναφορά από την Κρήτη στην οποία τονίζεται η δερματική λεϊσμανίαση από Leishmania tropica ΜΟΝ-300 ως αναδυόμενη νόσος (3 περιστατικά/ έτος). 6 Επιπλέον, στην Κρήτη παρατηρείται αύξηση της οροθετικότητας των σκύλων τα τελευταία χρόνια. 7 Οι αναφορές αυτές σε συνδυασμό με την ενδεχόμενη υποδήλωση του νοσήματος, την πιθανότητα παρουσίας του παρασίτου σε μεγαλύτερο ποσοστό του πληθυσμού χωρίς κλινικές εκδηλώσεις νόσου και το γεγονός ότι η Λεϊσμάνια αποτελεί ένα από τα συχνότερα ευκαιριακά παθογόνα σε ασθενείς με AIDS καθιστούν τη λεϊσμανίαση μια νόσο που χρήζει ιδιαίτερης προσοχής. Στην παρούσα εργασία περιγράφονται επτά περιπτώσεις ασθενών με σπλαχνική λεϊσμανίαση, (πέντε ενηλίκων και δυο παιδιών), που νοσηλεύθηκαν στο νοσοκομείο μας, τα τελευταία πέντε χρόνια ( ), και ακολουθεί σύντομη ανασκόπηση της βιβλιογραφίας. ΠΕΡΙΓΡΑΦΗ ΠΕΡΙΠΤΩΣΕΩΝ Πρώτη περίπτωση Άνδρας 69 ετών, ελληνικής καταγωγής, κάτοικος Ελευσίνας Αττικής, προσήλθε στο νοσοκομείο μας τον Ιανουάριο του 2007, λόγω παρατεινόμενου εμπύρετου (έως 39 C) και κακουχίας από τριμήνου. Ο ασθενής είχε ελεύθερο ατομικό αναμνηστικό, δεν ανέφερε πρόσφατο ταξίδι, ενώ σημαντική ήταν η καθημερινή του ενασχόληση με τη φροντίδα αδέσποτων ζώων. Από την αντικειμενική εξέταση διαπιστώθηκε ωχρότητα και ηπατοσπληνομεγαλία, ενώ δεν ψηλαφήθηκαν λεμφαδένες. Από τον αιματολογικό έλεγχο διαπιστώθηκαν: WBC: 6.100/mm 3, Ht: 35.3%, PLT: /mm 3. Ο βιοχημικός έλεγχος δεν ανέδειξε αξιόλογα ευρήματα πλην μιας ελαφρώς ελαττωμένης τιμής της αλβουμίνης (3,37 gr/dl) και μιας αύξησης της C-αντιδρώσας 24

3 VOL 57 / ISSUE 2 CASES REPORT, VISCERAL LEISHMANIASIS πρωτεΐνης (CRP: 50mg/dl). Το υπερηχογράφημα άνω κοιλίας επιβεβαίωσε την ύπαρξη ηπατοσπληνομεγαλίας. dl), αύξηση των ολικών λευκωμάτων (11,39 g/dl), υπεργαμμασφαιριναιμία και αύξηση της CRP: 72mg/dl. Δεύτερη περίπτωση Γυναίκα ηλικίας 70 ετών, ελληνικής καταγωγής, κάτοικος Αθηνών, προσήλθε στα εξωτερικά ιατρεία του νοσοκομείου μας τον Απρίλιο του 2007 αιτιώμενη καταβολή δυνάμεων και εμπύρετο (έως 38,5 Ο C) από μηνός. Η ασθενής ανέφερε την παρουσία σκύλου στο σπίτι, ενώ δεν είχε ταξιδέψει πρόσφατα στην Ελλάδα ή το εξωτερικό. Το κύριο εύρημα κατά την αντικειμενική εξέταση ήταν η σπληνομεγαλία, η οποία επιβεβαιώθηκε αργότερα και υπερηχογραφικά. Ο εργαστηριακός έλεγχος έδειξε λευκοπενία (WBC: 3000/mm 3 ), αναιμία (Ht: 30%), θρομβοπενία (PLT: /mm 3 ), αύξηση των ηπατικών δεικτών (SGOT: 72 U/L, SGPT: 65 U/L, ALP:183 U/L, ολική χολερυθρίνη: 2,06 mg/dl, άμεση χολερυθρίνη: 1,19mg/dl), καθώς και ήπια αύξηση της CRP (20 mg/dl). Με τη μέθοδο της ανοσοκαθήλωσης διαπιστώθηκε υπεργαμμασφαιριναιμία. Τρίτη περίπτωση Άνδρας 28 ετών, πακιστανικής καταγωγής, κάτοικος Ασπροπύργου Αττικής, προσήλθε στο νοσοκομείο μας τον Ιούλιο του 2007 με παρατεινόμενο εμπύρετο (έως 39 C) από εξαμήνου. Ο ασθενής ανέφερε ταξίδι στο Πακιστάν προ εξαμήνου και καθημερινή επαφή με αδέσποτα ζώα. Κατά την αντικειμενική εξέταση παρατηρήθηκαν πολλαπλά δήγματα εντόμων στα άνω και κάτω άκρα του ασθενούς και ηπατοσπληνομεγαλία, η οποία επιβεβαιώθηκε υπερηχογραφικά. Τα κυριότερα εργαστηριακά ευρήματα ήταν: WBC: 3.300/ mm 3, Ht: 35,7%, PLT: / mm 3, αύξηση των ηπατικών ενζύμων (SGOT: 175U/L, SGPT: 149U/L, ALP: 122U/L), υπεργαμμασφαιριναιμία και αυξημένη CRP: 55mg/dl. Τέταρτη περίπτωση Άνδρας 68 ετών, Ελληνικής καταγωγής, κάτοικος Ελευσίνας, προσήλθε στο τμήμα επειγόντων περιστατικών του νοσοκομείου μας το Νοέμβριο του 2007 αναφέροντας καταβολή δυνάμεων, απώλεια βάρους και κακουχία από τριμήνου. Ο ασθενής έπασχε από αλκοολική κίρρωση, ενώ σημαντική ήταν η καθημερινή του επαφή με αδέσποτους σκύλους. Κατά την αντικειμενική εξέταση διαπιστώθηκαν: πυρετός (38,6 C), ευαισθησία αριστερού και δεξιού υποχονδρίου και ηπατοσπληνομεγαλία, η οποία ήταν συμβατή με τον υπερηχογραφικό έλεγχο. Ο εργαστηριακός έλεγχος έδειξε: WBC:1300/ mm 3, Ht: 24%, PLT: / mm 3, ήπια αύξηση της ολικής χολερυθρίνης (1,55mg/ Πέμπτη περίπτωση Άνδρας 19 χρονών, Ελληνικής καταγωγής, κάτοικος Σκύρου, προσήλθε στο νοσοκομείο τον Ιανουάριο του 2012, αναφέροντας εμπύρετο έως 40 Ο C από δεκαημέρου. Ο ασθενής δεν ανέφερε επαφή με σκύλους, ούτε κάποιο ταξίδι το τελευταίο χρονικό διάστημα. Η αντικειμενική εξέταση ανέδειξε ηπατοσπληνομεγαλία. Από τον εργαστηριακό αιματολογικό έλεγχο διαπιστώθηκαν: WBC: 2.900/ mm 3, Ht: 25.5%, PLT: / mm 3. Ο βιοχημικός έλεγχος δεν ανέδειξε αξιόλογα ευρήματα πλην μιας αύξησης των ολικών λευκωμάτων (9.12 g/dl) και της CRP (110mg/dl). Έκτη περίπτωση Αγόρι 20 μηνών, αθίγγανος, αλβανικής καταγωγής, κάτοικος Ασπροπύργου, προσήλθε στο τμήμα επειγόντων περιστατικών του νοσοκομείου μας τον Ιούνιο του 2008, με αναφερόμενο εμπύρετο έως 38,5 Ο C και κοιλιακό άλγος από δεκαημέρου. Η φυσική εξέταση του ασθενούς δεν ανέδειξε ιδιαίτερα ευρήματα. Ο αιματολογικός έλεγχος έδειξε WBC: 4.400/ mm 3, Ht: 20.9%, PLT: / mm 3. Ο βιοχημικός έλεγχος ήταν εντός φυσιολογικών ορίων πλην της αυξημένης τιμής της CRP (45mg/dl). Το υπερηχογράφημα άνω κοιλίας έδειξε σπληνομεγαλία. Έβδομη περίπτωση Κορίτσι 2 ετών, αθίγγανη, αλβανικής καταγωγής, κάτοικος Ζεφυρίου Αττικής, διακομίσθηκε στο εξωτερικό Παιδιατρικό ιατρείο του νοσοκομείου μας τον Απρίλιο του 2008 λόγω εμπύρετου από μηνός έως 40 Ο C. Η ασθενής εμφάνιζε όψη πάσχοντος και ευαισθησία κατά την ψηλάφηση της κοιλιακής χώρας. Τα εργαστηριακά ευρήματα εισαγωγής ήταν WBC: 4.300/ mm 3, Ht: 18,5%, PLT: / mm 3, SGOT: 43 U/L, ALP: 133 U/L, CRP: 80 mg/dl. Το υπερηχογράφημα άνω κοιλίας έδειξε ηπατοσπληνομεγαλία. Εξέλιξη νόσου και διαγνωστική διαδικασία Σε όλες τις ανωτέρω περιπτώσεις με την υποψία λεϊσμανίασης οι ασθενείς υποβλήθηκαν στο νοσοκομείο μας σε βιοψία μυελού των οστών και σε ορολογικό έλεγχο με τη μέθοδο του έμμεσου ανοσοφθορισμού. Παράλληλα και προ της έναρξης της θεραπευτικής αγωγής, δείγματα περιφερικού αίματος εστάλησαν στο εργαστήριο Κλινικής Βακτηριολογίας, Παρασιτολογίας, Ζωονόσων και Γεωγραφικής Ιατρικής του Πανεπιστημίου της 25

4 ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΠΤΩΣΕΩΝ ΣΠΛΑΧΝΙΚΗΣ ΛΕΪΣΜΑΝΙΑΣΗΣ ΤΟΜΟΣ 57 / ΤΕΥΧΟΣ 2 Κρήτης, όπου ελέγχθηκαν με τη μέθοδο της ηλεκτροσυναίρεσης καθώς και με καλλιέργεια και PCR για την παρουσία και τον προσδιορισμό του είδους των παρασίτων. Η οστεομυελική βιοψία ήταν θετική σε όλες τις περιπτώσεις εκτός από την πρώτη. Τα μυελικά παρασκευάσματα εξετάσθηκαν στο μικροσκόπιο για την παρουσία αμαστιγωτών μορφών. Οι αμαστιγωτές μορφές είχαν στρογγυλό ή ωοειδές σχήμα, μέγεθος 2 3 μm και ανευρίσκονταν συνήθως μέσα σε μονοκύτταρα ή μακροφάγα Με τη χρώση Giemsa το κυτταρόπλασμα τους χρωματιζόταν ανοιχτό γαλάζιο, ενώ ο πυρήνας και ο κινητοπλάστης τους ερυθρός ή ιώδης. Για την ανίχνευση των ειδικών IgG αντισωμάτων εφαρμόστηκε σε όλα τα δείγματα ορού των ασθενών έμμεσος ανοσοφθορισμός με αντιγόνο Leishmania infantum (Vircell Microbiologist, Santa Fe, Granada, 18320, Spain), σύμφωνα με τις οδηγίες του κατασκευαστή. Η εκτίμηση των αποτελεσμάτων έγινε σε μικροσκόπιο φθορισμού σε σύγκριση με το θετικό και τον αρνητικό μάρτυρα. Τίτλος αντισωμάτων 1: 40 θεωρήθηκε θετικός για τη νόσο. Με εξαίρεση τον πρώτο ασθενή, οι υπόλοιποι ασθενείς είχαν αυξημένο τίτλο αντισωμάτων IgG. Ο τίτλος κυμάνθηκε από 1:400 έως 1:2560. Η τεχνική της ηλεκτροσυναίρεσης (Εικ. 1), εφαρμόστηκε σε όλα τα δείγματα των ασθενών και ήταν θετική σε όλες τις περιπτώσεις, εκτός από την πρώτη. Η μέθοδος αυτή χρησιμοποιείται για τον ποιοτικό προσδιορισμό αντισωμάτων και αποτελεί στην ουσία βελτίωση της μεθόδου της διπλής ανοσοδιάχυσης, η οποία στηρίζεται στην αντίθετη ηλεκτροφορητική μετακίνηση του αντιγόνου και του αντισώματος, όταν αυτά τοποθετούνται σε άγαρ και εφαρμόζεται ηλεκτρικό πεδίο. Συμβάλλει ουσιαστικά τόσο στην εξακρίβωση ενεργού νόσου (εμφάνιση του ειδικού τόξου 4/24 που είναι ειδικό για Λεϊσμανίαση), καθώς και στην παρακολούθηση της αποτελεσματικότητας της θεραπευτικής αγωγής (η ειδικότητα του τόξου 4/24 χάνεται μετά από μερικές εβδομάδες επιτυχούς θεραπευτικής αγωγής). Για την απομόνωση του παρασίτου διενεργήθηκαν ειδικές καλλιέργειες αίματος, οι οποίες ήταν θετικές σε όλα εκτός από τα δυο πρώτα περιστατικά. Το θρεπτικό υλικό που χρησιμοποιήθηκε ήταν το διφασικό υλικό Novy-McNeal-Nicolle (ΝΝΝ medium) με επικάλυψη RPMI. Τα δείγματα επωάστηκαν στους 22 Ο C για χρονικό διάστημα 3 4 εβδομάδων και ελέγχονταν εβδομαδιαίως για ανάπτυξη των προμαστιγωτών μορφών με την χρήση μικροσκοπίου αντίθεσης φάσης (Εικ. 2). Με την ανάλυση των ισοενζύμων των προμαστιγωτών μορφών έγινε ο προσδιορισμός του είδους και η τυποποίηση των παρασίτων. Τα στελέχη που απομονώθηκαν ήταν Leishmania infantum MON-98 και MON-1. ΕΙΚΟΝΑ 1 Η τεχνική της ηλεκτροσυναίρεσης με το χαρακτηριστικό τόξο 4/24. Απεικονίζονται από πάνω προς τα κάτω ο αρνητικός μάρτυρας, ο θετικός μάρτυρας και θετικός ορός. (Αρχείο Εργαστηρίου Κλινικής Βακτηριολογίας, Παρασιτολογίας, Ζωονόσων και Γεωγραφικής Ιατρικής, Ιατρική Σχολή Πανεπιστημίου Κρήτης). ΕΙΚΟΝΑ 2 Παράσιτο Leishmania κατά το προμαστιγωτό στάδιο, μορφή την οποία συναντάμε στις καλλιέργειες στους 26Ο C και στο σώμα του φλεβοτόμου. (Αρχείο Εργαστηρίου Κλινικής Βακτηριολογίας, Παρασιτολογίας, Ζωονόσων και Γεωγραφικής Ιατρικής, Ιατρική Σχολή Πανεπιστημίου Κρήτης). Για την ανίχνευση του DNA του παρασίτου στο αίμα των ασθενών εφαρμόστηκε η τεχνική της PCR, όπως αυτή περιγράφεται στην βιβλιογραφία. 8 Χρησιμοποιήθηκαν οι εκκινητές Τ2 (5 CGGCTTCGCACCATGCGGTG 3 ) και Β4 (5 ACATCCCTGCCACAT- ACGC 3 ) που ενισχύουν δυο διαφορετικές περιοχές του DNA του κινητοπλάστη της Leishmania spp. Για την εκχύλιση του DNA χρησιμοποιήθηκε το QIAamp DNA Blood Mini kit (Qiagen, Hilden,, 40724, Germany). Η PCR ήταν θετική σε όλες τις περιπτώσεις. Όλοι οι ασθενείς τέθηκαν σε αγωγή με λιποσωμική αμφοτερικίνη Β, σε δοσολογία 2 4mg/kg ημερησίως (συνολική δόση 26

5 VOL 57 / ISSUE 2 CASES REPORT, VISCERAL LEISHMANIASIS 15 21mg/kg), η οποία είχε πολύ καλά αποτελέσματα. Κανένας ασθενής δεν παρουσίασε υποτροπή της νόσου μέχρι σήμερα. ΣΥΖΗΤΗΣΗ Η λεϊσμανίαση ενδημεί σε χώρες της Μεσογείου, όπου κυρίως απαντάται το είδος L. infantum, το οποίο μεταδίδεται στον άνθρωπο με το δήγμα μολυσμένων φλεβοτόμων από τον σκύλο, και προκαλεί κυρίως τη σπλαχνική και σπάνια τη δερματική μορφή της νόσου. 5, 9 Ωστόσο, στα πλαίσια της παγκοσμιοποίησης, στην Ευρώπη τα τελευταία χρόνια, έχουν εισαχθεί και εξωτικά είδη, γεγονός που χρήζει ιδιαίτερης προσοχής. Έτσι, στην Κύπρο έχουν περιγραφεί περιστατικά σπλαχνικής και δερματικής λεϊσμανίασης από L. donovani. 9, 10 Στην Ελλάδα η σπλαχνική είναι η συχνότερη μορφή λεϊσμανίασης. 4 Ο χρόνος επώασης κυμαίνεται συνήθως από 2 έως 6 μήνες και τα κύρια κλινικά χαρακτηριστικά της νόσου, όπως φαίνεται και στα περιστατικά που περιγράφονται, είναι το παρατεινόμενο εμπύρετο, η απώλεια βάρους, η καχεξία, η ηπατοσπληνομεγαλία, και η αναιμία. Τα συχνότερα εργαστηριακά ευρήματα είναι η παγκυτταροπενία, η υπολευκωματιναιμία, η υπεργαμμασφαιριναιμία, η αύξηση των ηπατικών ενζύμων και της CRP. Η νόσος έχει συχνά χρόνια εξέλιξη και μπορεί να οδηγήσει στον θάνατο χωρίς θεραπεία. 11 Οι κυριότερες αιτίες θανάτου είναι οι δευτεροπαθείς βακτηριακές λοιμώξεις, η μαζική 1, 11 αιμορραγία και η σοβαρή αναιμία. Οι κυριότερες μέθοδοι που έχουν χρησιμοποιηθεί για την εργαστηριακή διάγνωση της λεϊσμανίασης είναι η μικροσκοπική εξέταση υλικών βιοψίας, ο ορολογικός έλεγχος για ανίχνευση αντισωμάτων, η ανίχνευση αντιγόνων του παρασίτου, η καλλιέργεια, ο ενοφθαλμισμός σε πειραματόζωα και οι μοριακές μέθοδοι. Μια ιδανική μέθοδος πρέπει να χαρακτηρίζεται από υψηλή ευαισθησία και ειδικότητα, δεδομένου ότι η νόσος είναι δυνητικά θανατηφόρος και κλινικά πρέπει να διαφοροδιαγνωσθεί από άλλα νοσήματα όπως μεταξύ άλλων ελονοσία, τυφοειδή πυρετό, λέμφωμα και λευχαιμία. Καθ ότι τα περισσότερα αντιλεϊσμανιακά φάρμακα είναι τοξικά, η ιδανική διαγνωστική μέθοδος θα πρέπει επίσης να διακρίνει την οξεία νόσο από την ασυμπτωματική έκθεση και να αξιολογεί την ανταπόκριση στην φαρμακευτική αγωγή. Τέλος, θα πρέπει να μην είναι ιδιαίτερα δαπανηρή, χρονοβόρος και πολύπλοκη, ώστε να μπορεί να εφαρμόζεται και σε εργαστήρια χωρίς εξειδικευμένο εξοπλισμό, δεδομένου ότι η νόσος συνήθως αφορά πληθυσμούς χαμηλού κοινωνικοοικονομικού επιπέδου σε αναπτυσσόμενες χώρες. Η εξέταση υλικού βιοψίας μυελού των οστών, σπληνός, ήπατος ή λεμφαδένων, ύστερα από χρώση με Giemsa παραμένει η πιο συνηθισμένη μέθοδος αναζήτησης των αμαστιγωτών μορφών, της μορφής με την οποία απαντάται το παράσιτο στους ιστούς. Η μέθοδος αυτή απαιτεί εμπειρία και επιμονή του εξεταστή, ο οποίος θα πρέπει να εξετάζει το σχήμα (στρογγυλό ή ωοειδές), το μέγεθος (2 4 μm) και τα εσωτερικά οργανίδια του παρασίτου (πυρήνας και κινητοπλάστης). 12 Η ειδικότητα της μεθόδου είναι υψηλή, αλλά η ευαισθησία ποικίλει και είναι μεγαλύτερη για δείγματα βιοψίας σπληνός (93 99%) και μικρότερη για τον μυελό των οστών (52 85%), τους λεμφαδένες (52 58%) και το ήπαρ (40%). 12, 13 Η παρακέντηση των οργάνων και η λήψη βιοψιών προϋποθέτουν επεμβατικούς χειρισμούς που είναι επώδυνοι και εγκυμονούν σοβαρούς κινδύνους, όπως η μαζική αιμορραγία στην περίπτωση της βιοψίας σπληνός. Ωστόσο, σε συγκεκριμένα εξειδικευμένα κέντρα, όπου υπάρχει έμπειρο προσωπικό και κατάλληλος εξοπλισμός, η μικροσκοπική εξέταση του υλικού παρακέντησης σπληνός εφαρμόζεται και για την παρακολούθηση της πορείας της νόσου. Η εκτίμηση του παρασιτικού φορτίου γίνεται με τη χρησιμοποίηση λογαριθμικής κλίμακας και οι τιμές κυμαίνονται από 0 (κανένα παράσιτο στα 1000 πεδία) έως +6 (>100 παράσιτα ανά οπτικό πεδίο). 12 Μια άλλη μέθοδος που χαρακτηρίζεται από υψηλή ευαισθησία είναι η καλλιέργεια των ιστικών δειγμάτων (μυελός οστών, σπλήνας, ήπαρ, λεμφαδένες) σε ειδικά θρεπτικά υλικά. Τέτοια είναι τα διφασικά ΝΝΝ και Tobies, στα οποία οι αμαστιγωτές μορφές μετατρέπονται σε προμαστιγωτές και τα μονοφασικά Shneider s, M199 και Grace s, που χρησιμοποιούνται για τoν πολλαπλασιασμό του αριθμού των παρασίτων. Στην παρούσα μελέτη χρησιμοποιήθηκε το διφασικό υλικό ΝΝΝ. O διαχωρισμός των διαφόρων ειδών Leishmania μπορεί να γίνει είτε με την ανάλυση των ισοενζύμων των προμαστιγωτών μορφών, όπως έγινε στην παρούσα μελέτη, είτε με τη χρήση μονοκλωνικών αντισωμάτων. 3, 5 Ωστόσο, η καλλιέργεια ενέχει τον κίνδυνο της επιμόλυνσης, και είναι δαπανηρή και χρονοβόρος (3 4 εβδομάδες) γι αυτό και εφαρμόζεται επί αποτυχίας των άλλων μεθόδων, ή συμπληρωματικά με αυτές, κυρίως σε εξειδικευμένα εργαστήρια. 3 Παρομοίως, ο ενοφθαλμισμός του παρασίτου σε πειραματόζωα hamster (Cricetus cricetus) απαιτεί μεγάλο χρονικό διάστημα (2 3 μήνες). 3 Έχουν αναπτυχθεί αρκετές τεχνικές ανίχνευσης αντιλεϊσμανιακών αντισωμάτων στον ορό, όπως ο έμμεσος ανοσοφθορισμός, η ELISA, η έμμεση αιμοσυγκόλληση, η τεχνική της ηλεκτροσυναίρεσης και η Western blot, ωστόσο η ορολογική διάγνωση με όλες τις παραπάνω μεθόδους έχει δυο σημαντικά 27

6 ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΠΤΩΣΕΩΝ ΣΠΛΑΧΝΙΚΗΣ ΛΕΪΣΜΑΝΙΑΣΗΣ ΤΟΜΟΣ 57 / ΤΕΥΧΟΣ 2 μειονεκτήματα. Πρώτον, τα επίπεδα των αντισωμάτων παραμένουν ανιχνεύσιμα για αρκετά χρόνια μετά τη θεραπεία και έτσι δεν μπορεί να γίνει η διάκριση παλαιάς από πρόσφατη λοίμωξη. Δεύτερον, ένας σημαντικός αριθμός ατόμων που διαμένουν σε ενδημικές περιοχές βρίσκονται θετικοί για αντι-λεϊσμανιακά αντισώματα χωρίς να έχουν ιστορικό σπλαχνικής λεϊσμανίασης, λόγω ασυμπτωματικής έκθεσης. Συνεπώς οι ορολογικές μέθοδοι συνήθως χρησιμοποιούνται σε συνδυασμό με άλλες μεθόδους για τη διάγνωση της σπλαχνικής λεϊσμανίασης. 1 Στην παρούσα μελέτη ο ορολογικός έλεγχος περιελάμβανε έμμεσο ανοσοφθορισμό και την τεχνική της ηλεκτροσυναίρεσης. Ο έμμεσος ανοσοφθορισμός ανιχνεύει αντισώματα που εμφανίζονται στα αρχικά στάδια της λοίμωξης και εξαφανίζονται 6 με 9 μήνες μετά τη θεραπεία. Η παραμονή των αντισωμάτων σε χαμηλούς τίτλους αποτελεί ένδειξη υποτροπής της νόσου. Η μέθοδος έχει ευαισθησία 96% και ειδικότητα 98%. 13 Ομοίως, η τεχνική της ηλεκτροσυναίρεσης χαρακτηρίζεται από υψηλή ευαισθησία και ειδικότητα (>98%), συμβάλλει, δε, τόσο στη διάγνωση της νόσου, όσο και στην παρακολούθηση της αποτελεσματικότητας της θεραπευτικής αγωγής και εφαρμόζεται σε κέντρα αναφοράς. Μια άλλη ευρέως χρησιμοποιούμενη μέθοδος είναι η ELISA. Η διαγνωστική της ακρίβεια εξαρτάται από τα αντιγόνα που χρησιμοποιούνται. Τέτοια είναι το διαλυτό κυτταροπλασματικό αντιγόνο (CSA) και διάφορα αντιγόνα που παράγονται με τεχνολογία ανασυνδυασμένου DNA όπως το rgbp από L. donovani, το rorff από L. infantum και τα rgp63, rk9, rk26, rk39 από L. chagasi. 12, 14 Τα πλέον υποσχόμενα αποτελέσματα έχει δώσει το αντιγόνο rk39 με ευαισθησία και ειδικότητα 100% και 96%, αντίστοιχα. 13 Τα αντισώματα έναντι rk39 συσχετίζονται άμεσα με την ενεργό νόσο, μπορούν να χρησιμοποιηθούν για εκτίμηση της ανταπόκρισης στη θεραπεία, πρόβλεψη της κλινικής υποτροπής. Επιπλέον, έχουν μεγάλη διαγνωστική αξία σε ασθενείς με AIDS. Τα τελευταία χρόνια έχει αναπτυχθεί ανοσοχρωματογραφική μέθοδος ανίχνευσης αντισωμάτων έναντι του αντιγόνου rk39 που χρησιμοποιεί ταινίες. Η μέθοδος αυτή είναι απλή (απαιτείται μια σταγόνα αίμα), σύντομη (δίνει αποτέλεσμα σε 15 λεπτά) και έχει υψηλή ευαισθησία (98 100%) και ειδικότητα (81 96%). 13 Μια άλλη απλή δοκιμασία είναι η δοκιμασία άμεσης συγκόλλησης (DAT), μια ημιποσοτική μέθοδος κατά την οποία ο ορός του ασθενούς σε υποδιπλάσιες αραιώσεις επωάζεται σε πλάκα, μαζί με κεγχρωσμένες προμαστιγωτές μορφές L. donovani. Αν ο ορός του ασθενούς περιέχει ειδικά αντισώματα έναντι του παρασίτου, μετά από 18 ώρες παρατηρείται συγκόλληση, ορατή με γυμνό οφθαλμό. Η μέθοδος έχει ευαισθησία και ειδικότητα 95% και 86%, αντίστοιχα. 13 Η ανοσοχρωματογραφία και η δοκιμασία άμεσης συγκόλλησης είναι οι κυριότερες μέθοδοι που χρησιμοποιούνται σε αναπτυσσόμενες χώρες (Ινδία, Αφρική). 13, 15 Στη διάγνωση μπορεί να συμβάλλει επίσης η ανίχνευση αντιγόνων του παρασίτου στα ούρα (τμήματα πολυπεπτιδίων 72 75kDa και 123kDa). Η συγκέντρωση του αντιγόνου συσχετίζεται ισχυρά με το παρασιτικό φορτίο, η μέθοδος έχει υψηλή ειδικότητα και μπορεί να εφαρμοσθεί και σε ανοσοκατασταλμένους ασθενείς, όπου η παραγωγή αντισωμάτων είναι διαταραγμένη. Τα τελευταία χρόνια έχει αναπτυχθεί μια δοκιμασία συγκόλλησης σωματιδίων latex (KATEX) για την ανίχνευση ενός άλλου λεϊσμανιακού αντιγόνου, ενός χαμηλού μοριακού βάρους υδατάνθρακα, στα ούρα ασθενών. Η μέθοδος είναι πολλά υποσχόμενη, δεδομένου ότι σύμφωνα με τις πρώτες μελέτες η ειδικότητά της είναι 100% και η ευαισθησία της κυμαίνεται από 68 έως 100%. 12 Η μοριακή διάγνωση, κυρίως η PCR, βρίσκει ιδιαίτερη εφαρμογή στη διάγνωση της σπλαχνικής λεϊσμανίασης. Η PCR, που εφαρμόζεται σε ποικιλία κλινικών δειγμάτων, μπορεί να ανιχνεύσει το παράσιτο πριν την εμφάνιση συμπτωμάτων, παρέχει τη δυνατότητα παρακολούθησης της ανταπόκρισης στη θεραπεία, αναγνώρισης υποτροπών, ταυτοποίησης σε επίπεδο είδους, έχει δε ιδιαίτερη διαγνωστική αξία σε ανοσοκατεσταλμένους ασθενείς. Έχουν περιγραφεί πολλές PCR με ποικίλη διαγνωστική αξία οι οποίες χρησιμοποιούν διάφορους εκκινητές με στόχους το rrna (18s rrna, ssu rrna), το DNA του κινητοπλάστη, ή άλλες αλληλουχίες του γονιδιώματος του παρασίτου (περιοχή ITS, περιοχές γονιδίων β-τουμπουλίνης, gp63 κ.α). 12 Τα τελευταία χρόνια έχουν αναπτυχθεί τεχνικές PCR πραγματικού χρόνου, που καθιστούν δυνατή την εκτίμηση του παρασιτικού φορτίου και απαιτούν ελάχιστη ποσότητα δείγματος. 13,16 Στην παρούσα μελέτη η PCR απέβη θετική και στις επτά περιγραφείσες περιπτώσεις, ενώ αξίζει να αναφερθεί ότι η οριστική διάγνωση της λεϊσμανίασης στην πρώτη περίπτωση τέθηκε μόνο με βάση την PCR, καθ όσον ο έλεγχος με όλες τις υπόλοιπες μεθόδους απέβη αρνητικός. Άλλωστε και η αναφερόμενη στη βιβλιογραφία ευαισθησία της PCR σε περιφερικό αίμα κυμαίνεται από 70 έως 100%. 13 Από τις συμβατικές μεθόδους η οστεομυελική βιοψία, ο έμμεσος ανοσοφθορισμός και η ηλεκτροσυναίρεση απέβησαν θετικές σε έξι από τα επτά περιστατικά, ενώ η καλλιέργεια σε πέντε από τα επτά. Σύμφωνα με μια πρόσφατη συγκριτική μελέτη μεταξύ PCR και συμβατικών μικροβιολογικών μεθόδων διάγνωσης, η ευαισθησία της PCR 28

7 VOL 57 / ISSUE 2 CASES REPORT, VISCERAL LEISHMANIASIS ήταν 99% σε δείγματα αίματος και 96% σε δείγματα μυελού των οστών ενώ εκείνη της καλλιέργειας 76%, της μικροσκοπικής εξέτασης μυελού των οστών 90% και του ορολογικού ελέγχου 86%. 17 Είναι λοιπόν προφανής η ανάγκη χρησιμοποίησης συνδυασμού μικροβιολογικών εξετάσεων στη διαγνωστική προσέγγιση της λεϊσμανίασης. Η λεϊσμανίαση είναι μια ιάσιμη νόσος. Η θεραπεία της βασίζεται στη χρήση των αντι-λεϊσμανιακών φαρμάκων και την αντιμετώπιση όλων των συνοδών διαταραχών, όπως οι δευτεροπαθείς λοιμώξεις, η αναιμία και η υποθρεψία. Τα πρώτα φάρμακα που χρησιμοποιήθηκαν ήταν οι ενώσεις του πεντασθενούς αντιμονίου, οι οποίες όμως χορηγούνται παρεντερικά, έχουν παρενέργειες (αρρυθμία, παγκρεατίτιδα, αρθραλγία, κοιλιακός πόνος) και απαιτούν μακροχρόνια χορήγηση. 1, 11 Η ανάπτυξη αντοχής σε αυτά τα φάρμακα οδήγησε σε άλλα εναλλακτικά φάρμακα, όπως η αμφοτερικίνη Β, η οποία γρήγορα αντικαταστάθηκε σε Ευρώπη και Αμερική από την λιποσωμική αμφοτερικίνη Β, που γίνεται καλύτερα ανεκτή αν και με μεγαλύτερο κόστος. 1, 11 Ο Παγκόσμιος Οργανισμός Υγείας (WHO) ανακοίνωσε το 2007 μια μεγάλη μείωση της τιμής του φαρμάκου με στόχο την χρησιμοποίησή του και σε αναπτυσσόμενες χώρες. 1 Νεώτερα φάρμακα για τη θεραπεία της σπλαχνικής νόσου είναι η μιλτεφοσίνη και η σιταμακίνη, τα οποία χορηγούνται από του στόματος, αλλά έχουν σημαντικές παρενέργειες και η παρομομυκίνη, μια αμινογλυκοσίδη η οποία σε πρόσφατες κλινικές μελέτες εμφάνισε υψηλή αποτελεσματικότητα και ασφάλεια. 1,11 Η δερματική μορφή της νόσου, ανάλογα με την έκτασή της και το είδος του παρασίτου που την προκαλεί, μπορεί να αντιμετωπισθεί είτε με τοπική (παρομομυκίνη, κρυοθεραπεία) είτε με συστηματική (πενταμιδίνη, φλουκοναζόλη, κετοκοναζόλη, μιλτεφοσίνη, ενώσεις πεντασθενούς αντιμονίου) αγωγή. Συμπερασματικά, η λεϊσμανίαση είναι μια νόσος που ενδημεί στη χώρα μας. Απαιτείται εγρήγορση τόσο των κλινικών όσο και των εργαστηριακών ιατρών τόσο για τη διάγνωση των αυτόχθονων κρουσμάτων L. infantum, όσο και για τον εντοπισμό αναδυόμενων εξωτικών ειδών. Η συνεκτίμηση των κλινικών δεδομένων και των εργαστηριακών ευρημάτων, που προκύπτουν από συνδυασμό εξετάσεων, συμβάλλει στην έγκαιρη διάγνωση, την άμεση έναρξη θεραπευτικής αγωγής και την καλή έκβαση της νόσου. ΒΙΒΛΙΟΓΡΑΦΙΑ 1 Chappuis F, Sundar S, Hailu A, Ghalib H, Rijal S, Peeling RW, et al. Visceral leishmaniasis: what are the needs for diagnosis, treatment and control? Nat Rev Microbiol. 2007; 5: World Health Organization. Leishmaniasis, who.int/leishmaniasis//en/ 3 Sundar S, and Rai M. Laboratory diagnosis of visceral leishmaniasis. Clin Diagn Lab Immunol ; 9: Κέντρο ελέγχου και πρόληψης νοσημάτων (ΚΕΕΛΠΝΟ). κατάλογοςνοσημάτων/λ.aspx (Ιανουάριος 2011). 5 Κανσουζίδου-Κανακούδη Α. Λεϊσμανίαση-Μία παλιά νόσος με νέα δεδομένα. Εφαρμ. Κλιν. Μικρ. Εργαστ. Διαγν. 2006; 11: Christodoulou V, Antoniou M, Ntais P, Messaritakis I, Ivovic V, Dedet JP, et al. Re-emergence of visceral and cutaneous leishmaniasis in the Greek island of Crete. Vector Borne Zoonotic Dis ;12: Antoniou M, Messaritakis I, Christodoulou V, Ascoksilaki I, Kanavakis N, Sutton AJ, et al. Increasing incidence of zoonotic visceral leishmaniasis on Crete, Greece. Emerg Infect Dis. 2009; 15: Minodier P, Piarroux R, Gambarelli F, Joblet C, Dumon H. Rapid identification of causative species in patients with Old World leishmaniasis. J Clin Microbiol 1997; 35: Ready PD. Leishmaniasis emergence in Europe. Euro Surveill ;15: Antoniou M, Haralambous C, Mazeris A, Pratlong F, Dedet JP, Soteriadou K. Leishmania donovani leishmaniasis in Cyprus. Lancet Infect Dis. 2009; 9: Piscopo TV, and Azzopardi C. Leishmaniasis. Postgrad Med J. 2007; 83: Singh S. New developments in diagnosis of leishmaniasis. Indian J Med Res. 2006; 123: Srivastava P, Dayama A, Mehrotra S, Sundar S. Diagnosis of visceral leishmaniasis. Trans R Soc Trop Med Hyg. 2011;105: Maalej IA, Chenik M, Louzir H, Ben Salah A, Bahloul C, Amri F, et al. Comparative evaluation of ELISAs based on ten recombinant or purified Leishmania antigens for the serodiagnosis of Mediterranean visceral leishmaniasis. Am J Trop Med Hyg. 2003; 68:

8 ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΠΤΩΣΕΩΝ ΣΠΛΑΧΝΙΚΗΣ ΛΕΪΣΜΑΝΙΑΣΗΣ ΤΟΜΟΣ 57 / ΤΕΥΧΟΣ 2 15 Singh DP, Goyal RK, Singh RK, Sundar S, Mohapatra TM. In search of an ideal test for diagnosis and prognosis of kala-azar. J Health Popul Nutr. 2010; 28: Wortmann G, Hochberg L, Houng HH, Sweeney C, Zapor M, Aronson N, et al. Rapid identification of Leishmania complexes by a real-time PCR assay. Am J Trop Med Hyg. 2005; 73: Antinori S, Calattini S, Longhi E, Bestetti G, Piolini R, Magni C, et al. Clinical use of polymerase chain reaction performed on peripheral blood and bone marrow samples for the diagnosis and monitoring of visceral leishmaniasis in HIV-infected and HIV-uninfected patients: a singlecenter, 8-year experience in Italy and review of the literature. Clin Infect Dis ; 44:

Τµήµα Επιδηµιολογικής Επιτήρησης και Παρέµβασης

Τµήµα Επιδηµιολογικής Επιτήρησης και Παρέµβασης Τµήµα Επιδηµιολογικής Επιτήρησης και Παρέµβασης ΕΠΙΔΗΜΙΟΛΟΓΙΚΑ ΣΤΟΙΧΕΙΑ ΓΙΑ ΤΗ ΛΕΪΣΜΑΝΙΑΣΗ ΣΤΗΝ ΕΛΛΑΔΑ (ΣΥΣΤΗΜΑ ΥΠΟΧΡΕΩΤΙΚΗΣ ΔΗΛΩΣΗΣ ΝΟΣΗΜΑΤΩΝ) Κύρια σημεία Η δηλούμενη επίπτωση της λεϊσμανίασης στην Ελλάδα

Διαβάστε περισσότερα

Παγκυτταροπενία και ηπατοσπληνομεγαλία. προ 6μηνου. Παπαποστόλου Ανδρονίκη

Παγκυτταροπενία και ηπατοσπληνομεγαλία. προ 6μηνου. Παπαποστόλου Ανδρονίκη Παρουσίαση περιστατικού Παγκυτταροπενία και ηπατοσπληνομεγαλία σε ασθενή με ιστορικό μελιταίου πυρετού προ 6μηνου. Παπαποστόλου Ανδρονίκη Νέπκα Μάρθα Τσιάμαλος Παντελής Ασθενής 26 ετών, 1. 1. εργαζόμενος

Διαβάστε περισσότερα

ΤΣΑΚΜΑΚΙΔΗΣ ΓΙΑΝΝΗΣ. Κτηνίατρος, Υποψήφιος Διδάκτωρ Εργαστήριο Παρασιτολογίας και Παρασιτικών Νοσημάτων Τμήμα Κτηνιατρικής, Α.Π.Θ.

ΤΣΑΚΜΑΚΙΔΗΣ ΓΙΑΝΝΗΣ. Κτηνίατρος, Υποψήφιος Διδάκτωρ Εργαστήριο Παρασιτολογίας και Παρασιτικών Νοσημάτων Τμήμα Κτηνιατρικής, Α.Π.Θ. ΤΣΑΚΜΑΚΙΔΗΣ ΓΙΑΝΝΗΣ Κτηνίατρος, Υποψήφιος Διδάκτωρ Εργαστήριο Παρασιτολογίας και Παρασιτικών Νοσημάτων Τμήμα Κτηνιατρικής, Α.Π.Θ. Ενδημική σε 98 χώρες (35 με μικτές με HIV μολύνσεις) 12 εκατ. κρούσματα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης Σημαντικά Σημεία ΕΠΙΔΗΜΙΟΛΟΓΙΚΑ ΣΤΟΙΧΕΙΑ ΓΙΑ ΤΗΝ ΕΛΟΝΟΣΙΑ ΣΤΗΝ ΕΛΛΑΔΑ (ΣΥΣΤΗΜΑ ΥΠΟΧΡΕΩΤΙΚΗΣ ΔΗΛΩΣΗΣ ΝΟΣΗΜΑΤΩΝ) Η δηλούμενη επίπτωση της ελονοσίας στην Ελλάδα παρουσιάζει αυξητική τάση. Για την πενταετία

Διαβάστε περισσότερα

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Εργαστηριακή Διάγνωση της HIV λοίμωξης Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Διάγνωση της HIV λοίμωξης Από το 1985 και μέχρι σήμερα η διαγνωστική διαδικασία

Διαβάστε περισσότερα

Εργαστηριακή ιάγνωση Γρίπης Μοριακή διάγνωση ή όχι?

Εργαστηριακή ιάγνωση Γρίπης Μοριακή διάγνωση ή όχι? Εργαστηριακή ιάγνωση Γρίπης Μοριακή διάγνωση ή όχι? Εθνικόν και Καποδιστριακόν Πανεπιστήμιον Αθηνών ΣΠΑΝΑΚΗΣ ΝΙΚΟΛΑΟΣ Αναπλ. Καθηγητής ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ, ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΟΜΗ ΙΩΝ ΓΡΙΠΗΣ ΓΟΝΙ ΙΑ ΙΩΝ ΓΡΙΠΗΣ Μέθοδοι

Διαβάστε περισσότερα

Μαστιγοφόρα του αίματος και των ιστών. Οικογένεια: Τρυπανοσωμιδών Τάξη: Κινητοπλαστιδίων Γένη: Leishmania Trypanosoma

Μαστιγοφόρα του αίματος και των ιστών. Οικογένεια: Τρυπανοσωμιδών Τάξη: Κινητοπλαστιδίων Γένη: Leishmania Trypanosoma Μαστιγοφόρα του αίματος και των ιστών Οικογένεια: Τρυπανοσωμιδών Τάξη: Κινητοπλαστιδίων Γένη: Leishmania Trypanosoma Τροφοζωίτης Μορφές των παρασίτων Leishmania: 35 είδη 21-30 στον άνθρωπο Σπλαχνική, ή

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Σύνοψη της προσέγγισης ασθενούς με πανκυτταροπενία. Ιατρικό Τμήμα Πανεπιστημίου Πατρών Απαρτιωμένη διδασκαλία στην Αιματολογία Αργύρης Συμεωνίδης

Σύνοψη της προσέγγισης ασθενούς με πανκυτταροπενία. Ιατρικό Τμήμα Πανεπιστημίου Πατρών Απαρτιωμένη διδασκαλία στην Αιματολογία Αργύρης Συμεωνίδης Σύνοψη της προσέγγισης ασθενούς με πανκυτταροπενία Ιατρικό Τμήμα Πανεπιστημίου Πατρών Απαρτιωμένη διδασκαλία στην Αιματολογία Αργύρης Συμεωνίδης Αρχική κλινική προσέγγιση Συμπτωματικός ή μη συμπτωματικός

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Ασθενής άρρεν 67 ετών προσήλθε λόγω ρινορραγίας από 4ημέρου, ενός επεισοδίου μέλαινας κένωσης προ 8ώρου, με συνοδό αδυναμία και καταβολή.

Ασθενής άρρεν 67 ετών προσήλθε λόγω ρινορραγίας από 4ημέρου, ενός επεισοδίου μέλαινας κένωσης προ 8ώρου, με συνοδό αδυναμία και καταβολή. Ασθενής άρρεν 67 ετών προσήλθε λόγω ρινορραγίας από 4ημέρου, ενός επεισοδίου μέλαινας κένωσης προ 8ώρου, με συνοδό αδυναμία και καταβολή. ΑΤΟΜΙΚΟ ΑΝΑΜΝΗΣΤΙΚΟ Μικροκυτταρικός καρκίνος πνεύμονα από έτους(λόγω

Διαβάστε περισσότερα

ΕΚΘΕΣΗ ΕΠΙ ΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 16/09/2011)

ΕΚΘΕΣΗ ΕΠΙ ΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 16/09/2011) ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ & ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ (ΚΕ.ΕΛ.Π.ΝΟ.) ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Σελ 1 ΕΚΘΕΣΗ ΕΠΙ ΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 16/09/2011) Εισαγωγή

Διαβάστε περισσότερα

Μπρούζου Κάτια- Ουρανία Πιστιόλα Χρυσούλα. Μάθημα επιλογής Λευχαιμίες

Μπρούζου Κάτια- Ουρανία Πιστιόλα Χρυσούλα. Μάθημα επιλογής Λευχαιμίες Μπρούζου Κάτια- Ουρανία Πιστιόλα Χρυσούλα Μάθημα επιλογής Λευχαιμίες ΧΛΛ Η συχνότερη Λευχαιμία Μονοκλωνικά Β κύτταρα > 5x10 9 /L τυχαία εξέταση αίματοςà Λεμφοκυττάρωση! Διογκωμένοι LN αναιμία ηπατοσπληνομεγαλία

Διαβάστε περισσότερα

Οξεία μυελογενής λευχαιμία

Οξεία μυελογενής λευχαιμία Οξεία μυελογενής λευχαιμία Γενικά στοιχεία Ταξινόμηση και τύποι Ενδείξεις και συμπτώματα Αίτια πρόκλησης Διάγνωση Παρουσίαση και επαναστόχευση από Βικιπαίδεια Οξεία μυελογενής λευχαιμία : Ζήσου Ιωάννης

Διαβάστε περισσότερα

Εργαστήριο και Εμβολιασμοί. Καθ. Αθανάσιος Τσακρής

Εργαστήριο και Εμβολιασμοί. Καθ. Αθανάσιος Τσακρής Εργαστήριο και Εμβολιασμοί Καθ. Αθανάσιος Τσακρής Σημαντικός ο Ρόλος του Εργαστηρίου στη Δημόσια Υγεία,για Νοσήματα που Προλαμβάνονται με τον Εμβολιασμό Στη Διάγνωση και έγκαιρη αντιμετώπιση: Μοριακή ανίχνευση

Διαβάστε περισσότερα

Επιδημιολογικά δεδομένα νοσημάτων που μεταδίδονται με διαβιβαστές στην Ελλάδα

Επιδημιολογικά δεδομένα νοσημάτων που μεταδίδονται με διαβιβαστές στην Ελλάδα Καταπολέμηση κουνουπιών και δημόσια υγεία: Η επίδραση της κλιματικής αλλαγής, 10 Δεκ 2015 Επιδημιολογικά δεδομένα νοσημάτων που μεταδίδονται με διαβιβαστές στην Ελλάδα Δανάη Περβανίδου Γραφείο Νοσημάτων

Διαβάστε περισσότερα


Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 2 Φεβρουαρίου 2012

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 2 Φεβρουαρίου 2012 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 2 Φεβρουαρίου 2012 Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των επιδημιολογικών

Διαβάστε περισσότερα

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης


Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 16 Φεβρουαρίου 2012

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 16 Φεβρουαρίου 2012 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 16 Φεβρουαρίου 2012 Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των επιδημιολογικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 31/12/2011)

ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 31/12/2011) ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ & ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ (ΚΕ.ΕΛ.Π.ΝΟ.) ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 31/12/2011) 1 Το καλοκαίρι

Διαβάστε περισσότερα

Ερμηνεία αποτελεσμάτων ηλεκτροφόρησης πρωτεϊνών ορού. Μιχάλης Μιχαήλ MD, PhD Αιματολόγος Γ. Ν Λευκωσίας

Ερμηνεία αποτελεσμάτων ηλεκτροφόρησης πρωτεϊνών ορού. Μιχάλης Μιχαήλ MD, PhD Αιματολόγος Γ. Ν Λευκωσίας Ερμηνεία αποτελεσμάτων ηλεκτροφόρησης πρωτεϊνών ορού Μιχάλης Μιχαήλ MD, PhD Αιματολόγος Γ. Ν Λευκωσίας Περίγραμμα Τι είναι η Η/Φ πρωτεϊνών Πότε πρέπει να ζητάμε την Η/Φ Πως ερμηνεύονται τα αποτελέσματα

Διαβάστε περισσότερα

ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 05/12/2011)

ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 05/12/2011) ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ & ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ (ΚΕ.ΕΛ.Π.ΝΟ.) ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 05/12/2011) 1 Εισαγωγή

Διαβάστε περισσότερα

ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 15/11/2011)

ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 15/11/2011) ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ & ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ (ΚΕ.ΕΛ.Π.ΝΟ.) ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ Ελονοσία στην Ελλάδα, περίοδος 2011 (01/01/2011 έως 15/11/2011) 1 Εισαγωγή

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 27 Ιανουαρίου 2012

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 27 Ιανουαρίου 2012 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 27 Ιανουαρίου 2012 Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των επιδημιολογικών

Διαβάστε περισσότερα


ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ Dr Α. Μεντής, Ιατρός Βιοπαθολόγος, Κλινικός Μικροβιολόγος ιευθυντής ιαγνωστικού Τμήματος ιευθυντής Εργαστηρίου Ιατρικής Μικροβιολογίας ιευθυντής Εθνικού Εργαστηρίου

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 9 Φεβρουαρίου 2012

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 9 Φεβρουαρίου 2012 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 9 Φεβρουαρίου 2012 Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των επιδημιολογικών

Διαβάστε περισσότερα

ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων

ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ 15/10/2015 Πέμπτη ( Ηλεκτρονικά) 16.00 18.00 Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων Γενική επισκόπηση μεθόδων που χρησιμοποιούνται

Διαβάστε περισσότερα

Εμβόλιο Ηπατίτιδας Β

Εμβόλιο Ηπατίτιδας Β Εμβόλιο Ηπατίτιδας Β ΤΙ ΧΡΕΙΑΖΕΤΑΙ ΝΑ ΓΝΩΡΙΖΕΤΕ Είστε σίγουροι πως έχετε πάρει τα κατάλληλα μέτρα για να προστατευτείτε από την ηπατίτιδα Β; ΕΝΗΜΕΡΩΣΟΥ! ΕΜΒΟΛΙΑΣΟΥ! ΠΡΟΣΤΑΤΕΥΣΟΥ! ΕΜΒΟΛΙΟ ΗΠΑΤΙΤΙΔΑΣ Β Γνωρίζετε

Διαβάστε περισσότερα

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp.

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. 5 ο Πανελλήνιο Συνέδριο Ιατρικής Βιοπαθολογίας Η εφαρμογή μοριακών

Διαβάστε περισσότερα

Εμβόλιο Ηπατίτιδας Β

Εμβόλιο Ηπατίτιδας Β Εμβόλιο Ηπατίτιδας Β ΤΙ ΧΡΕΙΑΖΕΤΑΙ ΝΑ ΓΝΩΡΙΖΕΤΕ Είστε σίγουροι πως έχετε πάρει τα κατάλληλα μέτρα για να προσατευτείτε από την ηπατίτιδα Β; ΕΝΗΜΕΡΩΘΕΙΤΕ! ΕΜΒΟΛΙΑΣΤΕΙΤΕ! ΠΡΟΣΤΑΤΕΥΤΕΙΤΕ! ΕΜΒΟΛΙΟ ΗΠΑΤΙΤΙΔΑΣ

Διαβάστε περισσότερα

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Δ. Ιακωβίδης Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Νέα διαγνωστικά μέσα για τη λανθάνουσα φυματίωση Η στοχευμένη δοκιμασία δερματικής φυματινοαντίδρασης

Διαβάστε περισσότερα


ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΣΤΗΝ ΑΛΚΟΟΛΙΚΗ ΗΠΑΤΙΚΗ ΝΟΣΟ ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΣΤΗΝ ΑΛΚΟΟΛΙΚΗ ΗΠΑΤΙΚΗ ΝΟΣΟ Ερωτήσεις (μπορεί να υπάρχουν περισσότερες από μια σωστές απαντήσεις, οι σωστές απαντήσεις είναι με bold) 1) Από τη εξαρτάται ανάπτυξη της αλκοολικής νόσου

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας

ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας Ε. ΠΕΤΕΙΝΑΚΗ Aναπληρώτρια Καθηγήτρια Μικροβιολογίας Διευθύντρια Εργαστηρίου Μικροβιολογίας ΜΙΚΡΟΒΙΟΛΟΓΙΑ φάση της κλινικής ιατρικής Η μικροβιολογία

Διαβάστε περισσότερα


ΘΡΟΜΒΩΤΙΚΗ ΘΡΟΜΒΟΠΕΝΙΚΗ ΠΟΡΦΥΡΑ ΜΕ ΑΤΥΠΗ ΣΥΜΠΤΩΜΑΤΟΛΟΓΙΑ ΠΟΡΦΥΡΑ ΜΕ ΑΤΥΠΗ 1 Παθολογική Κλινική Νοσοκομείου Ξάνθης, 2 Τμήμα Επειγόντων Περιστατικών Νοσοκομείου Ξάνθης, 3Αιματολογική Κλινική Νοσοκομείου Αλεξανδρούπολης ΕΙΣΑΓΩΓΗ Η θρομβωτική θρομβοπενική πορφύρα

Διαβάστε περισσότερα

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης Κύρια σημεία Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης ΕΠΙΔΗΜΙΟΛΟΓΙΚΑ ΔΕΔΟΜΕΝΑ ΓΙΑ ΤΗ ΣΙΓΚΕΛΛΩΣΗ ΣΤΗΝ ΕΛΛΑΔΑ 2004-2011 (ΣΥΣΤΗΜΑ ΥΠΟΧΡΕΩΤΙΚΗΣ ΔΗΛΩΣΗΣ ΝΟΣΗΜΑΤΩΝ) - Η δηλούμενη επίπτωση της σιγκέλλωσης

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 23 Φεβρουαρίου 2012

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 23 Φεβρουαρίου 2012 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 23 Φεβρουαρίου 2012 Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των επιδημιολογικών

Διαβάστε περισσότερα

Αρχές μοριακής παθολογίας. Α. Αρμακόλας Αν. Καθηγητής Ιατρική Σχολή ΕΚΠΑ

Αρχές μοριακής παθολογίας. Α. Αρμακόλας Αν. Καθηγητής Ιατρική Σχολή ΕΚΠΑ Αρχές μοριακής παθολογίας Α. Αρμακόλας Αν. Καθηγητής Ιατρική Σχολή ΕΚΠΑ Μοριακή Παθολογία Ανερχόμενος κλάδος της Παθολογίας Επικεντρώνεται στην μελέτη και τη διάγνωση νοσημάτων Στον καθορισμό και την πιστοποίηση

Διαβάστε περισσότερα


ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ ΚΑΙ ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ. Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδες 40 η /2011-44 η /2011 21 Νοεμβρίου 2011 Η επιτήρηση της γρίπης για την περίοδο 2011-2012 σε Ευρωπαϊκό

Διαβάστε περισσότερα


ΒΙΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Ευρεθείσα τιμή Τιμές αναφοράς Σάκχαρο : 96.8 mg/dl 65-115 Κρεατινίνη : 0.97 mg/dl 0,50-1,60 Ουρικό οξύ : 7.72 mg/dl 3.0-7.7 ενήλικες 3.0-6.1 παιδιά SGOT : 21 U/L 5-38 ενήλικες 5-48

Διαβάστε περισσότερα

Οξεία μονοαρθρίτιδα. 2 ο Κλινικό Σεμινάριο Εσωτερικής Παθολογίας Οκτ 2015, Πάτρα

Οξεία μονοαρθρίτιδα. 2 ο Κλινικό Σεμινάριο Εσωτερικής Παθολογίας Οκτ 2015, Πάτρα Οξεία μονοαρθρίτιδα 2 ο Κλινικό Σεμινάριο Εσωτερικής Παθολογίας Οκτ 2015, Πάτρα Δαούσης Δημήτρης Επίκουρος καθηγητής Παθολογίας/Ρευματολογίας Ιατρική Σχολή Πανεπιστημίου Πατρών Γενικώς η ρευματολογία είναι

Διαβάστε περισσότερα

ΕΜΠΙΣΤΕΥΤΙΚΟ. 1 η Μηνιαία Έκθεση Πεπραγμένων. του υποέργου

ΕΜΠΙΣΤΕΥΤΙΚΟ. 1 η Μηνιαία Έκθεση Πεπραγμένων. του υποέργου 1 η Μηνιαία Έκθεση Πεπραγμένων του υποέργου με τίτλο «Επιδημιολογική Διερεύνηση, Διάγνωση και Αντιμετώπιση της Ελονοσίας με πεδίο εφαρμογής την περιοχή του Δήμου Ευρώτα για την διετία 2016-2017» Ιούλιος

Διαβάστε περισσότερα

κλινική και εργαστηριακή προσέγγιση των νοσημάτων του Τ. Ράλλης Καθηγητής Παθολογίας Ζώων Συντροφιάς, Τμήμα Κτηνιατρικής, ΑΠΘ

κλινική και εργαστηριακή προσέγγιση των νοσημάτων του Τ. Ράλλης Καθηγητής Παθολογίας Ζώων Συντροφιάς, Τμήμα Κτηνιατρικής, ΑΠΘ Τι είναι κοινό και τι όχι κατά την κλινική και εργαστηριακή προσέγγιση των νοσημάτων του ήπατος στο σκύλο και στη γάτα Τ. Ράλλης Καθηγητής Παθολογίας Ζώων Συντροφιάς, Τμήμα Κτηνιατρικής, ΑΠΘ Η γάτα δεν

Διαβάστε περισσότερα

Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία

Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΥΓΙΕΙΝΗΣ ΚΑΙ ΕΠΙΔΗΜΙΟΛΟΓΙΑΣ Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία Μάρκα Ανδριανή Ιατρός,

Διαβάστε περισσότερα


ΒΙΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Ευρεθείσα τιμή Τιμές αναφοράς Σάκχαρο : 88.2 mg/dl 65-115 Ουρία : 25 mg/dl 12-48 Κρεατινίνη : 0.69 mg/dl 0,50-1,40 SGOT : 10 U/L 5-38 ενήλικες 5-48 παιδιά 1-3 ετών SGPT : 12 U/L 5-43

Διαβάστε περισσότερα

Βασικές αρχές Ιατρικής Μικροβιολογίας

Βασικές αρχές Ιατρικής Μικροβιολογίας Σελίδες 1 έως 5 ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Για τους φοιτητές Β εξαμήνου ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΤΜΗΜΑΤΟΣ Παν/κό έτος 2011-2012 Ύλη αποτελεί η θεματολογία των μαθημάτων (αμφιθεάτρου, εργαστηρίων, φροντιστηρίων)

Διαβάστε περισσότερα

ΣΤΟΙΧΕΙΑ ΝΟΣΟΛΟΓΙΑΣ ΣΠΛΑΧΝΙΚΗ ΛΕΪΣΜΑΝΙΑΣΗ 1. Αιτιολογικοίπαράγοντες L. donovani L. infantum L. amazonensis (λεκάνη Αµαζονίου, Βραζιλία) L. tropica (Μέση Ανατολή, Ινδία, ανατολική Ευρώπη, υτική Ασία) L.

Διαβάστε περισσότερα

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης Κύρια σημεία Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης ΕΠΙΔΗΜΙΟΛΟΓΙΚΑ ΔΕΔΟΜΕΝΑ ΓΙΑ ΤΗ ΣΙΓΚΕΛΛΩΣΗ ΣΤΗΝ ΕΛΛΑΔΑ 2004-2012 (ΣΥΣΤΗΜΑ ΥΠΟΧΡΕΩΤΙΚΗΣ ΔΗΛΩΣΗΣ ΝΟΣΗΜΑΤΩΝ) - Η δηλούμενη επίπτωση της σιγκέλλωσης

Διαβάστε περισσότερα

Αιμόλυση σε παιδί 8 ετών

Αιμόλυση σε παιδί 8 ετών Αιμόλυση σε παιδί 8 ετών Ε.Μανταδακης 1, Ζ.Μπεζιργιαννίδου 2, Γ.Μαρτίνης 2, Α Χατζημιχαήλ 1 1. Πανεπιστημιακή Παιδιατρική Κλινική, Π.Γ.Ν. Αλεξανδρούπολης 2. Κέντρο Αιμοδοσίας, Π.Γ.Ν. Αλεξανδρούπολης Παρουσίαση

Διαβάστε περισσότερα


ΣΥΝΗΘΕΙΣ ΠΑΘΗΣΕΙΣ ΘΥΡΕΟΕΙΔΟΥΣ Οι όζοι του θυρεοειδούς είναι συχνοί και αποτελούν το συχνότερο ενδοκρινολογικό πρόβλημα σε πολλές χώρες. Οι πιθανότητες ότι κάποιος θα ανακαλύψει έναν τουλάχιστον όζο θυρεοειδούς είναι 1 στις 10 ενώ σε

Διαβάστε περισσότερα


ΧΕΙΡΟΥΡΓΙΚΗ ΑΝΤΙΜΕΤΩΠΙΣΗ ΣΥΝΔΡΟΜΟΥ FOURNIER ΣΕ ΑΣΘΕΝΗ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΣΥΝΔΡΟΜΟΥ FOURNIER Β ΚΛΙΝΙΚΗ, ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΑΘΗΝΩΝ «ΚΑΤ, 1 Η οξεία γαγγραινώδης φλεγμονή του οσχέου με επέκταση στο περίνεο (σύνδρομο FOURNIER) αποτελεί μια σπάνια νόσο που εμφανίζεται συχνότερα σε

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΙΖΗΜΑΤΙΝΟΑΝΤΙΔΡΑΣΕΙΣ ΙΖΗΜΑΤΙΝΟΑΝΤΙΔΡΑΣΕΙΣ Ιζηματινο-αντίδραση ονομάζουμε την ένωση ενός διαλυτού αντιγόνου με το ομόλογο αντίσωμα του και το σχηματισμό ιζήματος. Στην πρώτη φάση γίνεται η ταχεία ένωση του αντιγόνου με το αντίσωμα

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 14/2013 (1-7 Απριλίου 2013)

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 14/2013 (1-7 Απριλίου 2013) Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 14/2013 (1-7 Απριλίου 2013) Η επιτήρηση της γρίπης για την περίοδο 2012-2013 σε Ευρωπαϊκό επίπεδο και στην Ελλάδα ξεκίνησε την εβδομάδα

Διαβάστε περισσότερα

ΤΙ ΕΙΝΑΙ Η ΛΥΣΣΑ. «Η λύσσα οφείλεται σε ιό, ο οποίος προκαλεί θανατηφόρο λοίμωξη, η οποία μεταδίδεται

ΤΙ ΕΙΝΑΙ Η ΛΥΣΣΑ. «Η λύσσα οφείλεται σε ιό, ο οποίος προκαλεί θανατηφόρο λοίμωξη, η οποία μεταδίδεται Σωστή ενημέρωση, πρόληψη, επαγρύπνηση, όχι πανικό αλλά και εμβολιασμό ΟΛΩΝ των οικόσιτων και αδέσποτων ζώων συνιστούν ειδικοί επιστήμονες, με αφορμή την επανεμφάνιση του ιού της λύσσας στη χώρα μας μετά

Διαβάστε περισσότερα

Τμήμα Παρεμβάσεων σε Χώρους Παροχής Υγείας. Γραφείο Ταξιδιωτικής Ιατρικής. Ελονοσία και ταξίδι

Τμήμα Παρεμβάσεων σε Χώρους Παροχής Υγείας. Γραφείο Ταξιδιωτικής Ιατρικής. Ελονοσία και ταξίδι Ελονοσία και ταξίδι 1 Η ελονοσία είναι η πιο σοβαρή παρασιτική λοίμωξη και σημαντικό αίτιο θανάτου παγκόσμια. Σύμφωνα με εκτιμήσεις του Παγκόσμιου Οργανισμού Υγείας, 300-500 εκατομμύρια άτομα προσβάλλονται

Διαβάστε περισσότερα


ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ ΚΑΙ ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 45 η /2011 (22 Νοεμβρίου 2011) Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση

Διαβάστε περισσότερα

Διάγνωση λανθάνουσας φυματίωσης. Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ

Διάγνωση λανθάνουσας φυματίωσης. Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ Διάγνωση λανθάνουσας φυματίωσης 1 Χαράλαμπος Μόσχος Επιμελητής Α Πνευμονολόγος-Φυματιολογος ΝΝΘΑ Η ΣΩΤΗΡΙΑ Τι είναι η λανθανουσα φυματική λοίμωξη (ΛΦ)? 2 Υποκλινική νόσος ΛΦ είναι η παρουσία M. tuberculosis

Διαβάστε περισσότερα

Οικογενησ Μεσογειακοσ Πυρετοσ

Οικογενησ Μεσογειακοσ Πυρετοσ www.printo.it/pediatric-rheumatology/gr/intro Οικογενησ Μεσογειακοσ Πυρετοσ Έκδοση από 2016 2. ΔΙΑΓΝΩΣΗ ΚΑΙ ΘΕΡΑΠΕΙΑ 2.1 Πως μπαίνει η διάγνωση; Γενικά ακολουθείται η παρακάτω προσέγγιση: Κλινική υποψία:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ι. Βλαχογιαννάκος, Γ. Β. Παπαθεοδωρίδης, Γ.Ν. Νταλέκος, Α. Αλεξοπούλου, Χ. Τριάντος, Ε. Χολόγκιτας, Ι. Κοσκίνας


Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 6/2013 (4-10 Φεβρουαρίου 2013)

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 6/2013 (4-10 Φεβρουαρίου 2013) Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 6/2013 (4-10 Φεβρουαρίου 2013) Η επιτήρηση της γρίπης για την περίοδο 2012-2013 σε Ευρωπαϊκό επίπεδο και στην Ελλάδα ξεκίνησε την εβδομάδα

Διαβάστε περισσότερα


ΒΙΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Ευρεθείσα τιμή Τιμές αναφοράς Σάκχαρο : 100.2 mg/dl 65-115 Κρεατινίνη : 1.07 mg/dl 0,50-1,40 Τριγλυκερίδια : 75 mg/dl 40-200 Χοληστερίνη LDL : 136.9 mg/dl 50-150 SGOT : 19 U/L 5-38

Διαβάστε περισσότερα


ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ Καθώς η επιστημονική γνώση και κατανόηση αναπτύσσονται, ο μελλοντικός σχεδιασμός βιοτεχνολογικών προϊόντων περιορίζεται μόνο από τη φαντασία μας Βιοτεχνολογία

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 19 Απριλίου 2012

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 19 Απριλίου 2012 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 19 Απριλίου 2012 Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των επιδημιολογικών δεδομένων

Διαβάστε περισσότερα

Πρόταση: καινούργιος ευρωπαϊκός ορισμός κρούσματος για ηπατίτιδα Β

Πρόταση: καινούργιος ευρωπαϊκός ορισμός κρούσματος για ηπατίτιδα Β ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ & ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ (ΚΕ.ΕΛ.Π.ΝΟ.) ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Αλλαγή του ορισμού κρούσματος της Ηπατίτιδας Β και C Δήλωση των περιστατικών χρόνιας ηπατίτιδας Το ECDC προτείνει

Διαβάστε περισσότερα


ΕΡΓΑΣΤΗΡΙΑΚΗ ΠΡΟΣΕΓΓΙΣΗ ΣΤΗ ΤΑΞΙΔΙΩΤΙΚΗ ΙΑΤΡΙΚΗ Ν.ΒΑΚΑΛΗΣ ΕΡΓΑΣΤΗΡΙΑΚΗ ΠΡΟΣΕΓΓΙΣΗ ΣΤΗ ΤΑΞΙΔΙΩΤΙΚΗ ΙΑΤΡΙΚΗ Ν.ΒΑΚΑΛΗΣ Η εργαστηριακή διερεύνηση σε ταξιδιώτη που επιστρέφει καθοδηγείται από : Τις κλινικές εκδηλώσεις (πυρετός, διάρροια,δερματίτιδες...) Την ανοσολογική

Διαβάστε περισσότερα


ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ Χρυσούλα Νικολάου Μονοκλωνικές ελεύθερες ελαφρές αλύσεις Οι μονοκλωνικές ελεύθερες ελαφρές αλύσεις οι οποίες είναι γνωστές ως πρωτεΐνη Bence

Διαβάστε περισσότερα


ΒΙΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΧΗΜΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Ευρεθείσα τιμή Τιμές αναφοράς Σάκχαρο : 88.4 mg/dl 65-115 Ουρία : 60 mg/dl 12-48 Κρεατινίνη : 1.62 mg/dl 0,50-1,60 Ουρικό οξύ : 7.85 mg/dl 3.0-7.7 ενήλικες 3.0-6.1 παιδιά Τριγλυκερίδια

Διαβάστε περισσότερα

ΛΕΥΧΑΙΜΙΕΣ. Λ.Β. Αθανασίου

ΛΕΥΧΑΙΜΙΕΣ. Λ.Β. Αθανασίου ΛΕΥΧΑΙΜΙΕΣ Λ.Β. Αθανασίου ΟΡΙΣΜΟΙ Λευχαιμίες Κακοήθη νεοπλάσματα των πρόδρομων αιμοκυττάρων του μυελού των oστών. Ατελής διαφοροποίηση οδηγεί σε πολλαπλασιασμό μη ώριμων (και μη λειτουργικών) κυττάρων.

Διαβάστε περισσότερα

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης Σημαντικά σημεία ΕΠΙΔΗΜΙΟΛΟΓΙΚΑ ΔΕΔΟΜΕΝΑ ΓΙΑ ΤΗΝ ΠΑΡΩΤΙΤΙΔΑ ΣΤΗΝ ΕΛΛΑΔΑ, 2004-2016 (ΣΥΣΤΗΜΑ ΥΠΟΧΡΕΩΤΙΚΗΣ ΔΗΛΩΣΗΣ ΝΟΣΗΜΑΤΩΝ) Η παρωτίτιδα είναι μία νόσος που προλαμβάνεται με εμβολιασμό που η συχνότητα

Διαβάστε περισσότερα

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης ΕΠΙΔΗΜΙΟΛΟΓΙΚΑ ΔΕΔΟΜΕΝΑ ΓΙΑ ΤΗ ΣΙΓΚΕΛΛΩΣΗ ΣΤΗΝ ΕΛΛΑΔΑ 2004-2013 * ΣΥΣΤΗΜΑ ΥΠΟΧΡΕΩΤΙΚΗΣ ΔΗΛΩΣΗΣ ΝΟΣΗΜΑΤΩΝ Κύρια σημεία - Η δηλούμενη επίπτωση της σιγκέλλωσης στην Ελλάδα παρουσιάζει αύξηση τα τελευταία

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 30 Δεκεμβρίου 2011

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 30 Δεκεμβρίου 2011 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 30 Δεκεμβρίου 2011 Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των επιδημιολογικών

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 19 Ιανουαρίου 2012

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 19 Ιανουαρίου 2012 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 19 Ιανουαρίου 2012 Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των επιδημιολογικών

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 48/2011. (9 Δεκεμβρίου 2011)

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 48/2011. (9 Δεκεμβρίου 2011) ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 48/2011 (9 Δεκεμβρίου 2011) Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των

Διαβάστε περισσότερα

Επιδημιολογία Λοιμώξεων Βασικά στοιχεία. Ιωσήφ Παπαπαρασκευάς Εργαστήριο Μικροβιολογίας Ιατρική Σχολή ΕΚΠΑ

Επιδημιολογία Λοιμώξεων Βασικά στοιχεία. Ιωσήφ Παπαπαρασκευάς Εργαστήριο Μικροβιολογίας Ιατρική Σχολή ΕΚΠΑ Επιδημιολογία Λοιμώξεων Βασικά στοιχεία Ιωσήφ Παπαπαρασκευάς Εργαστήριο Μικροβιολογίας Ιατρική Σχολή ΕΚΠΑ Επιδημία είναι κάθε κατάσταση στην οποία παρατηρείται αυξημένη συχνότητα (επίπτωση) ενός νοσήματος

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 13 Ιανουαρίου 2012

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 13 Ιανουαρίου 2012 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 13 Ιανουαρίου 2012 Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των επιδημιολογικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΤΗΣΙΑ ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ ΤΗΣ ΓΡΙΠΗΣ ΓΙΑ ΤΗΝ ΠΕΡΙΟΔΟ ΠΕΡΙΛΗΨΗ ΕΤΗΣΙΑ ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ ΤΗΣ ΓΡΙΠΗΣ ΓΙΑ ΤΗΝ ΠΕΡΙΟΔΟ 2015-2016 ΠΕΡΙΛΗΨΗ Την περίοδο γρίπης 2015-2016 το επιδημικό κύμα της γρίπης ξεκίνησε την εβδομάδα 1/2016 (4-10 Ιανουαρίου 2016), κορυφώθηκε

Διαβάστε περισσότερα

ΠΝΕΥΜΟΝΙΑ. Γ. Λ. Δαΐκος, M.D. Ιατρική Σχολή ΕΚΠΑ, Λαϊκό Νοσοκομείο. Δεκέμβριος 2014

ΠΝΕΥΜΟΝΙΑ. Γ. Λ. Δαΐκος, M.D. Ιατρική Σχολή ΕΚΠΑ, Λαϊκό Νοσοκομείο. Δεκέμβριος 2014 ΠΝΕΥΜΟΝΙΑ Γ. Λ. Δαΐκος, M.D. Ιατρική Σχολή ΕΚΠΑ, Λαϊκό Νοσοκομείο Δεκέμβριος 2014 Επιδημιολογία Η πνευμονία είναι η έκτη κατά σειρά αιτία θανάτου Επίπτωση: 500-1000 περιπτώσεις /100.000 Στη χώρα μας υπολογίζεται

Διαβάστε περισσότερα

Διαγνωστική προσέγγιση ασθενούς με ποσοτικές διαταραχές αιμοπεταλίων- Θρομβοκυττάρωση

Διαγνωστική προσέγγιση ασθενούς με ποσοτικές διαταραχές αιμοπεταλίων- Θρομβοκυττάρωση Διαγνωστική προσέγγιση ασθενούς με ποσοτικές διαταραχές αιμοπεταλίων- Θρομβοκυττάρωση Διαγνωστική προσέγγιση ασθενούς με θρομβοκυττάρωση Εισαγωγή Αριθμός ΑΜΠ 450x10 9 /L γενικά αποδεκτός ως θρομβοκυττάρωση

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΜΜΕΣΗ COOMBS ΜΑΘΗΜΑ 5 Ο ΕΜΜΕΣΗ COOMBS ΜΑΘΗΜΑ 5 Ο ΕΜΜΕΣΗ COOMBS Η αντίδραση αυτή χρησιμοποιείται όταν θέλουμε να ανιχνεύσουμε αντι-d αντισώματα στον ορό του αίματος. Βρίσκονται στον ορό του αίματος μητέρων που έχουν Rhesus (-)

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Eβδομάδες 40-41/2017 (02 15 Οκτωβρίου 2017)

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Eβδομάδες 40-41/2017 (02 15 Οκτωβρίου 2017) Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Eβδομάδες 40-41/2017 (02 15 Οκτωβρίου 2017) Η επιτήρηση της γρίπης για την περίοδο 2017-2018 σε Ευρωπαϊκό επίπεδο και στην Ελλάδα ξεκίνησε την εβδομάδα

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δεκαπεντάλεπτη προετοιμασία του φοιτητή, για την παρακολούθηση του μαθήματος του καρκίνου του προστάτη.

Δεκαπεντάλεπτη προετοιμασία του φοιτητή, για την παρακολούθηση του μαθήματος του καρκίνου του προστάτη. Δεκαπεντάλεπτη προετοιμασία του φοιτητή, για την παρακολούθηση του μαθήματος του καρκίνου του προστάτη. Καρκίνος του προστάτη Επιδημιολογία: Αποτελεί τον συχνότερα διαγνωσμένο καρκίνο στον άνδρα. 186.320

Διαβάστε περισσότερα

- Ποιά εικόνα παρουσιάζει η νόσος;

- Ποιά εικόνα παρουσιάζει η νόσος; Ηπατίτιδα είναι μία νόσος που χαρακτηρίζεται από βλάβη ενός ζωτικού οργάνου που είναι το ήπαρ, η σοβαρότητα της οποίας εξαρτάται από την αιτία που την προκαλεί, από την γενική κατάσταση του ατόμου και

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Eβδομάδα 5/2017 (30 Ιανουαρίου 05 Φεβρουαρίου 2017)

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Eβδομάδα 5/2017 (30 Ιανουαρίου 05 Φεβρουαρίου 2017) Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Eβδομάδα 5/2017 (30 Ιανουαρίου 05 Φεβρουαρίου 2017) Η επιτήρηση της γρίπης για την περίοδο 2016-2017 σε Ευρωπαϊκό επίπεδο και στην Ελλάδα ξεκίνησε

Διαβάστε περισσότερα


ΟΞΕΙΑ ΠΥΕΛΟΝΕΦΡΙΤΙΔΑ ΠΥΕΛΟΝΕΦΡΙΤΙΔΑ ΟΞΕΙΑ ΠΥΕΛΟΝΕΦΡΙΤΙΔΑ Πυελονεφρίτιδα είναι η φλεγμονή του νεφρικού παρεγχύματος και της νεφρικής πυέλου. Η διάγνωση τίθεται με βάση τα σημεία και τα συμπτώματα. Πόνος στην πλάτη, στο πλευρό

Διαβάστε περισσότερα

Σχολιασμός: Άννα Ναξάκη Επ. Α Καλλιρόη Τουρτίδου Διευθ. Πέτρος Αυγερινός Συντ. Διευθ.

Σχολιασμός: Άννα Ναξάκη Επ. Α Καλλιρόη Τουρτίδου Διευθ. Πέτρος Αυγερινός Συντ. Διευθ. Παρουσίαση Δώματος Ευαγγελισμού 19/10/2016 Γ Παθολογική Κλινική Γ.Ν.Α ΕΥΑΓΓΕΛΙΣΜΟΣ Παρατεινόμενο εμπύρετο με διάγνωση εισαγωγής αλιθιασική χολοκυστίτιδα Παρουσίαση : Ιωάννης Λεμπέσης Ειδικευόμενος Σχολιασμός:

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 05 Ιανουαρίου 2012

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 05 Ιανουαρίου 2012 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης 05 Ιανουαρίου 2012 Κατά την τρέχουσα περίοδο, γίνεται εβδομαδιαία ανακεφαλαίωση των επιδημιολογικών

Διαβάστε περισσότερα

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 2/2013 (7-13 Ιανουαρίου 2013)

Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 2/2013 (7-13 Ιανουαρίου 2013) Εβδομαδιαία Έκθεση Επιδημιολογικής Επιτήρησης της Γρίπης Εβδομάδα 2/2013 (7-13 Ιανουαρίου 2013) Η επιτήρηση της γρίπης για την περίοδο 2012-2013 σε Ευρωπαϊκό επίπεδο και στην Ελλάδα ξεκίνησε την εβδομάδα

Διαβάστε περισσότερα

Άσκηση 4. Οροδιαγνωστική των λοιμώξεων & Μοριακές τεχνικές στη διάγνωση των λοιμώξεων. Α. Βελεγράκη

Άσκηση 4. Οροδιαγνωστική των λοιμώξεων & Μοριακές τεχνικές στη διάγνωση των λοιμώξεων. Α. Βελεγράκη Άσκηση 4 Οροδιαγνωστική των λοιμώξεων & Μοριακές τεχνικές στη διάγνωση των λοιμώξεων Ανοσο-ορολογικές δοκιμασίες Ανιχνεύουν αντιγόνα (Ag) στον ορό, ή την ανταπόκριση του ανθρώπινου οργανισμού (αντισώματα-ab)

Διαβάστε περισσότερα



Διαβάστε περισσότερα


TOXOPLASMA LEISHMANIA COXIELLA RICKETTSIA. Καλλέργη Κωνσταντίνα ΟΡΟΛΟΓΙΚΗ ΙΑΓΝΩΣH TOXOPLASMA LEISHMANIA COXIELLA RICKETTSIA Καλλέργη Κωνσταντίνα Τοξοπλάσμωση-κατηγορίες λοίμωξης Λοίμωξη σε ανοσοεπαρκή άτομα Λοίμωξη κατά τη διάρκεια της κύησης Συγγενής λοίμωξη Πρωτολοίμωξη

Διαβάστε περισσότερα