ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ"

Transcript

1 Α ΧΗ 1Η ΕΛΙ Α ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ Ε Ω ΕΛΛΗ Ω Ε Ω Ε Ι ΑΙ Ε Ω ΕΛΛΗ Ω ΑΛΛΗΛΩ Σ Ε Ω Ε Ι Ε Α Η 7 ΣΕ Ε Ι 2011 Ε Ε Α Ε Α Η Α ΕΩ Η Ι ΗΣ Α Ε ΣΗΣ: Α ΧΑΙΑ ΕΛΛΗ Ι Α Σ Λ ΣΕΛΙ Ω : ΕΣΣΕ ΙΣ (4) 1. ι Σ νο ίσ νο Χό ο Χ ω ό Χο Ἀ ι ο λο Ἠθ ά Ν ομάχε α ( 1, 5-8) ῖ ὲ ὶ ὸ Σ ἐ ῖς π ἱ ὰ Σ ὺς π ς ἐ ς π ῦ ἀ ς, ὶ ὸ Σὲ ησ π ὸς Σ ῦ ἐ, ὅ ὲ Σὴ ὸ π ῦ Σ, ὶ ῳ π π ς ἀ ὴ ης. Ἔ ἐ ῶ ῶ ὶ ὰ ῶ ῶ ὶ πᾶ ἀ ὴ ὶ, Σ ς ὲ ὶ η ἐ ὰ ῦ ὶ ἱ ἀ ὶ ὶ ὶ. Ἀ ὲ ὶ Σ ὶ ἱ π ὶ π ς ἐ Σὲ ὰ ῦ Σ ῖ ἀ ὶ Σ, ἐ ὲ ῦ ῶς. Ε ὰ Σὴ ς ἶ, ὲ ἂ ῦ ς, ἀ ὰ π ς ἂ ἐ ἀ ὶ ἢ. ὴ ὶ ἐπὶ ῶ ἀ ῶ π ς ὰ ὰ ἐ ῖς Σ ῖς π ὸς ὺς ἀ π ς Σ Σὲ ὲ ἄ, π ς ὲ ὰ ἐ ῖς ῖς ὶ ἐ Σ ῖ ἢ ῖ Σὲ ἀ ῖ ὲ ὶ. ὉΣ ς ὲ ὶ ὰ π ὶ ὰς ἐπ Σ ς ὶ ὰ π ὶ ὰς ς Σὲ ὰ ς ὶ π ᾶ, ἀ ὶ, Σὲ ἐ ῦ ὶ ἐ ῖς ἀ, ὲ ἐ ῦ. ὶ ὶ ὴ ῳ ἐ ῶ Σ ἐ ῶ ἱ ς. ὸ ῖ ὰς ἐ ς π ὰς ἀπ ὰ ὰ ὰς ὰς ἀ ῦ ἱ ς. Σ ὸ ὸ ς ἢ ς ὺς ἐ ἐ, ἀ ὰ π Σπ, Σᾶ ὲ ὸ πᾶ. ΕΛ 1Η Α 4 ΕΛΙ Ε

2 Α ΧΗ 2Η ΕΛΙ Α Α. Απ Σ π ς Σ η η π π Σ : «ω ὴ... Σᾶλλον Χᾶν». ονά «ο νοσο ι οὺ Χολί ἐ ί ον Χοιοῦ ιν ἀ ο, Σ ν ο λησ Χ ν νοσο ο οῦ ἐ ίν, ὅ οι Σὴ Χοιοῦ ιν Σ άνο ιν, ι φ ι ο ῳ Χολι ί Χολι ί ἀ ὴ φ λη»: Σ η π Α ης π Σ «ἀ ὰ» «ῦ»; ονά Α π ς π π Σ ης ης π Σ, η η: «Σι ν ο ν ι φ ι ο ω ἢ ο ω ὺ ἐ ν ων ἐ ί ι, ἀλλ ΧάΣΧολ, Σᾶλλον Χᾶν». ονά ς Α ης η υ αιμονία Η ι ά Νι ομάχ ια π ς π π π ; ονά Χο ή η, Χ ο Χοίη η, ι φ ο ά, Χ ί, χήσ : Γ Σ π ς π π ς ης ς η ς Σ Σ η π Σ. ονά Α ο Σ νο λά ωνο ἈΧολο ί Σω ά ο 33b Ἐ ὼ ὲ ς Σὲ ὸς π π ἐ Ση ς Σ ς ὶ ὰ ἐσ ῦ π ς ἐπ Σ ῖ ἀ, ἴ ς ἴ π ς, ὶ π π ἐ η, ὲ Σ Σὲ Σ Σ Σὴ Σ ὲ, ἀ Σ ς ὶ π ῳ ὶ π η π ἐσ ὸ ἐ ᾶ, ὶ ἐ ς η ΕΛ 2Η Α 4 ΕΛΙ Ε

3 Α ΧΗ 3Η ΕΛΙ Α ἀπ Σ ς ἀ ὧ ἂ. ὶ ἐ ὼ ἴ ς η ὸς ἴ Σ, ἂ ς ὴ π Σ, ὧ Σ π Ση Ση ὶ Ση ὲ π π Σ ησ Σ ἐ ς η π ἐσ ῦ π π Σ ῖ ἢ ἀ ῦ ᾳ ὅ Σὴ ὶ ἱ ἄ π ς, ἴ ὅ ἀ η ῆ. φ ονῶ: Σ Χ χω ί ν ιν : Σ π ς π ὅ ι Σὴ: ὅ, Σὴ Γ1. Σ η η π π Σ. ονά 20 Γ2. η Σ π Σ π ς π ς Σ : Σο : η π η π π π η Σ χ ήσ : η π η Χ νη ι: η Σ ι ίω : Σ π Σ ς ἀλη ῆ: η ς ἐ νόσην: π Σ λ ον ο : π Σ η Χ ά ον ο : π π ης ς Α η ἐχι Σ ῖ: π π η π π ης ς η ἀχο ινόσ νο : π η π π ης ς η. ονά 10 Γ3. π ης η π Σ : ο ν, λ ον ο, χ η, ἀ οῦ ι, ἀλη ῆ. ονά 10 ΕΛ 3Η Α 4 ΕΛΙ Ε

4 Α ΧΗ 4Η ΕΛΙ Α ΗΓΙΕΣ ΓΙΑ Σ Ε Ε Α Ε Σ 1. Σ π (ησ Ση, Σ Σ ησ ). Ση Σ. 2. Σ π Σ ς π Σ ς Σ ς Σ ς ς π. π π π π η ησ η. η π η ς π Σ Σ, π Σ π ς ης ης. 3. π ο ά ιό Σ. 4. ς π ς ς Σ Σ Σπ Σ Σ Σ η ης Σ ης. 5. π η η Ση Σ η π. 6. ης: ς (3) ς Σ η Σ. 7. Χ ς ς π η ης: (1) Σ η Σ π ς 17:00. Ε Χ ΑΣ Ε Ε Ι ΧΙΑ ΕΛ Σ Η Α Σ ΕΛ 4Η Α 4 ΕΛΙ Ε

5 Α ΧΗ 1Η ΕΛΙ Α ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ Ε Ω ΕΛΛΗ Ω Ε Ω Ε Ι ΑΙ Ε Ω ΕΛΛΗ Ω ΑΛΛΗΛΩ Σ Ε Ω Ε Ι Α ΑΣ Ε Η 9 ΣΕ Ε Ι 2011 Ε Ε Α Ε Α Η Α ΕΩ Η Ι ΗΣ Α Ε ΣΗΣ: ΛΑ Ι Ι Α Σ Λ ΣΕΛΙ Ω : ΕΙΣ (3) Α. Σ φ ά ο Χ ά ω ίσ νο η ν λληνι ή λώ : Pleni omnes sunt libri, plenae sapientium voces, plena exemplorum vetustas; quae iacerent in tenebris omnia, nisi litterarum lumen accederet. Quam multas imagines f rtissimorum virorum non solum ad intuendum, verum etiam ad imitandum scriptores et Graeci et Latini nobis reliquerunt!... Num ad hostem veni et captiva in castris tuis sum? In hoc me longa vita et infelix senecta traxit, ut primum exsulem deinde hostem te viderem? Qui potuisti populari hanc terram, quae te genuit atque aluit? Non tibi ingredienti fines patriae ira cecidit? Quamvis infesto et minaci animo perveneras, cur, cum in conspectu Roma fuit, tibi non succurrit: «intra illa moenia domus ac penates mei sunt, mater coniunx liberique»? ονά ς π ς π η Σ π ς π ς: libri: η π η Σ exemplorum: η tenebris: η Σ Σ lumen: η π η Σ imagines: η η Σ fortissimorum: η ς Σ ΕΛ 1Η Α 3 ΕΛΙ Ε

6 Α ΧΗ 2Η ΕΛΙ Α virorum: nobis: tuis: exsulem: hanc: fines: minaci: illa: mater: η π η Σ η π π η Σ π π Σ ς η η ς η Σ η η π η ς Σ η π η Σ ς η π η. ονά ς π ς π η π ς π ησ ς π ς: sunt: π Σ π Σ accederet: η π imitandum: π π π η π reliquerunt: π Σ η π η traxit: η viderem: π η π π π Σ η π η potuisti: π η π π Σ η cecidit: π π π π η η perveneras: π η π π Σ η π η. ονά 15 ΕΛ 2Η Α 3 ΕΛΙ Ε

7 Α ΧΗ 3Η ΕΛΙ Α Γ1. π ης η π : pleni, sapientium, nobis, deinde, animo. (Σ ς 10) Γ1. ut primum exsulem deinde hostem te viderem: ς ης π ης (Σ 1) η η (Σ ς 2) ς ς (Σ ς 2). ονά 15 Γ2. In hoc me longa vita et infelix senecta traxit: Σ η η η π η. (Σ ς 6) Γ2. quae iacerent in tenebris omnia, nisi litterarum lumen accederet: Σ π π η π. (Σ ς 4) Γ2. Qui potuisti populari hanc terram, quae te genuit atque aluit?: Σ π Σ η η π «Mater interrogat (filium)». (Σ ς 5) ονά 15 ΗΓΙΕΣ ΓΙΑ Σ Ε Ε Α Ε Σ 1. Σ π (ησ Ση, Σ Σ ησ ). Ση Σ. 2. Σ π Σ ς π Σ ς Σ ς Σ ς ς π. π π π π η ησ η. η π η ς π Σ Σ, π Σ π ς ης ης. 3. π ο ά ιό Σ. 4. ς π ς ς Σ Σ Σπ Σ Σ Σ η ης Σ ης. 5. π η η Ση Σ η π. 6. ης: ς (3) ς Σ η Σ. 7. Χ ς ς π η ης: (1) Σ η Σ π ς 17:00. Ε Χ ΑΣ Ε Ε Ι ΧΙΑ ΕΛ Σ Η Α Σ ΕΛ 3Η Α 3 ΕΛΙ Ε

8 Α ΧΗ 1Η ΕΛΙ Α ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ Ε Ω ΕΛΛΗ Ω Ε Ω Ε Ι ΑΙ Ε Ω ΕΛΛΗ Ω ΑΛΛΗΛΩ Σ Ε Ω Ε Ι Ε Ε Α 5 ΣΕ Ε Ι 2011 Ε Ε Α Ε Α Η Α ΓΕ Ι ΗΣ ΑΙ ΕΙΑΣ: Ε ΕΛΛΗ Ι Η ΓΛΩΣΣΑ Σ Λ ΣΕΛΙ Ω : ΕΣΣΕ ΙΣ (4) ΕΙ Ε Η π ης π η ς Σ π ς Σ ς π ς π Σ π π ης, ς π η π Σ η. Χ η π Σ η π ς ΑΣ, ς π π Σ Σ., π π ς π π ς π ς η ης π ς. Η,, η. π π η π η ης ης. Ό π η Σ ς, Σ ΣηΣ π : Σ η ης ης, ς ς, η Σ η, η π η π Σ η, π Σ ησ Σ ς π π Σ ς π ς π ς π ς Σ π. Απ Σ Σ ς Σ ς ης π η ς, ης ς, π π,, Σ ς π. Χ Σ η η Σ ς π,, π ΣΣ Σ Σ.! Σ Σ π ς π Σ ς, π Σ ς ς πη ς π Χ χ ι η η Σ ς η ς ς ς, Σ ς ΣΣ Σ ς π π ς φι ό. Α Σ η Σπ Σ ς, η η Σ ς π. ί ω π Σ η π Σ π π. ς ς Σ η Σ η π, π, Σ ησ. π ς Σ Σ π η π Σ ς π Σ ; Σ πη, π ης, π η Σ. π Σπ ς π Σ η π ς π η η π Σ η π η. Α Σ Σ ς ς π Σπ ς η Σ Σ, η Σ ΕΛ 1Η Α 4 ΕΛΙ Ε

9 Α ΧΗ 2Η ΕΛΙ Α Σπ η π π 1 ς 6 C, Σ ς π ς ς. Σ η ς, Σ, π ησσ π, ς π ς. Χ Σ Σ Σ Σ η Σ π Σ Σ, ς π Σ ς π Σ ς ης ν Χ ι., η π ς «π ς». π Σ, π ς π, η Σ Σ (Σ ς Σ η ), ς π ς Σ Σ, π π ς ΣΣ ς. Σπ Σ Σ π Σ η π ης π η ς, Σ π Σ η Σ. Ε, Σ ς, Σ π Σ η Σ, ς Σ η π η Σ. π π Σ η π Σ η. π π Σ π Σ ς ς ς! Απ Βιβλίο ων Νέων η Ευρώπη ( ). Ε Ω ΗΣΕΙΣ Α. ς η π η η Σ π ς η ( ς). ονά π Σ π Σ Σ π π Σ ης π ης: «Χά χο ν άχοι Χ ιχ ώ ι Χι χο ι ή η η ο φ ι ο Χ ι άλλον ο». ονά π ς π ης ης π ης π, π ς ς Σ. ονά Σ Σ π ς π ς Σ : Χ χ ι, φι ό, ί ω, ν Χ ι (Σ ς 4). ΕΛ 2Η Α 4 ΕΛΙ Ε

10 Α ΧΗ 3Η ΕΛΙ Α. Σ Σ π ς π ς Σ : π, π Σ, π, (Σ ς 4). ονά η η η ( η π η ) ς π π ς (Σ ς 2) η Σ η ης (Σ ς 2): οι ο ήσ Χη ά ον ι, Χί η, Χό ην λισ ι ή λλ ή. χνό φ ινόσ ν η ί, Σά ων ων, ΧληΣΣ ών ι Χ ιών ο ν ίν νο ώ, φ ά ι ο ν ώχο.. η η ησ ης π π π Σ : Ό ο άν ι ο Χλη Σό, ό ο Σ λ ο ίν ι ο ίσησ ι ο Χ ι άλλον: ( ) ι όλ ά ω άν! ( Σ ) ήχω ό ίν ι Σόνο Σι Χ ό η Χό ό Σ Χιφ λά ι ο Σ λλον; ( ησ ) ι ω νοί, ά η ι οι άλ οι Χο λο ν φ ι «Χ ί άν» ( ) ά η Σ Σ ό ι ν (Σ ί Σ ην άλ ) (π η) (Σ ς 5). ονά 9 Γ. ΣΣ ς Σ ης Ε πης Σ 500 π π Σ Σ η π ης π η ς π η. η Σ ς η π ης π ς Σ ς η η π η ης ης π π ς Σ ς π ς Σπ η ης π ης π ς ης π π. ονά 40 ΕΛ 3Η Α 4 ΕΛΙ Ε

11 Α ΧΗ 4Η ΕΛΙ Α ΗΓΙΕΣ ΓΙΑ Σ Ε Ε Α Ε Σ 1. Σ π (ησ Ση, Σ Σ ησ ). Ση Σ. 2. Σ π Σ ς π Σ ς Σ ς Σ ς ς π. π π π π η ησ η. η π η ς π Σ Σ, π Σ π ς ης ης. 3. π ο ά ιό Σ. 4. ς π ς ς Σ Σ Σπ Σ Σ Σ η ης Σ ης. 5. π η η Ση Σ η π. 6. ης: ς (3) ς Σ η Σ. 7. Χ ς ς π η ης: (1) Σ η Σ π ς 17:00. Ε Χ ΑΣ Ε Ε Ι ΧΙΑ ΕΛ Σ Η Α Σ ΕΛ 4Η Α 4 ΕΛΙ Ε

12 Α ΧΗ 1Η ΕΛΙ Α ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ Ε Ω ΕΛΛΗ Ω Ε Ω Ε Ι ΑΙ Ε Ω ΕΛΛΗ Ω ΑΛΛΗΛΩ Σ Ε Ω Ε Ι Ε Η 8 ΣΕ Ε Ι 2011 Ε Ε Α Ε Α Η Α ΕΩ Η Ι ΗΣ Α Ε ΣΗΣ: ΙΣ ΙΑ Σ Λ ΣΕΛΙ Ω : ΕΣΣΕ ΙΣ (4) Α Α Ω Η Α1. π Σ :.. Σ Ι π. πη ς ς Α2. ονά 15 ς ς Σ ς ης Σ ήλη Ι π Σ π ΣΣ ης Σ ήλη ΙΙ, π π η η. Σ ήλη Ι Σ ήλη ΙΙ 1. Έ η Ό π η Ε Α ης η Σ ης Ί η ΣΣ ς Ί η π ης ης Ε ς Επ ς π ονά η η Σ ς Γ π Σ ; (Σ ς 6). ς ησ Γ πη η π ης Ε ς Σ ς ; (Σ ς 6) ονά ης π ης η ης ης η ς ς η π ης ς ης; ονά 13 ΕΛ 1Η Α 4 ΕΛΙ Ε

13 Α ΧΗ 2Η ΕΛΙ Α Α Α Ε Ε Η Γ1. η ς ς ς ς ς π Σ π ς :. η ς Σ ς π ς ς π Σ ς ης Ε ς π Σ. (Σ ς 12). π π Σ ς η π. (Σ ς 13) ονά 25 ΕΙ Ε ησ [...] η π, π η π η Σ η η π Σ ς. Απ 1922 η Α Σ π Σ ς η η η Σ ς η η π ησ ης ης Σ π 19. η Σ ς ης ς π Σ ς ς π ς Σ ς Σ ς π Σ, ς Σ Σ η π π π η ης π ης ς ς Σ ς π π Σ π ς ς η Α. [...] Η η Σ - π ησσ π η η η π η Σ η η π ς π ς ης ς, π π π Σ. Έ, 1926, π. 1928, π, π η Σ ς Σ ς Σ Σ : η American Foundation Co, π η Σ η η η η π ης η John Monks & Sons-Ulen & Co ς π ς Σ ς. [...] η η Σπ η Σ π ησσ / ς ς π ς, η π η η ς π ς ης ς π ς, Σ Σ π Σ ς, Σ ς π η Σ, π η Σ ς Σ ς π ς ησ ς η Σ ς π Σ. Χ Ι Ι Α ΑΓ ΙΑ ά Η ΓΕά ΓΙΑ. Α ΕΛΗ Α, «Η η Σ», Ι ορία ου Νέου Ελληνι μού, Σ ς 7 ς, ς , Ε η Γ ΣΣ, Α, 2003 ΕΛ 2Η Α 4 ΕΛΙ Ε

14 Α ΧΗ 3Η ΕΛΙ Α 1. Α π ς ς ς ς ς ς π Σ π ς, π ς:. ς ς Σ ς π η η η Ε π η η π ; (Σ ς 16). ς ς η η ης ς η ς ς ης ς; (Σ ς 9) ονά 25 ΕΙ Ε Α Η ησ η π ης ς π Σ Σ η η η η η η Σ ς ς. Ε ς π η Σ ης ς Σ η η, π Σ π π ς ς ς ς ης Έ η ς. Α, Σ η η ης Λ ης, Έ η ς ης ς π π 93,83%. [...] Η η η η η 1/3 3/4 π η Σ η η η η η η π. [...] η η, π η ς π η Σ ς π Σ η Σ η 1913, η η π Σ η π η η ς. 1924, η 62,1% π η Σ ς ς ς ς ης ης π ς. [...] Η η π ης ς π π π ς ης ς η ς ης π π ησ ς. ΓΙά Γ ΓΙΑ Α Λ, «Η Ε Σ ς π ς», Ι ορία ου Νέου Ελληνι μού, Σ ς 7 ς, ς 91-92, Ε η Γ ΣΣ, Α, 2003 ΕΙ Ε Η Ε, Ση, Σ π π ης ς Σ Σ η η η. Η π π Σ ΣΣ ΕΛ 3Η Α 4 ΕΛΙ Ε

15 Α ΧΗ 4Η ΕΛΙ Α π, ησ [...] Σπ π Σ ης ης π ς π π. Η π ς ησ ς η ς ς π ς ης η π η η π η π, Σ. Η Ε, ης η ς ς ς, Σ η η η Σ π η ης, π Σ, Σ π η, Σ ς ης Ε πης. ά Α Ι Λ Λ, «π η ης», Σμύρνη, ι ρα ία, 145, Ε Ι, η Ε π ς ΗΓΙΕΣ ΓΙΑ Σ Ε Ε Α Ε Σ 1. Σ π (ησ Ση, Σ Σ ησ ). Ση Σ. 2. Σ π Σ ς π Σ ς Σ ς Σ ς ς π. π π π π η ησ η. η π η ς π Σ Σ, π Σ π ς ης ης. 3. π ο ά ιό Σ. 4. ς π ς ς Σ Σ Σπ Σ Σ Σ η ης Σ ης. 5. π η η Ση Σ η π. 6. ης: ς (3) ς Σ η Σ. 7. Χ ς ς π η ης: (1) Σ η Σ π ς 17:00. Ε Χ ΑΣ Ε Ε Ι ΧΙΑ ΕΛ Σ Η Α Σ ΕΛ 4Η Α 4 ΕΛΙ Ε

16 Α ΧΗ 1Η ΕΛΙ Α ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ Ε Ω ΕΛΛΗ Ω Ε Ω Ε Ι ΑΙ Ε Ω ΕΛΛΗ Ω ΑΛΛΗΛΩ Σ Ε Ω Ε Ι Ι Η 6 ΣΕ Ε Ι 2011 Ε Ε Α Ε Α Η Α ΕΩ Η Ι ΗΣ Α Ε ΣΗΣ: Ε ΕΛΛΗ Ι Η Λ Γ ΕΧ ΙΑ Σ Λ ΣΕΛΙ Ω : ΕΣΣΕ ΙΣ (4) ΕΙ Ε ί ολ ο η ( ) όνο ι ί Σ ἀ άχη * ῶ, π Σ ἀ πη ς π Σ., ῦ π Σ Σ,, ῶ π Σ ἀ πη ς. Σ η ς Σ Σ η ς Σ, Σ ἶσ ὡ ῖ ς Σ ἀ Σ, Σ Σ η ς. Σ Σ Σ ΣΣ, π η π ῆς π ς Σ ΣΣ, Σ Σ Σ. Σ ἀ πη ς η ἡ Σ ἐ η ἄ η ἀ π η Σ ἡ π η η. Σ ἀ πη ς η. ΕΛ 1Η Α 4 ΕΛΙ Ε

17 Α ΧΗ 2Η ΕΛΙ Α ὡ ῖ Σ ἀ πη ς η, π η, ὡ ῖ, π ς π Σ ὡ ῖ Σ ἀ πη ς. ( ἱ ς π, 1928) * Σ π, π ς π π η η Α η (Η Χ Ση, η, 1990) Ε Ω ΗΣΕΙΣ Α. Η π η η ης ς η, π Σ Σ - Σ Σ, η π Σ, π ς η Σ, η η ησ η Σ η η. Γ π Σ π Σ π π ησ π ς η. ονά O ς π ς π η η η η η η π Σ ς ησ, ς π Σ.. π Σ Σ π ησ. (Σ ς 10). ς ς ς π ς Σ π. (Σ ς 10) ονά π ς ς ς π Σ ς ης. ς ς ς ης π η ης; (Σ ς 10). π Σ Σ Σ π Σ η π Σ ς. (Σ ς 10) ονά 20 Γ. π Σ ης ης ς π Σ ς 100 π π ς. ονά 25 ΕΛ 2Η Α 4 ΕΛΙ Ε

18 Α ΧΗ 3Η ΕΛΙ Α. ς π ς π Σ π ησ ης ς η «όνο ι ί Σ ἀ άχη» Σ π ησ η «Ε Ω Ι». ονά 20 Ε Ω Ι ὲ Σπ ῶ ὰ, ὲ Σπ ῶ ὰ πῶ ἂ ὰ ἀ πῶ ἴ Σ ὰ ὴ Σ ὥ ὅπ ς, ὅ, ς Σ π ὺ ὰ ἀ ῖ, ἄ ὰ Σ ῖ π ὰ ὸ π ὺ ὸ ὸ, ὲ Σπ ῶ ὰ. Ὅ, ἶ π ς, ἀπ ὴ ἡσ π ς Σ ἄ Σ ς π ς ὶ ὸ ῦΣ Σπῆ ὴ Σ ὅ ἀ η ἀπ ὸ ῶς π ὺ ἐ ς Σ π ἡ, ὰ ὰ π π ὺ ὰ π ησσ ὰ. Ἔ π ὰ ὅ ῦ ὅ, ἶ π : Σὲ Σ ὰ η π ὺ ὲ ἶ. ὴ ὴ ὴ π Σπ ς Σ ἀπ Σ ὸ ὶ ἀπ ὅ, η ῦ Σ ῦ ἡ ἀ πη π ὸ π, π ὺ ὰ ἂ ὅπ ς Σ ὰ ἡσ π π ἀπ Σ Σ ς, ὅπ ς Σ π ῶ, - ὰ Σὴ! (Α η, Σ. 4, η η π Σ, ς Ι. Χ η). ΕΛ 3Η Α 4 ΕΛΙ Ε

19 Α ΧΗ 4Η ΕΛΙ Α ΗΓΙΕΣ ΓΙΑ Σ Ε Ε Α Ε Σ 1. Σ π (ησ Ση, Σ Σ ησ ). Ση Σ. 2. Σ π Σ ς π Σ ς Σ ς Σ ς ς π. π π π π η ησ η. η π η ς π Σ Σ, π Σ π ς ης ης. 3. π ο ά ιό Σ. 4. ς π ς ς Σ Σ Σπ Σ Σ Σ η ης Σ ης. 5. π η η Ση Σ η π. 6. ης: ς (3) ς Σ η Σ. 7. Χ ς ς π η ης: (1) Σ η Σ π ς 17:00. Ε Χ ΑΣ Ε Ε Ι ΧΙΑ ΕΛ Σ Η Α Σ ΕΛ 4Η Α 4 ΕΛΙ Ε

20 Α ΧΗ 1Η ΛΙ Α ΣΟΞΣΠΓ ΘΞ Ο Θ Θ Ρ, Θ ΘΞΣ Λ ΘΗΡΗΡ Ι Θ ΘΠΗΡΙ ΣΛ ΩΜ Ι ΜΠΘΙΗ ΟΘΠΞΟΗ Ν Ρ ΩΜ Θ ΘΙΩΜ Λ ΘΗΛ ΩΜ ΚΚΗΜΩΜ ΝΩ ΠΘΙΞΣ Η Ν ΨΗΦ Ν ΗΝ ΓΓ Η Γ 12 Σεπτεμβρίου 2011 ΗΓ Γ / ΨΗΦ / 1. Να απα α α α α α α υ α α, : Να γ α υ α α γ α π υ α απ, π.. 4 C Να γ α υ α α Να γ α υ α α Να α α υ α γ α, π F Γ. Να α απ α α α α γ γ α- φ. 2. Να π π α υ α α α α. Δ α α : Τ (3) ώ α π υ α Έ α χ ό υ α : Α ω α ω ω Δυ α ό α απ χώ : ΛΟ 1Η Α Ο 5 ΛΙ

21 Α ΧΗ 2Η ΛΙ Α Α. Read the text below and respond to tasks A1 and A2. Jamie Oliver s school dinners shown to have improved academic results Today an audience of prestigious economists was told that the healthier school dinners introduced by the celebrity chef had not only significantly improved pupils test results, but also cut the number of days they were off sick. The proportion of 11-year-olds in Greenwich, south London, who did well in English and science rose after Oliver swept turkey twizzlers off canteen menus in favour of creamy coconut fish and Mexican bean wraps, according to a study of results in south east London. The number of authorised absences which are generally due to illness fell by 15% in the wake of his 2004 Feed Me Better campaign, brought into the nation s sitting rooms via the Channel 4 series Jamie s School Dinners. want to sit around and eat lettuce all day, radio DJ Rod Willis snapped at Oliver during the first episode of Jamie Oliver s Food Revolution. You come to town and you say you re going to change our menus. I just don t think you should come here and tell us what to do. However, there are signs that the tide in the US may be turning in Oliver s favour just as it did in Greenwich, where initial hostility from dinner ladies eventually turned to adoration. More than 100,000 people have signed an online petition supporting his campaign for better school food. After he appeared with Oprah Winfrey on Friday, 7.5 million people tuned in to watch his show. Oliver described the research results as fantastic. It s the first time a proper study has been done into the positive effects of the campaign and it strongly suggests we were right all along, he said. Even while doing the programme, we could see the benefits to children s health and teachers. We could see that it made them calmer and therefore able to learn. The presentation of the findings comes at a convenient time for Oliver, whose US version of the Greenwich project is currently being shown on the ABC network. We don t Adapted from Rachel_William_guardian.co.uk, Monday 29 March BST ΛΟ 2Η Α Ο 5 ΛΙ

22 Α ΧΗ 3Η ΛΙ Α A1. Answer questions 1-3 with information from the article (up to 20 words each). (3 x 4 points = 12 points) 1. In what sense did Oliver s contribution improve school performance? 2. Using text information and your own perception of what is healthy food, suggest a list of four items which could be included in canteen menus. 3. Please identify two words/phrases in the text that show the author s positive attitude towards the Jamie Oliver campaign. A2. Choose the best answer (A, B, or C) for items 4 9 with information from the article. (6 x 3 points = 18 points) 4. According to the text, healthy school diet raised A. pupils interest in economic education B. children s school records and attendance C. students performance 5. Turkey twizzlers were assumed to be A. junk food B. appropriate daily meals C. healthy food 6. Through the Feed Me Better campaign, students learned better because A. they had more time to study B. they were in a better physical state C. they had positive thoughts about food 7. At first, Jamie Oliver s project in the U.S. was A. negatively received B. favourably accepted C. enthusiastically adopted 8. Oliver s campaign was finally appreciated A. in the U.K. B. in the U.S. C. both in the U.S. and the U.K. 9. Oliver s raising popularity was indicated by A. TV. viewers massive response B. female audience constant support C. teachers initial adoration B1. Use the following words (A-H), in the correct form, to complete sentences 10-14, as in the example. There are two words you do not need. (5 x 2 points = 10 points) A. achieve B. diminish C. release D. discover E. naturalists F. centre G. shore H. ignition Example: This piece of evidence is central to our case The of the fossil says the new species is the most possible ancestor of archaic and modern humans. Our small ship, the National Geographic Sea Bird, has the flexibility to take us to places that few others see. A Kappa/Gallup poll this week found that 67 percent of the respondents were in favour of teaching in the public schools as a career. 13. Why do schools teach music in a way that turns off so many young people rather than ΛΟ 3Η Α Ο 5 ΛΙ

23 Α ΧΗ 4Η ΛΙ Α their imagination? 14. The report highlighted examples of the profession s sadly status. B2. Fill in the TWO gaps in the statements of Column B, so that they have a similar meaning with the statements of Column A. (5 x 2 points = 10 points) Example: He s so busy these days that he hardly remembers the things he has to do. He s rather forgetful of his duties these days because he s very busy COLUMN A Mary knew how to ride a bicycle when she was four. School uniform isn t compulsory at schools any more. I m sure he liked it. He stayed there long enough. Teachers are dissatisfied because they do not have appropriate equipment and adequate salaries. With school underway, I asked my eight-yearold son this week if he had any interest in learning guitar. COLUMN B Mary a bicycle at the age of four. Wearing a uniform optional at schools. If he has stayed there for so long, he liked it. They cite poor working conditions and as a chief reason for their dissatisfaction. Now that is approaching, I asked my eight-year-old son this week if he had any interest in learning guitar. B3. Match items (Column A) with options A-G (Column B) to make complete statements. In Column B there are two options you do not need. (5 x 2 points = 10 points) COLUMN A How can we create a green home environment? For one thing, the house must be adequately insulated, For another, packaging and containers can be reused, Wrapping food in foil or plastic seems to be practical, 23. Saving water is also very important, D. 24. Taking a shower instead of a bath is recommended, C. Produce a written text. (40 points) COLUMN B A. although it is better to use glass jars and cartons. B. so that it does not loose much heat. C. because we have many gardens. as they amount to a high percentage of the waste we produce. E. but appliances should be turned off. F. while the water shouldn t be running when we clean our teeth. G. since it is a precious commodity. TASK: his is an expedition suggested to Alaska visitors, by National Geographic Society. Voyage along Alaska s Inside Passage on an unforgettable family trip, discover hidden inlets by kayak and hike along salmon streams. A special program is ΛΟ 4Η Α Ο 5 ΛΙ

24 Α ΧΗ 5Η ΛΙ Α designed to encourage children s interest in topics as diverse as the feeding behavior of humpback whales and the identification of bear tracks in the wild. Think of analogous SUGGESTIONS you could make to school groups who would like to explore Greece s naturalistic environment. Think of potential locations in Greece, which would fulfill your purpose and EXPLAIN the educational value of the experience you suggest. Your 200-word article will be posted on your school site. (Do NOT sign the article) ΣΕΛΟΣ ΜΗΝΤΜΑΣΟΣ ΛΟ 5Η Α Ο 5 ΛΙ

25 Α ΧΗ 1Η ΕΛΙ Α ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ Ε Ω ΕΛΛΗ Ω Ε Ω Ε Ι ΑΙ Ε Ω ΕΛΛΗ Ω ΑΛΛΗΛΩ Σ Ε Ω Ε Ι Ε Α Η 7 ΣΕ Ε Ι 2011 Ε Ε Α Ε Α Η Α Ε Ι ΗΣ Α Ε ΣΗΣ: Ι Λ ΓΙΑ Σ Λ ΣΕΛΙ Ω : ΕΣΣΕ ΙΣ (4) Ε Α A Να ρά ο ρά ιό α ον αρι μό α μιά από ι παρα ά ω ημι λ ί προ ά ι A1 έω αι Α5 αι ίπλα ου ο ράμμα που αν ι οιχ ί ο ω ό υμπλ ρωμά η. A1., DNA π Σ. Σ ς π ς.. π Σ.. π.. π, Σ ς π ς. ονά 5 A2. π ς ς. ΣΣ η Σ η RNA.. ΣΣ η Σ DNA.. π η ς η η ης ς.. DNA Σ ς ς. ονά 5 A3. π Σ Ti. π Bacillus thuringiensis.. η Σ π η Σ η.. η Σ π η π π η η.. η Σ π η π π η η. ονά 5 A4. Σ πo π π Σ Σ ΧΧ. π π Σ Turner.. π π Σ Klinefelter.. π π Σ Down.. π. ονά 5 ΕΛ 1Η Α 4 ΕΛΙ Ε

26 Α ΧΗ 2Η ΕΛΙ Α A5. η DNΑ, η π ΣηΣ ΣΣ. Σ.. π Σ.. Σ.. π Σ Σ. ονά 5 Ε Α B B1. N π η π ς Σ Σ π Σ. ονά 8 B2. η π ς Σ ς ς ς Σ DNΑ. ονά 6 B3. η Σ π η Σ Σ Σ Σ ς ς ς η η. ονά 6 B4. Σ ς π π Σ η Σ ς ς ης π Σ ης (PCR); ονά 5 Ε Α Γ η Σ η Σ Σ ς π π Σ Σ η. Σ Σ ς Α, Σ Σ ς. π π π π Σ Σ π. Γ1. ς π ς π ς π ς π ς ς ς (Σ ς 8). η π η ς (Σ ς 10). ονά 18 ΕΛ 2Η Α 4 ΕΛΙ Ε

27 Α ΧΗ 3Η ΕΛΙ Α Γ2. π π η; η π η ς. ονά 7 Ε Α π Σ Σ Σ DNA (Ι) GACTAATAAAAGAAGTAGTTAGGATCATAGG (ΙΙ) CTGATTATTTTCTTCATCAATCCTAGTATCC π π π π H 2 N- η- η- η- η- η-cooh. 1. η π π ς ς π π Σ Σ ς DNA η π η Ση. (Σ ς 4) π Σ (Σ ς 2) η π η ς. (Σ ς 2) ονά 8 2. η η π Σ mrna π π π Σ η Σ π π Σ Σ ς DNA (Σ ς 2) ς η η Σ mrna (Σ ς 2). π η Σ Σ. (Σ ς 3) ονά 7 3. η π π Σ η Σ π π π π, Σ Σ η π Σ ης ης η η ης ης π Σ η. ονά 5 4. Ε η π π Σ η η η ης ης π η, η π π Σ η Σ π π. ΕΛ 3Η Α 4 ΕΛΙ Ε ονά 5

28 Α ΧΗ 4Η ΕΛΙ Α π ς Σ π : η: η: AUG UAC, UAU η: UUU, UUC ΗΓΙΕΣ ΓΙΑ Σ Ε Ε Α Ε Σ 1. Σ π (ησ Ση, Σ Σ ησ ). Ση Σ. 2. Σ π Σ ς π Σ ς Σ ς Σ ς ς π. π π π π η ησ η. η π η ς π Σ Σ, π Σ π ς ης ης. 3. π ο ά ιό Σ. 4. ς π ς ς Σ Σ Σπ Σ Σ Σ η ης Σ ης. 5. π η η π ησ Ση Σ η π. 6. ης: ς (3) ς Σ η Σ. 7. Χ ς ς π η ης: (1) Σ η Σ π ς 17:00. Ε Χ ΑΣ Ε Ε Ι ΧΙΑ ΕΛ Σ Η Α Σ ΕΛ 4Η Α 4 ΕΛΙ Ε

29 A ΧΗ 1Η ΕΛΙ Α ΚΕΝΣΡΙΚΗ ΕΠΙΣΡΟΠΗ ΕΞΕΣΑΣΕΩΝ ΕΙ ΙΚΩΝ ΜΑΘΗΜΑΣΩΝ ΕΛΛΗΝΩΝ ΕΞΩΣΕΡΙΚΟΤ ΣΕΣΑΡΣΗ 14 ΣΕΠΣΕΜ ΡΙΟΤ 2011 ΕΞΕΣΑΣΗ ΣΩΝ ΤΠΟΨΗΦΙΩΝ ΣΣΟ ΕΛΕΤΘΕΡΟ ΣΧΕ ΙΟ ΣΤΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΟ (2) Η ΑΙ: 1. Α Σ π η Σ ς Σ ης. ς ς «Σ π η» Σ Σ ς η η Σ Σ η π. (35 Σονά ) 2. π η Σ, ς ησ π π π π Σ ( π η). (35 Σονά ) 3. Απ η Σ π (5) ς π π Σ ς. (20 Σονά ) 4. η π ης Σ ς. (10 Σονά ) ΗΓΙΕΣ 1. Ση ς π η ς π π ς Ση Σ ς, η π π ς π η η ς η π η ς. 2. η Σ ν η ν π. 3. π Σπ η Σ π ς π ης π π Α4. 4. π Σπ Σ η Σ η η η ης,, ς Σ ς Σπ ς ς π η ς. Ε η π η Σ π η Σ ς 2,5 Σ. ά η χ ί η, όχω ι η οχ ι ή ωνί ίν ι Σον ι ι χ ι ι ά Χο λ Σ ιολο ο ν ι ( Χό ο Σολο η ) ι ό ισ. 5. η η ης ης ης ς ( π ς) π π π Σ. 6. η π η π 3 ς π η ς η η 15λ Χ ο ι λ ίσσ ο ς π η π Σ π Ση η Σ π π. ΕΛ 1Η Α 2 ΕΛΙ Ε

30 A ΧΗ 2Η ΕΛΙ Α 8. Απ π Σ ς ς ης. 9. π η η ς π η ης. 10. ης: Έ (6) ς. 11. Ε η ης: ΑΣ ς Σ η Σ π ς π η ς. 12. η π η ης: Σ η η ης. 13. Η ης ς ς π η ης π. ΑΛΗ Ε Ι ΧΙΑ ΕΛ Σ Η Α Σ ΕΛ 2Η Α 2 ΕΛΙ Ε

31 Α ΧΗ 1Η ΕΛΙ Α ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ Ε Ω ΕΛΛΗ Ω Ε Ω Ε Ι ΑΙ Ε Ω ΕΛΛΗ Ω ΑΛΛΗΛΩ Σ Ε Ω Ε Ι Ι Η 6 ΣΕ Ε Ι 2011 Ε Ε Α Ε Α Η Α Ε Ι ΗΣ Α Ε ΣΗΣ: Α Η Α Ι Α Σ Λ ΣΕΛΙ Ω : ΕΣΣΕ ΙΣ (4) Ε Α Α Α1. Α Σ η η f π Ση ησ x 0, π ς ησ. ονά 10 Α2. Έ Σ η η f ς ησ π Ση. Σ η η η f ; ονά 5 Α3. η ς π ς π, ς ς π ΣΣ π π η η η Σω ό, η π η Λά ο, η π η Σ η.. Α z, z ) = ( ν ( ) ν z, *. Α f, g, h ς ς η ho(gof), η (hog)of ho(gof) = (hog)of σ x -1. lim = 1 x 0 x ΕΛ 1Η Α 4 ΕΛΙ Ε

32 Α ΧΗ 2Η ΕΛΙ Α. Α η f ς ησ,,, ί f (x)dx = f (x)dx +. Α 0< <1, lim α = 0 α ΰ α x x ί ΰ f (x)dx ονά 10 Ε Α Έ 4 w = z +, π z Σ ς Σ ς Σ z 0 z 1. ς Σ ς Σ ς z 1 z 2 ς π ς w=2 ονά 6 2. Α z 1 = 1+i 3 z 2 = 1-i 3 Σ Σ π ησ 1, π z = = z - 8 ονά 6 3. Α z 1 z 2 Σ Σ π η Σ Σ ς, π ς Σ Σ z 1, z 2 z1 3 3 = 4 z Σ π π ς π. ονά 8 4. Α z = 2, π Σ ς w π Σ ς. ονά 5 ΕΛ 2Η Α 4 ΕΛΙ Ε

33 Α ΧΗ 3Η ΕΛΙ Α Ε Α Γ η η η f(x) = x - ln(e x +1), x Γ1. π η η η f η ς. Γ2. π η η η f η. ονά 7 Γ3. π : ονά 8 xf (x) < f(x) + ln2, x (0,+ ) ονά 10 Ε Α Έ η ς η η f : (-1,+ ) η π : x f (t) dt = ( ln(x 1) ) 2, x > ln(x + 1) 1. π f (x) =, x > -1 x + 1 ονά 6 2. Σ η η η f ς π ς η Σ π : (x+1) e e x+1, x > -1 ονά 6 3. Σ π π π η π η ης f, x x η x = e-1 ονά 6 ΕΛ 3Η Α 4 ΕΛΙ Ε

34 Α ΧΗ 4Η ΕΛΙ Α 4. π : (x+1) 2 = 2 x+1 f(x) = f(1), x>-1 η π η η (x+1) 2 = 2 x+1, x>-1 ς ς, ς x=1 x=3 ονά 7 ΗΓΙΕΣ ΓΙΑ Σ Ε Ε Α Ε Σ 1. Σ π (ησ Ση, Σ Σ ησ ). Ση Σ. 2. Σ π Σ ς π Σ ς Σ ς Σ ς ς π. π π π π η ησ η. η π η ς π Σ Σ, π Σ π ς ης ης. 3. π ο ά ιό Σ. 4. ς π ς ς Σ Σ Σπ Σ Σ Σ η ης Σ ης. 5. Ση η Σ π Σ Σ. 6. π η η Ση Σ η π. 7. ης: ς (3) ς Σ η Σ. 8. Χ ς ς π η ης: (1) Σ η Σ π ς 17:00. Ε Χ ΑΣ Ε Ε Ι ΧΙΑ ΕΛ Σ Η Α Σ ΕΛ 4Η Α 4 ΕΛΙ Ε

35 Α ΧΗ 1Η ΕΛΙ Α ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ Ε Ω ΕΛΛΗ Ω Ε Ω Ε Ι ΑΙ Ε Ω ΕΛΛΗ Ω ΑΛΛΗΛΩ Σ Ε Ω Ε Ι Ε Η 8 ΣΕ Ε Ι 2011 Ε Ε Α Ε Α Η Α Ε Ι ΗΣ Α Ε ΣΗΣ: ΣΙ Η Σ Λ ΣΕΛΙ Ω : Ε Ι (6) Ε Α Α Να ρά ο ρά ιό α ον αρι μό α μιά από ι παρα ά ω ημι λ ί προ ά ι A1 έω αι Α4 αι ίπλα ου ο ράμμα που αν ι οιχ ί ο ω ό υμπλ ρωμά η. Α1. T Ση Σ. Σ.. Σ Σ η.. Σ Σ... ονά 5 Α2. η η ς π Σ Σ η Α π η η η η πη, η π π Σπ η ς f s. Σ ης η ς υ Α η πη ς π η η. A η η, η η π Σ π η η ς υ. f A = υ υ Α f s. f A = υ υ υ υ Α υ υ + υ. f A = f s. f A = Α υ υ f s ονά 5 Α3. Σ π ς Σ ς ς Σ ς x 1 =A 1 ησ t x 2 =A 2 ησ( t+π) π η η π ησ, Σ A 2 > A 1. Η η η π π π η π Σ ης. t π ς A 2 A 1. t+π π ς A 2 A 1 ΕΛ 1Η Α 6 ΕΛΙ Ε Α f s

36 Α ΧΗ 2Η ΕΛΙ Α. t π ς A 1 +A 2 A A. t+π π ς ονά 5 Α4. Σ π Σ η π ς Α. Α π ς ης ης ς π, π. η π ς.. η η.. η ης ης.. η Σ η η Σ ς. ονά 5 Α5. Να χαρα ηρί αν ο π ρι χόμ νο ων α όλου ων προ ά ων ίναι Σω ό Λάθο, ρά ον α ο ρά ιό α η λέ η Σω ό Λάθο ίπλα ο ράμμα που αν ι οιχ ί ην ά πρό α η.. ς η Σ η Σ.. Ό ησ ς Σ ς π Σ η η η η.. Ό ς ς Σ Σ ς.. ς Ση ς ς η η ης ης Σ ς Σ ησ Σ.. Α η π ησ Σ Ση, η Σ Σ ς π Σ. Ε Α ονά 5 1. η Σ ς Σ η f π ς Α ησ ΣΣ Σ Σ, π π π η η ΕΛ 2Η Α 6 ΕΛΙ Ε

37 Α ΧΗ 3Η ΕΛΙ Α t x y=aησ2π( ) T λ Ό η πη Σ ς Σ π η π ς, ησ Σ Σ, π π π η η 2t. y=aησ2π( T. y=aησπ( T t x t ). y=aησ4π( λ T x ) λ x ) λ π ΣΣ π η π η η (Σ ς 2). η π ς (Σ ς 6). ονά 8 2. ησ Σ η η π ς. Η η Σ ς f o η 1 π ς η 1, π 1 >. Α η π ς η η, π ς ης ης. Σ.. π Σ.. Σ. π ΣΣ π η η (Σ ς 2). η π ς (Σ ς 6). ονά 8 3. π Σ f o Σ 2 Σ 1 ΕΛ 3Η Α 6 ΕΛΙ Ε

38 Α ΧΗ 4Η ΕΛΙ Α Σ 1 2 Σ, π Σ η. 2 η 1 π ς 2 Σ η υ. ς Σ 1 2 ς ς η η 2 Σ Σ. π ς ς ς π Σ. 1 Σ η υ, 2 η. υ. 1 2 Σ η η π, 2 Σ η 2 υ. π ΣΣ π η η (Σ ς 2). η π ς (Σ ς 7). ονά 9 Ε Α Γ Ι Σ η LC π π π η η ς C=10-6 F πη Σ π ς L=10-4 H. Γ1. π η η ης η ς ης. ονά 5 Γ2. π Σ π, Σ η π q= C, η η Σ ς π Σ i= A. ονά 6 Γ3. π π Σ π ς ς Σ ς ς π ς η Σ η π πη π π η η π π. ονά 7 ΕΛ 4Η Α 6 ΕΛΙ Ε

39 Α ΧΗ 5Η ΕΛΙ Α Γ4. Α η Σ t=0 π ς Σ, η η ης ς η π π η η Σ (Σ ς 2) η π ησ Σ ς π ης η ς ης (Σ ς 5). Γι ο χ ι Σό η φι ή Χ ά η ν χ η ισοχοιή ο χ ί ΣιλιΣ ο ίο. ονά 7 Ε Α Σ ς ς Σ ς m=4kg ς R=0,1m η ς π π π π ς ης =30 0 Σ. Γ π Σ π, ς Ση Σ. η η η Σ ς Ση Σ F 1 Σ η π η η π ς η π π π π Σ π ς π, π ς Σ. F 1 30 o 1. π Σ ης ς ς π ς π π π π. ονά 6 Α Σ η Ση F 1 Σ Ση F 2 ς ης Σ η F 1 Σ F 2 =7N, Σ π Σ ς ς π ς. Σ π ς. 2. π η π η Σ ς, ς η Σ ης ς ς. ονά 7 ΕΛ 5Η Α 6 ΕΛΙ Ε

40 Α ΧΗ 6Η ΕΛΙ Α 3. π Σ ης η ς ησ Σ ς ης F 2 η Σ t 1 η π ς π η Σ 1 =10 rad/s. ονά 5 4. π ησ π Σ ς π η Σ π Σ η Σ t 1. ονά 7 : ησ30 0 = 2 1, η π η ης η ς g=10 m/s 2 η π ς ς π ς π ς I= 2 1 mr 2. ΗΓΙΕΣ ΓΙΑ Σ Ε Ε Α Ε Σ 1. Σ π (ησ Ση, Σ Σ ησ ). Ση Σ. 2. Σ π Σ ς π Σ ς Σ ς Σ ς ς π. π π π π η ησ η. η π η ς π Σ Σ, π Σ π ς ης ης. 3. π ο ά ιό Σ. 4. ς π ς ς Σ Σ Σπ Σ Σ Σ η ης Σ ης. 5. π η η π ησ Ση Σ η π. 6. ης: ς (3) ς Σ η Σ. 7. Χ ς ς π η ης: (1) Σ η Σ π ς 17:00. Ε Χ ΑΣ Ε Ε Ι ΧΙΑ ΕΛ Σ Η Α Σ ΕΛ 6Η Α 6 ΕΛΙ Ε

41 Α ΧΗ 1Η ΕΛΙ Α ΕΙΣΑΓΩΓΙ ΕΣ Ε Ε ΑΣΕΙΣ Ε Ω ΕΛΛΗ Ω Ε Ω Ε Ι ΑΙ Ε Ω ΕΛΛΗ Ω ΑΛΛΗΛΩ Σ Ε Ω Ε Ι Α ΑΣ Ε Η 9 ΣΕ Ε Ι 2011 Ε Ε Α Ε Α Η Α Ε Ι ΗΣ Α Ε ΣΗΣ: ΧΗ ΕΙΑ Σ Λ ΣΕΛΙ Ω : Ε Ε (5) Ε Α Α Σ ι ρω ι Α1 έω αι Α5 να ρά ο ρά ιό α ον αρι μό η ρώ η η αι ίπλα ου ο ράμμα που αν ι οιχ ί η ω απάν η η. Α1. π ς π π ς Σ Σ Ση Σ Σ ;. η π π π Σ ς ς π ς ς.. π Σ η η η η η π π Σ.. π η π η ης η Σ. ονά 5 Α2. η ς η ς HSO 4 ;. H 2 SO 4. SO 4 2. SO 3 2. ΗSO 3 ονά 5 A3. ς π ς π ς η ς η Σ η η ς π η;. ης Σ a =10 2. ης Σ a =10 4. ης Σ a =10 8. ης Σ a =10 10 ονά 5 ΕΛ 1Η Α 5 ΕΛΙ Ε

42 Α ΧΗ 2Η ΕΛΙ Α Α4. π ς π ς ς η ς η π ης Σ Na;... η. η ονά 5 Α5. π ης ης ης 2 ης π H 2 SO 4 ;. 2. η ονά 5 Ε Α 1. π ΣΣ π Σ ς, π ησ Σ Σ Σ ς. Na Al S Cl Ca Mn. π η Σ η π Σ ; (Σ 1). π ησ Σ Σπ ; (Σ 1). π Σ ης ης π η Σ η Σ ; (Σ 1). η η Σ Σ Al π ς η Σ η η; (Σ ς 2). π Σ π 7 η s ; (Σ ς 2) ΕΛ 2Η Α 5 ΕΛΙ Ε ονά 7

43 Α ΧΗ 3Η ΕΛΙ Α 2. Σ NH 3. π ς Σ (, Σ, π Σ ) ph Σ ς Σ ς Σ ης NH 3,. Σ NH 3 Σ π η H 2 O ; (Σ ς 4). π Σ Σ NH 3 Σ π η KOH ; (Σ ς 4) ονά 8 3. To ph ς Σ ς ς CH 3 COONa 0,1 M Σ π ph Σ ς ς ΗCOONa 0,1 M. η π π Σ η π η: «ΗCOOΗ π CH 3 COOΗ». ονά 4 4. π η η π π ς π η π Σ ης. Γ Σ Σ ς π 1 η 2 η 2 Σ 2 π π η. π π Σ π Σ π π π π η η. ονά 6 Ε Α Γ Γ1. π ς. 1) (CHC) 3 7l NaΟΗ υ α δεό δϊζυηα + ΚΜnO 4 / H + Γ ( θ αθ δ λϊ η ο αθ δ λα άλδο Tollens) 2) (δ οη λάμ βμ Α) Μg Ϊθυ λομ αδγϋλαμ +Γ +Η Ο 2 Θ ΕΛ 3Η Α 5 ΕΛΙ Ε

44 Α ΧΗ 4Η ΕΛΙ Α. π ς ς π ς A, B, Γ,, Ε,,. (Σ ς 7). ς ς ησ π π ς π π ς. (Σ ς 10) ονά 17 Γ2. 0,1 mol Σ π η H 2 O, π Hg, HgSO 4 H 2 SO 4, Σ π η η π Σ Fehling ς ησ. π η Σ Σ ς. ς Σ ς Σ ς: Cu = 63,5 = 16. ονά 8 Ε Α Σ Σ HF ( Σ Α). Σ 25 ml Σ ς Α Σ π π Σ NaOH 0,1M. Σ ησ η 25 ml π π Σ ς NaOH. 1. π η η Σ ς Α. ονά 3 2. π ph Σ ησ. ονά 5 3. ΣΣ NaOH π π π 300 ml Σ ς Α π Σ Σ Σ ph=3; ονά Έ ς Σ η ς π η, Σ π Σ 300 ml H 2 O, ph Σ ς Σ η. Σ Σ η π ; (Σ 1). η π η ς. (Σ ς 4) ονά 5 : Ό Σ Σ =25 C, K a (HF) = , w = Σ π Σ ς π π ς ς Ση ς π ς. ΕΛ 4Η Α 5 ΕΛΙ Ε

45 Α ΧΗ 5Η ΕΛΙ Α Η π η Σ Σ ς Α. ς Σ ς Σ ς: a = 23, Η = 1, = 16. ΗΓΙΕΣ ΓΙΑ Σ Ε Ε Α Ε Σ 1. Σ π (ησ Ση, Σ Σ ησ ). Ση Σ. 2. Σ π Σ ς π Σ ς Σ ς Σ ς ς π. π π π π η ησ η. η π η ς π Σ Σ, π Σ π ς ης ης. 3. π ο ά ιό Σ. 4. ς π ς ς Σ Σ Σπ Σ Σ Σ η ης Σ ης. 5. π η η π ησ Ση Σ η π. 6. ης: ς (3) ς Σ η Σ. 7. Χ ς ς π η ης: (1) Σ η Σ π ς 17:00. Ε Χ ΑΣ Ε Ε Ι ΧΙΑ ΕΛ Η Α ΕΛ 5Η Α 5 ΕΛΙ Ε

46 Α ΧΗ 1ης ΕΛΙ Α Κ ΝΣΡΙΚΗ ΠΙΣΡΟΠΗ Ι ΙΚΩΝ ΜΑΘΗΜΑΣΩΝ ΛΛΗΝΩΝ ΞΩΣ ΡΙΚΟΤ ΣΟ ΓΡΑΜΜΙΚΟ Χ ΙΟ Π ΜΠΣΗ 15 ΠΣ Μ ΡΙΟΤ 2011 ΤΝΟΛΟ ΛΙ ΩΝ Π ΝΣ (5) Θ ΜΑ: «ΚΡΗΣΙΚΟ Σ ΝΟΜ ΣΩΠΟ ΚΑΜΑΡΟΠΙΣΟ» Π ΡΙΓΡΑΦΗ: Πλσε δ αδ ΰδα Ϋνα Κλβ δεσ λαρεσ αΰλκ δεσ σπέ δ, πκυ συναν Ϊη σ κλσελβλβ βν Κλά β. Τκ Κλβ δεσ εαηαλσσπδ κ έναδ κ πδκ δα κηϋνκμ εαδ αΰαπβ σμ τπκμ σπδ δκτ. έναδ δσσΰ δκ πϋ λδνκ ε έσηα, η κλγκΰυνδα εϊ κοβ. Τκ ξυλδσηα βμ εϊ κοβμ η βν καμάρα βηδκυλΰ έ πέ ηϋλκυμ ξυλκυμ η λ δ κυλΰδεά αυ κνκηέα, ξπλέμ σηπμ να δασπϊ αδ β νσ β α κυ ξυλκυ. Αναλυ δεσ λα: κ ε έσηα, σππμ φαέν αδ σ βν εϊ κοβ, π λδλαηίϊν δ β σϊλα, κ ηαΰ δλ έκ η βν σ έα εαδ Ϋνα ίκβγβ δεσ ξυλκ απκγάεβμ, πκυ έναδ υπ λυοπηϋνκμ εα Ϊ 0,45η απσ κν υπσλκδπκ ξυλκ κυ σπδ δκτ. Η έσκ κμ σ κν σπ λδεσ ξυλκ ΰέν αδ απσ β υ δεά πλ υλϊ ηϋσπ ηδαμ έφυλλβμ ιτλδνβμ πσλ αμ, σππμ φαέν αδ σ κ σξϋ δκ. β νσ δα πλ υλϊ υπϊλξ δ υ λ τκυσα πσλ α πκυ κ βΰ έ σ κν εάπκ. β νσ δα εαδ υ δεά πλ υλϊ κυ ε έσηα κμ υπϊλξ δ αυλά πκυ π λδελ έ αδ απσ ξαηβλσ ηαν λσ κδξκ. Η έσκ κμ σ βν αυλά ΰέν αδ απσ β υ δεά πλ υλϊ, σππμ φαέν αδ σ κ σξϋ δκ βμ εϊ κοβμ. κ νκ δκ υ δεσ Ϊελκ βμ αυλάμ υπϊλξ δ παλ Ϋλδ η Ϋνα Ϋν λκ (2). πδηϋλουμ οδχ ία: - Όλκδ κδ κέξκδ κυ σπδ δκτ, σπ λδεκέ εαδ ιπ λδεκέ, έναδ πϋ λδνκδ πϊξκυμ 0,50η. - Όλα α εκυφυηα α κπκγ κτν αδ σ β ηϋσβ πν κέξπν. - Οδ εϊσ μ σλπν πν εκυφπηϊ πν Ϋξκυν δα κηά 0,05η x 0,10η. Οδ δασ Ϊσ δμ πν εκυφπηϊ πν, πκυ ένκν αδ σ κ σξϋ δκ, έναδ απσ κέξκ σ κέξκ, π λδλαηίϊνκυν βλα ά, εαδ κ πϊξκμ πν εασυν. Η πσλ α δσσ κυ απκ λ έ αδ απσ υκ έσα η αιτ κυμ φτλλα. - Τκ πϊξκμ σλπν πν φτλλπν πν γυλυν έναδ 0,05η. ΕΛ 1ης Α 5 ΕΛΙ Ε

47 Α ΧΗ 2ης ΕΛΙ Α - Ο ξυλκμ βμ σ έαμ π λδίϊλλ αδ απσ πϋ λδνκ κέξκ πκυ εα αλάΰ δ σ εαηδνϊ α, σππμ φαέν αδ εαδ σ α σξϋ δα βμ κηάμ εαδ βμ σοβμ. Η εαηδνϊ α απκλάΰ δ σ πδγϊλδ (ξπλέμ πϊ κ) (3). - Η κλκφά κυ σπδ δκτ σ βλέα αδ απσ ιτλδνα κεϊλδα, σππμ φαένκν αδ σ κ σξϋ δκ βμ κηάμ (4), δασ Ϊσ πν 0,10η Χ 0,15η. έναδ κπκγ βηϋνα σ έσ μ απκσ Ϊσ δμ η αιτ κυμ, σππμ φαέν αδ σ κ σξϋ δκ βμ κηάμ εαδ κλέα αδ η κ ΰλΪηηα γ. - Ο ξαηβλσμ ηαν λσ κδξκμ, πκυ π λδελ έ δ βν αυλά, Ϋξ δ πϊξκμ 0,35η εαδ τοκμ 0,70η. - Η αυλά σ βν π λδκξά πν δσσ πν έναδ σ λπηϋνβ η πϋ λδν μ πλϊε μ, σππμ φαένκν αδ σ κ σξϋ δκ (1). ΗΣΟΤΝΣΑΙ: Α. Να χ δα οτθ η ηατλβ δθδεά η ζϊθβ χλβ δηοποδώθ αμ α εα Ϊζζβζα πϊχβ γλαηηώθ, α ιάμ: 1. Η εϊ οοβ ου δ ογ ίου, β οηά Α-Α εαδ β υ δεά όοβ σ ελέηαεα 1:50, στηφπνα η δμ δασ Ϊσ δμ σ ηϋ λα, σππμ αυ Ϋμ αναΰλϊφκν αδ σ α σξϋ δα εαδ αναφϋλκν αδ σ βν π λδΰλαφά κυ γϋηα κμ. 2. κ σξϋ δκ βμ εϊ κοβμ: α. Ο συηίκλδσησμ κυ σικυ βμ εαηϊλαμ ί. Ο συηίκλδσησμ βμ κηάμ. γ. Η ΰλαηηά ανϊίασβμ πν σεαλκπα δυν.. Ο συηίκλδσησμ κυ ΰλασδ δκτ εαδ κ Ϋν λκ σ κ παλ Ϋλδ βμ αυλάμ, ηπκλκτν να ΰένκυν η λ τγ λκ ξϋλδ ά η α πδ λ πση να σλΰανα σξ έασβμ, να δαφϋλκυν απσ αυ σν κυ γϋηα κμ, βλα ά ηπκλ έ να έναδ εαδ πδλκΰάμ κυ υπκοβφέκυ.. Η πλαεσσ λπσβ βμ αυλάμ σ βν π λδκξά πν δσσ πν, σππμ κλέα αδ απσ δμ λ π Ϋμ δαε εκηηϋν μ ΰλαηηΫμ, η λ τγ λκ ξϋλδ. Ο τπκμ βμ πλαεσσ λπσβμ ηπκλ έ να δαφϋλ δ απσ αυ σν κυ γϋηα κμ εαδ να έναδ βμ πδλκΰάμ πν υπκοβφέπν. 3. κ σξϋ δκ βμ σοβμ: α. Ο συηίκλδσησμ κυ πϋ λδνκυ κέξκυ κυ ξυλκυ βμ σ έαμ εαδ κ πδγϊλδ, η λ τγ λκ ξϋλδ. ί. Οδ σανέ μ σ βν πσλ α εαγυμ εαδ κδ πϋ λ μ σ κ π λέΰλαηηα βμ πσλ αμ, η λ τγ λκ ξϋλδ ά η α πδ λ πση να σλΰανα σξ έασβμ. ΕΛ 2ης Α 5 ΕΛΙ Ε

48 Α ΧΗ 3ης ΕΛΙ Α γ. Τκ Ϋν λκ. Ο συηίκλδσησμ ηπκλ έ να δαφϋλ δ απσ αυ σν κυ γϋηα κμ εαδ να έναδ βμ πδλκΰάμ πν υπκοβφέπν, η λ τγ λκ ξϋλδ ά η α πδ λ πση να σλΰανα σξ έασβμ. 4. κ σξϋ δκ βμ κηάμ: α. Τκ πδγϊλδ, η λ τγ λκ ξϋλδ. ί. Οδ σανέ μ σ βν πσλ α βμ απκγάεβμ η λ τγ λκ ξϋλδ ά η α πδ λ πση να σλΰανα σξ έασβμ. 5. Ο έ λκμ κυ γϋηα κμ ΚΡΗΣΙΚΟ Σ ΝΟΜ ΣΩΠΟ ΚΑΜΑΡΟΠΙΣΟ, κδ έ λκδ πν λδυν σξ έπν εαδ κ στηίκλκ κυ κλλϊ η λ τγ λκ ξϋλδ ά η α πδ λ πση να σλΰανα σξ έασβμ.. Να ηβ χ δα οτθ: 1. Οδ ΰλαηηΫμ δασ Ϊσ πν εαδ κδ ίκβγβ δεϋμ δαε εκηηϋν μ ΰλαηηΫμ πν σξ έπν. 2. κ σξϋ δκ βμ οηάμ β λδγκ κηά σ βν π λδκξά βμ σ έαμ. Γ. Να ηβ δαγλαηηδ οτθ α ηνση να ηάηα α σ α σξϋ δα.. Να ηβθ αθαγλαφοτθ κδ δασ Ϊσ δμ ά Ϊλλ μ ν έι δμ, α υοση λα πν πδπϋ πν εαδ κδ ξαλαε βλδσηκέ πν ξυλπν. Ι ΤΚΡΙΝΙ Ι 1. Η κπκγϋ βσβ πν σξ έπν εαδ πν έ λπν έναδ βμ πδλκΰάμ πν υπκοβφέπν. 2. Οδ γϋσ δμ πν έ λπν, κ τπκμ εαδ κ ηϋΰ γκμ πν ΰλαηηΪ πν γα πδλ ΰκτν απσ κυμ υπκοβφέκυμ. 3. Οδ δασ Ϊσ δμ γα λαηίϊνκν αδ απσ κυμ αναΰλαφση νκυμ αλδγηκτμ, κδ κπκέκδ αναφϋλκν αδ σ ηϋ λα (η.). Οδ δασ Ϊσ δμ πκυ αναΰλϊφκν αδ σ βν εϊ κοβ η α ΰλΪηηα α α, ί, εαγυμ εαδ β δϊσ ασβ πκυ αναΰλϊφ αδ σ βν κηά η κ γ, γα λβφγκτν ΰλαφδεΪ. Οδ δασ Ϊσ δμ πκυ ν αναΰλϊφκν αδ ά ν έναδ υελδν έμ, γα υπκλκΰδσ κτν αναλκΰδεϊ σ σξϋσβ η δμ υπσλκδπ μ δασ Ϊσ δμ. 4. Όλ μ κδ ΰπνέ μ σ α σξϋ δα έναδ κλγϋμ. 5. α σξϋ δα θ γα αθαγλαφοτθ δασ Ϊσ δμ κτ ΰλαηηΫμ δασ Ϊσ πν, ΰλΪηηα α ά Ϊλλ μ ν έι δμ ε σμ απσ αυ Ϋμ πκυ π λδλαηίϊνκν αδ σ α αβ κτη να κυ γϋηα κμ. ΕΛ 3ης Α 5 ΕΛΙ Ε

49 Α ΧΗ 4ης ΕΛΙ Α ΚΡΙΣΗΡΙΑ ΑΞΙΟΛΟΓΗΗ Α. Η δϊ αιβ ο χαλ ί 10/ ΤκπκγΫ βσβ εαδ συσξ δσησμ πν σξ έπν 5/ ΙσκλλκπβηΫνβ στνγ σβ σ κ ξυλκ σξ έασβμ 5/100.. Η ω ά χ ία β ου γϋηα ομ 40/ πσ ά η αφκλϊ ελέηαεαμ 25/ πσ ά ΰ πη λδεά απ δεσνδσβ 15/100. Γ. Η εα Ϊζζβζβ πδζογά γλαηηώθ 20/ ΠΪξβ ΰλαηηυν 10/ Πκδσ β α ΰλαηηυν 10/100.. Οδ υηίοζδ ηοί (πλαεσσ λπ κ, ν έι δμ κηάμ, στηίκλκ κλλϊ, ΰλαηηά ανϊίασβμ σεαλκπα δυν, Ϋν λκ, παλ Ϋλδ) εαδ α γλϊηηα α 15/100.. Σο υθοζδεό απο Ϋζ ηα 15/ Πλβλσ β α συνσλκυ (κλκελάλπσβ) 10/ Πκδσ β α συνσλκυ 5/100. Ο ΗΓΙ 1. Να δαν ηβγκτν σ κυμ υπκοβφέκυμ κ φτλλκ η α σξϋ δα υπκ έΰηα α εαδ κδ πϋν (5) σ λέ μ κυ γϋηα κμ. 2. Οδ υπκοάφδκδ, εα Ϊ βν απoξυλβσά κυμ, πδσ λϋφκυν δμ φπ κ υπέ μ εαδ κ φτλλκ η α σξϋ δα υπκ έΰηα α σ κυμ πδ βλβ Ϋμ. 3. Τκ γϋηα θ γα εφωθβγ ί εαδ θ γα γλαφ ί σ κν πέναεα. 4. Καγ σλβ β δϊλε δα βμ ιϋ ασβμ α φυ α βμ αέγκυσαμ (σξδ πλκίκλ έμ) πλϋπ δ να παλαηϋνκυν ανκδξ Ϊ. 5. Οδ υπκοάφδκδ ηπκλκτν να ξλβσδηκπκδκτν πμ πλσξ δλκ σξ έασβμ λ υεσ ξαλ έ π λέπκυ Α4. 6. Μ Ϊ βν παλϋλ υσβ κυ πλυ κυ 3πλκυ έν αδ σ κυμ υπκοβφέκυμ β υνα σ β α 15ζ π ου δαζ ίηηα ομ ξπλέμ παλϊ ασβ κυ πλκεαγκλδσηϋνκυ 6πλκυ. 7. Οδ πδ βλβ Ϋμ υπκΰλϊφκυν σ βν εϊ π ιδϊ ΰπνέα κυ ξυλκυ σξ έασβμ. 8. ΔδΪλε δα ιϋ ασβμ: Έιδ (6) υλ μ. 9. Έναλιβ ξλσνκυ ιϋ ασβμ: ΑηΫσπμ η Ϊ β δανκηά πν φπ κ υπδυν σ κυμ υπκοβφέκυμ. ΕΛ 4ης Α 5 ΕΛΙ Ε

50 Α ΧΗ 5ης ΕΛΙ Α 10. Δυνα σ β α απκξυλβσβμ: Mέα υλα η Ϊ βν Ϋναλιβ κυ ξλσνκυ ιϋ ασβμ. 11. Η δϊλε δα ιϋ ασβμ εαδ κ ξλσνκμ υνα άμ απκξυλβσβμ θα αθαγλαφοτθ σ κν πέναεα βμ αέγκυσαμ. ΚΑΛΗ ΠΙΣΤΧΙΑ Σ ΛΟ ΜΗΝΤΜΑΣΟ ΕΛ 5ης Α 5 ΕΛΙ Ε

51

52 Α ΧΗ 1Η ΕΛΙ Α Κ ΝΣΡΙΚΗ ΠΙΣΡΟΠΗ Ι ΙΚΩΝ ΜΑΘΗΜΑΣΩΝ ΛΛΗΝΩΝ ΞΩΣ ΡΙΚΟΤ ΠΑΡΑΚ ΤΗ 16 ΠΣ Μ ΡΙΟΤ 2011 Ξ ΣΑ ΟΜ ΝΟ ΜΑΘΗΜΑ: ΑΡΜΟΝΙΑ Δέν αδ β παλαεϊ π η λπ έα: ΗΣ ΙΣΑΙ: Να ναληκνδσγ έ β η λπ έα αυ ά σ Ϋσσ λδμ (4) φπνϋμ. ΕΛ 1Η Α 4 ΕΛΙ Ε

53 Α ΧΗ 2Η ΕΛΙ Α Ι ΤΚΡΙΝΙ Ι Α. Η ναλησνδσβ βμ η λπ έαμ ηπκλ έ να ΰλαφ έ σ τκ π ν Ϊΰλαηηα η τκ ελ δ δϊ εα Ϊ κν (α) ά (ί) λσπκ, αλλϊ σξδ η ανϊη διά κυμ (ίλϋπ κ παλαεϊ π παλϊ δΰηα). ΠαλΪ δΰηα: Η αναΰλαφά ίαγηέ πν η λα δνδεκτμ ά Ϊλλκυμ συηίκλδσηκτμ ν έναδ υπκξλ π δεά.. Η ξλβσδηκπκέβσβ υνα κ ά πν ναλησνδσβμ βμ η λπ έαμ, πκυ έναδ πδπλϋκν κυ υπκξλ π δεκτ αληκνέαμ, πδ λϋπ αδ. Γ. Π λδσσσ λ μ απσ ηέα ναληκνέσ δμ βμ η λπ έαμ ά ηβηϊ πν βμ θ πδ λϋπκν αδ.. Κα Ϊ βν ναλησνδσβ βμ η λπ έαμ, λϊί υπσοβ σ δ: - Κίθβ β φωθώθ: β κσηϋνβ η λπ έα ηπ λδϋξ δ ιϋνκυμ φγσΰΰκυμ ( δαία δεκτμ, πκδεέληα α, εαγυσ λάσ δμ, ελπ.) εαδ, εα Ϊ β δαησλφπσβ πν Ϊλλπν λδυν φπνυν, ηπκλ έ εαδ σ έμ να εϊν αν έσ κδξβ ξλάσβ ιϋνπν φγσΰΰπν. - Λ δ ουλγδεό β α αληοθδεώθ υθ Ϋ ωθ: α) σ α σβη έα σπκυ β η λπ έα φαέν αδ να κ βΰ έ αδ σ π υσβ να ηφανέακν αδ α εα Ϊλλβλα π π δεϊ σξάηα α, ί) β αλλβλκυξέα πν συΰξκλ δυν γα πλϋπ δ να έναδ λκΰδεά στηφπνα η κυμ εανσν μ βμ κνδεάμ αληκνέαμ. Δβλα ά, εϊγ συΰξκλ έα γα πλϋπ δ να πλκετπ δ απσ βν πλκβΰκτη νβ εαδ να κ βΰ έ σ βν πση νβ ( ν ξκηϋνπμ, σξδ απαλαέ β α η Ϋναν εαδ ηκνα δεσ λσπκ). ΕΛ 2Η Α 4 ΕΛΙ Ε

54 Α ΧΗ 3Η ΕΛΙ Α - Αληοθδεόμ λυγηόμ: β συξνσ β α ναλλαΰάμ πν συΰξκλ δυν εαδ β ξλκνδεά κυμ δϊλε δα πλκετπ κυν απσ βν έ δα β η λπ έα. - υθοζδεά δεόθα: συν ε δηϊ αδ εαδ β ΰ νδεά ηκυσδεά βηδκυλΰδεσ β α.. Γδα πλσξ δλκ ηπκλκτν να ξλβσδηκπκδβγκτν κδ Ϋσσ λδμ (4) λ υ αέ μ σ λέ μ κυ λα έκυ. ΚΑΝΟΝ Οδ ελυηηϋν μ πϋηπ μ εαδ σΰ κ μ πδ λϋπκν αδ: α) η αιτ πν τκ ιπ λδευν φπνυν, σ αν β κιτ λβ (οβλσ λβ) φπνά πλκξπλ έ εα Ϊ δϊσ βηα υ Ϋλαμ. ί) σ εϊγ π λέπ πσβ, η αιτ ιπ λδευν εαδ σπ λδευν ά η αιτ σπ λδευν φπνυν. ΠΫηπ μ εαδ σΰ κ μ αν δπαλϊλλβλ μ απαΰκλ τκν αδ η αιτ πν τκ ιπ λδευν φπνυν, αλλϊ πδ λϋπκν αδ η αιτ ιπ λδεάμ εαδ σπ λδεάμ φπνάμ ά η αιτ τκ σπ λδευν φπνυν. Κα Ϊ α Ϊλλα δσξτ δ σ, δ π λδλαηίϊν δ β τλβ κυ υπκξλ π δεκτ αληκνέαμ. ΚΡΙΣΗΡΙΑ ΑΞΙΟΛΟΓΗΗ 1. Κένβσβ φπνυν: 20/ Λ δ κυλΰδεσ β α αληκνδευν συν Ϋσ πν: 50/ Αληκνδεσμ λυγησμ: 20/ υνκλδεά δεσνα: 10/100 ΕΛ 3Η Α 4 ΕΛΙ Ε

55 Α ΧΗ 4Η ΕΛΙ Α Ο ΗΓΙ 1. κ λϊ δκ να ΰλαφκτν β βη λκηβνέα εαδ κ ι ααση νκ ηϊγβηα. 2. κ λϊ δκ γα αν δΰλαφ έ ησνκ κ γϋηα (η λπ έα). 3. Οδ υπκοάφδκδ, πλδν αλξέσκυν να ΰλΪφκυν, πλϋπ δ να δαίϊσκυν πλκσ ε δεϊ δμ Ι ΤΚΡΙΝΙ Ι εαδ κυμ ΚΑΝΟΝ. 4. Μ Ϊ βν αναπαλαΰπΰά κυ γϋηα κμ να δαν ηβγ έ σ κυμ υπκοβφέκυμ απσ ηέα φπ κ υπέα εαδ πν σσϊλπν (4) σ λέ πν. 5. Οδ υπκοάφδκδ πδσ λϋφκυν δμ φπ κ υπέ μ σ κυμ πδ βλβ Ϋμ εα Ϊ βν απκξυλβσά κυμ. 6. Τκ γϋηα θ γα εφπνβγ έ εαδ θ γα ΰλαφ έ σ κν πέναεα. 7. Να ΰλΪο δμ απαν άσ δμ σαμ ησνκ η ηπλ ά ηατλκ σ υλσ δαλε έαμ εαδ ησνκ αν ιέ βλβμ η λϊνβμ. 8. ΔδΪλε δα ιϋ ασβμ: Τλ δμ (3) υλ μ. Έναλιβ ξλσνκυ ιϋ ασβμ: ΑηΫσπμ η Ϊ β δανκηά πν φπ κ υπδυν σ κυμ υπκοβφέκυμ. Χλσνκμ υνα άμ απκξυλβσβμ: Η δϊλε δα ιϋ ασβμ εαδ κ ξλσνκμ υνα άμ απκξυλβσβμ να αναΰλαφκτν σ κν πέναεα. ΚΑΛΗ ΠΙΣΤΧΙΑ Σ ΛΟ ΜΗΝΤΜΑΣΟ ΕΛ 4Η Α 4 ΕΛΙ Ε

56 Α ΧΗ 1Η ΕΛΙ Α ΚΕΝΣΡΙΚΗ ΕΠΙΣΡΟΠΗ ΕΞΕΣΑΣΕΩΝ ΕΙ ΙΚΩΝ ΜΑΘΗΜΑΣΩΝ ΕΛΛΗΝΩΝ ΕΞΩΣΕΡΙΚΟΤ ΣΕΣΑΡΣΗ 14 ΣΕΠΣΕΜ ΡΙΟΤ 2011 ΕΞΕΣΑ ΟΜΕΝΟ ΜΑΘΗΜΑ: ΕΛΕΓΧΟΣ ΜΟΤΣΙΚΩΝ ΑΚΟΤΣΣΙΚΩΝ ΙΚΑΝΟΣΗΣΩΝ ΤΝΟΛΟ ΛΙ ΩΝ ENNEA (9) ΟΜΑ Α Α: ΑΝΑΓΝΩΡΙΗ Μ ΛΩ ΙΚΩΝ ΙΑΣΗΜΑΣΩΝ Θα αεκτσ, ΰδα εϊγ ηδα απσ δμ παλαεϊ π λπ άσ δμ Α1 Ϋπμ Α4 κν φγσΰΰκαφ βλέα εαδ κ η λπ δεσ δϊσ βηα, α κπκέα γα παναλβφγκτν Ϊλλ μ τκ φκλϋμ. Να πδλϋι πκδα απσ δμ πϋν απαν άσ δμ, πκυ ένκν αδ σ εϊγ λυ βσβ, αν δσ κδξ έ σ κ η λπ δεσ δϊσ βηα πκυ αεκτσ βε. Να ΰλΪο σ κ λϊ δσ σαμ κν αλδγησ βμ λυ βσβμ εαδ έπλα κ ΰλΪηηα, κ κπκέκ αν δσ κδξ έ σ β σπσ ά απϊν βσβ. λώ β β Α1: α Πλυ β Καγαλά (Ταυ κφπνέα) ί Δ υ Ϋλα Μδελά ΰ Δ υ Ϋλα Μ ΰΪλβ Τλέ β Μδελά ΤΫ αλ β Καγαλά (5 ΜοθΪ μ ) λώ β β Α2: α Δ τ λβ Μδελά ί Τλέ β Μ ΰΪλβ ΰ ΤΫ αλ β ΑυιβηΫνβ ΠΫηπ β Καγαλά Έε β Μδελά (5 ΜοθΪ μ) ΕΛ 1Η Α 9 ΕΛΙ Ε

57 Α ΧΗ 2Η ΕΛΙ Α λώ β β Α3: α Τλέ β Μδελά ί Τλέ β Μ ΰΪλβ ΰ ΤΫ αλ β Καγαλά ΠΫηπ β λα πηϋνβ Έί κηβ λα πηϋνβ λώ β β Α4: α Δ τ λβ Μ ΰΪλβ ί ΤΫ αλ β Καγαλά ΰ ΠΫηπ β Καγαλά ΠΫηπ β ΑυιβηΫνβ Έε β Μ ΰΪλβ (5 ΜοθΪ μ) (5 ΜοθΪ μ) ΟΜΑ Α : ΑΝΑΓΝΩΡΙΗ ΤΓΧΟΡ ΙΩΝ Θα αεκτσ ηδα συΰξκλ έα, β κπκέα γα παναλβφγ έ Ϊλλ μ τκ φκλϋμ ΰδα εϊγ ηδα απσ δμ παλαεϊ π λπ άσ δμ 1 Ϋπμ 4. Να πδλϋι πκδα απσ δμ πϋν απαν άσ δμ, πκυ ένκν αδ σ εϊγ λυ βσβ, αν δσ κδξ έ σ κ έ κμ συΰξκλ έαμ πκυ αεκτσ βε. Να ΰλΪο σ κ λϊ δσ σαμ κν αλδγησ βμ λυ βσβμ εαδ έπλα κ ΰλΪηηα, κ κπκέκ αν δσ κδξ έ σ β σπσ ά απϊν βσβ. Δδ υελδνέα αδ σ δ: α) Οδ συΰξκλ έ μ ε λκτν αδ σ ελ δσ ά γϋσβ. ί) Όπκυ ν υπκ βλυν αδ ανασ λκφά, β συΰξκλ έα ε λ έ αδ σ υγ έα εα Ϊσ ασβ. λώ β β 1: α Μ έακνα ί λϊσσκνα ΰ Μ έακνα σ Πλυ β Ανασ λκφά λϊσσκνα σ Πλυ β Ανασ λκφά λα πηϋνβ (5 ΜοθΪ μ) ΕΛ 2Η Α 9 ΕΛΙ Ε

58 Α ΧΗ 3Η ΕΛΙ Α λώ β β 2: α Μ έακνα ί λϊσσκνα ΰ λϊσσκνα σ Πλυ β Ανασ λκφά Μ έακνα η Έί κηβ Μδελά ΑυιβηΫνβ (5 ΜοθΪ μ) λώ β β 3: α Μ έακνα η Έί κηβ Μδελά ί λϊσσκνα ΰ Μ έακνα η Ένα β Μδελά λϊσσκνα η Έί κηβ Μδελά λα πηϋνβ (5 ΜοθΪ μ) λώ β β 4: α Μ έακνα ί λϊσσκνα ΰ Μ έακνα σ Πλυ β Ανασ λκφά Μ έακνα σ Δ τ λβ Ανασ λκφά Μ έακνα η Έί κηβ Μ ΰΪλβ (5 ΜοθΪ μ) ΟΜΑ Α Γ: ΑΝΑΓΝΩΡΙΗ ΙΑ ΟΧΗ ΤΓΧΟΡ ΙΩΝ Θα αεκτσ ηδα δα κξά συΰξκλ δυν, β κπκέα γα παναλβφγ έ Ϊλλ μ τκ φκλϋμ ΰδα εϊγ ηδα απσ δμ παλαεϊ π λπ άσ δμ Γ1 Ϋπμ Γ4. Να πδλϋι πκδα απσ δμ πϋν απαν άσ δμ, πκυ ένκν αδ σ εϊγ λυ βσβ, αν δσ κδξ έ σ β δα κξά συΰξκλ δυν πκυ αεκτσ βε. Να ΰλΪο σ κ λϊ δσ σαμ κν αλδγησ βμ λυ βσβμ εαδ έπλα κ ΰλΪηηα, κ κπκέκ αν δσ κδξ έ σ β σπσ ά απϊν βσβ. ΕΛ 3Η Α 9 ΕΛΙ Ε

59 Α ΧΗ 4Η ΕΛΙ Α λώ β β Γ1: α I ΙΙ 6 I 6 4 V7 I 6 ί I II 5 I 6 V I 4 ΰ I ΙΙΙ ΙV V 7 I I V VΙ V 7 VI I II 7 IV V VI (5 ΜοθΪ μ) λώ β β Γ2: α I III IV V 7 I ί I V/IV IV V 7 I ΰ I VI IV V 7 /V V I III IV V 7 /V V I VI IV VI V λώ β β Γ3: α I II 6 b (N) I V I (5 ΜοθΪ μ) ί ΰ 6 I II 5 I 6 V I 4 I II 6 b (N) I 6 4 V7 VI I V 7 /V I 6 4 V7 VI I II 6 I 6 4 V VI (5 ΜοθΪ μ) λώ β β Γ4: α I I 2 V 7 /V V 7 I 3# ί I I 2 VI 7 V 7 I ΰ I V 7 /IV IV V 7 I 3# I VI 7 IV 6 5 # (Γ λη.) V 7 I I I 2 IV 6 5 # (Γ λη.) V 7 I 3# (5 ΜοθΪ μ) ΕΛ 4Η Α 9 ΕΛΙ Ε

60 Α ΧΗ 5Η ΕΛΙ Α ΟΜΑ Α : ΑΝΑΓΝΩΡΙΗ Μ ΣΡΟΤ ΚΑΙ ΡΤΘΜΙΚΩΝ ΧΗΜΑΣΩΝ Θα αεκτσ δα κξϋμ δαφκλ δευν λυγηδευν αιδυν, πκυ συΰελκ κτν φλϊσ δμ σσϊλπν Ϋπμ Ϋιδ ηϋ λπν εαδ κδ κπκέ μ γα παναλβφγκτν Ϊλλ μ τκ φκλϋμ ΰδα εϊγ ηδα απσ δμ παλαεϊ π λπ άσ δμ 1 Ϋπμ 3. Να πδλϋι πκδα απσ δμ πϋν απαν άσ δμ, πκυ ένκν αδ σ εϊγ λυ βσβ, αν δσ κδξ έ σ βν Ϋν διβ πν λυγηδευν αιδυν πκυ αεκτσ βεαν. Να ΰλΪο σ κ λϊ δσ σαμ κν αλδγησ βμ λυ βσβμ εαδ έπλα κ ΰλΪηηα, κ κπκέκ αν δσ κδξ έ σ β σπσ ά απϊν βσβ. Οδ δα οχϋμ γα αεου οτθ η οθδ ηοτμ α δ χυλϊ εαδ α η λίωμ δ χυλϊ ηϋλβ ωθ ηϋ λωθ. λώ β β 1: α 2/4 ί 3/4 ΰ 4/4 6/8 7/8 (5 ΜοθΪ μ) λώ β β 2: α 3/8 ί 5/8 ΰ 4/4 7/8 9/8 (5 ΜοθΪ μ) λώ β β 3: α 9/8 ί 7/8 ΰ 2/4 4/4 3/4 (5 ΜοθΪ μ) ΕΛ 5Η Α 9 ΕΛΙ Ε

61 Α ΧΗ 6Η ΕΛΙ Α λώ β β 4: Θα αεκτσ ηδα δα κξά λυγηδευν αιδυν, β κπκέα γα παναλβφγ έ Ϊλλ μ τκ φκλϋμ. Να αυ έσ β δα κξά λυγηδευν αιδυν, πκυ αεκτσα, η ηδα απσ δμ παλαεϊ π πϋν πδλκΰϋμ. Να ΰλΪο σ κ λϊ δσ σαμ κν αλδγησ βμ λυ βσβμ 4 εαδ έπλα κ ΰλΪηηα η κ κπκέκ αυ έσα β δα κξά λυγηδευν αιδυν πκυ αεκτσ βε. (5 ΜοθΪ μ) ΕΛ 6Η Α 9 ΕΛΙ Ε

62 Α ΧΗ 7Η ΕΛΙ Α ΟΜΑ Α : ΑΝΑΓΝΩΡΙΗ ΣΑΤΣΙΗ Μ ΛΩ ΙΩΝ Θα αεκτσ ηέα ηκνκφπνδεά η λπ έα, πκυ γα παναλβφγ έ Ϊλλ μ τκ φκλϋμ ΰδα εϊγ ηδα απσ δμ παλαεϊ π λπ άσ δμ 1 Ϋπμ 4. Να αναΰνπλέσ εαδ να αυ έσ β η λπ έα, πκυ γα αεκτσ, η ηδα απσ δμ πϋν πδλκΰϋμ απϊν βσβμ πκυ έ κν αδ σ εϊγ λυ βσβ. Να ΰλΪο σ κ λϊ δσ σαμ κν αλδγησ βμ λυ βσβμ εαδ έπλα κ ΰλΪηηα η κ κπκέκ αυ έσα β η λπ έα πκυ αεκτσ βε. λώ β β 1: (5 ΜοθΪ μ) ΕΛ 7Η Α 9 ΕΛΙ Ε

63 Α ΧΗ 8Η ΕΛΙ Α λώ β β 2:. (5 ΜοθΪ μ) λώ β β 3:. (5 ΜοθΪ μ) ΕΛ 8Η Α 9 ΕΛΙ Ε

64 Α ΧΗ 9Η ΕΛΙ Α λώ β β 4: (5 ΜοθΪ μ) ΚΑΛΗ ΕΠΙΣΤΧΙΑ ΣΕΛΟΣ ΜΗΝΤΜΑΣΟΣ ΕΛ 9Η Α 9 ΕΛΙ Ε

65 ΑΡΧΗ ΛΙ Α 1 ΤΠΟΤΡΓΕΙΟ ΠΑΙ ΕΙΑΣ, ΙΑ ΙΟΤ ΜΑΘΗΣΗΣ ΚΑΙ ΘΡΗΣΚΕΤΜΑΣΩΝ ΚΕΝΣΡΙΚΗ ΕΠΙΣΡΟΠΗ ΕΞΕΣΑΣΕΩΝ ΕΙ ΙΚΩΝ ΜΑΘΗΜΑΣΩΝ ΕΛΛΗΝΩΝ ΕΞΩΣΕΡΙΚΟΤ ΕΞΕΣΑΣΗ ΣΩΝ ΤΠΟΨΗΦΙΩΝ ΣΣΗΝ ΙΣΑΛΙΚΗ ΓΛΩΣΣΑ Τ 14 π β υ 2011 ΗΓ Γ ΨΗΦ KAI ΨΗΦ 1. Να απα α α α α α α υ α α, : Να γ α υ α α γ α π υ α απ, π.. 5. c Να γ α υ α α Να γ α υ α α α π Να γ α υ α α γ α π υ α φ, π e Γ. Να α απ α α α α γ γ α- φ. 2. Να π π α υ α α α α. α π υ α! Δ α α : Τ (3) ώ Έ α χ ό υ α : Α ω α ω ω Δυ α ό α απ χώ : ΛΙ Α 1 ΑΠΟ 5

66 ΑΡΧΗ ΛΙ Α 2 ΚΕΙΜΕΝΟ Rapporti fra compagni di scuola Andare a scuola è bello innanzitutto perché ci sono i compagni. È bello poter parlare insieme, discutere, confrontarsi, mandarsi i bigliettini, gli sms, le foto, le gite scolastiche, gli amori, le emozioni degli sguardi, il copiare, il suggerire... E poi c è tutto il mondo fuori dalla scuola, gli incontri a casa, i compiti fatti insieme, le feste di compleanno... Certo le cose non vanno sempre così bene, lo sappiamo che a stare insieme tutti i giorni possono sorgere delle incomprensioni. E tu come ti trovi con i tuoi compagni? E loro come pensi che si trovino con te? Ci sono compagni a cui ti piacerebbe assomigliare? La relazione con i compagni di scuola è una relazione alla pari proprio perché si caratterizza per essere simmetrica (parità di età) e per essere reciproca (parità di ruoli, di diritti, di doveri). È una relazione che si definisce attraverso i diversi gradi di amicizia con i propri coetanei, partendo dall essere semplicemente inseriti nella stessa classe fino ad arrivare con qualcuno all amicizia profonda del "raccontarsi proprio tutto". E quando sorgono dei problemi? Vediamo innanzitutto come possiamo descriverli. Ti senti un po solo in mezzo ai tuoi compagni di scuola? Ti senti deluso o arrabbiato? È possibile trovarsi in questi stati d animo, siamo consapevoli che nelle relazioni con gli altri vi possono essere momenti di crisi. Quindi se ci sono difficoltà che cosa fare? Un primo suggerimento è di partire dalla convinzione ottimistica che è sempre possibile un cambiamento. Tuttavia è importante sapere che il cambiamento deve sempre partire da noi stessi; finché ci aspettiamo che qualcun altro faccia il primo passo niente accadrà. Incomincia quindi a osservare il tuo modo di comunicare e di porti in relazione con gli altri; guarda in quanti altri modi si relazionano i tuoi compagni e prova anche solo per gioco a imitarne alcuni. Un ulteriore suggerimento è di stare in ascolto di ciò che hai dentro e parlarne con gli amici. Proponi ai tuoi amici di fare ogni tanto un po di circle time, cioè un "gioco" in cui ci si siede in cerchio e ognuno parla per qualche minuto e condivide i propri dubbi, paure, problemi, ma anche le proprie esperienze positive, mentre gli altri ascoltano con il massimo rispetto, senza giudicare. ΛΙ Α 2 ΑΠΟ 5

67 Α. ΚΑΣΑΝΟΗΣΗ ΓΡΑΠΣΟΤ ΛΟΓΟΤ ΑΡΧΗ ΛΙ Α 3 A1. Leggete il testo e rispondete alle seguenti domande. Ogni risposta non deve contenere più di 20 parole. (4 x 3 punti = 12 punti) 1. Che cosa è bello fare con i compagni di scuola? 2. Cosa possono fare i compagni di classe fuori dalla scuola? 3. Perché la relazione con i compagni di scuola è una relazione alla pari? 4. Che cosa è il circle-time? Α2. Tenendo in considerazione il contenuto del testo, segnate la lettera (a, b o c) corrispondente all affermazione corretta tra quelle proposte. (6 x 3 punti = 18 punti) 5. Andare a scuola è bello perché ci sono i a. voti. b. com pagni. c. com piti. 6. Con i com pagni è bello a. litigare. b. confrontarsi. c. scontrarsi. 7. I gradi di am icizia che nasce tra com pagni di scuola sono a. diversi. b. uguali. c. inesistenti. 8. I coetanei hanno più o m eno gli stessi a. am ici. b. abiti. c. anni. 9. Che sia possibile un cam biam ento è una convinzione a. ottim istica. b. inaccettabile. c. pessim istica Bisogna parlare di ciò che abbiam o dentro con a. i nem ici. b. gli am ici. c. i bidelli. ΛΙ Α 3 ΑΠΟ 5

68 ΑΡΧΗ ΛΙ Α 4 B. ΓΛΩΣΣΙΚΗ ΕΠΙΓΝΩΣΗ 1. Completate le seguenti frasi, scegliendo una sola parola tra quelle date per ogni spazio. Attenzione! Ci sono due parole in più. (5 x 2 punti = 10 punti) nessuno niente pure rosso ultimo qualunque dunque 1 1. cosa accada, non perdere il tuo coraggio Non c era proprio che volesse diffendermi L terremoto ha provocato danni in tutta la zona Per questa volta andate! 1 5. Ha bevuto da solo una bottiglia di vino. B2. Completate le seguenti frasi, mettendo il verbo tra parentesi nella forma conveniente. (5 x 2 punti = 10 punti) 1 6. Ieri, io (girare) tutta la città, per trovare una farmacia aperta Ragazzi, (andare) a dormire subito! È già molto tardi Carlo, (non rispondere) in quel modo! 1 9. Quando è arrivato all aeroporto, Mario si è accorto che non (avere) il passaporto Credo che loro (mangiare) abbastanza. ΛΙ Α 4 ΑΠΟ 5

69 ΑΡΧΗ ΛΙ Α 5 3. Rimettete le seguenti frasi nell ordine adatto, affinché si ricostituisca il testo nella sua forma iniziale. Indicate la lettera (a, b, c, d o e) che segna l ordine di ogni frase nel testo da cui è tratta. (5 x 2 punti = 10 punti) Consiglio: viaggio a Malta dopo la m aturità? a b c d e 2 1. Grazie in anticipo, aspetto risposte con ansia Ho pensato di andare a Malta e sapete perché? Volevo sapere da voi quale sarebbe il m iglior periodo per andarci e se è giusta o meno la mia scelta. Perché offre più divertim ento per ragazzi diciottenni Avevo intenzione di fare un viaggio all estero. Γ. ΠΑΡΑΓΩΓΗ ΓΡΑΠΣΟΤ ΛΟΓΟΤ Scrivete un testo in italiano ( parole) sul tema seguente: (40 punti) Hai cam biato ultim am ente casa. Scrivi un e-m ail a un tuo am ico / una tua am ica, in cui: a) Gli / Le descrivi la tua nuova casa. b) Gli / Le presenti due vantaggi e due svantaggi che la caratterizzano. Non firm are il testo! Σ ΛΟ ΜΗΝΤΜΑΣΟ ΛΙ Α 5 ΑΠΟ 5

70 ΑΡΧΗ Σ ΛΙ ΑΣ 1 ΣΟΞΣΠΓ ΘΞ Ο Θ Θ Ρ, Θ ΘΞΣ Λ ΘΗΡΗΡ Ι Θ ΘΠΗΡΙ ΣΛ ΩΜ Ι ΜΠΘΙΗ ΟΘΠΞΟΗ Ν Ρ ΩΜ Θ ΘΙΩΜ Λ ΘΗΛ ΩΜ ΚΚΗΜΩΜ ΝΩ ΠΘΙΞΣ Η Ν ΨΗΦ Ν Η Γ Ν Η Γ 13 Σεπτεμβρίου 2011 ΗΓ Γ / ΨΗΦ / 1. Να απα α α α α α α υ α α, : Να γ α υ α α γ α π υ α απ, π.. 4 C Να γ α υ α α Να γ α υ α α Να α α υ α γ α, π Γ. Να α απ α α α α γ γ α- φ. 2. Να π π α υ α α α α. Δ α α : Τ (3) ώ α π υ α Έ α χ ό υ α : Α ω α ω ω Δυ α ό α απ χώ : Σ ΛΙ Α 1 ΑΠΟ 5

71 ΑΡΧΗ Σ ΛΙ ΑΣ 2 ΚΕΙΜΕΝΟ Bewegung macht schlau Bewegung ist ein angeborenes Grundbedürfnis. Sich nach einem langen Tag in der Schule mal richtig auszutoben dazu muss man Kinder normalerweise nicht überreden. Der Drang, den Körper nach einer Phase des Stillsitzens wieder in Schwung zu bringen, steckt in jedem von uns. Lydia Riepe, Sportwissenschaftlerin der Universität Paderborn, erklärt: Wir drücken uns vor allem am Anfang des Lebens ausschließlich über unseren Körper aus, machen die ersten angenehmen und anregenden Erfahrungen über uns selbst und unsere Umwelt durch Körper und Stimme. Dieses positive Erleben verankert sich früh im motorischen Gedächtnis. Wenn wir später Sport treiben, kehren wir quasi zum Ursprung unserer Selbstentwicklung und in einen Zustand des körperlichen Umgangs mit der Welt zurück. Mehr Sport, weniger Stress, bessere Laune. Bewegung baut Stresshormone ab. Ein inzwischen relativ bekannter Effekt: Die Produktion von Adrenalin sinkt und körpereigene Glücksstoffe die berühmten Endorphine werden produziert. Eltern, die ihre Kinder nachmittags zum Toben nach draußen schicken, wissen, wie sehr Bewegung den schulischen Druck reduzieren und die Laune heben kann. Wie wichtig regelmäßige Bewegung im TV- und Computerzeitalter ist, um Übergewicht bei Heranwachsenden zu vermeiden, haben Gesundheitsexperten deutlich gemacht. Darüber hinaus belegen immer mehr Studien die positiven Auswirkungen sportlicher Betätigung sowohl für die Gewichtsregulation als auch für die geistige Entwicklung. Man hat festgestellt, dass bei Bewegung nicht nur in den Muskeln, sondern auch im Gehirn die Durchblutung verbessert wird, sagt Martin Korte, Biologe der Technischen Universität Braunschweig und Experte für Lernen und Gedächtnis. Dadurch steigt die Konzentrationsfähigkeit an. Außerdem werden beim Sport spezielle Hirnzentren angeregt, die in direktem Austausch mit dem Sprachzentrum oder dem Gedächtnis stehen. Dabei wird Dopamin verwendet, ein Stoff, der unser Gedächtnis aktiviert und unsere Motivation anregt. Das bedeutet: Schüler, die regelmäßig körperlich aktiv sind, stärken neben der Konzentration gleichzeitig auch ihre Lernfähigkeit und die Lust am Lernen. Tierversuche weisen zusätzlich darauf hin, dass Sport wie Laufen das Gehirn dabei unterstützt, neue Verknüpfungen zu bilden und so seine Kapazität auszuweiten. Beim Menschen vermutet man einen ähnlichen Effekt, der allerdings noch nicht nachgewiesen werden konnte. nach:http://www.focus.de/schule Σ ΛΙ Α 2 ΑΠΟ 5

72 ΑΡΧΗ Σ ΛΙ ΑΣ 3 Α. ΚΑΣΑΝΟΗΣΗ ΓΡΑΠΣΟΤ ΛΟΓΟΤ A1. Lesen Sie den Text und geben Sie anschließend auf die Fragen 1-3 eine kurze Antwort (max. 20 Wörter pro Antwort). 1. Worum handelt es sich in diesem Text? 2. Was beabsichtigt der Autor mit diesem Text? 3. Für wen könnte dieser Text besonders interessant sein? 3 x 4 Punkte = 12 Punkte Α2. Lesen Sie den Text noch einmal und kreuzen Sie die richtige Antwort (A, B oder C) an. 4. Der Drang nach Bewegung ist ein Grundbedürfnis... Α. für alle.. ausschließlich für Kinder. C. nur für Heranwachsende. 5. Babys äußern ihre Bedürfnisse A. beim Austoben. B. eigenartig. C. über Körpersprache und Laute. 6. Wer mehr Sport treibt, ist... A. weniger gestresst. B. launisch. C. überfordert. 7. Der Körper produziert Stoffe, die für... verantwortlich sind. A. Angst. B. Glück. C. Stress. 8. Dopamin ist ein Stoff, der A. aktiviert und motiviert. B. attraktiv macht. C. lustig macht. 9. Beobachtungen bei Tieren haben gezeigt, dass Bewegung die Gehirnfunktion... A. reduziert. B. hemmt. C. fördert. 6 x 3 Punkte = 18 Punkte Σ ΛΙ Α 3 ΑΠΟ 5

73 ΑΡΧΗ Σ ΛΙ ΑΣ 4 B. ΓΛΩΣΣΙΚΗ ΕΠΙΓΝΩΣΗ B1. Ergänzen Sie in den Sätzen das richtige Wort (A-G). Zwei Wörter bleiben übrig. A. Erfolg B. Aktivitäten C. Gedächtnis D. Forderung E. Förderung F. Bedarf G. Bedürfnis 10. Das sich zu bewegen, ist natürlich. 11. Darum verankern sich positive Erlebnisse in unserem. 12. Sportliche beeinflussen unsere Körpersysteme. 13. Sport führt zu gutem Aussehen und zum schulischen. 14. Diese Tatsachen führen zur der Lernfähigkeit. 5 x 2 Punkte = 10 Punkte B2. Ergänzen Sie in den Sätzen die fehlenden Präpositionen. 15. Kinder beschäftigen sich lange dem Computer. 16. Dabei haben sie weniger Zeit, sich ihre Freunde zu kümmern. 17. Eltern berichten gern die Erfolge ihrer Kinder. 18. Wissenschaftler sind Untersuchungen interessiert. 19. Sich die Aufgaben zu konzentrieren, fällt vielen Schülern schwer. 5 x 2 Punkte = 10 Punkte Σ ΛΙ Α 4 ΑΠΟ 5

74 ΑΡΧΗ Σ ΛΙ ΑΣ 5 B3. Verbinden Sie die Satzteile der linken Spalte (20-24) mit den Satzteilen der rechten Spalte (A-E), so dass ein korrekter Satz entsteht. 20. Bewegung macht glücklich,... A. dass Sport Gehirnverbindungen begünstigt. 21. Tierversuche haben erwiesen,... B. sitzt er lange vor dem Fernsehen und dem Computer. 22. Wenn Adrenalin sinkt, C. sich zu konzentrieren, kann durch 23. Obwohl der Mensch von Natur aus Bewegung braucht, Bewegung verbessert werden. D. indem dabei Hormone abgebaut werden. 24. Die Fähigkeit E. produziert der Körper Endorphine. 5 x 2 Punkte = 10 Punkte Γ. ΠΑΡΑΓΩΓΗ ΓΡΑΠΣΟΤ ΛΟΓΟΤ Sie lesen in der Zeitung einen Artikel mit dem Titel Junge Akademiker wandern aus. Schreiben Sie an die Redaktion der Zeitung einen Leserbrief von ca Wörtern, in dem Sie sich auf folgende Punkte beziehen: Was führt junge Akademiker ins Ausland? Nennen Sie zwei Gründe dafür! Würden Sie persönlich ins Ausland ziehen, um dort zu arbeiten? Begründen Sie Ihre Meinung, indem Sie zwei Argumente angeben. Unterschreiben Sie als A. Grigoriou. 40 Punkte ΗΝ Σ ΛΙ Α 5 ΑΠΟ 5

75 Α ΧΗ ΣΕΛΙ ΑΣ 1 ΣΟΞΣΠΓ ΘΞ Ο Θ Θ Ρ, Θ ΘΞΣ Λ ΘΗΡΗΡ Ι Θ ΘΠΗΡΙ ΣΛ ΩΜ Ι ΜΠΘΙΗ ΟΘΠΞΟΗ Ν Ρ ΩΜ Θ ΘΙΩΜ Λ ΘΗΛ ΩΜ ΚΚΗΜΩΜ ΝΩ ΠΘΙΞΣ Η Ν ΨΗΦ Ν Η Γ Η Γ 16 Σεπτεμβρίου 2011 ΗΓ Γ ΨΗΦ KAI ΨΗΦ 1. Να απα α α α α α α υ α α, : Να γ α υ α α γ α π υ α απ, π.. 4 A Να γ α υ α α Να γ α υ α α Να γ α υ α α γ α π υ α απ, π F Γ. Να α απ α α α α γ γ α- φ. 2. Να π π α υ α α α α. α π υ α Δ α α : Τ (3) ώ Έ α χ ό υ α : Α ω α ω ω Δυ α ό α απ χώ : 17: 00 ΣΕΛΙ Α 1 Α 5

76 Α ΧΗ ΣΕΛΙ ΑΣ 2 Ν Lisez le texte et répondez aux questions des activités A1 et A2. La Fête du Livre de Saint-Étienne À la fois littéraire et populaire, la Fête du Livre de Saint-Étienne stimule les échanges entre les auteurs invités et des visiteurs aux profils très diversifiés (public familial et lecteurs avertis). De nombreuses rencontres, débats et ateliers sont organisés en octobre, avec un effort tout particulier d accueil et d animation en direction des scolaires, auxquels une journée est spécialement dédiée. Durant sept jours, toute la ville de Saint-Étienne se transforme en une vaste librairie à ciel ouvert. Les auteurs, conférences-débats, tables rondes et cafés littéraires, rencontres, spectacles, expositions investissent tous les lieux emblématiques de la ville! La Grande Librairie située sur la place de l Hôtel de Ville accueille au sein d un espace de m² les quelques 350 auteurs invités qui représenteront plus de 130 maisons d édition nationales, régionales et locales. Au-delà des dédicaces d ouvrages, la Grande Librairie est par excellence le lieu d échange, de dialogue et de rencontre avec les auteurs présents. Le Village des Livres réunit quant à lui les bouquinistes, pour le plus grand plaisir de tous les passionnés de livres anciens à la recherche de la perle rare. Vous y retrouverez également l Espace Jeunesse, véritable centre névralgique du Village où de multiples activités seront proposées aux enfants : ateliers d illustrations, de coloriage, lectures de contes... À l Hôtel de Ville a lieu un grand nombre de conférences-débats qui ponctuent chaque année la Fête du Livre. La Fête du Livre de Saint-Étienne met cette année à l'honneur «la liberté». Brûlés, censurés, réprimés lorsque les libertés sont menacées, le livre et la lecture sont des catalyseurs incontestables de ce processus ; ils nous ouvrent à toutes les libertés: celles de la création et de l'expression pour les auteurs et les éditeurs, celles de l'émancipation pour leurs lecteurs. Le choix de consacrer cette 26e édition à la thématique «liberté» réaffirme une volonté d'inscrire la Fête du Livre de Saint-Étienne, sans laisser de côté sa dimension de détente et de rencontres très libres, au cœur de réflexions, de liens, de dialogues indispensables à notre présent et notre avenir commun. ΣΕΛΙ Α 2 Α 5

77 Α ΧΗ ΣΕΛΙ ΑΣ 3 Α. ΚΑΣΑΝΟΗΣΗ ΓΡΑΠΣΟΤ ΛΟΓΟΤ A1. Donnez une réponse courte (jusqu à 20 mots) pour chacune des questions suivantes. (3 x 4 points = 12 points) 1. D où ce texte est-il tiré? 2. À qui ce texte s adresse-t-il? 3. Dans quel but ce texte est-il rédigé? Α2. Pour chaque item, choisissez A, B ou C. 4. La Fête du Livre de Saint-Étienne a lieu (6 x 3 points = 18 points) A. au printem ps B. en hiver C. en autom ne 5. La Grande Librairie accueille environ A. 130 auteurs invités B. 350 auteurs invités C. 350 m aisons d édition 6. Dans l Espace Jeunesse, de m ultiples activités sont proposées A. aux bouquinistes B. aux enfants C. aux adultes 7. À l Hôtel de Ville, durant la Fête du Livre on peut assister à A. des réunions de professeurs B. des repas festifs C. des conférences-débats 8. Cette année la Fête du Livre a pour thèm e A. la liberté B. l écologie C. l ém ancipation des fem m es 9. La Fête du Livre de Saint-Étienne se prête, entre autres, à A. la gastronom ie B. la critique de film s C. la détente ΣΕΛΙ Α 3 Α 5

78 Α ΧΗ ΣΕΛΙ ΑΣ 4 B. ΓΛΩΣΣΙΚΗ ΕΠΙΓΝΩΣΗ 1. Choisissez le mot approprié, mettez-le à la bonne forme, puis complétez les phrases suivantes, comme dans l exemple. Attention, il y a un mot en trop. (5 x 2 points = 10 points) ouvrir collaborer retourner réserver sortir visiter exposer Exemple : Idées de sortie: des œuvres du peintre Paul Cézanne au musée du Luxembourg (octobre 2011 février 2012): Organisée en avec le Petit Palais, m usée des Beaux-Arts de la Ville de Paris, l réunit environ 80 œuvres m aj eures de Cézanne issues du m onde entier. 12. Date d : 12 octobre guidée pour les enfants de 8 à 12 ans. 14. de billets recom m andée. B2. Mettez les verbes entre parenthèses à la forme convenable. (5 x 2 points = 10 points) Hier, Maxim e (voir) Hélène qui ( prom ener) son chien. Les voitures roulent très vite. ( faire) attention quand vous traversez la rue. 18. Si j étais riche, je (voyager) aux États-Unis. 19. Nos grands parents souhaitent que nous (venir) les voir plus souvent. ΣΕΛΙ Α 4 Α 5

79 Α ΧΗ ΣΕΛΙ ΑΣ 5 3. Mettez les phrases suivantes dans le bon ordre afin de reconstituer le texte. L ordre des lettres représente l ordre des phrases dans le texte. (5 x 2 points = 10 points) Faire un séj our linguistique à l'étranger! A B C D E F G Déjà trois m ois que j e suis rentré en 4èm e m erveilleuse idée de dém énager pendant les vacances! Nouveau rougir dès que quelqu un essaie d établir le contact... à l aise au collège. Si seulem ent m es parents n avaient pas eu la collège, nouvelles têtes... Difficile de s intégrer quand on est du genre à 24. et je ne m e sens pas toujours Mais pourquoi je suis com m e ça? X X Γ. ΠΑΡΑΓΩΓΗ ΓΡΑΠΣΟΤ ΛΟΓΟΤ Rédigez un texte en français ( mots), en vous basant sur la consigne suivante: (40 points) Dans le cadre d une cam pagne lancée par la Mairie de votre ville sur l am élioration du niveau de vie des habitants, vous écrivez une lettre au Maire où vous m entionnez trois problèm es qui perturbent la vie de vos co-citoyens et où vous proposez une solution pour chaque problèm e. Signez votre lettre du nom de G. Vassiliou. ΣΕΛΟΣ ΜΗΝΤΜΑΣΟΣ ΣΕΛΙ Α 5 Α 5

80 Α ΧΗ ΣΕΛΙ ΑΣ 1 ΣΟΞΣΠΓ ΘΞ Ο Θ Θ Ρ, Θ ΘΞΣ Λ ΘΗΡΗΡ Ι Θ ΘΠΗΡΙ ΣΛ ΩΜ Ι ΜΠΘΙΗ ΟΘΠΞΟΗ Ν Ρ ΩΜ Θ ΘΙΩΜ Λ ΘΗΛ ΩΜ ΚΚΗΜΩΜ ΝΩ ΠΘΙΞΣ ΕΞΕΣΑΣΗ ΣΩΝ ΤΠΟΨΗΦΙΩΝ ΣΣΗΝ ΙΣΠΑΝΙΚΗ ΓΛΩΣΣΑ Π π, 15 π β υ 2011 ΗΓ Γ ΨΗΦ KAI ΨΗΦ 1. Να απα α α α α α α υ α α, : Να γ α υ α α γ α π υ α απ, π.. 4. A Να γ α υ α α γ α π υ α απ, π C Να γ α υ α α Να γ α φ α γ α π υ α απ, π E Γ. Να α απ α α α α γ γ α- φ. 2. Να π π α υ α α α α. α π υ α! Δ α α : Τ (3) ώ Έ α χ ό υ α : Α ω α ω ω Δυ α ό α απ χώ : 17: 00 ΣΕΛΙ Α 1 Α 5

81 Α ΧΗ ΣΕΛΙ ΑΣ 2 ΚΕΙΜΕΝΟ Los niños y los animales domésticos Los animales domésticos son parte de la vida de los niños. La participación de los padres, la discusión abierta y la planificación son necesarias para que la experiencia de tener un animal en casa sea positiva para todos. Un niño que aprende a cuidar de un animal y a tratarlo con cariño y con paciencia adquiere un aprendizaje invalorable de cómo tratar a las personas de igual manera. Por el contrario, el tratamiento inadecuado de los animales no es saludable ni para el animal ni para el niño. O sea que el cuidado de un animal doméstico puede ayudar a que los niños desarrollen destrezas sociales. Sin embargo, los padres deberían tener en cuenta lo siguiente: Los niños pequeños (menores de 3-4 años) no tienen la madurez para controlar sus impulsos de agresividad e irritabilidad, por lo que hay que observarlos cuando están con los animales domésticos. Los niños pre-adolescentes (menores de 10 años) en muy raras ocasiones pueden ser capaces de cuidar por su propia cuenta a un animal grande, como un gato o un perro. Los padres tienen que supervisar el cuidado del animal aunque ellos crean que su niño sea suficientemente maduro para cuidar del animal. Si el niño desatiende el cuido del animal, serán los padres los que asumirán la responsabilidad del cuidado. A los niños hay que recordarles con suavidad y no como que fuera un regaño, que los animales, al igual que las personas, necesitan alimento, agua y ejercicio. Si un niño continúa descuidando al animal, quizás se debería conseguir un nuevo hogar para el animal. Los padres son los modelos por excelencia para sus hijos. Los niños aprenden a ser los dueños responsables de un animal doméstico al observar el comportamiento de sus padres. Los niños que se crían junto a animales domésticos muestran muchos beneficios, pues desarrollar sentimientos positivos hacia un animal puede contribuir a la autoestima y la autoconfianza del niño. Los niños pueden sentir placer con toda clase de animales, pero es importante que se escoja el animal adecuado para su familia, su casa y su estilo de vida, a fin de que el niño pueda ayudar a cuidarlo. Los padres han de ser cautelosos y no escoger animales que sean agresivos. Recuerde que aún los animales domésticos que han sido adiestrados pueden ser agresivos. Por otra parte, los animales exóticos y poco comunes pueden ser difíciles de cuidar y tratar. (Texto adaptado.) ΣΕΛΙ Α 2 Α 5

ΕΞΕΤΑΣΗ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΗΝ ΙΣΠΑΝΙΚΗ ΓΛΩΣΣΑ

ΕΞΕΤΑΣΗ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΗΝ ΙΣΠΑΝΙΚΗ ΓΛΩΣΣΑ ΑΡΧΗ ΣΕΛΙ ΑΣ 1 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΚΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΕΞΕΤΑΣΕΩΝ ΕΙΔΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΕΛΛΗΝΩΝ ΕΞΩΤΕΡΙΚΟΥ ΕΞΕΤΑΣΗ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΗΝ ΙΣΠΑΝΙΚΗ ΓΛΩΣΣΑ Πέμπτη, 15 Σεπτεμβρίου 2011

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΗ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΗΝ ΑΓΓΛΙΚΗ ΓΛΩΣΣΑ ΟΔΗΓΙΕΣ ΓΙΑ ΤΟΥΣ/ΤΙΣ ΥΠΟΨΗΦΙΟΥΣ/ΕΣ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΗ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΗΝ ΑΓΓΛΙΚΗ ΓΛΩΣΣΑ ΟΔΗΓΙΕΣ ΓΙΑ ΤΟΥΣ/ΤΙΣ ΥΠΟΨΗΦΙΟΥΣ/ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΚΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΕΞΕΤΑΣΕΩΝ ΕΙΔΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΕΛΛΗΝΩΝ ΕΞΩΤΕΡΙΚΟΥ ΕΞΕΤΑΣΗ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΗΝ ΑΓΓΛΙΚΗ ΓΛΩΣΣΑ 12 Σεπτεμβρίου 2011 ΟΔΗΓΙΕΣ

Διαβάστε περισσότερα

y ay uoy Uy t -1050 m -9,8 m/s^2 0 m/s

y ay uoy Uy t -1050 m -9,8 m/s^2 0 m/s ΚΙΝ ΣΟ ΠΙΠ Ο ΠαλΪ δΰηα 1 Π υ β παεϋ ου ίοάγ δαμ απσ Ϋθα α λοπζϊθο Σκ α λκπζϊθκ εδθ έ αδ κλδασθ δα η ηέα αγ λά αξτ β α +115 m / s εαδ υοση λκ 1050 m. Καγκλέ κθ απαδ κτη θκ ξλσθκ πκυ ξλ δϊα αδ κ παεϋ κ ΰδα

Διαβάστε περισσότερα

ΠΡΩΣ ΘΛΗΜ ΝSUPERLEAGUE ΟΠ Π UEFA CHAMPIONS LEAGUE *

ΠΡΩΣ ΘΛΗΜ ΝSUPERLEAGUE ΟΠ Π UEFA CHAMPIONS LEAGUE * ΑΰκλΪακθ αμ δ δ άλδκ δαλε έαμ κ φέζαγζκμ ια φαζέα δ βθ παλαεκζκτγβ β σζπθ πθ θ σμ Ϋ λαμ αΰυθπθ κ ΰάπ κ «Γ. Καλαρ εϊεβμ», κδ κπκέκδ αθϋλχκθ αδ κυζϊχδ κθ έεκ δ πϋθ (25). ΠΡΩΣ ΘΛΗΜ ΝSUPERLEAGUE ΟΠ Π UEFA

Διαβάστε περισσότερα

δκθ έα ζ εαδ ΠλΪ δθκ Ν έα ζ

δκθ έα ζ εαδ ΠλΪ δθκ Ν έα ζ γθδεσ Μ σίδκ Πκζυ χθ έκ ( ΜΠ) ξκζά Χβηδευθ Μβξαθδευθ - ΣκηΫαμ ΙΙ ΜκθΪ α Μβξαθδεάμ δ λΰα δυθ Τ λκΰκθαθγλϊεπθ εαδ δκεαυ έηπθ δκθ έα ζ εαδ ΠλΪ δθκ Ν έα ζ πμ Yπκεα Ϊ α α κυ Π λ ζα εκτ Ν έα ζ Ν. ΠαπαΰδαθθΪεκμ

Διαβάστε περισσότερα

LESSON 14 (ΜΑΘΗΜΑ ΔΕΚΑΤΕΣΣΕΡΑ) REF : 202/057/34-ADV. 18 February 2014

LESSON 14 (ΜΑΘΗΜΑ ΔΕΚΑΤΕΣΣΕΡΑ) REF : 202/057/34-ADV. 18 February 2014 LESSON 14 (ΜΑΘΗΜΑ ΔΕΚΑΤΕΣΣΕΡΑ) REF : 202/057/34-ADV 18 February 2014 Slowly/quietly Clear/clearly Clean Quickly/quick/fast Hurry (in a hurry) Driver Attention/caution/notice/care Dance Σιγά Καθαρά Καθαρός/η/ο

Διαβάστε περισσότερα

Tipologie installative - Installation types Type d installation - Installationstypen Tipos de instalación - Τυπολογίες εγκατάστασης

Tipologie installative - Installation types Type d installation - Installationstypen Tipos de instalación - Τυπολογίες εγκατάστασης AMPADE MOOCROMATICHE VIMAR DIMMERABII A 0 V~ - VIMAR 0 V~ DIMMABE MOOCHROME AMP AMPE MOOCHROME VIMAR VARIATEUR 0 V~ - DIMMERFÄHIGE MOOCHROMATICHE AMPE VO VIMAR MIT 0 V~ ÁMPARA MOOCROMÁTICA VIMAR REGUABE

Διαβάστε περισσότερα

ΟΙΚΟΛΟΓΙΚΗΝ ΡΧΙΣ ΚΣΟΝΙΚΗ ΧΟΝ ΡΟ Ν ΗΜΗΣΡΙΟ Ν

ΟΙΚΟΛΟΓΙΚΗΝ ΡΧΙΣ ΚΣΟΝΙΚΗ ΧΟΝ ΡΟ Ν ΗΜΗΣΡΙΟ Ν ΟΙΚΟΛΟΓΙΚΗΝ ΡΧΙΣ ΚΣΟΝΙΚΗ ΠΣΤΧΙ ΚΗΝ ΡΓ Ι ΝΣΩΝ:Ν Ι ΟΤΝΜ Γ ΛΗΝΗΝ ΧΟΝ ΡΟ Ν ΗΜΗΣΡΙΟ Ν Λ ΜΠΡΟΤΝ Λ Ξ Ν ΡΟ Ι ΣΟΡΙΚΗΝ Ν ΡΟΜΗ Ν Ν Ω ΙΜ ΝΠΗΓ Ν Ν ΡΓ Ι ΚΟΠΟ,Ν ΣΟΧΟΙΝΚ ΙΝ ΡΧ Ν ΙΟΚΛΙΜ ΣΙΚΗ Ν ΡΧΙΣ ΚΣΟΝΙΚΗ Μ κθ σλκ δκεζδηα

Διαβάστε περισσότερα

English PDFsharp is a.net library for creating and processing PDF documents 'on the fly'. The library is completely written in C# and based

English PDFsharp is a.net library for creating and processing PDF documents 'on the fly'. The library is completely written in C# and based English PDFsharp is a.net library for creating and processing PDF documents 'on the fly'. The library is completely written in C# and based exclusively on safe, managed code. PDFsharp offers two powerful

Διαβάστε περισσότερα

English PDFsharp is a.net library for creating and processing PDF documents 'on the fly'. The library is completely written in C# and based

English PDFsharp is a.net library for creating and processing PDF documents 'on the fly'. The library is completely written in C# and based English PDFsharp is a.net library for creating and processing PDF documents 'on the fly'. The library is completely written in C# and based exclusively on safe, managed code. PDFsharp offers two powerful

Διαβάστε περισσότερα

ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»

ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας» ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΠΡΟΣΧΟΛΙΚΗΣ ΑΓΩΓΗΣ ΚΑΙ ΤΟΥ ΕΚΠΑΙ ΕΥΤΙΚΟΥ ΣΧΕ ΙΑΣΜΟΥ «ΠΑΙ ΙΚΟ ΒΙΒΛΙΟ ΚΑΙ ΠΑΙ ΑΓΩΓΙΚΟ ΥΛΙΚΟ» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ που εκπονήθηκε για τη

Διαβάστε περισσότερα

Οι αδελφοί Montgolfier: Ψηφιακή αφήγηση The Montgolfier Βrothers Digital Story (προτείνεται να διδαχθεί στο Unit 4, Lesson 3, Αγγλικά Στ Δημοτικού)

Οι αδελφοί Montgolfier: Ψηφιακή αφήγηση The Montgolfier Βrothers Digital Story (προτείνεται να διδαχθεί στο Unit 4, Lesson 3, Αγγλικά Στ Δημοτικού) Οι αδελφοί Montgolfier: Ψηφιακή αφήγηση The Montgolfier Βrothers Digital Story (προτείνεται να διδαχθεί στο Unit 4, Lesson 3, Αγγλικά Στ Δημοτικού) Προσδοκώμενα αποτελέσματα Περιεχόμενο Ενδεικτικές δραστηριότητες

Διαβάστε περισσότερα

LESSON 6 (ΜΑΘΗΜΑ ΕΞΙ) REF : 201/045/26-ADV. 10 December 2013

LESSON 6 (ΜΑΘΗΜΑ ΕΞΙ) REF : 201/045/26-ADV. 10 December 2013 LESSON 6 (ΜΑΘΗΜΑ ΕΞΙ) REF : 201/045/26-ADV 10 December 2013 I get up/i stand up I wash myself I shave myself I comb myself I dress myself Once (one time) Twice (two times) Three times Salary/wage/pay Alone/only

Διαβάστε περισσότερα

Right Rear Door. Let's now finish the door hinge saga with the right rear door

Right Rear Door. Let's now finish the door hinge saga with the right rear door Right Rear Door Let's now finish the door hinge saga with the right rear door You may have been already guessed my steps, so there is not much to describe in detail. Old upper one file:///c /Documents

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΨΥΧΟΛΟΓΙΚΕΣ ΕΠΙΠΤΩΣΕΙΣ ΣΕ ΓΥΝΑΙΚΕΣ ΜΕΤΑ ΑΠΟ ΜΑΣΤΕΚΤΟΜΗ ΓΕΩΡΓΙΑ ΤΡΙΣΟΚΚΑ Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ

Διαβάστε περισσότερα

ΤΠΟΤΡΓ ΙΟΝ Ν ΠΣΤΞΗΝΤ ΝΟΜΟΘ ΣΙΚΗΝΠ Ρ Μ ΗΝΓΙ ΝΣΗΝΡΤΘΜΙΗΝΧΡ ΩΝΝΜΙΚΡΩΝΝ ΠΙΧ ΙΡΗ ΩΝΝΚ ΙΝ Π ΓΓ ΛΜ ΣΙΩΝΝ. δ δπ δεκτνξλϋκυμν

ΤΠΟΤΡΓ ΙΟΝ Ν ΠΣΤΞΗΝΤ ΝΟΜΟΘ ΣΙΚΗΝΠ Ρ Μ ΗΝΓΙ ΝΣΗΝΡΤΘΜΙΗΝΧΡ ΩΝΝΜΙΚΡΩΝΝ ΠΙΧ ΙΡΗ ΩΝΝΚ ΙΝ Π ΓΓ ΛΜ ΣΙΩΝΝ. δ δπ δεκτνξλϋκυμν ΤΠΟΤΡΓ ΙΟΝ Ν ΠΣΤΞΗΝΤ ΝΣ ΓΩΝΙΣΙΚΟΣΗΣ ΝΟΜΟΘ ΣΙΚΗΝΠ Ρ Μ ΗΝΓΙ ΝΣΗΝΡΤΘΜΙΗΝΧΡ ΩΝΝΜΙΚΡΩΝΝ ΠΙΧ ΙΡΗ ΩΝΝΚ ΙΝ Π ΓΓ ΛΜ ΣΙΩΝΝ ΗΝη ΰαζτ λβναθα δϊλγλπ βν δ δπ δεκτνξλϋκυμν πκυνϋΰδθ Νπκ ΫΝ σχκδ Παλκξά εδθά λπθ ΰδα υηη

Διαβάστε περισσότερα

LESSON 12 (ΜΑΘΗΜΑ ΔΩΔΕΚΑ) REF : 202/055/32-ADV. 4 February 2014

LESSON 12 (ΜΑΘΗΜΑ ΔΩΔΕΚΑ) REF : 202/055/32-ADV. 4 February 2014 LESSON 12 (ΜΑΘΗΜΑ ΔΩΔΕΚΑ) REF : 202/055/32-ADV 4 February 2014 Somewhere κάπου (kapoo) Nowhere πουθενά (poothena) Elsewhere αλλού (aloo) Drawer το συρτάρι (sirtari) Page η σελίδα (selida) News τα νέα (nea)

Διαβάστε περισσότερα

σξκδ Χλά β κυ Νσηκυ κυ Newton ΰδα β αλτ β α εαδ κυ τ λκυ Νσηκυ βμ εέθβ βμ (F = ma) ΰδα κθ υπκζκΰδ ησ πζαθβ υθ. αξτ β αμ δαφυΰάμ.

σξκδ Χλά β κυ Νσηκυ κυ Newton ΰδα β αλτ β α εαδ κυ τ λκυ Νσηκυ βμ εέθβ βμ (F = ma) ΰδα κθ υπκζκΰδ ησ πζαθβ υθ. αξτ β αμ δαφυΰάμ. Κ φάζδο ΡΤΣΗΣ σξκδ Μ ζϋ β κυ Νσηκυ κυ Newton ΰδ β λτ β Χλά β κυ Νσηκυ κυ Newton ΰδ β λτ β εδ κυ τ λκυ Νσηκυ βμ εέθβ βμ (F = ma) ΰδ κθ υπκζκΰδ ησ πθ λκξδευθ ξυ ά πθ πθ κλυφσλπθ εδ πθ πζθβ υθ. Χλά β βμ η

Διαβάστε περισσότερα

Tipologie installative - Installation types Types d installation - Die einbauanweisungen Tipos de instalación - Τυπολογίες εγκατάστασης

Tipologie installative - Installation types Types d installation - Die einbauanweisungen Tipos de instalación - Τυπολογίες εγκατάστασης Types d installation Die einbauanweisungen Tipos de instalación Τυπολογίες εγκατάστασης AMPADE MOOCROMATICHE VIMAR DIMMERABII A 0 V~ MOOCHROME DIMMABE AMP VIMAR 0 V~ AMPE MOOCHROME VIMAR DIMMABE 0 V~ EUCHTE

Διαβάστε περισσότερα

ΟΙ ΑΞΙΕΣ ΤΗΣ ΖΩΗΣ THE VALUES OF LIFE Η ΥΠΕΥΘΥΝΟΤΗΤΑ..THE RESPONSIBILITY ΔΗΜΗΤΡΑ ΚΩΝΣΤΑΝΤΙΝΟΥ

ΟΙ ΑΞΙΕΣ ΤΗΣ ΖΩΗΣ THE VALUES OF LIFE Η ΥΠΕΥΘΥΝΟΤΗΤΑ..THE RESPONSIBILITY ΔΗΜΗΤΡΑ ΚΩΝΣΤΑΝΤΙΝΟΥ ΟΙ ΑΞΙΕΣ ΤΗΣ ΖΩΗΣ THE VALUES OF LIFE Η ΥΠΕΥΘΥΝΟΤΗΤΑ..THE RESPONSIBILITY ΔΗΜΗΤΡΑ ΚΩΝΣΤΑΝΤΙΝΟΥ ΜΑΘΗΜΑΤΑ ΥΠΕΥΘΥΝΟΤΗΤΑΣ/ LESSONS ABOUT RESPONSIBILITY Μάθημα 1: Νιώθω υπερήφανος όταν.../ I feel proud when.

Διαβάστε περισσότερα

LESSON 16 (ΜΑΘΗΜΑ ΔΕΚΑΕΞΙ) REF : 102/018/16-BEG. 4 March 2014

LESSON 16 (ΜΑΘΗΜΑ ΔΕΚΑΕΞΙ) REF : 102/018/16-BEG. 4 March 2014 LESSON 16 (ΜΑΘΗΜΑ ΔΕΚΑΕΞΙ) REF : 102/018/16-BEG 4 March 2014 Family η οικογένεια a/one(fem.) μία a/one(masc.) ένας father ο πατέρας mother η μητέρα man/male/husband ο άντρας letter το γράμμα brother ο

Διαβάστε περισσότερα

ΤΑ ΝΕΑ ΜΑΣ!!!! Ο Αγιασμός στην Αδαμάντιο Σχολή. Επίσκεψη των προνηπίων στο Κτήμα Γεροβασιλείου

ΤΑ ΝΕΑ ΜΑΣ!!!! Ο Αγιασμός στην Αδαμάντιο Σχολή. Επίσκεψη των προνηπίων στο Κτήμα Γεροβασιλείου ΣΕΠΤΕΜΒΡΙΟΣ 2013 Ο Αγιασμός στην Αδαμάντιο Σχολή Οι μικροί μαθητές κάτω από την Ευλογία και τη Χάρη της εκκλησίας στον Αγιασμό για την έναρξη της νέας σχολικής χρονιάς 2013 2014. Όμορφα πρόσωπα, χαρούμενα,

Διαβάστε περισσότερα

Μπκλκτη ΝθαΝθδεά κυη Ν κνϋηφλαΰηα. π ηία δεσμνκαλ δκζσΰκμ,ν θέν δ υγυθ άμνγ'νκαλ δκζκΰδεάμνκζδθδεάμ,ν υλπεζδθδεάμν γβθυθ,νστηίκυζκμν κυν ΛέΙέΚ Ρέ

Μπκλκτη ΝθαΝθδεά κυη Ν κνϋηφλαΰηα. π ηία δεσμνκαλ δκζσΰκμ,ν θέν δ υγυθ άμνγ'νκαλ δκζκΰδεάμνκζδθδεάμ,ν υλπεζδθδεάμν γβθυθ,νστηίκυζκμν κυν ΛέΙέΚ Ρέ Μπκλκτη ΝθΝθδεά κυη Ν κνϋηφλΰη ΗΝ ηη έν ημνϋΰεδλημνθ δη υπδ ημ έζ δκμννένσπθσμ π ηί δεσμνκλ δκζσΰκμ,ν θέν δ υγυθ άμνγ'νκλ δκζκΰδεάμνκζδθδεάμ,ν υλπεζδθδεάμν γβθυθ,νστηίκυζκμν κυν ΛέΙέΚ Ρέ Απ π Γδ πκδκ ζσΰκ

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΛΑΤΙΝΙΚΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΛΑΤΙΝΙΚΑ ΚΑΤΕΥΘΥΝΣΗΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΛΑΤΙΝΙΚΑ ΚΑΤΕΥΘΥΝΣΗΣ Α. Κείμενο: Sulla, occupata urbe, senatum armatus coegerat ut G. Marius quam celerrime hostis iudicaretur. Cuius voluntati nemo obviam ire audebat; solus Quintus Mucius

Διαβάστε περισσότερα

Final Test Grammar. Term C'

Final Test Grammar. Term C' Final Test Grammar Term C' Book: Starting Steps 1 & Extra and Friends Vocabulary and Grammar Practice Class: Junior AB Name: /43 Date: E xercise 1 L ook at the example and do the same. ( Κξίηα ηξ παοάδειγμα

Διαβάστε περισσότερα

Exercises 10. Find a fundamental matrix of the given system of equations. Also find the fundamental matrix Φ(t) satisfying Φ(0) = I. 1.

Exercises 10. Find a fundamental matrix of the given system of equations. Also find the fundamental matrix Φ(t) satisfying Φ(0) = I. 1. Exercises 0 More exercises are available in Elementary Differential Equations. If you have a problem to solve any of them, feel free to come to office hour. Problem Find a fundamental matrix of the given

Διαβάστε περισσότερα

LESSON 26 (ΜΑΘΗΜΑ ΕΙΚΟΣΙ ΕΞΙ) REF : 102/030/26. 18 November 2014

LESSON 26 (ΜΑΘΗΜΑ ΕΙΚΟΣΙ ΕΞΙ) REF : 102/030/26. 18 November 2014 LESSON 26 (ΜΑΘΗΜΑ ΕΙΚΟΣΙ ΕΞΙ) REF : 102/030/26 18 November 2014 But Weekend I love The song I sing I smile I laugh Greek (thing) Greek(people) Greek (man) αλλά (το) Σαββατοκύριακο αγαπώ (το) τραγούδι τραγουδώ

Διαβάστε περισσότερα

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΟΥ ΑΝΘΡΩΠΟΥ

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΟΥ ΑΝΘΡΩΠΟΥ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΟΥ ΑΝΘΡΩΠΟΥ Πρόγραμμα Μεταπτυχιακών Σπουδών «Επιστήμη και Τεχνολογία Τροφίμων και Διατροφή του Ανθρώπου» Κατεύθυνση: «Διατροφή, Δημόσια

Διαβάστε περισσότερα

ΛΑΤΙΝΙΚΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΛΑΤΙΝΙΚΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Α. ΚΕΙΜΕΝΟ Να µεταφράσετε το παρακάτω κείµενο: Nonnulli sunt in hoc ordine, qui aut ea, quae imminent, non videant, aut ea, quae vident, dissimulent: qui spem Catilinae mollibus sententiis aluerunt coniurationemque

Διαβάστε περισσότερα

3.4 Αζηίεξ ημζκςκζηήξ ακζζυηδηαξ ζημ ζπμθείμ... 64 3.4.1 Πανάβμκηεξ πνμέθεοζδξ ηδξ ημζκςκζηήξ ακζζυηδηαξ... 64 3.5 οιαμθή ηςκ εηπαζδεοηζηχκ ζηδκ

3.4 Αζηίεξ ημζκςκζηήξ ακζζυηδηαξ ζημ ζπμθείμ... 64 3.4.1 Πανάβμκηεξ πνμέθεοζδξ ηδξ ημζκςκζηήξ ακζζυηδηαξ... 64 3.5 οιαμθή ηςκ εηπαζδεοηζηχκ ζηδκ 2 Πεξηερόκελα Δονεηήνζμ πζκάηςκ... 4 Δονεηήνζμ δζαβναιιάηςκ... 5 Abstract... 6 Πενίθδρδ... 7 Δζζαβςβή... 8 ΘΔΩΡΗΣΙΚΟ ΜΔΡΟ... 12 Κεθάθαζμ 1: Θεςνδηζηέξ πνμζεββίζεζξ βζα ηδκ ακζζυηδηα ζηδκ εηπαίδεοζδ...

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία "Η ΣΗΜΑΝΤΙΚΟΤΗΤΑ ΤΟΥ ΜΗΤΡΙΚΟΥ ΘΗΛΑΣΜΟΥ ΣΤΗ ΠΡΟΛΗΨΗ ΤΗΣ ΠΑΙΔΙΚΗΣ ΠΑΧΥΣΑΡΚΙΑΣ" Ειρήνη Σωτηρίου Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ»

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ» I ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΝΟΜΙΚΩΝ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΠΟΛΙΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΗΝ «ΔΙΟΙΚΗΣΗ ΚΑΙ ΟΙΚΟΝΟΜΙΑ» ΚΑΤΕΥΘΥΝΣΗ: ΟΙΚΟΝΟΜΙΚΗ

Διαβάστε περισσότερα

STARTING STEPS IN GRAMMAR, FINAL TEST C TERM 2012 UNITS 1-18

STARTING STEPS IN GRAMMAR, FINAL TEST C TERM 2012 UNITS 1-18 STARTING STEPS IN GRAMMAR, FINAL TEST C TERM 2012 UNITS 1-18 Name.. Class. Date. EXERCISE 1 Answer the question. Use: Yes, it is or No, it isn t. Απάντηςε ςτισ ερωτήςεισ. Βάλε: Yes, it is ή No, it isn

Διαβάστε περισσότερα

1999 MODERN GREEK 2 UNIT Z

1999 MODERN GREEK 2 UNIT Z STUDENT NUMBER CENTRE NUMBER HIGHER SCHOOL CERTIFICATE EXAMINATION 1999 MODERN GREEK 2 UNIT Z (55 Marks) Time allowed Two hours (Plus 5 minutes reading time) DIRECTIONS TO CANDIDATES Write your Student

Διαβάστε περισσότερα

Στεγαστική δήλωση: Σχετικά με τις στεγαστικές υπηρεσίες που λαμβάνετε (Residential statement: About the residential services you get)

Στεγαστική δήλωση: Σχετικά με τις στεγαστικές υπηρεσίες που λαμβάνετε (Residential statement: About the residential services you get) Νόμος περί Αναπηριών 2006 (Disability Act 2006) Στεγαστική δήλωση: Σχετικά με τις στεγαστικές υπηρεσίες που λαμβάνετε (Residential statement: About the residential services you get) Greek Νόμος περί Αναπηριών

Διαβάστε περισσότερα

Newborn Upfront Payment & Newborn Supplement

Newborn Upfront Payment & Newborn Supplement GREEK Newborn Upfront Payment & Newborn Supplement Female 1: Το μωρό μου θα ρθει σύντομα, θα πρέπει να κανονίσω τα οικονομικά μου. Άκουσα ότι η κυβέρνηση δεν δίνει πλέον το Baby Bonus. Ξέρεις τίποτα γι

Διαβάστε περισσότερα

Advanced Subsidiary Unit 1: Understanding and Written Response

Advanced Subsidiary Unit 1: Understanding and Written Response Write your name here Surname Other names Edexcel GE entre Number andidate Number Greek dvanced Subsidiary Unit 1: Understanding and Written Response Thursday 16 May 2013 Morning Time: 2 hours 45 minutes

Διαβάστε περισσότερα

@ BY AVENUES PRIVATE INSTITUTE JUNE 2014

@ BY AVENUES PRIVATE INSTITUTE JUNE 2014 1 Εκεί που η ποιότητα συναντά την επιτυχία Λεωφ. Αρχ. Μακαρίου 7, Αρεδιού Τηλ. 22874368/9 2 ENGLISH INSTITUTE A Place where quality meets success 7, Makarios Avenue, Arediou, Tel. 22874368/9 99606442 Anglia

Διαβάστε περισσότερα

Objectives-Στόχοι: -Helping your Child become a fantastic language learner «Βοηθώντας το παιδί σας να γίνει εξαιρετικό στην εκμάθηση γλωσσών» 6/2/2014

Objectives-Στόχοι: -Helping your Child become a fantastic language learner «Βοηθώντας το παιδί σας να γίνει εξαιρετικό στην εκμάθηση γλωσσών» 6/2/2014 -Helping your Child become a fantastic language learner «Βοηθώντας το παιδί σας να γίνει εξαιρετικό στην εκμάθηση γλωσσών» Dr Caroline Linse Queens University, Belfast, Northern Ireland Objectives-Στόχοι:

Διαβάστε περισσότερα

Inverse trigonometric functions & General Solution of Trigonometric Equations. ------------------ ----------------------------- -----------------

Inverse trigonometric functions & General Solution of Trigonometric Equations. ------------------ ----------------------------- ----------------- Inverse trigonometric functions & General Solution of Trigonometric Equations. 1. Sin ( ) = a) b) c) d) Ans b. Solution : Method 1. Ans a: 17 > 1 a) is rejected. w.k.t Sin ( sin ) = d is rejected. If sin

Διαβάστε περισσότερα

Κάθε γνήσιο αντίγραφο φέρει υπογραφή του συγγραφέα. / Each genuine copy is signed by the author.

Κάθε γνήσιο αντίγραφο φέρει υπογραφή του συγγραφέα. / Each genuine copy is signed by the author. Κάθε γνήσιο αντίγραφο φέρει υπογραφή του συγγραφέα. / Each genuine copy is signed by the author. 2012, Γεράσιμος Χρ. Σιάσος / Gerasimos Siasos, All rights reserved. Στοιχεία επικοινωνίας συγγραφέα / Author

Διαβάστε περισσότερα

Verklarte Nacht, Op.4 (Εξαϋλωμένη Νύχτα, Έργο 4) Arnold Schoenberg (1874-1951)

Verklarte Nacht, Op.4 (Εξαϋλωμένη Νύχτα, Έργο 4) Arnold Schoenberg (1874-1951) 1 Verklarte Nacht, Op.4 (Εξαϋλωμένη Νύχτα, Έργο 4) Arnold Schoenberg (1874-1951) Αναγνώσματα από το βιβλίο Η Απόλαυση της Μουσικής (Machlis, Forney), για τους μαθητές που θα μελετήσουν το έργο: «Ο Σαίνμπεργκ

Διαβάστε περισσότερα

ΣΤΥΛΙΑΝΟΥ ΣΟΦΙΑ Socm09008@soc.aegean.gr

ΣΤΥΛΙΑΝΟΥ ΣΟΦΙΑ Socm09008@soc.aegean.gr ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΚΟΙΝΩΝΙΟΛΟΓΙΑΣ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ «ΕΡΕΥΝΑ ΓΙΑ ΤΗΝ ΤΟΠΙΚΗ ΚΟΙΝΩΝΙΚΗ ΑΝΑΠΤΥΞΗ ΚΑΙ ΣΥΝΟΧΗ» ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Θέμα: Διερεύνηση των απόψεων

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΟΣ ΣΥΝΔΕΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY 21 ος ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ Δεύτερος Γύρος - 30 Μαρτίου 2011

ΚΥΠΡΙΑΚΟΣ ΣΥΝΔΕΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY 21 ος ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ Δεύτερος Γύρος - 30 Μαρτίου 2011 Διάρκεια Διαγωνισμού: 3 ώρες Απαντήστε όλες τις ερωτήσεις Μέγιστο Βάρος (20 Μονάδες) Δίνεται ένα σύνολο από N σφαιρίδια τα οποία δεν έχουν όλα το ίδιο βάρος μεταξύ τους και ένα κουτί που αντέχει μέχρι

Διαβάστε περισσότερα

Επίλυση Προβλήματος σε Προγραμματιστικό Περιβάλλον από Παιδιά Προσχολικής Ηλικίας

Επίλυση Προβλήματος σε Προγραμματιστικό Περιβάλλον από Παιδιά Προσχολικής Ηλικίας Επίλυση Προβλήματος σε Προγραμματιστικό Περιβάλλον από Παιδιά Προσχολικής Ηλικίας Γ. Φεσάκης, Ε. Γουλή, Ε. Μαυρουδή Τμήμα Επιστημών Προσχολικής Αγωγής και Εκπαιδευτικού Σχεδιασμού, Πανεπιστήμιο Αιγαίου

Διαβάστε περισσότερα

Code Breaker. TEACHER s NOTES

Code Breaker. TEACHER s NOTES TEACHER s NOTES Time: 50 minutes Learning Outcomes: To relate the genetic code to the assembly of proteins To summarize factors that lead to different types of mutations To distinguish among positive,

Διαβάστε περισσότερα

ΘΕΜΑ: Π Σ Τ Χ Ι Α Κ Η Ε Ρ Γ Α Ι Α. ( έμένίθ1ήίλ) πδίζϋππθμ Γ υλΰδκμνκκυλ Ϋ αμ Καγβΰβ άμ

ΘΕΜΑ: Π Σ Τ Χ Ι Α Κ Η Ε Ρ Γ Α Ι Α. ( έμένίθ1ήίλ) πδίζϋππθμ Γ υλΰδκμνκκυλ Ϋ αμ Καγβΰβ άμ ΘΕΜΑ: ΝΣΡΙΣΟ ΘΜΙ ΝΣΟΤΡΙΣΙΚ ΝΝ ΚΠ Ι Τ ΝΣ ΝΝΓ ΡΜ ΝΙ Π Σ Τ Χ Ι Α Κ Η Ε Ρ Γ Α Ι Α βηβ λέκυνχ ΝΣ Ρ Ν κυνχλά κυ ( έμένίθ1ήίλ) πδίζϋππθμ Γ υλΰδκμνκκυλ Ϋ αμ Καγβΰβ άμ Θ ΛΟΝΙΚ,ΝΝΟ Μ ΡΙΟΝβί1γ Π λέζβοβ ΣκΝ επαδ υ

Διαβάστε περισσότερα

ΦΤΣ ΠΟΤ Κ ΛΛΙ ΡΓΟΤΝΣ Ι Σ Ν

ΦΤΣ ΠΟΤ Κ ΛΛΙ ΡΓΟΤΝΣ Ι Σ Ν ΦΤΣ ΠΟΤ Κ ΛΛΙ ΡΓΟΤΝΣ Ι Σ Ν ΛΛ ΓΙ Σ Ν Π Ρ ΓΩΓ ΙΟ ΙΘ ΝΟΛ Κ Ι ΙΟΝΣ Λ ΚΟΠΟΝ ΡΓ Ι υ βηα δεά εαζζδϋλΰ δα πθ φυ υθ αυ υθ έθαδ ΰθπ ά εαδ πμ θ λΰ δαεά ΰ πλΰέα εαδ έθαδ Ϋθαμ κζκϋθα αθαπ υ ση θκμ κηϋαμ σ κ β ξυλα

Διαβάστε περισσότερα

Επιβλέπουσα Καθηγήτρια: ΣΟΦΙΑ ΑΡΑΒΟΥ ΠΑΠΑΔΑΤΟΥ

Επιβλέπουσα Καθηγήτρια: ΣΟΦΙΑ ΑΡΑΒΟΥ ΠΑΠΑΔΑΤΟΥ EΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΕΚΠΑΙΔΕΥΤΙΚΟ ΤΕΧΝΟΛΟΓΙΚΟ ΙΔΡΥΜΑ ΤΕΙ ΙΟΝΙΩΝ ΝΗΣΩΝ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ Ταχ. Δ/νση : Λεωφ. Αντ.Τρίτση, Αργοστόλι Κεφαλληνίας Τ.Κ. 28 100 τηλ. : 26710-27311 fax : 26710-27312

Διαβάστε περισσότερα

Areas and Lengths in Polar Coordinates

Areas and Lengths in Polar Coordinates Kiryl Tsishchanka Areas and Lengths in Polar Coordinates In this section we develop the formula for the area of a region whose boundary is given by a polar equation. We need to use the formula for the

Διαβάστε περισσότερα

Πτυχιακή Εργασία. Παραδοσιακά Προϊόντα Διατροφική Αξία και η Πιστοποίηση τους

Πτυχιακή Εργασία. Παραδοσιακά Προϊόντα Διατροφική Αξία και η Πιστοποίηση τους ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΔΙΑΤΡΟΦΗΣ ΚΑΙ ΔΙΑΙΤΟΛΟΓΙΑΣ Πτυχιακή Εργασία Παραδοσιακά Προϊόντα Διατροφική Αξία και η Πιστοποίηση τους Εκπόνηση:

Διαβάστε περισσότερα

Βασιλική Σαμπάνη 2013. Μαντάμ Μποβαρύ: Αναπαραστάσεις φύλου και σεξουαλικότητας

Βασιλική Σαμπάνη 2013. Μαντάμ Μποβαρύ: Αναπαραστάσεις φύλου και σεξουαλικότητας Βασιλική Σαμπάνη 2013 Μαντάμ Μποβαρύ: Αναπαραστάσεις φύλου και σεξουαλικότητας 200 Διαγλωσσικές Θεωρήσεις μεταφρασεολογικός η-τόμος Interlingual Perspectives translation e-volume ΜΑΝΤΑΜ ΜΠΟΒΑΡΥ: ΑΝΑΠΑΡΑΣΤΑΣΕΙΣ

Διαβάστε περισσότερα

κ ηϋλ μ α λκπκλδευμ www.karmatravel.gr Travel.Karma@yahoo.gr ΙΝΔΙΑΝ ΧΡΤΟΝ ΣΡΙΓΩΝΟ 06, 27/10/15 639 899 03/11/15 769 1029 600 5* ΦόλκδΝ Α φαζέ Κα ηγέ

κ ηϋλ μ α λκπκλδευμ www.karmatravel.gr Travel.Karma@yahoo.gr ΙΝΔΙΑΝ ΧΡΤΟΝ ΣΡΙΓΩΝΟ 06, 27/10/15 639 899 03/11/15 769 1029 600 5* ΦόλκδΝ Α φαζέ Κα ηγέ www.karmatravel.gr Travel.Karma@yahoo.gr ΙΝ Ι ΧΡ Ο ΡΙ ΩΝΟ κ ηϋλ μ α λκπκλδευμ Β ί Ο Ά α (2) Ο Φα π υ ί Ο μπ α Ο α π (2) Ο Φ Άμπ Ο Β ί (2) Πλκκλδ ηόμ ΙΝΔΙΑΝ ΧΡΤΟΝ ΣΡΙΓΩΝΟ ΜΫλ μ Αθαχωλά δμ Δέεζδθκ Μκθόεζδθκ

Διαβάστε περισσότερα

MARKSCHEME BARÈME DE NOTATION ESQUEMA DE CALIFICACIÓN

MARKSCHEME BARÈME DE NOTATION ESQUEMA DE CALIFICACIÓN IB DIPLOMA PROGRAMME PROGRAMME DU DIPLÔME DU BI PROGRAMA DEL DIPLOMA DEL BI M06/2/ABMGR/SP1/GRE/TZ0/XX/M MARKSCHEME BARÈME DE NOTATION ESQUEMA DE CALIFICACIÓN May / mai / mayo 2006 MODERN GREEK / GREC

Διαβάστε περισσότερα

Αζεκίλα Α. Μπνπράγηεξ (Α.Μ. 261)

Αζεκίλα Α. Μπνπράγηεξ (Α.Μ. 261) ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΧΝ ΥΟΛΖ ΑΝΘΡΧΠΗΣΗΚΧΝ ΚΑΗ ΚΟΗΝΧΝΗΚΧΝ ΠΟΤΓΧΝ ΠΑΗΓΑΓΧΓΗΚΟ ΣΜΖΜΑ ΓΖΜΟΣΗΚΖ ΔΚΠΑΗΓΔΤΖ ΜΔΣΑΠΣΤΥΗΑΚΟ ΠΡΟΓΡΑΜΜΑ ΠΟΤΓΧΝ ΘΔΜΑ ΓΗΠΛΧΜΑΣΗΚΖ ΔΡΓΑΗΑ: Ζ ΑΝΣΗΛΖΦΖ ΣΧΝ ΔΚΠΑΗΓΔΤΣΗΚΧΝ ΓΗΑ ΣΖ ΖΜΑΗΑ ΣΖ ΑΤΣΟΔΚΣΗΜΖΖ

Διαβάστε περισσότερα

Προφίλ επισκεπτών - Δημογραφικά Χαρακτηριστικά

Προφίλ επισκεπτών - Δημογραφικά Χαρακτηριστικά Στατιστικά στοιχεία επισκεψιμότητας γραφείου ενημέρωσης και πληροφόρησης επισκεπτών Ιnfo Point περιόδου Απριλίου-Μαΐου 2015. Στο διάστημα αυτό συμπληρώθηκαν 140 ερωτηματολόγια, τα οποία αντιστοιχούν σε

Διαβάστε περισσότερα

ΧτηφπθαΝη Ν κνπαλέ2ν κυνκαθέν1λίιή2ίίθψ ΌππμΝ λκπκπκδάγβε ΝαπσΝ κθνκαθέν 453/2010

ΧτηφπθαΝη Ν κνπαλέ2ν κυνκαθέν1λίιή2ίίθψ ΌππμΝ λκπκπκδάγβε ΝαπσΝ κθνκαθέν 453/2010 η λκηβθέανέε κ βμμν2/01/2013 λδγησμνέε κ βμμνννννννν0 ΛΣΙΟΝ ΟΜ ΝΧΝΝ Φ Λ Ι ΝΠΡΟΨΟΝΣΧΝ ΧτηφπθαΝη Ν κνπαλέ2ν κυνκαθέν1λίιή2ίίθψ ΌππμΝ λκπκπκδάγβε ΝαπσΝ κθνκαθέν 453/2010 1. ΣΟΙΥ Ι ΝΣΟΤΝΠ Ρ Κ Τ Μ ΣΟΝΚ ΙΝΣ

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΙΛΟΛΟΓΙΑΣ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΙΛΟΛΟΓΙΑΣ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΙΛΟΛΟΓΙΑΣ Π.Μ.Σ: «Σύγχρονες Προσεγγίσεις στη γλώσσα και στα κείμενα» ΚΑΤΕΥΘΥΝΣΗ ΓΛΩΣΣΟΛΟΓΙΑΣ ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΑΤΡΙΒΗ Το φωνηεντικό

Διαβάστε περισσότερα

ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΑΝΔΡΕΟΥ ΣΤΕΦΑΝΙΑ Λεμεσός 2012 i ii ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΒΑΛΕΝΤΙΝΑ ΠΑΠΑΔΟΠΟΥΛΟΥ Α.Μ.: 09/061. Υπεύθυνος Καθηγητής: Σάββας Μακρίδης

ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΒΑΛΕΝΤΙΝΑ ΠΑΠΑΔΟΠΟΥΛΟΥ Α.Μ.: 09/061. Υπεύθυνος Καθηγητής: Σάββας Μακρίδης Α.Τ.Ε.Ι. ΙΟΝΙΩΝ ΝΗΣΩΝ ΠΑΡΑΡΤΗΜΑ ΑΡΓΟΣΤΟΛΙΟΥ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ ΚΑΙ ΕΠΙΚΟΙΝΩΝΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Η διαμόρφωση επικοινωνιακής στρατηγικής (και των τακτικών ενεργειών) για την ενδυνάμωση της εταιρικής

Διαβάστε περισσότερα

Chapter 2 * * * * * * * Introduction to Verbs * * * * * * *

Chapter 2 * * * * * * * Introduction to Verbs * * * * * * * Chapter 2 * * * * * * * Introduction to Verbs * * * * * * * In the first chapter, we practiced the skill of reading Greek words. Now we want to try to understand some parts of what we read. There are a

Διαβάστε περισσότερα

Homework 3 Solutions

Homework 3 Solutions Homework 3 Solutions Igor Yanovsky (Math 151A TA) Problem 1: Compute the absolute error and relative error in approximations of p by p. (Use calculator!) a) p π, p 22/7; b) p π, p 3.141. Solution: For

Διαβάστε περισσότερα

Θέμα διπλωματικής εργασίας: «Από το «φρενοκομείο» στη Λέρο και την Ψυχιατρική Μεταρρύθμιση: νομικό πλαίσιο και ηθικοκοινωνικές διαστάσεις»

Θέμα διπλωματικής εργασίας: «Από το «φρενοκομείο» στη Λέρο και την Ψυχιατρική Μεταρρύθμιση: νομικό πλαίσιο και ηθικοκοινωνικές διαστάσεις» ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΕΣ ΙΑΤΡΙΚΗΣ & ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΤΜΗΜΑΤΑ ΝΟΜΙΚΗΣ & ΘΕΟΛΟΓΙΑΣ ΔΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «ΣΥΓΧΡΟΝΕΣ ΙΑΤΡΙΚΕΣ ΠΡΑΞΕΙΣ: ΔΙΚΑΙΙΚΗ ΡΥΘΜΙΣΗ ΚΑΙ ΒΙΟΗΘΙΚΗ

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 6/5/2006

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 6/5/2006 Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Ολοι οι αριθμοί που αναφέρονται σε όλα τα ερωτήματα είναι μικρότεροι το 1000 εκτός αν ορίζεται διαφορετικά στη διατύπωση του προβλήματος. Διάρκεια: 3,5 ώρες Καλή

Διαβάστε περισσότερα

Adjectives. Describing the Qualities of Things. A lesson for the Paideia web-app Ian W. Scott, 2015

Adjectives. Describing the Qualities of Things. A lesson for the Paideia web-app Ian W. Scott, 2015 Adjectives Describing the Qualities of Things A lesson for the Paideia web-app Ian W. Scott, 2015 Getting Started with Adjectives It's hard to say much using only nouns and pronouns Simon is a father.

Διαβάστε περισσότερα

IMPARA LE LINGUE CON I FILM AL CLA

IMPARA LE LINGUE CON I FILM AL CLA UNIVERSITÀ DEGLI STUDI DI PADOVA - CENTRO LINGUISTICO DI ATENEO IMPARA LE LINGUE CON I FILM AL CLA Vedere film in lingua straniera è un modo utile e divertente per imparare o perfezionare una lingua straniera.

Διαβάστε περισσότερα

ΛΑΤΙΝΙΚΑ Γ ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΑΤΙΝΙΚΑ Γ ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΑΤΙΝΙΚΑ Γ ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Α. Να µεταφράσετε τα παρακάτω αποσπάσµατα: Qui potuisti populari hanc terram, quae te genuit atque te aluit? Non tibi ingredienti fines patriae ira cecidi? Quamvis

Διαβάστε περισσότερα

«Συμπεριφορά μαθητών δευτεροβάθμιας εκπαίδευσης ως προς την κατανάλωση τροφίμων στο σχολείο»

«Συμπεριφορά μαθητών δευτεροβάθμιας εκπαίδευσης ως προς την κατανάλωση τροφίμων στο σχολείο» ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΓΕΩΠΟΝΙΚΗ ΣΧΟΛΗ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΕΙΔΙΚΕΥΣΗ «ΑΓΡΟΤΙΚΗ ΟΙΚΟΝΟΜΙΑ» «Συμπεριφορά μαθητών δευτεροβάθμιας εκπαίδευσης ως προς την κατανάλωση τροφίμων στο

Διαβάστε περισσότερα

Mission Berlin. Deutsch lernen und unterrichten Arbeitsmaterialien. Mission Berlin 22 Έλα τώρα, κουνήσου

Mission Berlin. Deutsch lernen und unterrichten Arbeitsmaterialien. Mission Berlin 22 Έλα τώρα, κουνήσου 22 Έλα τώρα, κουνήσου Η Άννα µεταφέρεται στο Βερολίνο του έτους 1989, όπου κυριαρχεί ο ενθουσιασµός για την πτώση του Τείχους. Πρέπει να περάσει µέσα από το πλήθος και να πάρει τη θήκη. Θα τα καταφέρει;

Διαβάστε περισσότερα

JEAN-CHARLES BLATZ 02XD34455 01RE52755

JEAN-CHARLES BLATZ 02XD34455 01RE52755 ΟΡΘΗ ΕΠΑΝΑΛΗΨΗ ΤΩΝ ΕΝ Ι ΑΜ ΕΣ ΩΝ ΟΙ Κ ΟΝΟΜ Ι Κ ΩΝ Κ ΑΤΑΣ ΤΑΣ ΕΩΝ ΤΗΣ ΕΤΑΙ ΡΙ ΑΣ Κ ΑΙ ΤΟΥ ΟΜ Ι ΛΟΥ Α Τρίµηνο 2005 ΑΝΩΝΥΜΟΣ Γ ΕΝΙ Κ Η ΕΤ ΑΙ Ρ Ι Α Τ ΣΙ ΜΕΝΤ ΩΝ Η Ρ ΑΚ Λ Η Σ ΑΡ. ΜΗ Τ Ρ. Α.Ε. : 13576/06/Β/86/096

Διαβάστε περισσότερα

M14/1/AYMGR/HP1/GRE/TZ0/XX

M14/1/AYMGR/HP1/GRE/TZ0/XX M14/1/AYMGR/HP1/GRE/TZ0/XX 22142045 MODERN GREEK A: LANGUAGE AND LITERATURE HIGHER LEVEL PAPER 1 GREC MODERNE A : LANGUE ET LITTÉRATURE NIVEAU SUPÉRIEUR ÉPREUVE 1 GRIEGO MODERNO A: LENGUA Y LITERATURA

Διαβάστε περισσότερα

1) Abstract (To be organized as: background, aim, workpackages, expected results) (300 words max) Το όριο λέξεων θα είναι ελαστικό.

1) Abstract (To be organized as: background, aim, workpackages, expected results) (300 words max) Το όριο λέξεων θα είναι ελαστικό. UΓενικές Επισημάνσεις 1. Παρακάτω θα βρείτε απαντήσεις του Υπουργείου, σχετικά με τη συμπλήρωση της ηλεκτρονικής φόρμας. Διευκρινίζεται ότι στα περισσότερα θέματα οι απαντήσεις ήταν προφορικές (τηλεφωνικά),

Διαβάστε περισσότερα

Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ

Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η προβολή επιστημονικών θεμάτων από τα ελληνικά ΜΜΕ : Η κάλυψή τους στον ελληνικό ημερήσιο τύπο Σαραλιώτου

Διαβάστε περισσότερα

Η ΨΥΧΙΑΤΡΙΚΗ - ΨΥΧΟΛΟΓΙΚΗ ΠΡΑΓΜΑΤΟΓΝΩΜΟΣΥΝΗ ΣΤΗΝ ΠΟΙΝΙΚΗ ΔΙΚΗ

Η ΨΥΧΙΑΤΡΙΚΗ - ΨΥΧΟΛΟΓΙΚΗ ΠΡΑΓΜΑΤΟΓΝΩΜΟΣΥΝΗ ΣΤΗΝ ΠΟΙΝΙΚΗ ΔΙΚΗ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΝΟΜΙΚΗ ΣΧΟΛΗ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΤΟΜΕΑΣ ΙΣΤΟΡΙΑΣ ΦΙΛΟΣΟΦΙΑΣ ΚΑΙ ΚΟΙΝΩΝΙΟΛΟΓΙΑΣ ΤΟΥ ΔΙΚΑΙΟΥ Διπλωματική εργασία στο μάθημα «ΚΟΙΝΩΝΙΟΛΟΓΙΑ ΤΟΥ ΔΙΚΑΙΟΥ»

Διαβάστε περισσότερα

ΙΩΑΝΝΗΣ ΛΑΣΚΑΡΗΣ, ΠΗΓΩΝΙΤΗΣ Ή ΣΥΡΠΑΓΑΝΟΣ, Ο ΚΑΛΟΜΙΣΙΔΗΣ

ΙΩΑΝΝΗΣ ΛΑΣΚΑΡΗΣ, ΠΗΓΩΝΙΤΗΣ Ή ΣΥΡΠΑΓΑΝΟΣ, Ο ΚΑΛΟΜΙΣΙΔΗΣ ΙΩΑΝΝΗΣ ΛΑΣΚΑΡΗΣ, ΠΗΓΩΝΙΤΗΣ Ή ΣΥΡΠΑΓΑΝΟΣ, Ο ΚΑΛΟΜΙΣΙΔΗΣ Ἀναπάντεχες λεπτομέρειες γιὰ τὸν βίο καὶ τὴν πολιτεία τοῦ Ἰωάννη Λάσκαρη μᾶς εἶναι γνωστὲς ἀπὸ μιὰ σειρὰ ἐγγράφων (ποὺ ἀνακάλυψε στὰ κρατικὰ ἀρχεῖα

Διαβάστε περισσότερα

Session novembre 2009

Session novembre 2009 ΥΠΟΥΡΓΕΙΟ ΕΘΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΚΡΑΤΙΚΟ ΠΙΣΤΟΠΟΙΗΤΙΚΟ ΓΛΩΣΣΟΜΑΘΕΙΑΣ MINISTÈRE GREC DE L ÉDUCATION NATIONALE ET DES CULTES CERTIFICATION EN LANGUE FRANÇAISE NIVEAU ÉPREUVE B1 sur l échelle proposée

Διαβάστε περισσότερα

ΠΕΡΙΕΧΟΜΕΝΑ. Μάρκετινγκ Αθλητικών Τουριστικών Προορισμών 1

ΠΕΡΙΕΧΟΜΕΝΑ. Μάρκετινγκ Αθλητικών Τουριστικών Προορισμών 1 ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΔΙΟΙΚΗΣΗΣ ΤΜΗΜΑ ΔΙΟΙΚΗΣΗΣ ΕΠΙΧΕΙΡΗΣΕΩΝ ΔΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «Σχεδιασμός, Διοίκηση και Πολιτική του Τουρισμού» ΜΑΡΚΕΤΙΝΓΚ ΑΘΛΗΤΙΚΩΝ ΤΟΥΡΙΣΤΙΚΩΝ

Διαβάστε περισσότερα

Κ Α Ν Ο Ν Ι Σ Μ Ο Σ Λ Ε Ι Τ Ο Υ Ρ Γ Ι Α Σ Ε Π Ι Τ Ρ Ο Π Ω Ν

Κ Α Ν Ο Ν Ι Σ Μ Ο Σ Λ Ε Ι Τ Ο Υ Ρ Γ Ι Α Σ Ε Π Ι Τ Ρ Ο Π Ω Ν Κ Α Ν Ο Ν Ι Σ Μ Ο Σ Λ Ε Ι Τ Ο Υ Ρ Γ Ι Α Σ Ε Π Ι Τ Ρ Ο Π Ω Ν Ψ η φ ί σ τ η κ ε α π ό τ η Γ ε ν ι κ ή Σ υ ν έ λ ε υ σ η τ ω ν Μ ε λ ώ ν τ ο υ Σ Ε Π Ε τ η ν 24 η Μ α ΐ ο υ 2003 Δ ι ά τ α ξ η Ύ λ η ς 1. Π

Διαβάστε περισσότερα

ΑΛΕΞΑΝΔΡΟΣ ΠΑΛΛΗΣ SCHOOLTIME E-BOOKS

ΑΛΕΞΑΝΔΡΟΣ ΠΑΛΛΗΣ SCHOOLTIME E-BOOKS ΟΜΗΡΟΥ ΙΛΙΑΔΑ ΑΛΕΞΑΝΔΡΟΣ ΠΑΛΛΗΣ SCHOOLTIME E-BOOKS www.scooltime.gr [- 2 -] The Project Gutenberg EBook of Iliad, by Homer This ebook is for the use of anyone anywhere at no cost and with almost no restrictions

Διαβάστε περισσότερα

Math 6 SL Probability Distributions Practice Test Mark Scheme

Math 6 SL Probability Distributions Practice Test Mark Scheme Math 6 SL Probability Distributions Practice Test Mark Scheme. (a) Note: Award A for vertical line to right of mean, A for shading to right of their vertical line. AA N (b) evidence of recognizing symmetry

Διαβάστε περισσότερα

ΕΡΕΥΝΑ ΕΠΙΤΥΧΙΑ ΚΑΤΑΡΤΙΣΗ ΕΡΓΑΣΙΑ ΕΜΠΕΙΡΙΑ ΥΠΟΤΡΟΦΙΕΣ ΕΚΠΑΙΔΕΥΣΗ ΑΚΑΔΗΜΑΙΚΗ ΕΠΙΤΥΧΙΑ ΚΥΠΡΟΣ ΟΔΗΓΟΣ ΕΠΙΤΥΧΙΑΣ: ΣΤΑΔΙΟΔΡΟΜΙΑ ΧΩΡΙΣ ΣΥΝΟΡΑ!

ΕΡΕΥΝΑ ΕΠΙΤΥΧΙΑ ΚΑΤΑΡΤΙΣΗ ΕΡΓΑΣΙΑ ΕΜΠΕΙΡΙΑ ΥΠΟΤΡΟΦΙΕΣ ΕΚΠΑΙΔΕΥΣΗ ΑΚΑΔΗΜΑΙΚΗ ΕΠΙΤΥΧΙΑ ΚΥΠΡΟΣ ΟΔΗΓΟΣ ΕΠΙΤΥΧΙΑΣ: ΣΤΑΔΙΟΔΡΟΜΙΑ ΧΩΡΙΣ ΣΥΝΟΡΑ! ΕΡΓΑΣΙΑ ΕΠΑΓΓΕΛΜΑΤΙΚΗ ΥΠΕΡΟΧΗ ΚΑΤΑΡΤΙΣΗ ΕΚΠΑΙΔΕΥΣΗ ΕΠΙΤΥΧΙΑ ΕΜΠΕΙΡΙΑ ΚΥΠΡΟΣ ΕΥΡΩΠΗ ΓΝΩΣΗ ΥΠΟΤΡΟΦΙΕΣ ΑΚΑΔΗΜΑΙΚΗ ΕΠΙΤΥΧΙΑ ΕΡΕΥΝΑ ΟΔΗΓΟΣ ΕΠΙΤΥΧΙΑΣ: ΣΤΑΔΙΟΔΡΟΜΙΑ ΧΩΡΙΣ ΣΥΝΟΡΑ! ΠΑΝΕΠΙΣΤΗΜΙΟ FREDERICK ΥΠΗΡΕΣΙΑ

Διαβάστε περισσότερα

Η ΕΕ εγκρίνει νέο πρόγραµµα για ασφαλέστερη χρήση του Ίντερνετ και διαθέτει 55 εκατ. ευρώ ώστε να καταστεί ασφαλές για τα παιδιά

Η ΕΕ εγκρίνει νέο πρόγραµµα για ασφαλέστερη χρήση του Ίντερνετ και διαθέτει 55 εκατ. ευρώ ώστε να καταστεί ασφαλές για τα παιδιά IP/8/899 Βρυξέλλες, 9 εκεµβρίου 8 Η ΕΕ εγκρίνει νέο πρόγραµµα για ασφαλέστερη χρήση του Ίντερνετ και διαθέτει εκατ. ευρώ ώστε να καταστεί ασφαλές για τα παιδιά Από την η Ιανουαρίου 9 η ΕΕ θα διαθέτει ένα

Διαβάστε περισσότερα

Αναερόβια Φυσική Κατάσταση

Αναερόβια Φυσική Κατάσταση Αναερόβια Φυσική Κατάσταση Γιάννης Κουτεντάκης, BSc, MA. PhD Αναπληρωτής Καθηγητής ΤΕΦΑΑ, Πανεπιστήµιο Θεσσαλίας Περιεχόµενο Μαθήµατος Ορισµός της αναερόβιας φυσικής κατάστασης Σχέσης µε µηχανισµούς παραγωγής

Διαβάστε περισσότερα

Το κοινωνικό στίγμα της ψυχικής ασθένειας

Το κοινωνικό στίγμα της ψυχικής ασθένειας Διεπιζηημονική Φρονηίδα Υγείας(2015) Τόμος 7,Τεύχος 1, 8-18 ISSN 1791-9649 Το κοινωνικό στίγμα της ψυχικής ασθένειας Κνξδώζε Α 1, Σαξίδε Μ 2, Σνπιηώηεο Κ 3 1 Ννζειεύηξηα ΤΔ, MSc, Γεληθό Ννζνθνκείν Κνξίλζνπ.

Διαβάστε περισσότερα

ΠΡΟΤΑΣΗ ΖΩΗΣ: «Η ΒΙΟΛΟΓΙΚΗ ΚΑΛΛΙΕΡΓΕΙΑ ΚΑΙ ΤΑ ΠΡΟΪΟΝΤΑ ΤΗΣ»

ΠΡΟΤΑΣΗ ΖΩΗΣ: «Η ΒΙΟΛΟΓΙΚΗ ΚΑΛΛΙΕΡΓΕΙΑ ΚΑΙ ΤΑ ΠΡΟΪΟΝΤΑ ΤΗΣ» ΠΡΟΤΑΣΗ ΖΩΗΣ: «Η ΒΙΟΛΟΓΙΚΗ ΚΑΛΛΙΕΡΓΕΙΑ ΚΑΙ ΤΑ ΠΡΟΪΟΝΤΑ ΤΗΣ» ΠΑΣΧΑΛΙΔΗΣ Ν. 1, και ΤΣΑΜΠΛΗΣ Ι. 1 1 3 Ο Δημοτικό Σχολείο Δράμας, Α/θμια Εκπαίδευση Δράμας e-mail: nikospas18@yahoo.gr ΠΕΡΙΛΗΨΗ Οι λόγοι επιλογής

Διαβάστε περισσότερα

ΣΟΡΟΠΤΙΜΙΣΤΡΙΕΣ ΕΛΛΗΝΙΔΕΣ

ΣΟΡΟΠΤΙΜΙΣΤΡΙΕΣ ΕΛΛΗΝΙΔΕΣ ΕΛΛΗΝΙΔΕΣ ΣΟΡΟΠΤΙΜΙΣΤΡΙΕΣ ΕΚΔΟΣΗ ΤΗΣ ΣΟΡΟΠΤΙΜΙΣΤΙΚΗΣ ΕΝΩΣΗΣ ΕΛΛΑΔΟΣ - ΤΕΥΧΟΣ Νο 110 - Δ ΤΡΙΜΗΝΟ 2014 Το πρώτο βραβείο κέρδισε η Ελλάδα για την φωτογραφία Blue + Yellow = Green στον διαγωνισμό 2014 του

Διαβάστε περισσότερα

Πανεπιστήμιο Πειραιώς Τμήμα Πληροφορικής Πρόγραμμα Μεταπτυχιακών Σπουδών «Πληροφορική»

Πανεπιστήμιο Πειραιώς Τμήμα Πληροφορικής Πρόγραμμα Μεταπτυχιακών Σπουδών «Πληροφορική» Πανεπιστήμιο Πειραιώς Τμήμα Πληροφορικής Πρόγραμμα Μεταπτυχιακών Σπουδών «Πληροφορική» Μεταπτυχιακή Διατριβή Τίτλος Διατριβής Επίκαιρα Θέματα Ηλεκτρονικής Διακυβέρνησης Ονοματεπώνυμο Φοιτητή Σταμάτιος

Διαβάστε περισσότερα

Όλνκα πνπδάζηξηαο: Γξεγνξία αββίδνπ Α.Δ.Μ:7859. Δπηβιέπνλ Καζεγεηήο: Παζραιίδεο Αζαλάζηνο ΑΝΩΣΑΣΟ ΣΔΥΝΟΛΟΓΗΚΟ ΔΚΠΑΗΓΔΤΣΗΚΟ ΗΓΡΤΜΑ ΚΑΒΑΛΑ

Όλνκα πνπδάζηξηαο: Γξεγνξία αββίδνπ Α.Δ.Μ:7859. Δπηβιέπνλ Καζεγεηήο: Παζραιίδεο Αζαλάζηνο ΑΝΩΣΑΣΟ ΣΔΥΝΟΛΟΓΗΚΟ ΔΚΠΑΗΓΔΤΣΗΚΟ ΗΓΡΤΜΑ ΚΑΒΑΛΑ ΑΝΩΣΑΣΟ ΣΔΥΝΟΛΟΓΗΚΟ ΔΚΠΑΗΓΔΤΣΗΚΟ ΗΓΡΤΜΑ ΚΑΒΑΛΑ ΥΟΛΖ ΓΗΟΗΚΖΖ ΚΑΗ ΟΗΚΟΝΟΜΗΑ ΣΜΖΜΑ ΛΟΓΗΣΗΚΖ Εςπωπαϊϊκή Εταιιπείία,, ο θεσμόρ καιι η ανάπτςξη τηρ. Όλνκα πνπδάζηξηαο: Γξεγνξία αββίδνπ Α.Δ.Μ:7859 Δπηβιέπνλ Καζεγεηήο:

Διαβάστε περισσότερα

ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΑΓΩΓΗΣ

ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΑΓΩΓΗΣ ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΑΓΩΓΗΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΕΚΠΑΙΔΕΥΣΗΣ ΣΤΗΝ ΠΡΟΣΧΟΛΙΚΗ ΗΛΙΚΙΑ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Διαπολιτισμική Εκπαίδευση και Θρησκευτική Ετερότητα: εθνικές και θρησκευτικές

Διαβάστε περισσότερα

ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ «ΘΕΜΑ»

ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ «ΘΕΜΑ» ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΠΡΟΣΧΟΛΙΚΗΣ ΑΓΩΓΗΣ ΚΑΙ ΤΟΥ ΕΚΠΑΙΔΕΥΤΙΚΟΥ ΣΧΕΔΙΑΣΜΟΥ Π.Μ.Σ. «ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΠΑΙΔΕΥΣΗ» ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ «ΘΕΜΑ» «Εφαρμογή

Διαβάστε περισσότερα

Δηθνλνγξαθεκέλν Λεμηθό Σν Πξώην κνπ Λεμηθό

Δηθνλνγξαθεκέλν Λεμηθό Σν Πξώην κνπ Λεμηθό ΤΠΟΤΡΓΔΗΟ ΠΑΗΓΔΗΑ ΚΑΗ ΘΡΖΚΔΤΜΑΣΧΝ, ΠΟΛΗΣΗΜΟΤ ΚΑΗ ΑΘΛΖΣΗΜΟΤ Η.Σ.Τ.Δ. «ΓΗΟΦΑΝΣΟ» Αή Δί Ζίο Γήο Μί Μά Ηί Αύ Δέ Λό Σ Πώ Λό Α, Β, Γ Γύ Σόο 7ο (Σ, Τ, Φ, Υ, Φ,Φ Χ, Πά) Δέ Λό Α, Β, Γ Γύ Σ Πώ Λό Σόο 7ο (Σ, Τ,

Διαβάστε περισσότερα

ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ

ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕΔΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE

Διαβάστε περισσότερα

ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ USE INSTRUCTIONS

ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ USE INSTRUCTIONS ΟΔΗΓΙΕΣ ΧΡΗΣΗΣ USE INSTRUCTIONS ΤΗΛΕΦΩΝΟ ΜΕ ΑΝΑΓΝΩΡΙΣΗ ΚΛΗΣΗΣ /CORDED PHONE WITH CALLER ID ΜΟΝΤΕΛΟ/MODEL: TM09-448 DC48V Παρακαλούμε διαβάστε προσεκτικά όλες τις οδηγίες χρήσης πριν την χρήση της συσκευής

Διαβάστε περισσότερα

LESSON 28 (ΜΑΘΗΜΑ ΕΙΚΟΣΙ ΟΚΤΩ) REF : 201/033/28. 2 December 2014

LESSON 28 (ΜΑΘΗΜΑ ΕΙΚΟΣΙ ΟΚΤΩ) REF : 201/033/28. 2 December 2014 LESSON 28 (ΜΑΘΗΜΑ ΕΙΚΟΣΙ ΟΚΤΩ) REF : 201/033/28 2 December 2014 Place/Seat Right (noun) I am right I am not right It matters It does not matter The same (singular) The same (Plural) Η θέση Το δίκιο Έχω

Διαβάστε περισσότερα

: 14PROC002178853 . : 210 36.94.100. φ : 213 2116445 Fax : 210 3630110 E-mail : d.anagnostopoulos@tpd.gr. (PCs)». (L 335)».

: 14PROC002178853 . : 210 36.94.100. φ : 213 2116445 Fax : 210 3630110 E-mail : d.anagnostopoulos@tpd.gr. (PCs)». (L 335)». : 14PROC002178853 T Θ Ω & Ω π α α, 18-7-2014 α α 40-10174 Θ..: 5241. : 210 36.94.100 Θ : π ( 2) : ΓΣ φ :. α π υ φ : 213 2116445 Fax : 210 3630110 E-mail : d.anagnostopoulos@tpd.gr Θ : Δ α υ π υ α, α α

Διαβάστε περισσότερα

ήσ ς Creative Commons.

ήσ ς Creative Commons. π ά π υ Μά ά Τ υ 2 Α ά Ν ύ Π Τεχ γ Επ ω Ά ι ς ό ι ι ό ι ό ήσ ς Creative Commons ήσης ό ι ι σ ά ι ς ι ι ι ό ι ό, ό ς ι ό ς, ό ι ι σ ά ύ ά ις ήσ ς, ά ι ήσ ς φέ ι ώς 2 η ό ηση ό ι ι ι ό ι όέ ι θ ίσ ι ύ έ

Διαβάστε περισσότερα

Στο εστιατόριο «ToDokimasesPrinToBgaleisStonKosmo?» έξω από τους δακτυλίους του Κρόνου, οι παραγγελίες γίνονται ηλεκτρονικά.

Στο εστιατόριο «ToDokimasesPrinToBgaleisStonKosmo?» έξω από τους δακτυλίους του Κρόνου, οι παραγγελίες γίνονται ηλεκτρονικά. Διαστημικό εστιατόριο του (Μ)ΑστροΈκτορα Στο εστιατόριο «ToDokimasesPrinToBgaleisStonKosmo?» έξω από τους δακτυλίους του Κρόνου, οι παραγγελίες γίνονται ηλεκτρονικά. Μόλις μια παρέα πελατών κάτσει σε ένα

Διαβάστε περισσότερα

FAX : 210.34.42.241 spudonpe@ypepth.gr) Φ. 12 / 600 / 55875 /Γ1

FAX : 210.34.42.241 spudonpe@ypepth.gr) Φ. 12 / 600 / 55875 /Γ1 Ε Λ Λ Η Ν Ι Κ Η Η Μ Ο Κ Ρ Α Τ Ι Α Υ ΠΟΥ ΡΓΕΙΟ ΕΘΝ. ΠΑ Ι ΕΙΑ Σ & ΘΡΗΣ Κ/Τ Ω ΕΝΙΑ ΙΟΣ ΙΟΙΚΗΤ ΙΚΟΣ Τ ΟΜ ΕΑ Σ Σ ΠΟΥ Ω Ν ΕΠΙΜ ΟΡΦΩ Σ ΗΣ ΚΑ Ι ΚΑ ΙΝΟΤ ΟΜ ΙΩ Ν /ΝΣ Η Σ ΠΟΥ Ω Τ µ ή µ α Α Α. Πα π α δ ρ έ ο υ 37

Διαβάστε περισσότερα

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση κατά του ιού της γρίπης Σε δομές του νομού Λάρισας

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση κατά του ιού της γρίπης Σε δομές του νομού Λάρισας ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΡΩΤΟΒΑΘΜΙΑ ΦΡΟΝΤΙΔΑ ΥΓΕΙΑΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση

Διαβάστε περισσότερα