Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες"

Transcript

1 Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες

2 Γένωμα vs Πρωτέωμα Όλη η αλληλουχία βάσεων στο DNA Τι είναι δυνατόν Συγκεκριμένο Στατικό Οι πρωτεΐνες που κωδικοποιούνται από το γένωμα Τι είναι λειτουργικά παρόν Ποικίλλει αναλόγως τύπου κυττάρου, σταδίου ανάπτυξης, συνθηκών στο περιβάλλον Δυναμικό Γ-2

3 Στα ευκαρυωτικά οι πρωτεΐνες είναι περισσότερες από τα γονιδια Β-3

4 H δομή των πρωτεϊνών καθορίζει τη λειτουργία τους Β-4

5 Η ιεραρχία στην πρωτεϊνική δομή Πρωτοταγής Δευτεροταγής Τριτοταγής Τεταρτοταγής Β-5

6 Υπάρχουν διάφοροι τρόποι αναπαράστασης μορίων ανάλογα με το χαρακτηριστικό που ενδιαφέρει περισσότερο Χωροπληρωτική αναπαράσταση Συντακτικοί τύποι Ball-and-stick Β-6

7 Διάγραμμα ταινίας Αναπαράσταση επιφάνειας Β-7

8 Οι πρωτεΐνες αποτελούνται από αμινοξέα-οπτικά ισομερή Β-8

9 Β-9

10 Τιτλοδότηση α-καρβοξυλίου και α-αμινομάδας αμινοξέων pi: ph όπου το συνολικό φορτίο είναι μηδενικό Β-10

11 Aμινοξέα με μη πολικές πλευρικές ομάδες Β-11

12 Αμινοξέα με πολικές μη φορτισμένες πλευρικές ομάδες Β-12

13 Αμινοξέα με βασικές πλευρικές ομάδες Β-13

14 Αμινοξέα με όξινες πλευρικές ομάδες Β-14

15 ε Η Tyr και η Trp απορροφούν στα 280nm-έτσι μετράται η συγκέντρωση πρωτεϊνικών διαλυμάτων Β-15

16 Η προλίνη είναι ιμινοξύ Β-16

17 Η κυστεΐνη είναι σουλφυδρυλικό αμινοξύ Β-17

18 Β-18

19 Μερικά αμινοξέα είναι πιο «ογκώδη» από άλλα με μεγαλύτερες ακτίνες van der Waals Bασικό χαρακτηριστικό που συχνά καθορίζει πόσο συμπαγής είναι μια πρωτεΐνη Gly Trp Β-19

20 Κάποια αμινοξέα τροποποιούνται χημικά μετά τη μετάφρασημετα-μεταφραστικές τροποποιήσεις αμινοξέων-παίζουν ρυθμιστικό ρόλο σε πολλές κυτταρικές διαδικασίες Β-20

21 Πολλαπλές μορφές μεθυλίωσης Lys, Arg Β-21

22 Ser, Thr, Tyr φωσφορυλιώνονται Β-22

23 Οι πρωτεΐνες είναι γραμμικά πολυμερή Η υδρόλυση του πεπτιδικού δεσμού είναι αυθόρμητη διαδικασία, αλλά... η κινητική της πολύ βραδεία >1000 χρόνια Β-23

24 Η πολυπεπτιδική αλυσίδα έχει συγκεκριμένη φορά Β-24

25 Πολυπεπτιδική αλυσίδα: Ομοειδείς ομάδες στον κορμό και μεταβλητές πλευρικές αλυσίδες, τα χαρακτηριστικά των οποίων καθορίζουν τις φυσικοχημικές ιδιότητες (π.χ. pi) και τη λειτουργικότητα των πρωτεϊνών Β-25

26 Η πολυπεπτιδική αλυσίδα συχνά περιέχει δισουλφιδικές γέφυρες Β-26

27 Ο πρώτος προσδιορισμός πρωτοταγούς δομής πρωτεΐνης: Bovine insulin - Sanger, 1953 Β-27

28 Διαστάσεις πεπτιδικού δεσμού Λόγω δομών συντονισμού Β-28

29 Ο πεπτιδικός δεσμός ορίζει ένα επίπεδο Ca, C, O, N, H στο ίδιο επίπεδο Β-29

30 Ο πεπτιδικός δεσμός έχει trans διάταξη (Cα διαδοχικών αμινοξέων σε αντίθετες πλευρές του πεπτιδικού δεσμού) λόγω στερεοχημικής παρεμπόδισης με ελάχιστες εξαιρέσεις Cα Cα Cα Cα Β-30

31 Συνοπτικά, ο πεπτιδικός δεσμός: Είναι συνήθως trans Έχει εν μέρει (40%) χαρακτήρα διπλού δεσμού Έχει μήκος nm βραχύτερος από απλό δεσμό, μακρύτερος από διπλό δεσμό Λόγω του χαρακτήρα διπλού δεσμού, τα 6 άτομα που συμμετέχουν στη δημιουργία του πεπτιδικού δεσμού βρίσκονται στο ίδιο επίπεδο! Το N φέρει μερικό θετικό φορτίο- το O μερικά αρνητικό, άρα είναι πολικός-όχι φορτισμένος Β-31

32 Οι πρωτεΐνες «αναπνέουν» Β-32

33 Οι Pauling και Corey ασχολήθηκαν με δομές στις οποίες η στερεοδιάταξη του C α είναι η ίδια και σχηματίζονται ισχυροί δεσμοί υδρογόνου

34 Δευτεροταγής δομή πρωτεϊνών Η δευτεροταγής δομή αναφέρεται στην τοπική διαμόρφωση τμήματος της πολυπεπτιδικής αλυσίδας που σχηματίζεται από υδρογονοδεσμούς μεταξύ ατόμων του πολυπεπτιδικού σκελετού (C=O και N-H) Δύο βασικοί τύποι δευτεροταγούς δομής : α-έλικα (α-helix) β-πτυχωτή επιφάνεια ή β-πτυχωτό φύλλο (βpleated sheet) Β-34

35 α-έλικα ( ) Προτάθηκε από Pauling (Βραβείο Nobel 1954) Β-35

36 Υδρογονοδεσμοί στην α-έλικα Υδρογονοδεσμός μεταξύ C=O του αμινοξέος i και N-H του i+4 Β-36

37 Οι πλευρικές αλυσιδες στην α-έλικα: Στρέφονται προς το εξωτερικό της α-έλικας, γειτονεύουν ανά 3 ή 4 αμινοξέα και μπορεί να απωθούνται ή να οδηγούν σε στερεοχημική παρεμπόδιση Julie Newdoll "Rise of the Alpha Helix" (2003) Β-37

38 Η Pro βρίσκεται στα άκρα της α-έλικας και/ή εισάγει σημεία καμπής στην α-έλικα Β-38

39 Δευτεροταγής δομή: β-πτυχωτά φύλλα Οι υδρογονοδεσμοί αναπτύσσονται μεταξύ C=O και N-H που δεν είναι γειτονικά και μπορεί να απέχουν πολύ στην αλληλουχία ή και να είναι σε διαφορετικές πολυπεπτιδικές αλυσίδες Β-39

40 Τα β-πτυχωτά φύλλα αποτελούνται από β-κλώνους β-κλώνος C N β-πτυχωτό φύλλο Β-40

41 Αντιπαράλληλο β-πτυχωτό φύλλο (συνηθέστερο) C N N C Οι υδρογονοδεσμοί αναπτύσσονται μεταξύ C=O και N-H που δεν είναι γειτονικά και μπορεί να απέχουν πολύ στην αλληλουχία ή και να είναι σε διαφορετικές πολυπεπτιδικές αλυσίδες

42 Παράλληλο β-πτυχωτό φύλλο Ν N C C N Ν C C Β-42

43 Μεικτό β-πτυχωτό φύλλο N C N C C N Β-43

44 Οι πλευρικές αλυσιδες προβάλλουν πάνω και κάτω εναλλάξ από το επίπεδο του β-φύλλου Β-44

45 β-στροφές ή θηλειές αλλάζουν την κατεύθυνση της πολυπεπτιδικής αλυσίδας και συνδέουν α-έλικες ή β-κλώνους ή α-έλικα με β-κλώνο Σχεδόν 30% κατά μέσο όρο των αμινοξέων βρίσκονται σε β- στροφές Pro και Gly κυριαρχούν στις β- στροφές Β-45

46 Οι θηλειές (β-στροφές, βρόχοι) στην επιφάνεια των πρωτεϊνών διαμεσολαβούν αλληλεπιδράσεις με άλλα μόρια Β-46

47 Η α-έλικα είναι η συμπαγέστερη μορφή δευτεροταγούς δομής Στην α-έλικα 3.6 αα/στροφή Απόσταση μεταξύ διαδοχικών αμινοξέων 0.15nm κατά μήκος του άξονα της α-έλικας Βήμα της α-έλικας 0.54nm Σε αντιπαράλληλο β-φύλλο Απόσταση μεταξύ γειτονικών αμινοξέων 0.34nm 2 αα/στροφή Σε παράλληλο β-φύλλο Απόσταση μεταξύ διαδοχικών αμινοξέων 0.32nm 2 αα/στροφή Β-47

48 Tριτοταγής δομή Στο σχηματισμό της τριτοταγούς δομής βασικό ρόλο (επιπλέον των υδρογονοδεσμών που καθορίζουν τη δευτεροταγή δομή) παίζουν οι μεγάλου βεληνεκούς αλληλεπιδράσεις μεταξύ πλευρικών ομάδων γειτονικών και απομακρυσμένων στην αμινοξική αλληλουχία αμινοξέων Β-48

49 Γλουταμικό Ασπαρτικό Ισολευκίνη Πολυπεπτιδικός κορμός Λευκίνη Υδρόφοβες αλληλεπιδράσεις Σερίνη Υδρογονοδεσμός Λυσίνη Ιοντικός δεσμός Υδρόφοβες αλληλεπιδράσεις ανάμεσα σε αμινοξέα με μη πολικές πλευρικές ομάδες Αλληλεπιδράσεις πλευρικών ομάδων αμινοξέων μέσω δεσμών υδρογόνου και ιοντικών δεσμών (γέφυρες άλατος) Β-49

50 Ανάλογα με το ποσοστό δευτεροταγούς δομής, οι πρωτεΐνες κατατάσσονται σε 5 κατηγορίες α (πρωτεΐνες στις οποίες κυριαρχούν α-έλικες) β (πρωτεΐνες στις οποίες κυριαρχούν β-επιφάνειες) α/β (πρωτεΐνες στις οποίες οι α-έλικες εναλλάσσονται κανονικά με β-κλώνους) α+β (πρωτεΐνες στις οποίες α-έλικες και β-κλώνοι δεν εμφανίζονται με κανονική εναλλαγή) c (πρωτεΐνες που δεν εμφανίζουν κανονική δευτεροταγή δομή) Β-50

51 Η φερριτίνη, αποθήκη σιδήρου, αποτελείται από α-έλικεςα-πρωτεΐνη Β-51

52 Η flavodoxin είναι α/β πρωτεΐνη

53 Μια πρωτεΐνη πρόσδεσης λιπαρών οξών πλούσια σε β- πτυχωτά φύλλα - α+β Β-53

54 Οι πρωτεΐνες έχουν πλαστικότητα και συχνά υφίστανται διαμορφωτικές μετατροπές Σίδηρος Β-54

55 Τεταρτοταγής δομή Οι πρωτεΐνες μπορεί να περιέχουν περισσότερες από μια πολυπεπτιδικές αλυσίδες (υπομονάδες) Μια πολυπεπτιδική αλυσίδα μονομερής πρωτεΐνη Περισσότερες από μια πολυπεπτιδικές αλυσίδες (υπομονάδες) πολυμερής πρωτεΐνη Ομοπολυμερής 2 ή περισσότερα αντίτυπα της ίδιας πολυπεπτιδικής αλυσίδας Ετεροπολυμερής 2 ή περισσότερα είδη πολυπεπτιδικής αλυσίδας Β-55

56 Θερμοδυναμική βάση σχηματισμού τεταρτοταγούς δομής Για το σχηματισμό τεταρτοταγούς δομής η ενέργεια αλληλεπίδρασης kj/mole σε 37 o C Ο σχηματισμός πολυμερούς δεν ευνοείται από την εντροπία που μειώνεται, αλλά τον ευνοούν Συχνότερα η απόκρυψη από το διαλύτη υδρόφοβων ομάδων (υδροφοβικό φαινόμενο) Ο σχηματισμός σπανιότερα ιοντικών δεσμών Β-56

57 Τι λειτουργικά και δομικά πλεονεκτήματα έχει η δημιουργία τεταρτοταγούς δομής; Σταθεροποίηση λόγω μείωσης του λόγου επιφάνειας προς όγκο Γενετική οικονομία και αποτελεσματικότητα Προσέγγιση καταλυτικών περιοχών Β-57

58 Tο τετραμερές της αιμοσφαιρίνης α 2 β 2 Β-58

59 Η πρωτεΐνη Cro είναι ομοδιμερής Β-59

60 Υπερδευτεροταγής δομή: Επίπεδo οργάνωσης μεταξύ δευτεροταγούς και τριτοταγούς δομής Πολλά τμήματα πρωτεϊνών με ιδιότυπη, σταθερή δομή και συχνά και λειτουργία χαρακτηρίζονται σαν πρωτεϊνικά μοτίβα και κατατάσσονται σε ένα επίπεδο οργάνωσης μεταξύ της δευτεροταγούς και της τριτοταγούς δομής Το πρωτεϊνικό μοτίβο υπερδευτεροταγούς δομής προκύπτει από συνδυασμό δευτεροταγών δομικών μονάδων Β-60

61 Συνδυασμοί στοιχείων δευτεροταγους δομής συνιστούν πρωτεϊνικά τμήματα-μοτίβα με συγκεκριμένη λειτουργία Το μοτίβο έλικας-θηλειάς-έλικας (Helix-loop-helix)-συχνά προσδένει DNA Β-61

62 Το μοτίβο EF hand προσδένει Ca +2 Β-62

63 Συστραμμένο σπειραμα (coiled coil): Υπερέλικα από 2 ή περισσότερες α-ελικες που διπλώνονται η μία γύρω από την άλλη Συστραμμένο σπειραμα: Υπερέλικα από 2 ή περισσότερες α- ελικες που διπλώνονται η μία γύρω από την άλλη Β-63

64 Υπερέλικα από 3 α-ελικες Το βήμα κλειδί στην είσοδο του ιού στο ανθρώπινο κύτταρο είναι η αποκάλυψη μιας τριμερούς παράλληλης υπερέλικας, γνωστής ως gp41. Κατόπιν μετατρέπεται σε εξαμερές.

65 Οι πρωτεΐνες έχουν μεγέθη και σχήματα που ποικίλλουν Β-65

Μικρά αμινοξέα. Βιοχημεία Ι Β-3

Μικρά αμινοξέα. Βιοχημεία Ι Β-3 Βιοχημεία Ι Β-2 Μικρά αμινοξέα Βιοχημεία Ι Β-3 Aλειφατικά αμινοξέα Βιοχημεία Ι Β-4 Ιμινοξύ Βιοχημεία Ι Β-5 Αρωματικά αμινοξέα Βιοχημεία Ι Β-6 Βιοχημεία Ι Β-7 Η Tyr και η Trp απορροφούν στα 280nm-έτσι μετράται

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων Διαλέξεις Χημείας -2014 Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων 1. Κατάταξη 2. Λειτουργίες 1. Πεπτιδικές ορμόνες 3. Πεπτιδικός δεσμός 1. Χαρακτηριστικά

Διαβάστε περισσότερα

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών

Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Αρχιτεκτονική της τρισδιάστατης δομής πρωτεϊνών Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου Ταχ.Κιβ. 20537 1678,

Διαβάστε περισσότερα

Δομή πρωτεϊνών: Τριτοταγής διαμόρφωση της δομής

Δομή πρωτεϊνών: Τριτοταγής διαμόρφωση της δομής Δομή πρωτεϊνών: Τριτοταγής διαμόρφωση της δομής - Αναφέρεται στην αναδίπλωση της πολυπεπτιδικής αλυσίδας πάνω στον εαυτό της και στο τελικό σχήμα που θα πάρει στο χώρο -Σ αυτή τη διαμόρφωση σημαντικό ρόλο

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Κεφάλαιο 1. Οι δομικοί λίθοι

Κεφάλαιο 1. Οι δομικοί λίθοι Κεφάλαιο 1 Οι δομικοί λίθοι Κεφάλαιο 1 Οι Δομικοί Λίθοι των Πρωτεϊνών Εικόνα 1.1 Η αμινοξική αλληλουχία μιας πρωτεϊνικής πολυπεπτιδικής αλυσίδας ονομάζεται πρωτοταγής δομή. Διαφορετικές περιοχές της αλληλουχίας

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

οµικά στοιχεία βιοµορίων

οµικά στοιχεία βιοµορίων 2-1 Κεφάλαιο 2 οµικά στοιχεία βιοµορίων 2.1. ιαστάσεις των Βιοµορίων Οι διαστάσεις των βιοµορίων κυµαίνονται από µερικά Ångströms (10-10 m) έως µερικές εκατοντάδες Ångströms (10-8 m). (εικόνα 2.1, 2.2)

Διαβάστε περισσότερα

Στοιχεία Φυσικοχηµείας και Βιοφυσικής

Στοιχεία Φυσικοχηµείας και Βιοφυσικής Στοιχεία Φυσικοχηµείας και Βιοφυσικής Β. Φαδούλογλου 2008 Στοιχεία Φυσικοχηµείας και Βιοφυσικής Εργαστήρια Βιβλίο Εξετάσεις Ύλη Στοιχεία Φυσικοχηµείας και Βιοφυσικής Εργαστήρια Βιβλίο Εξετάσεις Ύλη Στοιχεία

Διαβάστε περισσότερα

Κεφάλαιο 22 Πρωτεΐνες

Κεφάλαιο 22 Πρωτεΐνες Κεφάλαιο 22 Πρωτεΐνες Σύνοψη Οι πρωτεΐνες είναι μακρομόρια που προκύπτουν από την ένωση α-αμινοξέων. Τα α-αμινοξέα είναι οργανικές ενώσεις που έχουν μία αμινομάδα (ΝΗ 2 ) και καρβοξύλιο (COOH) συνδεδεμένα

Διαβάστε περισσότερα

Οι πρωτεΐνες δομούνται από ένα σύνολο αμινοξέων. 1/10/2015 Δ.Δ. Λεωνίδας

Οι πρωτεΐνες δομούνται από ένα σύνολο αμινοξέων. 1/10/2015 Δ.Δ. Λεωνίδας αμινοξέα Οι πρωτεΐνες δομούνται από ένα σύνολο αμινοξέων Λυσίνη CORN Ισομερές L Ισομερές D R = πλευρική αλυσίδα (side chain) Τα περισσότερα αμινοξέα είναι ασύμμετρα Όλα τα αμινοξέα που βρίσκονται στις

Διαβάστε περισσότερα

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες ΠΡΩΤΕΙΝΕΣ Οι πρωτεΐνες είναι πολυμερείς ουσίες με κυρίαρχο και πρωταρχικό ρόλο στη ζωή. Πρωτεΐνες είναι οι ουσίες που κυρίως δομούν και λειτουργούν τους οργανισμούς. Λέγονται και λευκώματα λόγω του λευκού

Διαβάστε περισσότερα

Δομές (Διαμορφώσεις) Πρωτεινικών μορίων

Δομές (Διαμορφώσεις) Πρωτεινικών μορίων Δομές (Διαμορφώσεις) Πρωτεινικών μορίων Πρωτοταγής δομή (αλληλουχία αμινοξέων) Δευτεροταγής δομή Η διάταξη της πεπτιδικής αλυσίδας στον χωρο αυτής καθ αυτής (χωρίς να ληφθούν υπ όψη οι ομάδες R) Τριτοταγής

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις

Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις Οι πρωτεΐνες μπορεί να είναι σφαιρικές (συμπαγείς) ή ινώδεις Β-1 Οι συμπαγείς, σφαιροειδείς πρωτεΐνες Είναι ευδιάλυτες στο νερό Έχουν σφαιρικό σχήμα Έχουν τα περισσότερα πολικά αμινοξέα στην εξωτερική

Διαβάστε περισσότερα

Κεφάλαιο 2. Μοτίβα πρωτεϊνικής δομής

Κεφάλαιο 2. Μοτίβα πρωτεϊνικής δομής Κεφάλαιο 2 Μοτίβα πρωτεϊνικής δομής Εικόνα 2.1 Το μοντέλο του Kendrew για τη δομή χαμηλής διακριτικότητας της μυοσφαιρίνης όπως φαίνεται από τρεις διαφορετικές οπτικές γωνίες. Οι επιμήκεις περιοχές αντιπροσωπεύουν

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Η πλειοψηφία των αμινοξέων είναι του τύπου :

Η πλειοψηφία των αμινοξέων είναι του τύπου : ΚΕΦΑΛΑΙΟ 5 Η πλειοψηφία των αμινοξέων είναι του τύπου : H 2 NCHCOOH R O συνδυασμός καρβοξυλίου και αμινομάδας στο μόριό τους έχει ως αποτέλεσμα να συμπεριφέρονται είτε ως οξέα είτε ως βάσεις (αμφολύτες).

Διαβάστε περισσότερα

Κυκλικός διχρωισµός, Circular Dichroism (CD)

Κυκλικός διχρωισµός, Circular Dichroism (CD) Κυκλικός διχρωισµός, Circular Dichroism (CD) Κυκλικός διχρωισµός Προβλήµατα που µπορούν να διερευνηθούν µε CD: Στοιχεία δευτεροταγούς δοµής. Αλλαγές στη διαµόρφωση πρωτεϊνών που οφείλονται σε µεταβολές

Διαβάστε περισσότερα

Τα τείχη έχουν πέσει: Κυτταρική Βιολογία, Βιοχημεία, Γενετική γέννησαν τη σύγχρονη Βιοϊατρική. Βιοχημεία Ι Α-2

Τα τείχη έχουν πέσει: Κυτταρική Βιολογία, Βιοχημεία, Γενετική γέννησαν τη σύγχρονη Βιοϊατρική. Βιοχημεία Ι Α-2 Περιεχόμενο της σύγχρονης Βιοχημείας Η περιγραφή της δομής, της οργάνωσης και της λειτουργίας του κυττάρου σε μοριακό επίπεδο Η διερεύνηση της σχέσης δομής-λειτουργίας των βιομορίων Η μελέτη του μεταβολισμού

Διαβάστε περισσότερα

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ MAΘΗΜΑ 4 ο AMIΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ Αλανίνη (Αla) Αλανυλοσερίνη (Αla-Ser) Αλβουµίνη ρα. Κουκουλίτσα Αικατερίνη Χηµικός Εργαστηριακός Συνεργάτης Τ.Ε.Ι Αθήνας ckoukoul@teiath.gr AMIΞΕΑ 2 λειτουργικές οµάδες

Διαβάστε περισσότερα

Μεταγωγή σήματος και βιολογικές μεμβράνες

Μεταγωγή σήματος και βιολογικές μεμβράνες Μεταγωγή σήματος και βιολογικές μεμβράνες ΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΪΝΕΣ ΠΡΩΤΕΪΝΕΣ ΒΙΟΛΟΓΙΚΩΝ ΜΕΜΒΡΑΝΩΝ Ορισμός / Μονάδες Δομές (πρωτοταγής κλπ) Ταξινόμηση με βάση τις λειτουργίες Απεικόνιση - Μοντέλα (συρμάτων

Διαβάστε περισσότερα

Πρωτεινική αναδίπλωση

Πρωτεινική αναδίπλωση Πρωτεινική αναδίπλωση Η αμινοξική αλληλουχία καθορίζει την τριτοταγή δομή - Οι πληροφορίες για τη βιολογικά δραστική στερεοδιάταξη είναι κωδικοποιημένες στην αμινοξική αλληλουχία Ριβονουκλεάση- Anfinsen,

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4 Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: καταλύτες

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4 Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: καταλύτες ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του;

ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του; ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του; Β-Α γιατί το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του άρα θα γράφεται

Διαβάστε περισσότερα

Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά

Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά Είναι απλή πολυπεπτιδική αλυσίδα 307 αμινοξέων Είναι συμπαγής και έχει σχήμα ελλειψοειδές διαστάσεων 50 x 42 x 38 A Περιέχει περιοχές α-έλικος 38%

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ)

ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) ΚΕΡΑΤΙΝΕΣ (ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ) ΣΥΣΤΑΤΙΚΑ ΥΛΙΚΑ: -ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΥ - ΜΑΛΛΙΩΝ, ΝΥΧΙΩΝ, ΟΠΛΩΝ (ΘΗΛΑΣΤΙΚΑ) - ΦΤΕΡΩΝ (ΠΤΗΝΑ) - ΔΕΡΜΑΤΟΣ ΕΡΠΕΤΩΝ Οι ιστοί που περιέχουν κερατίνες Είναι συνήθως ισχυροί και αδιάλυτοι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 1ο ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ 2010-11 ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 1 ο : ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ ΚΑΙ ΒΙΟΧΗΜΕΙΑ 1. Τι είναι η Βιοχημεία και με ποιες ενώσεις ασχολείται. 2. Πόσα και ποια στοιχεία

Διαβάστε περισσότερα

Χαρακτηριστικά της δομής της Μυοσφαιρίνης

Χαρακτηριστικά της δομής της Μυοσφαιρίνης Χαρακτηριστικά της δομής της Μυοσφαιρίνης Η μυοσφαιρίνη είναι ενα εξαιρετικά συμπαγές μόριο.οι διαστάσεις είναι 45Χ35Χ25 Α και υπαρχει πολύ λίγος αδειος χώρος στο εσωτερικό τού μορίου Γυρω στα 75% της

Διαβάστε περισσότερα

Τα αμινοξέα αποτελούν τις δομικές μονάδες των πρωτεϊνών και αποτελούν βασικό στοιχείο των οργανισμών.

Τα αμινοξέα αποτελούν τις δομικές μονάδες των πρωτεϊνών και αποτελούν βασικό στοιχείο των οργανισμών. ΑΜΙΝΟΞΕΑ Τα αμινοξέα αποτελούν τις δομικές μονάδες των πρωτεϊνών και αποτελούν βασικό στοιχείο των οργανισμών. Ο γενικός μοριακός τύπος ενός α- αμινοξέος παρουσιάζεται στο διπλανό σχήμα και συνίσταται

Διαβάστε περισσότερα

Μοριακή Αναγνώριση ΗΛΙΑΣ ΗΛΙΟΠΟΥΛΟΣ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ

Μοριακή Αναγνώριση ΗΛΙΑΣ ΗΛΙΟΠΟΥΛΟΣ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Μοριακή Αναγνώριση ΗΛΙΑΣ ΗΛΙΟΠΟΥΛΟΣ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΑΘΗΝΑ 2001 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1. Εισαγωγή στην Μοριακή Αναγνώριση 1.1. Εισαγωγή 1.2. Παραδείγματα Κεφάλαιο 2. Δομικά στοιχεία βιομορίων

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Ζήτηµα 1ο Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο

Διαβάστε περισσότερα

ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ

ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Γιώργος Τσιάµης Επίκουρος Καθηγητής Περιβαλλοντικής Μικροβιολογίας Η Περιβαλλοντική Μικροβιολογία επηρεάζει σε µεγάλο βαθµό τις περιβαλλοντικές επιστήµες γιατί συµβάλλει στην!

Διαβάστε περισσότερα

ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ <=> R

ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ <=> R ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ R ΔΕΟΞΥΑΙΜΟΣΦΑΙΡΙΝΗ ΟΞΥΑΙΜΟΣΦΑΙΡΙΝΗ (Σταθερότητα, χαμηλή συγγένεια για Ο2Εύκαμπτη, υψηλή συγγένεια για Ο2) Λόγο των

Διαβάστε περισσότερα

Ενεργειακή ανάλυση βιομορίων

Ενεργειακή ανάλυση βιομορίων Ενεργειακή ανάλυση βιομορίων Τα βιομόρια ως φυσικά συστήματα πρωτεΐνες, DNA, πεπτίδια, μικρά μόρια (ligands, φάρμακα) Αλληλεπιδράσεις μεταξύ των ατόμων + επίδραση του περιβάλλοντος νερού σταθεροποίηση

Διαβάστε περισσότερα

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογικές Μεμβράνες και Μεταγωγή Σήματος Πρωτεΐνες Διδάσκουσα: Καθ. Μαρία - Ελένη Ε. Λέκκα Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

Βιοφυσική. ΦΥΣ 415 Διδάσκων Σ. Σκούρτης (χειμερινό εξάμηνο ) 2 η διάλεξη

Βιοφυσική. ΦΥΣ 415 Διδάσκων Σ. Σκούρτης (χειμερινό εξάμηνο ) 2 η διάλεξη Βιοφυσική ΦΥΣ 415 Διδάσκων Σ. Σκούρτης (χειμερινό εξάμηνο 2009-10) 2 η διάλεξη Πρωτεΐνες Πρωτεΐνη: πολυμερές από αμινοξέα 20 διαφορετικά αμινοξέα CH 2 Pro Ένα από αυτά είναι η Προλίνη CH 2 CH 2 NH C α

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

ΑΜΙΝΟΞΕΑ ΠΕΠΤΙΔΙΑ ΠΡΩΤΕΪΝΕΣ

ΑΜΙΝΟΞΕΑ ΠΕΠΤΙΔΙΑ ΠΡΩΤΕΪΝΕΣ ΑΜΙΝΟΞΕΑ ΠΕΠΤΙΔΙΑ ΠΡΩΤΕΪΝΕΣ Παππάς Χρήστος Επίκουρος καθηγητής ΑΜΙΝΟΞΕΑ Αμινοξέα είναι οργανικά μόρια που διαθέτουν καρβοξύλιο (-α) και αμινομάδα (-ες). Πλευρική αλυσίδα R NH 2 α O α- αμινοξύ OH Είναι

Διαβάστε περισσότερα

Υπερδευτεροταγής Δομή Πρωτεϊνών

Υπερδευτεροταγής Δομή Πρωτεϊνών Υπερδευτεροταγής Δομή Πρωτεϊνών Δομικά μοτίβα Τα μοτίβα ακολουθιών (sequence motifs) είναι τοπικά διατηρημένες ακολουθίες που σχετίζονται (ή όχι) με μια συγκεκριμένη λειτουργία (βλ. τη βάση δεδομένων PROSITE)

Διαβάστε περισσότερα

2.1 Εισαγωγή. 2.1 Εισαγωγή. 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο. 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο. τη δευτεροταγή δοµή

2.1 Εισαγωγή. 2.1 Εισαγωγή. 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο. 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο. τη δευτεροταγή δοµή Κεφάλαιο 2 2.1 Εισαγωγή 2.2 Το εσωτερικό των ϖρωτεϊνών είναι υδρόφοβο 2.3 Η α-έλικα αϖοτελεί ένα σηµαντικό στοιχείο της δευτεροταγούς δοµής 2.4 Η α-έλικα έχει διϖολική ροϖή 2.5 Κάϖοια αµινοξέα ϖροτιµώνται

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες Οργανική Χημεία Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες 1. Γενικά Πρωτεΐνες: μεγάλα βιομόρια που απαντούν σε όλους τους ζωντανούς οργανισμούς Διαφορετικά είδη πρωτεϊνών με ποικίλη βιολογική

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Τρίτη, 7 Μαΐου 008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ ο Για τις ερωτήσεις. -. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση... Ποιο

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ 3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Ερωτήσεις πολλαπλής επιλογής Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΠΡΩΤΕΙΝΕΣ ΚΑΙ ΔΙΑΤΡΟΦΗ

ΠΡΩΤΕΙΝΕΣ ΚΑΙ ΔΙΑΤΡΟΦΗ ΠΡΩΤΕΙΝΕΣ ΚΑΙ ΔΙΑΤΡΟΦΗ Σεπτέμβριος 2015 Αντωνία Ματάλα Χαροκόπειο Πανεπιστήμιο Τι είναι οι πρωτεΐνες Βασικά σημεία Οργανικά μεγαλομόρια που αποτελούνται από αμινοξέα (περιέχουν C, H, O & Ν) Απαραίτητες

Διαβάστε περισσότερα

Κεφάλαιο 5 Δομές β: Τρεις Κατηγορίες

Κεφάλαιο 5 Δομές β: Τρεις Κατηγορίες Κεφάλαιο 5 β-δομές Κεφάλαιο 5 Δομές β: Τρεις Κατηγορίες Οι β-επικράτειες είναι οι δομές οι οποίες αποτελούν την δεύτερη μεγάλη ομάδα πρωτεϊνικών επικρατειών. Η ομάδα αυτή παρουσιάζει τη μεγαλύτερη ποικιλομορφία

Διαβάστε περισσότερα

Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης

Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης Καθώς το οξυγόνο χρησιμοποιείται στους ιστούς παράγεται CO2 το οποίο πρέπει να μεταφερθεί πίσω στους πνεύμονες ή τα βράγχια

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2016-2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ 1) Δίνονται τα αμινοξέα σερίνη, αλανίνη, γλουταμικό, κυστεΐνη, λυσίνη, αργινίνη, διαχωρίστε τα

Διαβάστε περισσότερα

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τίτλος Μαθήματος: Ενζυμολογία Ενότητα: Εισαγωγή Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τμήμα: Χημείας 8 1. EIΣAΓΩΓH Tα ένζυμα είναι οι καταλύτες της ζώσης ύλης. Καταλύουν τις χημικές αντιδράσεις,

Διαβάστε περισσότερα

ΠΡΩΤΕΙΝΕΣ ΚΑΙ ΔΙΑΤΡΟΦΗ

ΠΡΩΤΕΙΝΕΣ ΚΑΙ ΔΙΑΤΡΟΦΗ ΠΡΩΤΕΙΝΕΣ ΚΑΙ ΔΙΑΤΡΟΦΗ Σεπτέμβριος 2016 Αντωνία Ματάλα Χαροκόπειο Πανεπιστήμιο Βασικά στοιχεία Πρωτεΐνες και διατροφή Οργανικά μεγαλομόρια τα οποία αποτελούνται από αμινοξέα (περιέχουν C, H, O & Ν) Απαραίτητες

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2015-2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ 1)Πώς το φαινόμενο Bohr επηρεάζει την πρόσδεση οξυγόνου στην αιμοσφαιρίνη; Που συνδέονται τα ιόντα

Διαβάστε περισσότερα

Φυσική Στερεών στις Πρωτεΐνες

Φυσική Στερεών στις Πρωτεΐνες Φυσική Στερεών στις Πρωτεΐνες Νίκος Απ. Παπανδρέου Τ.Ε.Ι. Πειραιά Φεβρουάριος 2010 Ένα ελικοϊδές μονοπάτι Χημική δομή μίας πρωτεΐνης Μήκος αλυσίδας ~30 έως ~1000 αµινοξέα Συνολικός αριθµός ατόµων έως ~

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ

ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ Διδάσκοντες: Δ.Δ. Λεωνίδας, Α.-Μ. Ψαρρά Κωδικός e-class: SEYC194 28/9/2015 Δ.Δ. Λεωνίδας 28/9/2015 Δ.Δ. Λεωνίδας Βιοχημεία είναι η Χημεία που εμφανίζεται μέσα στους ζώντες οργανισμούς

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

Οργανική χηµεία και βιοχηµεία

Οργανική χηµεία και βιοχηµεία Οργανική χηµεία και βιοχηµεία Ερωτήσεις πολλαπλής επιλογής 1. Στις χηµικές ενώσεις, που αποτελούν το κύτταρο, περιέχονται περίπου a) δέκα χηµικά στοιχεία b) ενενήντα χηµικά στοιχεία c) είκοσι χηµικά στοιχεία

Διαβάστε περισσότερα

οµή και λειτουργία των πρωτεϊνών TÚÈÙÔÙ Á ÔÌ

οµή και λειτουργία των πρωτεϊνών TÚÈÙÔÙ Á ÔÌ οµή και λειτουργία των πρωτεϊνών Κρύσταλλοι ανθρώπινης ινσουλίνης. Η ινσουλίνη είναι µια πρωτεϊνική ορ- µόνη, απολύτως απαραίτητη για τη διατήρηση των επιπέδων του σακχάρου στο αίµα. (Κάτω) Αυτό που προσδιορίζει

Διαβάστε περισσότερα

Βασικοί μηχανισμοί προσαρμογής

Βασικοί μηχανισμοί προσαρμογής ΣΥΓΚΡΙΤΙΚΗ ΦΥΣΙΟΛΟΓΙΑ ΖΩΩΝ 23-24, 18/4/2016 Π.Παπαζαφείρη Βασικοί μηχανισμοί προσαρμογής Προσαρμογή σε μοριακό και γονιδιακό επίπεδο Επίπεδα ελέγχου 1. Πρωτεïνική δράση 2. Πρωτεïνοσύνθεση 3. Ρύθμιση της

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA

Δοµή και ιδιότητες του DNA Δοµή και ιδιότητες του DNA Βακτηριακό χρωµόσωµα ευκαρυωτικό χρωµόσωµα και χρωµατίνη 28/02/2014 1 Tο βακτηριακό γονιδίωµα περιέχεται σε ένα κυκλικό DNA µήκους 1300 µm εντός του βακτηριακού κυττάρου που

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο. 1.2 Όξινο είναι το υδατικό διάλυμα του α. ΝaCl. β. ΝΗ 4 Cl. γ. CH 3 COONa. δ. KOH. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΤΕΛΟΣ 1ΗΣ ΑΠΟ 7 ΣΕΛΙ ΕΣ

ΘΕΜΑ 1 ο. 1.2 Όξινο είναι το υδατικό διάλυμα του α. ΝaCl. β. ΝΗ 4 Cl. γ. CH 3 COONa. δ. KOH. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΤΕΛΟΣ 1ΗΣ ΑΠΟ 7 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 30 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Άσκηση 7. Προσομοίωση 3D Δομών Βιομορίων μέσω. Ομολογίας & Threading

Άσκηση 7. Προσομοίωση 3D Δομών Βιομορίων μέσω. Ομολογίας & Threading Άσκηση 7 Προσομοίωση 3D Δομών Βιομορίων μέσω Ομολογίας & Threading Προσομοίωση 2ταγούς δομής πρωτεϊνών Δευτεροταγής Δομή: Η 2ταγής δομή των πρωτεϊνών είναι σταθερή τοπική διαμόρφωση της πολυπεπτιδικής

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Κεφάλαιο 3. Δομές τάξης α

Κεφάλαιο 3. Δομές τάξης α Κεφάλαιο 3 Δομές τάξης α Κεφάλαιο 3 Δομές Τάξης α: Σπειρωμένα Σπειράματα Εικόνα 3.1 Σχηματικό διάγραμμα της δομής ενός σπειρωμένου σπειράματος α-ελίκων. Δύο α-έλικες συμπλέκονται και σταδιακά τυλίγονται

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

1. Αλληλεπιδράσεις μεταξύ βιομορίων

1. Αλληλεπιδράσεις μεταξύ βιομορίων 1. Αλληλεπιδράσεις μεταξύ βιομορίων Το αντικείμενο των αλληλεπιδράσεων μεταξύ των βιομορίων καλύπτει ένα τεράστιο σύνολο περιπτώσεων με αποτελέσματα από βιολογικές, βιοχημικές και βιοφυσικές μελέτες που

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια Περιγραφή μαθήματος Επανάληψη σημαντικών εννοιών από την Οργανική Χημεία Χημική σύσταση των κυττάρων Μονοσακχαρίτες Αμινοξέα Νουκλεοτίδια

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Χημεία Βιοχημεία Τεχνολογικής Κατεύθυνσης. Ημ/νία: 04 Ιουνίου 2014

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Χημεία Βιοχημεία Τεχνολογικής Κατεύθυνσης. Ημ/νία: 04 Ιουνίου 2014 Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Χημεία Βιοχημεία Τεχνολογικής Κατεύθυνσης Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. γ Α2. δ Α3. α. Σ β. Λ γ. Λ 𝐻! 𝚨𝟒. 𝛂)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Οι James Watson και Francis Crick δίπλα από το μοντέλο της διπλής έλικας του DNA που τους εξασφάλισε το Βραβείο Νόμπελ. 2015 2 Β.

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛ. ΜΑΚΡΟΜΟΡΙΑ 1 ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ 2010 2 ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Βιολογία είναι η επιστήμη

Διαβάστε περισσότερα

1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου

1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου 1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Τασος Οικονόµου Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό

Διαβάστε περισσότερα