ιπλωµατική Εργασία: Βελτίωση της ακρίβειας ταξινόµησης συνόλων δεδοµένων µικροσυστοιχιών µε εκµετάλλευση γνώσης από τη Γονιδιακή Οντολογία

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ιπλωµατική Εργασία: Βελτίωση της ακρίβειας ταξινόµησης συνόλων δεδοµένων µικροσυστοιχιών µε εκµετάλλευση γνώσης από τη Γονιδιακή Οντολογία"

Transcript

1 ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ιπλωµατική Εργασία: Βελτίωση της ακρίβειας ταξινόµησης συνόλων δεδοµένων µικροσυστοιχιών µε εκµετάλλευση γνώσης από τη Γονιδιακή Οντολογία του Παπαχριστούδη Γεωργίου Α.Ε.Μ.: 4691 Επιβλέπων Καθηγητής: Μήτκας Περικλής Θεσσαλονίκη, Ιούνιος

2 ΠΕΡΙΕΧΟΜΕΝΑ Ευχαριστίες...4 Εικόνες...6 Πίνακες Εισαγωγή Ορισµός του προβλήµατος Στόχοι διπλωµατικής Μεθοδολογία Οργάνωση της διπλωµατικής Επιτοµή βασικών βιολογικών εννοιών Σχέση Βιοπληροφορικής και Υπολογιστικής Βιολογίας Περιοχές έρευνας οµή του DNA Γονίδια Γονιδιακή έκφραση Μικροσυστοιχίες ιαδικασία κατασκευής µικροσυστοιχιών Μειονεκτήµατα από τη χρήση µικροσυστοιχιών Επεξήγηση των εννοιών της Οντολογίας και της Γονιδιακής Οντολογίας Ορισµός της Οντολογίας Βιοϊατρικές Οντολογίες Γονιδιακή Οντολογία Περιγραφή της Γονιδιακής Οντολογίας και των απόψεών της οµή της Γονιδιακής Οντολογίας Αρχεία Επισηµείωσης Όρων Γονιδιακής Οντολογίας Κανόνας του Ορθού Μονοπατιού Τύπος απόδειξης ως µέσο εξακρίβωσης της εγκυρότητας της επισηµείωσης Πλεονεκτήµατα και µειονεκτήµατα από τη χρήση επισηµειώσεων GO όρων Ανάλυση των χρησιµοποιούµενων µεθόδων Εξόρυξη εδοµένων Φιλτράρισµα γνωρισµάτων Λόγοι χρησιµοποίησης φιλτραρίσµατος γνωρισµάτων Παρουσίαση της ταξινόµησης φιλτραρίσµατος γνωρισµάτων Κριτήρια αξιολόγησης Μοντέλα φιλτραρίσµατος Μοντέλα περιτυλίγµατος ιαδικασίες παραγωγής Κατάταξη Μεµονωµένων Γνωρισµάτων (Individual Feature Ranking, IFR)

3 Επιλογή Υποσυνόλων Γνωρισµάτων (Feature Subset Selection, FSS) Ανάλυση χρησιµοποιούµενων αλγορίθµων φιλτραρίσµατος γνωρισµάτων Κέρδος σε Πληροφορία (Information Gain) Χι Τετράγωνο (Chi Square, Chi2) Relief Μηχανές ιανυσµάτων Υποστήριξης (Support Vector Machines, SVMs) ως αλγόριθµος εκπαίδευσης Σηµασιολογική οµοιότητα Πληροφοριακό περιεχόµενο (Information content) Μέθοδοι σηµασιολογικής οµοιότητας Resnik Lin Jiang & Conrath Cao oldzzl ZZL Leacock & Chodorow Wu & Palmer Resnik GRaSM Lin GRaSM Jiang & Conrath GRaSM Η ανάπτυξη του εργαλείου SoFoCles Λόγοι που οδήγησαν στην ανάπτυξη του SoFoCles Περιβάλλον ανάπτυξης του SoFoCles οµή του SoFoCles Συνοπτική περιγραφή των λειτουργιών του SoFoCles Εισαγωγή δεδοµένων Εισαγωγή παραµέτρων Παρουσίαση µηνυµάτων πληροφορίας Παραγωγή αποτελεσµάτων Προετοιµασία δεδοµένων εισόδου Arff αρχεία Αρχεία αντιστοίχησης (mappings) GOA αρχεία Αρχείο Γονιδιακής Οντολογίας Ο βασικός αλγόριθµος του SoFoCles Αποτίµηση των αποτελεσµάτων Μέτρα ελέγχου της αξιοπιστίας των αποτελεσµάτων D S σύνολο δεδοµένων Παρουσίαση του D S συνόλου δεδοµένων και των αποτελεσµάτων του Ανάλυση των αποτελεσµάτων του D S συνόλου δεδοµένων D CNV σύνολο δεδοµένων Παρουσίαση του D CNV συνόλου δεδοµένων και των αποτελεσµάτων του Ανάλυση των αποτελεσµάτων του D CNV συνόλου δεδοµένων Συµπεράσµατα και προοπτικές Συµπεράσµατα Προοπτικές Βιβλιογραφία Βιβλία και ηµοσιεύσεις

4 8.2 ιαδικτυακές Αναφορές Παράρτηµα Α Λίγα λόγια για τον Σοφοκλή και τους λόγους επιλογής αυτού του ονόµατος για το εργαλείο Παράρτηµα Β Εργαλεία και πακέτα που χρησιµοποιήθηκαν Β.1 Εργαλεία Β.1.1 JBuilder 2006 Enterprise Β.1.2 The R Project for Statistical Computing Β.2 Πακέτα Β.2.1 GO4J Β.2.2 Spring Framework Β.2.3 Weka Ευρετήριο Index

5 Ευχαριστίες Συνήθως η ενότητα των ευχαριστιών παρατίθεται στο τέλος ενός συγγράµµατος ως µία υποτυπώδη εκδήλωση ευγνωµοσύνης στους ανθρώπους που στήριξαν είτε ηθικά είτε υλικά τον συγγραφέα. Ας µου επιτραπεί να κάνω την εξαίρεση και να τοποθετήσω αυτή την ενότητα στην αρχή αυτού του συγγράµµατος ώστε να διασφαλιστεί το γεγονός της µνηµόνευσης όλων αυτών που συνέβαλλαν σε αυτή την εργασία από κάποιον πιθανό αναγνώστη. Αρχικά, θέλω να ευχαριστήσω τον Σωτήρη ιπλάρη, υποψήφιο διδάκτορα του τµήµατος Ηλεκτρολόγων Μηχανικών και Μηχανικών Υπολογιστών του Αριστοτελείου Πανεπιστηµίου Θεσσαλονίκης, ως επιβλέποντα της διπλωµατικής µου για τη συνεργασία µας καθόλη τη διάρκεια εκπόνησης της. Πιο συγκεκριµένα, τον ευχαριστώ για τη βοήθεια που µου παρείχε κατά την πρώτη µου επαφή µε θέµατα Βιοπληροφορικής, την εξήγηση του βασικού βιολογικού υποβάθρου του εξεταζόµενου προβλήµατος καθώς και για τη συνεισφορά του στην διπλωµατική εργασία όποτε αυτή κρίθηκε απαραίτητη. Επίσης, θα ήθελα να ευχαριστήσω τον κ. Michael Moorhouse, δόκτωρα του τµήµατος Ιολογίας του Πανεπιστηµίου Erasmus στην Ολλανδία, για τις πολύτιµες συµβουλές που µου έδωσε στην αρχή αυτής της διπλωµατικής δίνοντάς µου αισιοδοξία όταν η πρόοδος της εργασίας αρχικά βρισκόταν σε στάσιµα επίπεδα. Νιώθω επίσης την ανάγκη να ευχαριστήσω κ. Francisco Couto, επίκουρο καθηγητή του τµήµατος Πληροφορικής του Πανεπιστηµίου της Λισσαβόνας για την αποσαφήνιση ορισµένων σηµείων της δηµοσίευσής του [Couto Francisco, Silva Mário and Coutinho Pedro. Measuring Semantic Similarity between Gene Ontology Terms. Data & Knowledge Engineering, Volume 61, Issue 1, April 2007, pp ] και τη γόνιµη ανταλλαγή απόψεων κατά τις φορές που ήρθαµε σε επικοινωνία. Εξάλλου, θα ήθελα να στείλω τις ευχαριστίες µου στην κ. Σοφία Κοσσίδα, επικεφαλή της οµάδας Βιοπληροφορικής στο Ινστιτούτο Ιατροβιολογικών Ερευνών της Ακαδηµίας Αθηνών για την παροχή της δηµοσίευσης [Pomeroy SL et al. Prediction of central nervous system embryonal tumour outcome based on gene 4

6 expression. Nature, 415 (6870), 24 Jan 2002, pp ] για τους σκοπούς της διπλωµατικής. Αισθάνοµαι επίσης ευγνώµων για την πολύτιµη βοήθεια που µου προσέφερε ο φίλος µου Θανάσης Τερζής, πτυχιούχος του τµήµατος Εφαρµογών Πληροφορικής στη ιοίκηση και Οικονοµία του Ανωτάτου Τεχνολογικού Ιδρύµατος Μεσολογγίου αναλαµβάνοντας την καλλιτεχνική επιµέλεια του εξωφύλλου. Επιπλέον, θα ήθελα να ευχαριστήσω τον Φώτη Ψωµόπουλο, υποψήφιο διδάκτορα του τµήµατος Ηλεκτρολόγων Μηχανικών και Μηχανικών Υπολογιστών του Αριστοτελείου Πανεπιστηµίου Θεσσαλονίκης για την αδιάλειπτη και πάντα µε προθυµία παροχή της βοήθειας του όποτε του εζητήθη. Εξάλλου, στη διάρκεια της µονοετούς συνεργασίας µας αναπτύχθηκαν δεσµοί φιλίας καθώς και αισθήµατα αµοιβαίας αλληλοεκτίµησης. Ακόµη, θα ήθελα να ευχαριστήσω θερµά τον κ. Περικλή Μήτκα, καθηγητή του τµήµατος Ηλεκτρολόγων Μηχανικών και Μηχανικών Υπολογιστών του Αριστοτελείου Πανεπιστηµίου Θεσσαλονίκης όχι µόνο για την εµπιστοσύνη που επέδειξε στο πρόσωπό µου αναθέτοντας µου την εκπόνηση αυτής της διπλωµατικής εργασίας αλλά και γιατί µε στήριξε σε προσπάθειες µου πέρα από τα πλαίσια αυτής της εργασίας και έδειξε κατανόηση σε περιόδους όπου η προτεραιότητα περάτωσης άλλων προσωπικών θεµάτων έφερναν σε δεύτερη µοίρα την ανάπτυξη της διπλωµατικής. Κλείνοντας τον κύκλο των ευχαριστιών, θα ήθελα να ευχαριστήσω τους γονείς µου και την αδερφή µου για την παροιµιώδη υποµονή που επέδειξαν σε ουκ ολίγες στιγµές εντάσεων, αποτέλεσµα κούρασης και κόπου, αλλά και για την άγρυπνη συµπαράστασή τους στην προσπάθειά µου να εκπληρώσω τους στόχους µου. Τέλος, ξεφεύγοντας λίγο από τα στενά όρια απόδοσης ευχαριστιών σχετικά µε την εκπόνηση αυτής της διπλωµατικής εργασίας, δράττοµαι της ευκαιρίας να χαρίσω σε όλους αυτούς που µε στήριξαν ανιδιοτελώς και πίστεψαν σε µένα (συµπεριλαµβανοµένων και κάποιων από τα παραπάνω πρόσωπα) βοηθώντας µε να κυνηγήσω το όνειρό µου, το τρίτο στιχάκι από το παρακάτω απόφθεγµα του Νίκου Καζαντζάκη: Το πρώτο χρέος σου εκτελώντας τη θητεία σου στη ράτσα είναι να νιώσεις µέσα σου όλους τους προγόνους. Το δεύτερο να φωτίσεις την ορµή τους και να συνεχίσεις το έργο τους. Το τρίτο σου χρέος είναι να δώσεις στο γιό σου τη µεγάλη εντολή να σε ξεπεράσει 5

7 Εικόνες Εικόνα Περιγραφή Σελίδα 2.1 ιπλή Έλικα του DNA Νουκλεοτίδιο Σύνδεση δύο συµπληρωµατικών νουκλεοτιδίων µε δεσµό υδρογόνου Σύσταση του γονιδίου Εναλλακτικοί τρόποι συρραφής του γονιδίου Επεξήγηση του κωδικονίου Μικροσυστοιχία Χρωµατική διαβάθµιση µικροσυστοιχιών και επεξήγηση του χρωµατικού κώδικα ιαδικασία παραγωγής ενός πειράµατος µικροσυστοιχίας ιαδικασία κατασκευής µίας µικροσυστοιχίας Η Γονιδιακή Οντολογία Στιγµιότυπο της οντολογίας-άποψης της Μοριακής Λειτουργίας Στιγµιότυπο της οντολογίας-άποψης της Βιολογικής ιαδικασίας Στιγµιότυπο της οντολογίας-άποψης της Κυτταρικής Σύστασης Βασικοί τύποι (επίπεδα) part-of σχέσης είκτης αξιοπιστίας των τύπων αποδείξεων Απεικόνιση µη-βέλτιστου και βέλτιστου υπερ-επιπέδου Εύρεση του βέλτιστου υπερ-επιπέδου από τις Μηχανές ιανυσµάτων 82 Υποστήριξης (SVMs) 4.3 Η σηµασία των διανυσµάτων υποστήριξης στην πρόβλεψη νέων σηµείων Περίπτωση µη-γραµµικώς διαχωρίσιµου προβλήµατος ιαχωρισµός µη- γραµµικώς διαχωρίσιµων προβληµάτων µε χρήση πυρήνα Παράδειγµα γραµµικού πυρήνα Παράδειγµα πολυωνυµικού πυρήνα Παράδειγµα ακτινωτού (radial basis function) πυρήνα Παράδειγµα οντολογίας Σχήµα του SoFoCles Οθόνη εισαγωγής δεδοµένων του SoFoCles 121 6

8 5.3 Οθόνη ενηµέρωσης του χρήστη για ατελές ερώτηµα Οθόνη ενηµέρωσης του χρήστη για εισαγωγή αρχείου Γονιδιακής Οντολογίας µη 123 αποδεκτού format 5.5 Οθόνη ενηµέρωσης του χρήστη για εισαγωγή µη αποδεκτών χαρακτήρων κατά 123 την ονοµασία αρχείων 5.6 Οθόνη ενηµέρωσης του χρήστη για την πρόοδο αντιστοίχησης γονιδίων σε GO 124 όρους 5.7 Οθόνη ενηµέρωσης του χρήστη για την πρόοδο υπολογισµού της 124 σηµασιολογικής οµοιότητας 5.8 Οθόνη ενηµέρωσης του χρήστη για τη συνολική πρόοδο υπολογισµού της 125 σηµασιολογικής οµοιότητας 5.9 Οθόνη ενηµέρωσης του χρήστη για τη συνολική εικόνα που δηµιουργείται µετά 125 το πέρας του ερωτήµατος 5.10 ιάγραµµα ροής (flow chart) του SoFoCles Ακρίβεια ταξινόµησης για το D S σύνολο δεδοµένων Ρυθµοί Πραγµατικά Θετικών (TP Rates) και Λανθασµένα Θετικών (FP Rates) 150 της ετικέτας Current-Smoker για το D S σύνολο δεδοµένων 6.3 Ρυθµοί Πραγµατικά Θετικών (TP Rates), Precisions και F-Measures της ετικέτας 151 Current-Smoker για το D S σύνολο δεδοµένων 6.4 Ρυθµοί Πραγµατικά Θετικών (TP Rates) και Λανθασµένα Θετικών (FP Rates) 151 της ετικέτας Never-Smoked για το D S σύνολο δεδοµένων 6.5 Ρυθµοί Πραγµατικά Θετικών (TP Rates), Precisions και F-Measures της ετικέτας 152 Never-Smoked για το D S σύνολο δεδοµένων 6.6 Ρυθµοί Πραγµατικά Θετικών (TP Rates) και Λανθασµένα Θετικών (FP Rates) 152 της ετικέτας Former-Smoker για το D S σύνολο δεδοµένων 6.7 Ρυθµοί Πραγµατικά Θετικών (TP Rates), Precisions και F-Measures της ετικέτας 153 Former-Smoker για το D S σύνολο δεδοµένων 6.8 Μεταβολή της έκφρασης γονιδίων σε σχέση µε την ετικέτα του ασθενούς για το 156 D S σύνολο δεδοµένων 6.9 Ακρίβεια ταξινόµησης για το D CNV σύνολο δεδοµένων Ρυθµοί Πραγµατικά Θετικών (TP Rates) και Λανθασµένα Θετικών (FP Rates) 164 της ετικέτας Class1 (επιζώντες) για το D CNV σύνολο δεδοµένων 6.11 Ρυθµοί Πραγµατικά Θετικών (TP Rates), Precisions και F-Measures της ετικέτας 165 Class1 (επιζώντες) για το D CNV σύνολο δεδοµένων 6.12 Ρυθµοί Πραγµατικά Θετικών (TP Rates) και Λανθασµένα Θετικών (FP Rates) 165 της ετικέτας Class0 (αποτυχία) για το D CNV σύνολο δεδοµένων 6.13 Ρυθµοί Πραγµατικά Θετικών (TP Rates), Precisions και F-Measures της ετικέτας 166 Class0 (αποτυχία) για το D CNV σύνολο δεδοµένων Παρ. Α Σοφοκλής 176 7

9 Πίνακες Πίνακας Περιγραφή Σελίδα Ι Πίνακας αντιστοίχησης αµινοξέων κωδικονίων 21 ΙΙ Παρουσίαση των σχέσεων των βιοϊατρικών οντολογιών 31 ΙΙΙ Μερικές ιδιότητες των σχέσεων της ΟΒΟ Οντολογίας 32 ΙV Στοιχεία για την κατανοµή των όρων και των σχέσεων στη Γονιδιακή Οντολογία 42 V Ταξινόµηση µεθόδων φιλτραρίσµατος γνωρισµάτων 57 VI Αλγόριθµος Chi2 69 VII Πρωτότυπος αλγόριθµος Relief 74 VIII Αλγόριθµος Relief-F 79 IX Παρουσίαση ορισµένων όρων της ΒΡ οντολογίας κατά αύξουσα σειρά 95 πληροφοριακού περιεχοµένου X Πεδία ενός GOA αρχείου 129 XI Παρουσίαση των ποιοτικών χαρακτηριστικών για το D S σύνολο δεδοµένων 145 XII Confusion-Matrix για το D S σύνολο δεδοµένων 146 XIII Παρουσίαση των ποιοτικών χαρακτηριστικών για το D CNV σύνολο δεδοµένων 160 XIV Confusion-Matrix για το D CNV σύνολο δεδοµένων 161 8

10 1 Εισαγωγή Τα τελευταία χρόνια η ολοένα αυξανόµενη υπολογιστική δύναµη έχει δώσει λύσεις σε προβλήµατα πολλών διαφορετικών κλάδων επιστηµών. Από την άλλη, η διάθεση απέραντων σχεδόν αποθηκευτικών χώρων δίνει τη δυνατότητα εκτέλεσης πειραµάτων που παράγουν τεράστιους όγκους δεδοµένων και εσωκλείουν σηµαντική πληροφορία. Η εφαρµογή µαθηµατικών και στατιστικών µεθόδων βοηθούν στην αποµόνωση των σηµαντικών στοιχείων από πολύ µεγάλες πηγές δεδοµένων και εν τέλει στην εξαγωγή αυτής της χρήσιµης πληροφορίας. Τα παραπάνω έχουν δώσει ώθηση και σε βιολογικά προβλήµατα. Οι όγκοι δεδοµένων που παράγονται από τέτοιου είδους προβλήµατα κάνουν την παρουσία της Πληροφορικής καθώς και άλλων εφαρµοσµένων επιστηµών όχι µόνο επωφελή αλλά αναγκαία για την επεξεργασία τους. Η συνέργεια όλων των παραπάνω επιστηµών για την επίλυση βιολογικών προβληµάτων οδήγησε στην ανάπτυξη ενός νέου κλάδου που είναι γνωστός µε το όνοµα Βιοπληροφορική. Με απλά λόγια, η Βιοπληροφορική είναι η ανάπτυξη και εφαρµογή εργαλείων για την οργάνωση και ανάλυση τέτοιων δεδοµένων. 1.1 Ορισµός του προβλήµατος Ένα από τα πιο διαδεδοµένα προβλήµατα βιοπληροφορικής είναι αυτό της ανάλυσης µικροσυστοιχιών. Οι µικροσυστοιχίες είναι διατάξεις που επιτρέπουν την εποπτεία του τρόπου έκφρασης γονιδίων ή γονιδιακών προϊόντων υπό διαφορετικές συνθήκες. Παρόλα τα πλεονεκτήµατα αυτών των διατάξεων, ο τεράστιος όγκος δεδοµένων και κυρίως η µεγάλη διαφορά µεταξύ του πλήθους των γονιδίων και των διαφορετικών συνθηκών κάνει ιδιαίτερα δύσκολη την εξαγωγή χρήσιµης πληροφορίας. Πιο συγκεκριµένα, οι υπάρχοντες αλγόριθµοι εκµάθησης και φιλτραρίσµατος γνωρισµάτων δεν έχουν κατασκευαστεί για να αντιµετωπίζουν 9

11 βέλτιστα τέτοια ογκώδη σύνολα δεδοµένων. Έτσι, πέρα από την αύξηση του υπολογιστικού χρόνου είναι πιθανό να δηµιουργηθούν και φαινόµενα υπερεκπαίδευσης, όπου καθίσταται αδύνατη η ασφαλής γενίκευση των συµπερασµάτων. Επιπλέον, η παρουσία πολλών άσχετων προς το πρόβληµα γονιδίων γνωρισµάτων εµποδίζει την εµφάνιση της διακριτικός ισχύος των σχετικών (προς το πρόβληµα) γονιδίων γνωρισµάτων. Τέλος, µεγάλη σηµασία εµφανίζει η απόδοση βιολογικής ερµηνείας στα παραγόµενα αποτελέσµατα κάτι που µέχρι στιγµής δεν καλύπτεται από τις υπάρχουσες µεθόδους. Τα παραπάνω έχουν ωθήσει στη δηµιουργία ενός νέου εργαλείου, όπου γίνεται προσπάθεια εισαγωγής βιολογικής γνώσης στα δεδοµένα µε στόχο την παραγωγή αποτελεσµάτων µε πληρέστερο βιολογικό νόηµα. 1.2 Στόχοι διπλωµατικής Μέχρι τούδε ο συχνότερος τρόπος αντιµετώπισης αυτού του προβλήµατος ήταν µέσω της εφαρµογής µεθόδων στατιστικής οµοιότητας όπου µε αυτό τον τρόπο επιτυγχανόταν η αποµόνωση των πιο πληροφοριακών γονιδίων βάσει των τιµών τους κατά µήκος του συγκεκριµένου συνόλου δεδοµένων. Αυτό που φιλοδοξούµε να επιτύχουµε σε αυτή τη διπλωµατική θέση είναι: i. Να βελτιώσουµε την ποιότητα των αποτελεσµάτων όχι µόνο µε την αποκλειστική χρήση της εσωτερικής πληροφορίας του συνόλου δεδοµένων µέσω της εφαρµογής µεθόδων επιλογής γνωρισµάτων αλλά να προχωρήσουµε ένα βήµα πιο µπροστά εκµεταλλευόµενοι τη γνώση που µας προσφέρει ένα δοµηµένο λεξιλόγιο γονιδιακών όρων, γνωστό µε την ονοµασία Γονιδιακή Οντολογία. ii. Να αναπτύξουµε την κατάλληλη µεθοδολογία για την επίτευξη των προαναφερθέντων απαιτήσεων. iii. Να κατασκευάσουµε το εργαλείο που θα βασίζεται στην παραπάνω µεθοδολογία και θα υλοποιείται σε µία µεταφέρσιµη γλώσσα προγραµµατισµού (όπως είναι η Java). iv. Να εκτελέσουµε ικανό αριθµό πειραµάτων που θα πιστοποιούν τη χρησιµότητα ή µη του παραπάνω εργαλείου. Με λίγα λόγια, ο κύριος στόχος της διπλωµατικής αυτής είναι η βελτίωση όχι µόνο της ακρίβειας ταξινόµησης καθώς και άλλων µέτρων ελέγχου της αξιοπιστίας 10

12 των αποτελεσµάτων αλλά και η απόδοση περισσότερης βιολογικής ερµηνείας σε αυτά αξιοποιώντας πληροφορία που περιέχει βιολογικό νόηµα και είναι ήδη επιστηµονικώς τεκµηριωµένη. 1.3 Μεθοδολογία Το κύριο πρόβληµα αυτής της διπλωµατικής ήταν η εύρεση ενός τρόπου ενοποίησης της υπάρχουσας βιολογικής γνώσης και της γνώσης που εµπεριέχεται στα εσωτερικά χαρακτηριστικά των συνόλων δεδοµένων. Αναλυτικότερα, οι είσοδοι για το πρόβληµά µας ήταν σύνολα δεδοµένων µικροσυστοιχιών καθώς και αρχεία Γονιδιακής Οντολογίας και Καταχώρησης Όρων Γονιδιακής Οντολογίας. Ο τελικός στόχος ήταν η άντληση της βιολογικής πληροφορίας που περιέχεται στη Γονιδιακή Οντολογία και σε συνδυασµό µε την εφαρµογή µεθόδων φιλτραρίσµατος γνωρισµάτων στο αρχικό σύνολο δεδοµένων, η παραγωγή ενός µικρότερου συνόλου που θα περιείχε ως επί το πλείστον γονίδια γνωρίσµατα σχετικά προς το πρόβληµα. Με αυτό τον τρόπο επιχειρείται η βελτίωση της ποιότητας των αποτελεσµάτων. Συνοπτικά, η διαδικασία που ακολουθήθηκε για την επίτευξη του παραπάνω στόχου ήταν η εξής: Αρχικά εφαρµόζεται κάποια από τις γνωστές µεθόδους φιλτραρίσµατος γνωρισµάτων. Αποτέλεσµα αυτής της διαδικασίας είναι η αποµόνωση των πιο πληροφοριακών γονιδίων (γονιδίων γνωρισµάτων) βάσει των εσωτερικών χαρακτηριστικών τους στο σύνολο δεδοµένων. Από αυτό το στάδιο κατασκευάζεται και ένα αρχείο που περιέχει τα πιο πληροφοριακά γονίδια του αρχικού συνόλου δεδοµένων (καθώς και τιµές τους κατά µήκος όλων των παραδειγµάτων του αρχικού συνόλου). Στη συνέχεια, αφού εντοπιστούν όλοι οι όροι (από τις επιθυµητές οντολογίες απόψεις) των γονιδίων του συνόλου δεδοµένων µέσω των GOA αρχείων, υπολογίζεται η σηµασιολογική οµοιότητα µεταξύ των πιο πληροφορικών γονιδίων (αυτών που περιέχονται στο µικρότερο αρχείο) και αυτών που απορρίφθηκαν κατά την εφαρµογή µεθόδων επιλογής γνωρισµάτων. Κατόπιν, επαναεισάγονται ορισµένα από τα γονίδια που είχαν προηγουµένως απορριφθεί αλλά εµφανίζονται να έχουν υψηλή σηµασιολογική οµοιότητα (άρα, κοινές λειτουργίες) µε τα πιο πληροφοριακά γονίδια. ηµιουργείται, έτσι, ένα σύνολο δεδοµένων που περιέχει τα πιο πληροφοριακά γονίδια και επιπροσθέτως γονίδια που έχουν µεγάλη (λειτουργική) οµοιότητα µε αυτά. 11

13 Τέλος, για την αποτίµηση των αποτελεσµάτων γίνεται σύγκριση της ακρίβειας ταξινόµησης καθώς και άλλων µέτρων ελέγχου της αξιοπιστίας µεταξύ του αρχικού συνόλου, αυτού που περιέχει µόνο τα πιο πληροφοριακά γονίδια γνωρίσµατα και αυτού που παράγεται από το εργαλείο αυτής της διπλωµατικής (που περιέχει δηλαδή τα πιο πληροφοριακά γονίδια γνωρίσµατα και επιπλέον τα γονίδια γνωρίσµατα που εµφανίζουν µεγάλη οµοιότητα µε αυτά). 1.4 Οργάνωση της διπλωµατικής Η διπλωµατική συνεχίζει µε το Κεφάλαιο 2 όπου γίνεται µία εισαγωγή στις βασικές βιολογικές έννοιες που αφορούν το συγκεκριµένο πρόβληµα. Αρχικά, ορίζονται οι έννοιες της Βιοπληροφορικής και της Υπολογιστικής Βιολογίας (2.1), κλάδοι στους οποίους εντάσσεται το συγκεκριµένο πρόβληµα. Έπειτα, επεξηγώντας γενικές έννοιες όπως το DNA, τα γονίδια και τη γονιδιακή έκφραση (2.2) επιτυγχάνεται το οµαλό πέρασµα στις µικροσυστοιχίες (2.3), όπου γίνεται εκτενής αναφορά σε αυτές και τη χρησιµότητά τους ενώ στο τέλος παρατίθενται και τα µειονεκτήµατα από τη χρησιµοποίησή τους. Αφού έχουµε αναπτύξει το στέρεο βιολογικό υπόβαθρο του προβλήµατος, προχωρούµε στο Κεφάλαιο 3 όπου αναλύεται αρχικά η έννοια της Οντολογίας (3.1) και κατόπιν η έννοια της Γονιδιακής Οντολογίας (3.3), που αποτελεί το βασικότερο εργαλείο σε αυτή τη διπλωµατική. Κατόπιν, το Κεφάλαιο 4 αποτελεί το τεχνικό κοµµάτι της διπλωµατικής αφού περιγράφονται αναλυτικά οι χρησιµοποιούµενες µέθοδοι. Αρχικά, γίνεται αναφορά σε γενικές έννοιες όπως η Εξόρυξη εδοµένων, Απόκτηση Γνώσης και Εκµάθηση Μηχανών (4.1). Στη συνέχεια, παρουσιάζεται η έννοια του φιλτραρίσµατος γνωρισµάτων (4.2) προτού παρατεθούν οι λόγοι χρησιµοποίησης αυτών των µεθόδων, ενώ επιχειρείται και η ταξινόµηση αυτών των µεθόδων βάσει των διαφορετικών κριτηρίων αξιολόγησης και διαδικασιών παραγωγής. Εν συνεχεία, περιγράφονται διεξοδικά οι µέθοδοι φιλτραρίσµατος γνωρισµάτων που χρησιµοποιήθηκαν σε αυτήν εδώ τη διπλωµατική (Information Gain, Chi Square, Relief). Συνεχίζει µε την ανάπτυξη της θεωρίας των Μηχανών ιανυσµάτων Υποστήριξης (Support Vector Machines) ως αλγορίθµου εκπαίδευσης των δεδοµένων (4.3). Το Κεφάλαιο 4 κλείνει µε την παράθεση της έννοιας της σηµασιολογικής οµοιότητας (4.4) και την επεξήγηση ενός βασικότατου στοιχείου που χρησιµοποιείται κατά τον υπολογισµό της σηµασιολογικής οµοιότητας, του 12

14 πληροφοριακού περιεχοµένου. Τέλος, αναπτύσσονται οι µέθοδοι σηµασιολογικής οµοιότητας που υλοποιήθηκαν σε αυτήν την εργασία. Συνεχίζοντας, στο Κεφάλαιο 5 παρουσιάζεται αναλυτικά η πορεία ανάπτυξης του αλγορίθµου. Πιο συγκεκριµένα, αρχικά παρατίθενται οι λόγοι που οδήγησαν στην αναγκαιότητα ανάπτυξης ενός τέτοιου εργαλείου (5.1). Κατόπιν, γίνεται λόγος για το περιβάλλον ανάπτυξης του εργαλείου (5.2), ενώ στη συνέχεια παρουσιάζεται η δοµή του (5.3). Αφού πια ο αναγνώστης έχει λάβει µία πρώτη γνώση του τρόπου λειτουργίας του εργαλείου, περιγράφονται οι διάφορες λειτουργίες του (5.4) καθώς και η κατάλληλη µορφή των δεδοµένων εισόδου (5.5). Στο τέλος του Κεφαλαίου, παρατίθεται ο βασικός αλγόριθµος του SoFoCles (5.6). Κατόπιν, στο Κεφάλαιο 6 επιχειρείται η αποτίµηση των αποτελεσµάτων. Αφού πρώτα περιγραφούν τα µέτρα ελέγχου της αξιοπιστίας των αποτελεσµάτων (6.1), γίνεται παρουσίαση και αξιολόγηση των αποτελεσµάτων σε δύο σύνολα δεδοµένων. ενός που αφορά τις επιδράσεις του καπνίσµατος στη µεταγραφή του γονιδιώµατος των επιθηλιακών κυττάρων του ανθρώπινου αναπνευστικού συστήµατος (D S σύνολο δεδοµένων (6.2) ) και ενός που περιέχει πληροφορία σχετική µε τα αποτελέσµατα της θεραπείας σε ασθενείς που έχουν αναπτύξει εµβρυϊκούς όγκους στο Κεντρικό Νευρικό Σύστηµα (D CNV σύνολο δεδοµένων (6.3) ). Στο Κεφάλαιο 7 γίνεται µία σύνοψη του αλγορίθµου, της λειτουργίας του καθώς και των στόχων που εξυπηρετεί ενώ προτείνονται και πιθανά σενάρια για ενδεχόµενη βελτίωσή του. Εξάλλου, στο Κεφάλαιο 8, παρεµβάλλεται η Βιβλιογραφία και πιο συγκεκριµένα οι δηµοσιεύσεις (8.1) και οι διαδικτυακές αναφορές (8.2) που αποτέλεσαν πηγή πληροφοριών για τη συγγραφή αυτής εδώ της αναφοράς καθώς και για την ανάπτυξη του εργαλείου. Λίγο πριν το τέλος αυτής της αναφοράς, παρατίθενται τα Παραρτήµατα, όπου στο Α γίνεται µία µικρή αναφορά στον τραγικό ποιητή Σοφοκλή και στην όποια οµοιότητα των καινοτοµιών που εισήγαγε στα έργα του µε τα στοιχεία αυτού του εργαλείου, SoFoCles. Από την άλλη, στο Παράρτηµα Β αναφέρονται τα διάφορα πακέτα και τα εργαλεία που χρησιµοποιήθηκαν για την εκπόνηση αυτής της διπλωµατικής. Τέλος, η αναφορά αυτή κλείνει µε την παράθεση ευρετηρίου για την ευκολότερη και λειτουργικότερη ανάγνωση. 13

15 2 Επιτοµή βασικών βιολογικών εννοιών Η εκθετική αύξηση του όγκου των βιολογικών και ιατρικών δεδοµένων ιδίως µετά την αποκρυπτογράφηση του γονιδιώµατος οργανισµών έθεσε ως απαραίτητο κριτήριο για την επεξεργασία τους την εκµετάλλευση της υπάρχουσας υπολογιστικής δύναµης και τη χρησιµοποίηση αλγορίθµων για την έγκυρη εξαγωγή συµπερασµάτων. Σε αυτό το σηµείο, η Πληροφορική καθώς και άλλοι συγγενείς κλάδοι επιστρατεύτηκαν για την επίλυση τέτοιων απαιτητικών προβληµάτων. Οι δύο κλάδοι που επιφορτίζονται κυρίως µε την επίλυση των παραπάνω προβληµάτων είναι η Βιοπληροφορική και η Υπολογιστική Βιολογία. Συνεπώς, απαραίτητη κρίνεται η αποσαφήνιση του αντικειµένου ενασχόλησης των δύο παραπάνω κατευθύνσεων καθώς και µία σύντοµη επισκόπηση των σηµαντικότερων περιοχών έρευνας. 2.1 Σχέση Βιοπληροφορικής και Υπολογιστικής Βιολογίας Συνήθως οι όροι Βιοπληροφορική (Bioinformatics) και Υπολογιστική Βιολογία (Computational Biology) συγχέονται και όχι άδικα αφού υπάρχει σηµαντική επικάλυψη όσον αφορά το αντικείµενο έρευνας τους. Η βάση τους προέρχεται από τις επιστήµες υγείας όπως και από επιστήµες υπολογιστών και πληροφορικής. Για την επίλυση των προβληµάτων των παραπάνω κλάδων επιστρατεύονται κλάδοι όπως εφαρµοσµένα µαθηµατικά, φυσική, επιστήµη των υπολογιστών, µηχανική, στατιστική, τεχνητή νοηµοσύνη, βιολογία, χηµεία και επιστήµη της συµπεριφοράς (behavioral science). Παρόλα αυτά, οι δύο κλάδοι έχουν και διακριτούς ρόλους οι οποίοι σύµφωνα µε τον λειτουργικό ορισµό (working definition) που δίνουν τα Εθνικά Ινστιτούτα Υγείας (National Institutes of Health, NIH) των Η.Π.Α., από τους επικεφαλής και πρωτοπόρους στην Ιατρική Έρευνα, συνοψίζονται ως εξής: 14

16 Βιοπληροφορική: Έρευνα, ανάπτυξη, ή εφαρµογή υπολογιστικών εργαλείων και µεθόδων για την επέκταση της χρήσης βιολογικών, ιατρικών δεδοµένων ή δεδοµένων που σχετίζονται µε συµπεριφορά και υγεία, συµπεριλαµβανοµένων και αυτών (ενν. εργαλείων και µεθόδων) για την απόκτηση, αποθήκευση, οργάνωση, αρχειοθέτηση, ανάλυση ή οπτικοποίηση τέτοιων δεδοµένων. Υπολογιστική Βιολογία: Ανάπτυξη και εφαρµογή θεωρητικών µεθόδων και µεθόδων ανάλυσης δεδοµένων, τεχνικών µαθηµατικής µοντελοποίησης και υπολογιστικής προσοµοίωσης για την µελέτη δεδοµένων που εκπορεύονται από βιολογικά, κοινωνικά συστήµατα καθώς και συστήµατα συµπεριφοράς. [15] Με απλά λόγια, η Βιοπληροφορική έχοντας ένα εµφανώς πιο πρακτικό προσανατολισµό ασχολείται µε την κατασκευή αλγορίθµων και µεθόδων για την επίλυση πρακτικών και φορµαλιστικών (δηλ. σαφώς ορισµένων) βιολογικών προβληµάτων, ενώ η Υπολογιστική Βιολογία ασχολείται µε την κατευθυνόµενη µέσω υποθέσεων έρευνα (hypothesis-driven investigation) ενός συγκεκριµένου βιολογικού προβλήµατος µε την βοήθεια πειραµάτων και προσοµοίωσης Περιοχές έρευνας Οι περιοχές έρευνας των παραπάνω κλάδων περιλαµβάνουν την ανάλυση αλληλουχίας (sequence analysis), επισηµείωση γονιδιώµατος (genome annotation), υπολογιστική εξελικτική βιολογία (computational evolutionary biology), ανάλυση γονιδιακής έκφρασης (analysis of gene expression), ανάλυση γονιδιακής ρύθµισης (analysis of regulation), ανάλυση πρωτεϊνικής έκφρασης (analysis of protein expression), ανάλυση µεταλλάξεων σε περιπτώσεις καρκίνου (analysis of mutations in cancer), πρόβλεψη πρωτεϊνικής δοµής (prediction of protein structure), συγκριτική γονιδιωµατική (comparative genomics), µοντελοποίηση βιολογικών συστηµάτων (modeling of biological systems) και ανάλυση εικόνας σε ευρεία κλίµακα (highthroughput image analysis). Αναλυτικότερα, η ανάλυση αλληλουχίας αναφέρεται στην συστοίχιση της πρωτοταγούς δοµής του DNA, RNA ή της πρωτεΐνης για τον εντοπισµό λειτουργικών, δοµικών ή εξελικτικών σχέσεων µεταξύ διαφορετικών οργανισµών. Η επισηµείωση γονιδιώµατος αναφέρεται στην απόδοση λειτουργικών χαρακτηριστικών σε γονίδια, ενώ η υπολογιστική εξελικτική βιολογία στην µελέτη της καταγωγής των ειδών και την εξέλιξή τους στην πάροδο του χρόνου. 15

17 Επιπλέον, η ανάλυση γονιδιακής ρύθµισης αναφέρεται στην προσπάθεια αποσαφήνισης των συµβάντων που διέπουν την γονιδιακή ρύθµιση, διαδικασία που περιλαµβάνει την εξωκυτταρική σηµατοδότηση και επεκτείνεται µέχρι την µεταβολή της δραστηριότητας των πρωτεϊνικών µορίων. Ένα διάσηµο πρόβληµα αυτής της περιοχής αποτελεί ο εντοπισµός ειδικών DNA ακολουθιών, των προαγωγέων (promoters), που περιβάλλουν το κωδικοποιηµένο τµήµα ενός γονιδίου και είναι υπεύθυνες για τον βαθµό µεταγραφής αυτού σε mrna. H ανάλυση µεταλλάξεων σε περιπτώσεις καρκίνου αναφέρεται στον εντοπισµό µεταλλάξεων µίας πληθώρας γονιδίων, ενώ η πρόβλεψη πρωτεϊνικής δοµής περιλαµβάνει την εκτίµηση της δευτεροταγούς, τριτοταγούς ή τεταρτοταγούς δοµής µίας πρωτεΐνης µέσω της αλληλουχίας των αµινοξέων της (πρωτοταγής δοµή). Εξάλλου, η συγκριτική γονιδιωµατική ασχολείται µε την εύρεση ορθολογίας (οµοιότητας δηλαδή) ανάµεσα σε γονίδια (ή άλλα γονιδιωµατικά χαρακτηριστικά) µεταξύ διαφορετικών οργανισµών. Η µοντελοποίηση βιολογικών συστηµάτων υλοποιεί την ανάλυση και οπτικοποίηση πολύπλοκων κυτταρικών διαδικασιών όπως είναι τα δίκτυα µεταβολιτών, µονοπάτια µεταγωγής σηµάτων και δίκτυα γονιδιακής ρύθµισης, ενώ η ανάλυση εικόνας σε ευρεία κλίµακα χρησιµοποιείται για την επεξεργασία, ποσοτικοποίηση και ανάλυση µεγάλων ποσοτήτων δεδοµένων. Τελευταία και όχι τυχαία αφήσαµε την ανάλυση γονιδιακής και πρωτεϊνικής έκφρασης, που αποδίδουν τα επίπεδα έκφρασης των γονιδίων (ή αντίστοιχα την παρούσα κατάσταση των πρωτεϊνών) κάτω από ορισµένες συνθήκες. Μία διαδεδοµένη τεχνική αναπαράστασης τέτοιων δεδοµένων είναι µέσω των µικροσυστοιχιών (microarrays), στις οποίες θα αναφερθούµε εκτενέστερα στη συνέχεια. Σε αυτήν τη διπλωµατική θέση θα ασχοληθούµε µε τη βελτίωση της ακρίβειας (accuracy) ταξινόµησης (classification) ή οµαδοποίησης (clustering) microarray συνόλων. Πριν όµως αναφερθούµε εκτενέστερα στις µικροσυστοιχίες παρουσιάζει ενδιαφέρον να αναπτύξουµε λίγο το βιολογικό υπόβαθρο πάνω στο οποίο κινούνται οι παραπάνω τεχνικές. Με άλλα λόγια, να αναφερθούµε σε κάποιες βασικές έννοιες της Μοριακής Βιολογίας. 16

18 2.2 οµή του DNA Τα κύτταρα είναι οι θεµελιώδεις λειτουργικές µονάδες κάθε ζωντανού οργανισµού. Όλες οι απαραίτητες πληροφορίες για να δηµιουργηθεί και να συντηρηθεί ζωή εσωκλείονται σε ένα µόριο ονόµατι δεοξυριβοζονουκλεϊκό οξύ ( DNA, DeoxyriboNucleic Acid ). Πιο συγκεκριµένα, το DNA είναι ένα δίκλωνο µόριο πολυµεράσης αποτελούµενο από τέσσερις βασικές µοριακές µονάδες, τα νουκλεοτίδια (Εικ. 2.1). Κάθε νουκλεοτίδιο αποτελείται από µία οµάδα φωσφόρου, ένα δεοξυριβοϊκό σάκχαρο και µία από τις τέσσερις νιτρικές βάσεις (A: Adenine, T: Thymine, G: Guanine, C: Cytosine) (Εικ. 2.2). Το µόριο του DNA σχηµατίζει µία διπλή έλικα όπου το νουκλεοτίδιο ενός κλώνου συνδέεται µε δεσµό υδρογόνου µε το συµπληρωµατικό του νουκλεοτίδιο στον απέναντι κλώνο (Εικ. 2.3). Ως ζεύγη συµπληρωµατικών νουκλεοτιδίων θεωρούµε αυτά που φέρουν τις βάσεις Α (Αδενίνη) Τ (Θυµίνη), G (Γουανίνη) C (Κυτοσίνη). Οι βάσεις Εικόνα 2.1. ιπλή Έλικα του DNA Η παραπάνω εικόνα έχει ληφθεί από την τοποθεσία [xvii] Εικόνα 2.2. Νουκλεοτίδιο είναι κυκλικές ενώσεις που περιέχουν άζωτο στο Η παραπάνω εικόνα δακ έχει ληφθεί από την τοποθεσία [xxii] τύλ ιό τους. ιακρίνονται σε δύο οµάδες: τις πουρίνες και τις πυριµιδίνες. Τις πουρίνες αποτελούν η Αδενίνη (Α) και η Γουανίνη (G) και τις πυριµιδίνες η Ουρακίλη (U), η Κυτοσίνη (C) και η Θυµίνη (Τ). Ουσιαστικά, κάθε κλώνος στη διπλή έλικα του DNA µπορεί να ειδωθεί ως χηµικό κατοπτρικό είδωλο του άλλου. Εικόνα 2.3. Σύνδεση δύο συµπληρωµατικών νουκλεοτιδίων µε δεσµό υδρογόνου Η παραπάνω εικόνα έχει ληφθεί από την τοποθεσία [v] 17

19 Προαναφέρθηκε, ότι το µόριο του DNA περιέχει όλες τις απαραίτητες πληροφορίες για τη δηµιουργία ζωής. Πιο συγκεκριµένα, είναι η συγκεκριµένη αλληλουχία των νουκλεοτιδίων που επιτυγχάνει κάτι τέτοιο, που δίνει δηλαδή όλες τις απαραίτητες οδηγίες για την διαµόρφωση των ιδιαίτερων χαρακτηριστικών κάθε οργανισµού. Εξάλλου, ολόκληρη η αλληλουχία ενός οργανισµού καλείται το γονιδίωµά (genome) του. Η λειτουργικότητα του γονιδιώµατος δεν είναι συνεχής αλλά διαιρείται σε λειτουργικές περιοχές, τα γονίδια Γονίδια Όπως προαναφέραµε τα γονίδια συνιστούν τις λειτουργικές περιοχές του γονιδιώµατος. Πιο συγκεκριµένα, αποτελούνται από µεγάλους κλώνους DNA (ή RNA σε µερικούς ιούς). Αυτοί οι κλώνοι περιέχουν ακολουθίες ελέγχου της δραστηριότητας τους, τους προαγωγείς (promoters) και µία κωδική ακολουθία που καθορίζει τι παράγει το γονίδιο. Τα περισσότερα γονίδια περιέχουν µη-κωδικές περιοχές που δεν κωδικοποιούν γονιδιακά προϊόντα αλλά ρυθµίζουν τη γονιδιακή έκφραση. Αυτές οι µη-κωδικές περιοχές ονοµάζονται ιντρόνια (introns) και αποµακρύνονται από το m-rna κατά το δεύτερο στάδιο της γονιδιακής έκφρασης (µετάφρασης) σε µία διαδικασία που είναι γνωστή ως συρραφή (splicing). Οι περιοχές που κωδικοποιούν την παραγωγή γονιδιακών προϊόντων είναι στην πραγµατικότητα πολύ µικρότερες από τα ιντρόνια και είναι γνωστές ως εξόνια (exons) (Εικ. 2.4). Όπως θα δούµε και παρακάτω, ένα µόνο γονίδιο µπορεί Εικόνα 2.4. Το γονίδιο αποτελείται από ιντρόνια και εξόνια. Τα ιντρόνια να οδηγήσει στη σύνθεση πολλών αποµακρύνονται κατά τη πρωτεϊνών µέσω των διαφορετικών διαδικασία συρραφής (splicing) ενώ τα εξόνια κωδικοποιούν την διευθετήσεων των εξονίων, µίας πρωτεΐνη. Η παραπάνω εικόνα έχει ληφθεί διαδικασίας που είναι γνωστή ως από την τοποθεσία [xxv] εναλλακτική συρραφή (alternative splicing). 18

20 Τα γονίδια χωρίζονται σε: γονίδια καθορισµού RNA (RNA-specifying genes), γονίδια κωδικοποίησης πρωτεϊνών (protein-coding genes) και γονίδια που δεν µεταγράφονται (untranscribed genes). Η πρώτη οµάδα γονιδίων συντελεί στην πρώτη φάση της εκτέλεσης της γονιδιακής έκφρασης (gene expression), που είναι γνωστή ως µεταγραφή (transcription). Μ άλλα λόγια, αποτελεί κλώνο για την κατασκευή µορίων RNA, όπως είναι τα: r-rna (δοµικό και λειτουργικό στοιχείο του ριβοσώµατος), t-rna (προσαρµογέας µετάφρασης), mi-rna (καταστολέας µετάφρασης), sn-rna (συσκευή σύνδεσης RNA), sno-rna (προεπεξεργασία r-rna), large nc-rna (γονιδιακή ρύθµιση) και m-rna. Η δεύτερη οµάδα γονιδίων κωδικοποιεί την κατασκευή πρωτεϊνών συµβάλλοντας έτσι στη δεύτερη και τελική φάση της γονιδιακής έκφρασης που είναι γνωστή ως µετάφραση (translation), ενώ η τελευταία ουσιαστικά αποτελείται από περιοχές του γονιδιώµατος που έχουν κάποια βιολογική λειτουργία, η οποία όµως δεν σχετίζεται µε τη µεταγραφή ή τη µετάφραση. [14] Στον άνθρωπο υπάρχουν περίπου γονίδια της δεύτερης οµάδας, γονίδια δηλαδή που κωδικοποιούν την παραγωγή πρωτεϊνών. Ο ανθρώπινος οργανισµός αποτελείται επίσης από 10 τρισεκατοµµύρια (10 13 ) κύτταρα που κατανέµονται σε 210 περίπου είδη. Μερικά από αυτά τα είδη είναι τα επιθηλιακά κύτταρα, τα κύτταρα του ανοσοποιητικού συστήµατος και τα νευρικά κύτταρα. Είναι όµως αξιοσηµείωτο πως τα γονίδια µπορούν να καθορίσουν τη δοµή ενός πολύπλοκου οργανισµού όπως αυτόν των θηλαστικών. Οι κύριοι λόγοι που το επιτρέπουν αυτό είναι η καθορισµένη από το είδος του κυττάρου γονιδιακή έκφραση (cell-type specific gene expression), η καθορισµένη από τον ιστό γονιδιακή µεταγραφή (tissue specific gene transcription) και η εναλλακτική συρραφή εξονίων (alternative splicing) (Εικ. 2.5). 19

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Σάββατο, 22 Μαΐου 2010 07:30-10:30

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

07:30 10:30. παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση

07:30 10:30. παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία και Ώρα εξέτασης: Τρίτη, 26 Μαΐου 2009 07:30 10:30

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr 1 TO 1. µ, : i µ µ DNA ii µ DNA iii

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

iii ΠΕΡΙΕΧΟΜΕΝΑ Πρόλογος

iii ΠΕΡΙΕΧΟΜΕΝΑ Πρόλογος iii ΠΕΡΙΕΧΟΜΕΝΑ Πρόλογος xi 1 Αντικείμενα των Πιθανοτήτων και της Στατιστικής 1 1.1 Πιθανοτικά Πρότυπα και Αντικείμενο των Πιθανοτήτων, 1 1.2 Αντικείμενο της Στατιστικής, 3 1.3 Ο Ρόλος των Πιθανοτήτων

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας Βιοπληροφορική Ι Παντελής Μπάγκος Παν/µιο Στερεάς Ελλάδας Λαµία 2006 1 Βιοπληροφορική Ι Εισαγωγή: Ορισµός της Βιοπληροφορικής, Υποδιαιρέσεις της Βιοπληροφορικής, Τα είδη των δεδοµένων στη Βιοπληροφορική.

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

Γεωγραφικά Πληροφοριακά Συστήµατα (Geographical Information Systems GIS)

Γεωγραφικά Πληροφοριακά Συστήµατα (Geographical Information Systems GIS) Γεωγραφικά Πληροφοριακά Συστήµατα (Geographical Information Systems GIS) ρ. ΧΑΛΚΙΑΣ ΧΡΙΣΤΟΣ xalkias@hua.gr Χ. Χαλκιάς - Εισαγωγή στα GIS 1 Ορισµοί ΓΠΣ Ένα γεωγραφικό πληροφοριακό σύστηµα Geographic Information

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΜΕ ΜΕΤΑΛΛΑΓΕΣ Μεταλλαγή ή Μετάλλαξη Οποιαδήποτε αλλαγή του γενετικού υλικού που δεν οφείλεται σε ανασυνδυασµό ή σε διάσχιση των γονιδίων και η οποία

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΟΜΑΔΑ Λ. Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα

ΟΜΑΔΑ Λ. Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα ΟΜΑΔΑ Λ Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ Τι είναι η βιοπληροφορική; Αποκαλείται ο επιστημονικός κλάδος ο οποίος προέκυψε από

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

Οπτική αντίληψη. Μετά?..

Οπτική αντίληψη. Μετά?.. Οπτική αντίληψη Πρωτογενής ερεθισµός (φυσικό φαινόµενο) Μεταφορά µηνύµατος στον εγκέφαλο (ψυχολογική αντίδραση) Μετατροπή ερεθίσµατος σε έννοια Μετά?.. ΓΙΑ ΝΑ ΚΑΤΑΝΟΗΣΟΥΜΕ ΤΗΝ ΟΡΑΣΗ ΠΡΕΠΕΙ ΝΑ ΑΝΑΛΟΓΙΣΤΟΥΜΕ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

Τι είναι τα Συστήµατα Γεωγραφικών Πληροφοριών. (Geographical Information Systems GIS)

Τι είναι τα Συστήµατα Γεωγραφικών Πληροφοριών. (Geographical Information Systems GIS) Τι είναι τα Συστήµατα Γεωγραφικών Πληροφοριών (Geographical Information Systems GIS) ΧΑΡΟΚΟΠΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ, ΤΜΗΜΑ ΓΕΩΓΡΑΦΙΑΣ ΧΑΛΚΙΑΣ ΧΡΙΣΤΟΣ Εισαγωγή στα GIS 1 Ορισµοί ΣΓΠ Ένα σύστηµα γεωγραφικών πληροφοριών

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. Η Επιτροπή Παιδείας της ΠΕΒ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα