ΜΕΡΟΣ ΙI: Η ΡΟΗ ΤΩΝ ΓΕΝΕΤΙΚΩΝ ΠΛΗΡΟΦΟΡΙΩΝ ΚΕΦΑΛΑΙΟ 7 Σύνθεση και επεξεργασία του RNA

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΜΕΡΟΣ ΙI: Η ΡΟΗ ΤΩΝ ΓΕΝΕΤΙΚΩΝ ΠΛΗΡΟΦΟΡΙΩΝ ΚΕΦΑΛΑΙΟ 7 Σύνθεση και επεξεργασία του RNA"

Transcript

1 Ευάγγελος Κωλέττας, B.Sc (HONS), Ph.D.(LON) Αναπληρωτής Καθηγητής, Εργαστήριο Βιολογίας, Ιατρική Σχολή, Πανεπιστήμιο Ιωαννίνων ΜΕΡΟΣ ΙI: Η ΡΟΗ ΤΩΝ ΓΕΝΕΤΙΚΩΝ ΠΛΗΡΟΦΟΡΙΩΝ ΚΕΦΑΛΑΙΟ 7 Σύνθεση και επεξεργασία του RNA 7.1. Η μεταγραφή στους προκαρυωτικούς οργανισμούς 7.2. Η RNA πολυμεράση των ευκαρυωτικών οργανισμών και οι γενικοί μεταγραφικοί παράγοντες 7.3. Η ρύθμιση της μεταγραφής στους ευκαρυωτικούς οργανισμούς 7.4. Επεξεργασία και ανακύκλωση του RNA Πείραμα-Σταθμός: Η απομόνωση ενός μεταγραφικού παράγοντα Πείραμα-Σταθμός: Η ανακάλυψη των snrnp ΕΙΣΑΓΩΓΗ Στα Κ5 και Κ6 εξετάστηκαν η οργάνωση του γονιδιωματικού DNA, καθώς και οι μηχανισμοί με τους οποίους εξασφαλίζεται η πιστή μεταβίβαση του από γενιά σε γενιά. Το γονιδιωματικό DNA μπορεί να θεωρηθεί η πηγή των γενετικών οδηγιών που ελέγχουν τις κυτταρικές λειτουργίες. Οι οδηγίες αυτές εκτελούνται μέσω της σύνθεσης του RNΑ και των πρωτεϊνών. Ωστόσο να σημειωθεί πως τα χαρακτηριστικά ενός κυττάρου δεν καθορίζονται μόνο από το ποια γονίδια έχει κληρονομήσει, αλλά και από το ποια από αυτά εκφράζονται σε κάθε δεδομένη στιγμή. Η ρύθμιση της γονιδιακής έκφρασης επιτρέπει στα κύτταρα να προσαρμόζονται στις αλλαγές του περιβάλλοντος τους και είναι υπεύθυνη για τις ξεχωριστές ιδιότητες κάθε κυτταρικού τύπου των σύνθετων ζωικών οργανισμών. Για παράδειγμα, τα μυϊκά και τα ηπατικά κύτταρα διαθέτουν τα ίδια γονίδια. Έχουν όμως διαφορετικές ιδιότητες, καθώς κατά την ανάπτυξη του οργανισμού, από την αρχή ακόμα της διαφοροποίησης τους, εκφράζουν διαφορετικά γονίδια μέσω ειδικών μηχανισμών ελέγχου της γονιδιακής έκφρασης. Το πρώτο στάδιο της έκφρασης ενός γονιδίου, η μεταγραφή του DNA σε RNA, αποτελεί το αρχικό επίπεδο όπου ρυθμίζεται η γονιδιακή έκφραση τόσο στα προκαρυωτικά όσο και στα ευκαρυωτικά κύτταρα. Στη συνέχεια, τα RNA των ευκαρυωτικών κυττάρων τροποποιούνται με διάφορους τρόπους - για παράδειγμα, αφαιρούνται τα ιντρόνια με το μάτισμα - προκειμένου το πρωτογενές μετάγραφο να αποκτήσει τη λειτουργική του μορφή. Οι διάφοροι τύποι του RNΑ έχουν συγκεκριμένο ρόλο στα κύτταρα: τα αγγελιαφόρο RNA (mrna) λειτουργούν ως μήτρες για τη σύνθεση πρωτεϊνών, ενώ τα ριβοσωμικά RNA (rrna) και τα μεταφορικά RNA (trna) συμμετέχουν στη μετάφραση του mrna. Επιπλέον, ορισμένα μικρά RNA συμμετέχουν στη ρύθμιση της έκφρασης των γονιδίων, στο μάτισμα του mrna, στην ωρίμανση του rrna και στη διαλογή των πρωτεϊνών στους ευκαρυώτες. Στην πραγματικότητα, μερικά από τα σημαντικότερα σύγχρονα επιτεύγματα της βιολογίας σχετίζονται με τον ρόλο των μικρών μη κωδικών μορίων RNA (mirna) ως ρυθμιστών της έκφρασης των γονιδίων στα ευκαρυωτικά κύτταρα. Η μεταγραφή και η ωρίμανση του RNA εξετάζονται σε αυτό το κεφάλαιο. Το τελικό στάδιο της έκφρασης των γονιδίων, η μετάφραση του mrna σε πρωτεΐνη, εξετάζεται στο Κ Η μεταγραφή στους προκαρυωτικούς οργανισμούς Όπως στους περισσότερους τομείς της μοριακής βιολογίας, έτσι και στη μεταγραφή η Ε. coli έχει αποτελέσει τον οργανισμό-μοντέλο με τη μελέτη του οποίου τέθηκαν οι βάσεις όπου στηρίχτηκε αργότερα η έρευνα στα ευκαρυωτικά κύτταρα. Στο Κ4 αναφέρθηκε ότι το mrna ανακαλύφθηκε στην Ε. coli. Η Ε. coli αποτέλεσε επίσης τον πρώτο οργανισμό από τον οποίο απομονώθηκε και μελετήθηκε η RNΑ πολυμεράση. Οι βασικοί μηχανισμοί ρύθμισης της μεταγραφής διευκρινίστηκαν χάρη σε καινοτόμα πειράματα στην Ε. coli, όπου η ρύθμιση της γονιδιακής έκφρασης επιτρέπει στα κύτταρα να ανταποκρίνονται σε αλλαγές του περιβάλλοντος, όπως είναι οι αλλαγές στη διαθεσιμότητα των θρεπτικών συστατικών. Η κατανόηση της μεταγραφής στην Ε. coli αποτέλεσε τη βάση για τη μελέτη των πιο σύνθετων μηχανισμών ρύθμισης της γονιδιακής έκφρασης που παρατηρούνται στα ευκαρυωτικά κύτταρα. 1

2 RNA πολυμεράση και μεταγραφή Το κύριο ένζυμο για τη σύνθεση του RNΑ είναι η RNA πολυμεράση (RNA polymerase), η οποία καταλύει τον πολυμερισμό 5'-τριφωσφορικών ριβονουκλεοσιδίων (ΝΤΡ, Nucleoside Triphosphates), με τη σειρά που υπαγορεύεται από ένα μόριο DNA το οποίο χρησιμοποιείται ως μήτρα. Η σύνθεση του RNA είναι παρόμοια με αυτή του DNA. Η RNA πολυμεράση, όπως και η DNA πολυμεράση, καταλύει την επιμήκυνση των αλυσίδων RNA πάντα με κατεύθυνση 5' προς 3'. Αντίθετα με την DNA πολυμεράση, η RNA πολυμεράση δε χρειάζεται έναν προϋπάρχοντα εκκινητή για να ξεκινήσει τη σύνθεση του RNΑ. Η μεταγραφή ξεκινάει de novo από ειδικές περιοχές στην αρχή των γονιδίων, με τον σχηματισμό φωσφοδιεστερικού δεσμού ανάμεσα στα δύο πρώτα ΝΤΡ του υπό σύνθεση μορίου RNΑ. Η διαδικασία της έναρξης είναι ιδιαίτερα σημαντική, επειδή αποτελεί βασικό στάδιο για τη ρύθμιση της μεταγραφής. ΕΙΚΟΝΑ 7.1. Η RNA πολυμεράση της Ε. coli. Το πλήρες ένζυμο αποτελείται από έξι υπομονάδες: δύο α, μία β, μία β', μία ω και μία σ [(α2ββ'ω)σ]. Η υπομονάδα σ συνδέεται πιο χαλαρά και έτσι μπορεί να αποσπαστεί σχετικά εύκολα από τις υπόλοιπες υπομονάδες, οι οποίες συνιστούν τη λεγόμενη κεντρική πολυμεράση (ή ολοένζυμο) (α2ββ'ω). Οι α, β και β έχουν σχετικά σταθερά μεγέθη σε διάφορα είδη βακτηρίων, ενώ η σ ποικίλλει σε μεγαλύτερο βαθμό. Η RNA πολυμεράση, όπως και η DNA πολυμεράση, είναι ένα σύνθετο ένζυμο που αποτελείται από πολλές πολυπεπτιδικές αλυσίδες. Το πλήρες βακτηριακό ένζυμο αποτελείται από 5 διαφορετικούς τύπους υπομονάδων που ονομάζονται α, β, β', ω και σ (Εικ. 7.1). Η υπομονάδα σ είναι σχετικά χαλαρά προσδεδεμένη και μπορεί να διαχωριστεί εύκολα από τις άλλες υπομονάδες, οπότε προκύπτει η λεγόμενη κεντρική πολυμεράση (core polymerase), που αποτελείται από δύο υπομονάδες α, μία β, μία β' και μία ω. Η κεντρική RNA πολυμεράση μπορεί να καταλύσει τον πολυμερισμό των ΝΤΡ στο RNΑ, γεγονός που αποδεικνύει ότι η υπομονάδα σ δεν είναι απαραίτητη για τη βασική καταλυτική ενεργότητα του ενζύμου. Ωστόσο, απουσία της σ, η κεντρική πολυμεράση δεν προσδένεται με ειδικότητα, όπως συμβαίνει φυσιολογικά στις αλληλουχίες του DNA που σηματοδοτούν την έναρξη της μεταγραφής. Επομένως, η υπομονάδα σ είναι απαραίτητη για την αναγνώριση των σωστών περιοχών έναρξης της μεταγραφής. Η αναγνώριση των περιοχών αυτών αποτελεί κρίσιμο στοιχείο της μεταγραφής, επειδή η σύνθεση ενός RNΑ, προκειμένου να είναι λειτουργικό, πρέπει να ξεκινάει από την αρχή του αντίστοιχου γονιδίου. Τα περισσότερα βακτήρια, συμπεριλαμβανομένης της Ε. coli, διαθέτουν αρκετές υπομονάδες σ, καθεμία από τις οποίες κατευθύνει την RNA πολυμεράση σε διαφορετικές περιοχές έναρξης της μεταγραφής (δηλαδή σε διαφορετικά γονίδια). Να σημειωθεί ότι υπάρχουν περισσότερα μόρια κεντρικής πολυμεράσης (ολοενζύμου) από ότι μόρια του παράγοντα σ. Τα βακτήρια, χρησιμοποιώντας εναλλακτικές υπομονάδες σ κάτω από διαφορετικές (περιβαλλοντικές) συνθήκες (για παράδειγμα, ανάλογα με τη διαθεσιμότητα των θρεπτικών συστατικών, θερμοκρασία), ενεργοποιούν διαφορετικές ομάδες γονιδίων τους. 2

3 Εκτός από τον σ70, η E. coli έχει αρκετούς παράγοντες σίγμα που επάγονται σε συγκεκριμένες περιβαλλοντικές συνθήκες. Ο εκθέτης στο όνομα του παράγοντα υποδηλώνει τη μάζα του. σ70(rpod) ή σa (The housekeeping sigma factor): Ο παράγοντας σ βασικών λειτουργιών (κύριος παράγοντας σ) εμπλέκεται στη μεταγραφή των περισσοτέρων γονιδίων στα βακτηριακά κύτταρα που πολλαπλασιάζονται και αυξάνονται, έτσι ώστε να διατηρούνται ενεργά τα απαραίτητα γονίδια και οι μεταβολικές πορείες. Τα γονίδια που αναγνωρίζονται από το σ70 περιέχουν στους υποκινητές τους τις συγκαταβατικές αλληλουχίες (στοιχεία -10 και -35). σ38(rpos) (Starvation/stationary phase σ factor): Παράγοντας σ που εμπλέκεται στη μεταγραφή γονιδίων σε περίοδο ασιτίας και κατά την στατική φάση αύξησης. σ32 (RpoH) (The heat shock σ factor): Επάγεται όταν τα βακτήρια εκτίθενται σε υψηλές θερμοκρασίες (>370C). Ως αποτέλεσμα της επαγωγής της έκφρασης του, ο σ32 δεσμεύεται στην κεντρική πολυμεράση, η οποία με τη σειρά της μεταγράφει γονίδια που κωδικοποιούν πρωτεΐνες του θερμικού στρες (heat shock proteins), που θα βοηθήσουν τα βακτήρια να επιβιώσουν σε υψηλότερες θερμοκρασίες. Μερικές απ αυτές τις πρωτεΐνες που επάγονται από την ενεργοποίηση του σ32 είναι πρωτεΐνες-συνοδοί (chaperones), πρωτεάσες και ένζυμα επιδιόρθωσης του DNA. σ24 (RpoE) ή σε (The extracytoplasmic/extreme heat stress sigma factor): Ο παράγοντας σ24 επάγεται στο κυτταρόπλασμα όταν τα βακτήρια εκτίθενται σε πάρα πολύ υψηλές θερμοκρασίες. σ54 (RpoN) (The nitrogen-limitation sigma factor): Επάγεται όταν υπάρχει έλλειψη αζώτου, και συμβάλλει στη μεταγραφή γονιδίων που εμπλέκονται στο μεταβολισμό του αζώτου. σ28 (RpoF) (The flagellar σ factor): Συμβάλλει στη μεταγραφή μαστιγιακών γονιδίων. Η περιοχή του DNA όπου προσδένεται η RNA πολυμεράση για να ξεκινήσει τη μεταγραφή ενός γονιδίου ονομάζεται υποκινητής (promoter). Οι αλληλουχίες του DNA που συμμετέχουν στη λειτουργία του υποκινητή προσδιορίστηκαν μέσω της σύγκρισης των νουκλεοτιδικών αλληλουχιών των υποκινητών μιας σειράς διαφορετικών γονιδίων της Ε. coli. Από τέτοιες συγκρίσεις προέκυψε ότι η περιοχή που βρίσκεται ανοδικά (προς το 5') της θέσης έναρξης της μεταγραφής περιέχει δύο μικρής έκτασης τμήματα με κοινή αλληλουχία σε πολλά γονίδια. Πρόκειται για δύο εξανουκλεοτίδια, που ονομάζονται στοιχεία -10 και -35 (Εικ. 7.2). Η ονομασία τους υποδηλώνει τη θέση τους σε σχέση με το σημείο έναρξης της μεταγραφής, το οποίο ορίζεται ως +1. Η πρότυπη αλληλουχία του στοιχείου -10 είναι TATAAT, ενώ του στοιχείου -35 είναι TTGACA. Όμως, σε διαφορετικούς υποκινητές, οι αλληλουχίες των στοιχείων -10 και -35 δεν είναι πανομοιότυπες, είναι όμως αρκετά όμοιες και από τη στοίχιση τους προκύπτουν πρότυπες αλληλουχίες οι οποίες υποδεικνύουν τα νουκλεοτίδια που εμφανίζονται συχνότερα σε κάθε θέση. ΕΙΚΟΝΑ 7.2. Οι χαρακτηριστικές αλληλουχίες των υποκινητών της Ε. coli. Οι υποκινητές της Ε. coli φέρουν 2 χαρακτηριστικές αλληλουχίες που βρίσκονται 10 και 35 ζεύγη βάσεων ανοδικά από τη θέση έναρξης της μεταγραφής (+1). Οι πρότυπες αλληλουχίες που υποδεικνύονται εδώ αντιστοιχούν στα νουκλεοτίδια που συναντώνται συχνότερα σε κάθε θέση με βάση τη σύγκριση των αντίστοιχων αλληλουχιών από διαφορετικούς υποκινητές. 3

4 Αρκετά πειραματικά δεδομένα υποστηρίζουν τον λειτουργικό ρόλο των στοιχείων -10 και -35 των υποκινητών. Πρώτον, τα γονίδια των οποίων οι υποκινητές διαφέρουν σημαντικά από τις πρότυπες αλληλουχίες μεταγράφονται λιγότερο αποτελεσματικά από αυτά με υποκινητές που εμφανίζουν μεγαλύτερη ομολογία προς τις πρότυπες αλληλουχίες. Δεύτερον, η εισαγωγή μεταλλαγών σε οποιαδήποτε από τις πρότυπες αλληλουχίες -35 και -10 επηρεάζει σημαντικά τη λειτουργία του υποκινητή. Τρίτον, η σύνδεση της RNA πολυμεράσης στις περιοχές αυτές των υποκινητών έχει διαπιστωθεί με πειράματα ιχνηλάτησης του DNA (DNA footprinting). Η ιχνηλάτηση του DNΑ χρησιμοποιείται ευρέως για τον εντοπισμό των περιοχών πρόσδεσης πρωτεϊνών στο DNA (Εικ. 7.3). ΕΙΚΟΝΑ 7.3: Ιχνηλάτηση του DNA. Μια αρχική ποσότητα του υπό έλεγχο τμήματος DNA με ραδιοσημασμένο το ένα του άκρο χωρίζεται στα δύο. Το ένα δείγμα επωάζεται με την πρωτεΐνη που αναγνωρίζει μια συγκεκριμένη αλληλουχία του τμήματος DNA και προσδένεται σε αυτή. Κατόπιν, τα δύο δείγματα υφίστανται μερική πέψη με DNάση, ώστε κάθε μόριο να κόβεται κατά μέσο όρο σε μία θέση. Στο δείγμα που έχει επωαστεί με την πρωτεΐνη, η περιοχή του DNA στην οποία αυτή συνδέεται προστατεύεται από τη δράση της DNάσης και δεν κόβεται. Στη συνέχεια, τα σύμπλοκα DNA-πρωτεΐνης υφίστανται αποδιάταξη και τα μεγέθη των ραδιοσημασμένων μορίων που έχουν προκύψει από την πέψη με την DNάση προσδιορίζονται με ηλεκτροφόρηση των δύο δειγμάτων σε πήκτωμα ακρυλαμιδίου. Στο δείγμα που επωάστηκε με την πρωτεΐνη απουσιάζουν τα κομμάτια του DNA που προκύπτουν από πέψη με την DNάση στην περιοχή πρόσδεσης της πρωτεΐνης. 4

5 Σε αυτού του τύπου τα πειράματα, το υπό έλεγχο τμήμα DNA σημαίνεται στο ένα του άκρο με κάποιο ραδιοϊσότοπο ή με μια φθορίζουσα χρωστική. Κατόπιν, το σημασμένο DNA επωάζεται με την πρωτεΐνη που εξετάζεται (π.χ. με την RNΑ πολυμεράση) και στη συνέχεια υποβάλλεται σε μερική πέψη με DΝάση. Όταν οι πρωτεΐνες βρίσκονται συνδεδεμένες με το DNA, εμποδίζουν την πέψη από την DΝάση στις περιοχές πρόσδεσης τους. Σε αυτό ακριβώς το γεγονός βασίζεται η μέθοδος της ιχνηλάτησης του DNA. Συγκρίνοντας τα προϊόντα της μερικής πέψης ενός δείγματος DNA που έχει επωαστεί με πρωτεΐνη με τα προϊόντα της μερικής πέψης ενός δεύτερου δείγματος DNΑ το οποίο αναλύεται παράλληλα χωρίς όμως να επωαστεί προηγουμένως με πρωτεΐνη, προσδιορίζονται οι περιοχές πρόσδεσης της πρωτεΐνης. Παραλλαγές αυτής της βασικής μεθόδου, όπου χρησιμοποιούνται χημικά αντιδραστήρια που τροποποιούν και κόβουν το DNA σε συγκεκριμένα νουκλεοτίδια, μπορούν να χρησιμοποιηθούν ώστε να εντοπιστούν οι συγκεκριμένες βάσεις που αλληλεπιδρούν με μια πρωτεΐνη. Τα πειράματα ιχνηλάτησης έδειξαν ότι η RNA πολυμεράση προσδένεται σε μια περιοχή των γονιδίων μήκους περίπου 60 bp, η οποία εκτείνεται από τη θέση -40 έως τη θέση +20 (δηλαδή από 40 νουκλεοτίδια ανοδικά μέχρι 20 νουκλεοτίδια καθοδικά της θέσης έναρξης της μεταγραφής). Η υπομονάδα σ προσδένεται ειδικά στις αλληλουχίες και των δυο περιοχών -35 και -10, γεγονός που υποδεικνύει τη σημασία των στοιχείων αυτών στη λειτουργία του υποκινητή. Επιπλέον, μερικοί υποκινητές της Ε. coli διαθέτουν μια τρίτη αλληλουχία, η οποία βρίσκεται ανοδικά του στοιχείου -35 και λειτουργεί ως ειδική περιοχή πρόσδεσης για την υπομονάδα α της RNA πολυμεράσης ANIMATION ( Μεταγραφή. Μεταγραφή ονομάζεται η διαδικασία σύνθεσης του RNA, την οποία καταλύει το ένζυμο RNA πολυμεράση χρησιμοποιώντας ως μήτρα το DNA. Απουσία της υπομονάδας σ, η RNA πολυμεράση προσδένεται μη ειδικά και με μικρή συγγένεια στο DNA. Ο ρόλος της σ είναι, μέσω της ειδικής πρόσδεσης της στις αλληλουχίες -35 και -10, να κατευθύνει την RNA πολυμεράση στους υποκινητές (Εικ. 7.4). Από την αρχική πρόσδεση της RNA πολυμεράσης στον υποκινητή προκύπτει το λεγόμενο κλειστό σύμπλοκο υποκινητή, που ονομάζεται έτσι επειδή το DNA δεν έχει ακόμα ξετυλιχτεί. Στη συνέχεια, η RNΑ πολυμεράση ξετυλίγει βάσεις του DNΑ, από περίπου τη θέση -12 μέχρι τη θέση +2, οπότε σχηματίζεται το λεγόμενο ανοικτό σύμπλοκο υποκινητή, στο οποίο η μία αλυσίδα του μονόκλωνου πλέον DNA λειτουργεί ως μήτρα για τη μεταγραφή. Η μεταγραφή ξεκινά με τη σύνδεση μέσω φωσφοδιεστερικού δεσμού δύο ελεύθερων ΝΤΡ. Μετά την προσθήκη των δέκα πρώτων νουκλεοτιδίων, η σ αποδεσμεύεται από την RNA πολυμεράση, η οποία κατόπιν απομακρύνεται από τον υποκινητή καθώς κινείται κατά μήκος της μήτρας DNA επιμηκύνοντας την αναπτυσσόμενη αλυσίδα του RNA. 5

6 ΕΙΚΟΝΑ 7.4. Η μεταγραφή στην Ε. coli. Η RNA πολυμεράση αρχικά προσδένεται χωρίς ειδικότητα στο DNA και μετακινείται κατά μήκος του μορίου μέχρι η υπομονάδα σ να προσδεθεί στα στοιχεία -35 και -10, ώστε να σχηματιστεί το λεγόμενο κλειστό σύμπλοκο υποκινητή. Κατόπιν, η πολυμεράση ξετυλίγει το DNA γύρω από τη θέση έναρξης της μεταγραφής και ξεκινάει ο πολυμερισμός ελεύθερων ΝΤΡ. Ακολούθως, η υπομονάδα σ αποδεσμεύεται από την κεντρική πολυμεράση, η οποία αρχίζει να κινείται καθοδικά σε σχέση με τον υποκινητή επιμηκύνοντας το υπό σύνθεση μόριο RNA. Κατά τη διάρκεια της επιμήκυνσης και ενώ συνεχίζει τη σύνθεση του mrna, η RNA πολυμεράση παραμένει συνδεδεμένη με τη μήτρα DNA. Καθώς κινείται κατά μήκος του DNA, ξετυλίγει την περιοχή που βρίσκεται μπροστά της και τυλίγει ξανά την περιοχή που βρίσκεται πίσω της. Το τμήμα του DNΑ στην περιοχή της μεταγραφής που ανά πάσα στιγμή είναι ξετυλιγμένο έχει μήκος περίπου 15 βάσεις. Στην αλυσίδα-μήτρα, 8-9 από τις βάσεις αυτές βρίσκονται συνδεδεμένες με τις συμπληρωματικές βάσεις της αναπτυσσόμενης αλυσίδας RNA. Υψηλής ανάλυσης μελέτες της δομής της βακτηριακής RNA πολυμεράσης έδειξαν ότι οι υπομονάδες β και β' σχηματίζουν μια δομή με σχήμα δαγκάνας καβουριού που «γραπώνει» τη μήτρα DNA (Εικ. 7.5). Το ενεργό κέντρο 6

7 της RNA πολυμεράσης εντοπίζεται σε έναν εσωτερικό δίαυλο που σχηματίζεται μεταξύ των υπομονάδων β και β' και χωράει περίπου 20 ζεύγη βάσεων DNA. Η σύνθεση του RNA συνεχίζεται μέχρι η RNA πολυμεράση να συναντήσει ένα σήμα τερματισμού. Στο σημείο που σταματάει η μεταγραφή, το RNA αποδεσμεύεται από την RNA πολυμεράση και το ένζυμο αποσυνδέεται από τη μήτρα DNA. ΕΙΚΟΝΑ 7.5. Δομή της βακτηριακής RNA πολυμεράσης. Οι υπομονάδες α της πολυμεράσης απεικονίζονται με σκούρο πράσινο και ανοιχτό πράσινο χρώμα. Με μπλε χρώμα απεικονίζεται η υπομονάδα β, με ροζ χρώμα η υπομονάδα β' και με κίτρινο χρώμα η υπομονάδα ω. (Ευγενική προσφορά του Seth Darst, Rockefeller University). Υπάρχουν δύο εναλλακτικοί μηχανισμοί τερματισμού της μεταγραφής στην Ε. coli. Ο απλούστερος και πιο κοινός τύπος σήματος τερματισμού αποτελείται από μια ανάστροφα επαναλαμβανόμενη, πλούσια σε GC αλληλουχία που ακολουθείται από περίπου επτά νουκλεοτίδια αδενίνης (Α) στην αλυσίδα-μήτρα (Εικ. 7.6). ΕΙΚΟΝΑ 7.6. Τερματισμός της μεταγραφής. Ο τερματισμός της μεταγραφής σηματοδοτείται από μια ανάστροφα επαναλαμβανόμενη αλληλουχία πλούσια σε GC, η οποία ακολουθείται από περίπου επτά νουκλεοτίδια αδενίνης (Α) στην αλυσίδα-μήτρα. Η μεταγραφή της ανάστροφης επανάληψης οδηγεί στον σχηματισμό μιας δομής στελέχους-βρόχου στο μόριο του RNA, η οποία αποσταθεροποιεί τη σύνδεση του μεταγράφου με τη μήτρα DNA προκαλώντας την απελευθέρωση του. Η μεταγραφή πλούσιων σε GC ανάστροφων επαναλήψεων δημιουργεί ένα τμήμα RNA που μπορεί να σχηματίσει μια σταθερή δομή στελέχους-βρόχου μέσω του ζευγαρώματος συμπληρωματικών βάσεων. Τέτοιες δομές αποσταθεροποιούν τη σύνδεση του RNΑ με τη μήτρα DNΑ και προκαλούν τον τερματισμό της μεταγραφής. Η παρουσία καταλοίπων αδενίνης (Α) καθοδικά των ανάστροφων επαναλήψεων θεωρείται ότι διευκολύνει τον διαχωρισμό του RNA από τη μήτρα του, επειδή μεταξύ A-U αναπτύσσονται δύο μόνο δεσμοί υδρογόνου αντί των τριών που αναπτύσσονται μεταξύ G-C. Εναλλακτικά, η μεταγραφή ορισμένων γονιδίων σταματά από 7

8 συγκεκριμένες πρωτεΐνες τερματισμού που προσδένονται στο RNA και ονομάζονται Rho. Η πρόσδεση των Rho πραγματοποιείται σε μεγάλα τμήματα (περισσότερο από 60 νουκλεοτίδια) μονόκλωνου RNA. Επειδή τα βακτηριακά mrna συνδέονται με τα ριβοσώματα και μεταφράζονται ενώ ακόμα εξελίσσεται η μεταγραφή τους, τέτοια μεγάλα μονόκλωνα τμήματα υπάρχουν μόνο στην 3' μη μεταφραζόμενη περιοχή των mrna. Καταστολείς και αρνητικός έλεγχος της μεταγραφής Η μεταγραφή ρυθμίζεται στα στάδια της έναρξης και της επιμήκυνσης, αλλά η μεταγραφική ρύθμιση στα βακτήρια συμβαίνει κυρίως στο στάδιο της έναρξης. Οι πρώτες μελέτες της γονιδιακής ρύθμισης στην Ε. coli έγιναν τη δεκαετία του 1950 από τον Francois Jacob και τον Jacques Monod. Οι ερευνητές αυτοί και οι συνεργάτες τους ανέλυσαν την έκφραση των γονιδίων που συμμετέχουν στον μεταβολισμό της λακτόζης. Η λακτόζη μπορεί να χρησιμοποιηθεί ως πηγή άνθρακα και ενέργειας, αφού προηγουμένως διασπαστεί σε γλυκόζη και λακτόζη (Εικ. 7.7). Δεδομένου ότι το κύτταρο αποφεύγει τη σύνθεση μη απαραίτητων RNΑ και πρωτεϊνών για λόγους εξοικονόμησης ενέργειας, προϋπόθεση για την παραγωγή του ενζύμου που καταλύει τη διάσπαση της λακτόζης (της β-γαλακτοζιδάσης) και άλλων ενζύμων που συμμετέχουν στον μεταβολισμό της λακτόζης είναι να υπάρχει λακτόζη διαθέσιμη. Η λακτόζη λοιπόν επάγει τη σύνθεση ενζύμων που συμμετέχουν στον μεταβολισμό της. Εκτός από τη β-γαλακτοζιδάση, στην αξιοποίηση της λακτόζης συμμετέχουν τα προϊόντα δύο ακόμα στενά συνδεδεμένων γονιδίων: της περμεάσης της λακτόζης, που μεταφέρει τη λακτόζη μέσα στο κύτταρο, και της τρανσακετυλάσης, η οποία θεωρείται ότι απενεργοποιεί τους τοξικούς θειογαλακτοζίτες που μεταφέρονται στο κύτταρο μαζί με τη λακτόζη από την περμεάση. ΕΙΚΟΝΑ 7.7. Μεταβολισμός της λακτόζης. Η βγαλακτοζιδάση καταλύει την υδρόλυση της λακτόζης σε γλυκόζη και γαλακτόζη. Οι Jacob και Monod, εκτελώντας απλά γενετικά πειράματα, ανακάλυψαν τον μηχανισμό ρύθμισης της έκφρασης αυτών των γονιδίων και διαμόρφωσαν ένα μοντέλο που παραμένει θεμελιώδες για την κατανόηση της μεταγραφικής ρύθμισης. Τα γονίδια που κωδικοποιούν τη β-γαλακτοζιδάση, την περμεάση και την τρανσακετυλάση εκφράζονται ως μια μονάδα, που ονομάζεται οπερόνιο (operon) (Εικ. 7.8). Οι Jacob και Monod, μελετώντας μεταλλάγματα τα οποία αδυνατούν να ρυθμίσουν την έκφραση αυτών των γονιδίων, εντόπισαν δύο διαφορετικούς γενετικούς τόπους, τους ο και i, που ελέγχουν την έκφραση του οπερονίου. Η πλήρης ονομασία του γενετικού τόπου ο είναι χειριστής (operator). Ο χειριστής είναι ένα τμήμα DNA που βρίσκεται κοντά στη θέση έναρξης της μεταγραφής του οπερονίου. Το γονίδιο i, που βρίσκεται σε κάποια άλλη περιοχή του γονιδιώματος, κωδικοποιεί μια πρωτεΐνη που ρυθμίζει τη μεταγραφή του οπερονίου μέσω της πρόσδεσης της στον χειριστή. Είναι σημαντικό να σημειωθεί ότι τα μεταλλάγματα που αποτυγχάνουν να συνθέσουν λειτουργικό προϊόν του γονιδίου i εκφράζουν το οπερόνιο ιδιοστατικά (ανεξαρτήτως συνθηκών), δηλαδή ακόμα και όταν δεν υπάρχει διαθέσιμη λακτόζη. Αυτό αποδεικνύει ότι το φυσιολογικό προϊόν του γονιδίου i είναι ένας καταστολέας (repressor), που αναστέλλει τη μεταγραφή όταν προσδένεται στον γενετικό τόπο ο. Η προσθήκη λακτόζης οδηγεί στην επαγωγή του οπερονίου, γιατί η λακτόζη προσδένεται στον καταστολέα και δεν του επιτρέπει να προσδεθεί στο DNA του χειριστή. 8

9 ΕΙΚΟΝΑ 7.8: Αρνητική ρύθμιση του οπερονίου lac. Το γονίδιο i κωδικοποιεί έναν καταστολέα ο οποίος, όταν δεν υπάρχει λακτόζη (επάνω τμήμα της εικόνας), προσδένεται στον χειριστή (ο) και εμποδίζει την RNA πολυμεράση να μεταγράψει τα τρία δομικά γονίδια του οπερονίου (z: βγαλακτοζιδάση, y: περμεάση και a: τρανσακετυλάση). Όταν υπάρχει λακτόζη (κάτω τμήμα της εικόνας), αυτή προσδένεται στον καταστολέα και τον εμποδίζει να προσδεθεί στον χειριστή, με αποτέλεσμα την επαγωγή της έκφρασης του οπερονίου. P = υποκινητής, Pol = RNA πολυμεράση. Η επιβεβαίωση της ισχύος αυτού του βασικού μοντέλου έγινε με ποικίλα πειράματα, συμπεριλαμβανομένων της απομόνωσης του καταστολέα lac και της ανάλυσης της πρόσδεσης του στο DNΑ του χειριστή από τον Walter Gilbert τη δεκαετία του Εξακριβώθηκε λοιπόν ότι ο χειριστής έχει μήκος περίπου 20 ζευγών βάσεων και αρχίζει λίγα ζεύγη βάσεων πριν από τη θέση έναρξης της μεταγραφής. Με πειράματα ιχνηλάτησης του DNA, αυτή η περιοχή αναγνωρίστηκε ως η θέση πρόσδεσης του καταστολέα, ο οποίος αναστέλλει τη μεταγραφή. Όπως προβλεπόταν από το μοντέλο, διαπιστώθηκε ότι, όταν η λακτόζη προσδένεται στον καταστολέα, αυτός δεν μπορεί να προσδεθεί στον χειριστή. Από τη μελέτη του οπερονίου της λακτόζης προκύπτει μια κεντρική αρχή σχετικά με τη γονιδιακή ρύθμιση που ισχύει τόσο στα προκαρυωτικά όσο και στα ευκαρυωτικά κύτταρα: Ο έλεγχος της μεταγραφής επιτυγχάνεται μέσω της αλληλεπίδρασης ρυθμιστικών πρωτεϊνών με ειδικές ρυθμιστικές αλληλουχίες του DNA. Οι ρυθμιστικές αλληλουχίες του DNA, όπως ο χειριστής, ονομάζονται cis-δραστικά ρυθμιστικά στοιχεία (cis-acting control elements), επειδή επηρεάζουν την έκφραση συνδεδεμένων γονιδίων που βρίσκονται στο ίδιο μόριο DNA με αυτές. Οι ρυθμιστικές πρωτεΐνες, όπως ο καταστολέας, ονομάζονται trans-δραστικοί παράγοντες (trans-acting factors), επειδή μπορούν να επηρεάζουν την έκφραση γονιδίων που βρίσκονται σε διαφορετικά χρωμοσώματα του κυττάρου. Το οπερόνιο lac αποτελεί παράδειγμα αρνητικού ελέγχου, καθώς η πρόσδεση του καταστολέα εμποδίζει τη μεταγραφή. Αυτό ωστόσο δεν αποτελεί το μοναδικό δυνατό σενάριο. Πολλοί trans-δραστικοί παράγοντες λειτουργούν ως ενεργοποιητές και όχι ως αναστολείς της μεταγραφής. 9

10 Θετικός έλεγχος της μεταγραφής Το καλύτερο παράδειγμα θετικού ελέγχου στην Ε. coli αφορά την επίδραση της γλυκόζης στην έκφραση γονιδίων που κωδικοποιούν ένζυμα του καταβολισμού (της διάσπασης) άλλων σακχάρων (συμπεριλαμβανομένης της λακτόζης). Τα σάκχαρα αυτά αποτελούν εναλλακτικές πηγές άνθρακα και ενέργειας. Επειδή όμως η γλυκόζη αποτελεί την προτιμώμενη από το κύτταρο πηγή άνθρακα και ενέργειας, όταν είναι διαθέσιμη δε συντίθενται τα ένζυμα που συμμετέχουν στον καταβολισμό άλλων σακχάρων. Για παράδειγμα, αν η Ε. coli αναπτύσσεται σε θρεπτικό μέσο που περιέχει και γλυκόζη και λακτόζη, δεν επάγεται το οπερόνιο lac και τα βακτήρια χρησιμοποιούν μόνο τη γλυκόζη. Επομένως, η παρουσία της γλυκόζης εμποδίζει την επαγωγή του οπερονίου lac ακόμα και παρουσία του επαγωγέα του (της λακτόζης). ΕΙΚΟΝΑ 7.9: Θετική ρύθμιση του οπερονίου lac από τη γλυκόζη. Όταν τα επίπεδα γλυκόζης είναι μειωμένα, ενεργοποιείται η αδενυλική κυκλάση, η οποία μετατρέπει το ATP σε κυκλικό AMP (camp). Το camp προσδένεται στον ενεργοποιητή καταβολικών γονιδίων (CAP) και διεγείρει την πρόσδεσή του σε ρυθμιστικές αλληλουχίες διαφόρων οπερονίων. Τα οπερόνια που ενεργοποιούνται από τον CAP κωδικοποιούν ένζυμα του μεταβολισμού άλλων, πέραν της γλυκόζης, εναλλακτικών σακχάρων, για παράδειγμα της λακτόζης. Η πρωτεΐνη CAP διευκολύνει την πρόσδεση της RNA πολυμεράσης στον υποκινητή μέσω αλληλεπιδράσεων που αναπτύσσει με την υπομονάδα α του ενζύμου. Η καταστολή μέσω της γλυκόζης (η οποία γενικά ονομάζεται καταβολική καταστολή) επιτυγχάνεται με τη βοήθεια ενός συστήματος θετικού ελέγχου, το οποίο συνδέεται με το ενδοκυτταρικό επίπεδο του κυκλικού AMP (camp, cyclic AMP) (Εικ. 7.9). Στα βακτήρια, το ένζυμο αδενυλική κυκλάση, που μετατρέπει το ΑΤΡ σε camp, ρυθμίζεται έτσι ώστε τα επίπεδα του camp να αυξάνονται όταν τα επίπεδα της γλυκόζης ελαττώνονται. To camp προσδένεται σε μια ρυθμιστική πρωτεΐνη της μεταγραφής που ονομάζεται ενεργοποιητής καταβολικών γονιδίων (CAP, Catabolite Activator Protein). Η πρόσδεση του camp διεγείρει την πρόσδεση της CAP στις αλληλουχίες του DNA που αποτελούν τους στόχους της. Για παράδειγμα, όταν τα επίπεδα της γλυκόζης είναι χαμηλά και κατά συνέπεια τα επίπεδα του camp υψηλά, η CAP μπορεί να προσδεθεί στο οπερόνιο lac περίπου 60 βάσεις ανοδικά της θέσης έναρξης της μεταγραφής. Κατόπιν, η CAP αλληλεπιδρά με την υπομονάδα α της RNA πολυμεράσης και ενεργοποιεί τη μεταγραφή διευκολύνοντας την πρόσδεση του ενζύμου στον υποκινητή. 10

11 7.2. Η RNA πολυμεράση μεταγραφικοί παράγοντες των ευκαρυωτικών οργανισμών και οι γενικοί Αν και η μεταγραφή βασίζεται στους ίδιους θεμελιώδεις μηχανισμούς σε όλα τα κύτταρα, είναι πολύ πιο πολύπλοκη στους ευκαρυωτικούς οργανισμούς απ' ότι στα βακτήρια. Αυτό οφείλεται σε τρεις διαφορές ανάμεσα στα προκαρυωτικά και στα ευκαρυωτικά συστήματα. Πρώτον, ενώ στα βακτήρια όλα τα γονίδια μεταγράφονται από μια κεντρική RNA πολυμεράση, τα ευκαρυωτικά κύτταρα διαθέτουν πολλές διαφορετικές RNA πολυμεράσες που μεταγράφουν διαφορετικά είδη γονιδίων. Δεύτερον, οι ευκαρυωτικές RNA πολυμεράσες πρέπει να αλληλεπιδράσουν με ποικίλες άλλες πρωτεΐνες στο πλαίσιο της έναρξης και της ρύθμισης της μεταγραφής. Τέλος, σε αντίθεση με το προκαρυωτικά, το ευκαρυωτικά DNA είναι οργανωμένο σε χρωματίνη και σε μεγάλο βαθμό η μεταγραφική ενεργότητα των ευκαρυωτικών γονιδίων ρυθμίζεται στο επίπεδο της δομής της χρωματίνης τους. Η αυξημένη πολυπλοκότητα της ευκαρυωτικής μεταγραφής προσφέρει επιπλέον δυνατότητες ρύθμισης της γονιδιακής έκφρασης, γεγονός που διευκολύνει τη δημιουργία πολλών διαφορετικών κυτταρικών τύπων με χαρακτηριστικά πρότυπα γονιδιακής έκφρασης στους πολυκύτταρους οργανισμούς. Ευκαρυωτικές RNA πολυμεράσες Τα ευκαρυωτικά κύτταρα περιέχουν στον πυρήνα τους τρεις διαφορετικές RNA πολυμεράσες οι οποίες μεταγράφουν διαφορετικά είδη γονιδίων (Πίνακας 7.1). ΠΙΝΑΚΑΣ 7.1: Κατηγορίες γονιδίων που μεταγράφονται από τις ευκαρυωτικές RNA πολυμεράσες. *Μερικά snrna και scrna μεταγράφονται από την RNA πολυμεράση II, ενώ άλλα μεταγράφονται από την RNA πολυμεράση IIΙ. **Οι μιτοχονδριακές και χλωροπλαστικές RNA πολυμεράσες μοιάζουν με τα αντίστοιχα βακτηριακά ένζυμα. Τα γονίδια που κωδικοποιούν πρωτεΐνες μεταγράφονται σε mrna από την RNA πολυμεράση II. Η ίδια πολυμεράση μεταγράφει και τα microrna (mirna), τα οποία έχουν καθοριστικό ρυθμιστικό ρόλο στη γονιδιακή έκφραση των ευκαρυωτικών κυττάρων. Τα ριβοσωμικά RNA (rrna, ribosomal RNA) και τα μεταφορικά RNA (trna, transfer RNA) μεταγράφονται από τις RNA πολυμεράσες I και III αντίστοιχα. Η RNA πολυμεράση I είναι υπεύθυνη για τη μεταγραφή των τριών μεγαλύτερων ειδών rrna, που ονομάζονται 28S, 18S και 5,8S σύμφωνα με την ταχύτητα καθίζησης (Sedimentation) κατά τη διάρκεια φυγοκέντρισης ταχύτητας. Η RNA πολυμεράση III μεταγράφει τα γονίδια των trna και το μικρότερο είδος ριβοσωμικού RNA (το 5S rrna). Ορισμένα μικρά RNA, όπως το μικρό πυρηνικό RNA (snrna, small nuclear RNA), που συμμετέχει στο μάτισμα του prerna, και το μικρό κυτταροπλασματικό RNA (scrna, small cytoplasmic RNA), που συμμετέχει στη μεταφορά πρωτεϊνών, μεταγράφονται επίσης από την RNA πολυμεράση III. Άλλα μικρά RNA μεταγράφονται, όπως προαναφέρθηκε, από την RNA πολυμεράση II. Επιπλέον, στους χλωροπλάστες και στα μιτοχόνδρια βρίσκονται κάποιες ξεχωριστές RNΑ πολυμεράσες, παρόμοιες με τις βακτηριακές RNA πολυμεράσες, που μεταγράφουν το DNA αυτών των οργανιδίων. 11

12 ΕΙΚΟΝΑ 7.10: Δομή της RNA πολυμεράσης ΙΙ του σακχαρομύκητα. Οι διαφορετικές υπομονάδες απεικονίζονται με διαφορετικά χρώματα. (Kramer P.D., et al., Science 292: 1863). Οι τρεις RNA πολυμεράσες του πυρήνα των ευκαρυωτικών κυττάρων είναι σύνθετα ένζυμα, που αποτελούνται από υπομονάδες. Αν και αναγνωρίζουν διαφορετικούς υποκινητές και μεταγράφουν διαφορετικά είδη γονιδίων, μοιράζονται αρκετά κοινά χαρακτηριστικά τόσο μεταξύ τους όσο και με τις βακτηριακές RNA πολυμεράσες. Συγκεκριμένα, περιέχουν εννέα συντηρημένες υπομονάδες, πέντε από τις οποίες είναι όμοιες με τις υπομονάδες α, β, β' και ω της βακτηριακής RNA πολυμεράσης. Η δομή της RNA πολυμεράσης II του σακχαρομύκητα μοιάζει ιδιαίτερα με αυτή του βακτηριακού ενζύμου (Εικ. 7.10), γεγονός που υποδεικνύει ότι ο βασικός μηχανισμός λειτουργίας όλων των πολυμερασών είναι εξελικτικά συντηρημένος. Γενικοί μεταγραφικοί παράγοντες και έναρξη της μεταγραφής από την RNA πολυμεράση II Η RNA πολυμεράση II αποτέλεσε το επίκεντρο των περισσότερων μελετών της μεταγραφής στους ευκαρυώτες, γιατί είναι υπεύθυνη για τη σύνθεση του mrna των γονιδίων που κωδικοποιούν πρωτεΐνες. Οι αρχικές μελέτες αυτού του ενζύμου έδειξαν ότι συμπεριφέρεται διαφορετικά από την προκαρυωτική RNA πολυμεράση. Η καθαρισμένη προκαρυωτική RNA πολυμεράση μπορεί να μεταγράψει in vitro τις αλληλουχίες ενός μορίου DNA που βρίσκονται καθοδικά από κάποιον υποκινητή τον οποίο αναγνωρίζει. Δεν ισχύει όμως το ίδιο για την ευκαρυωτική RNΑ πολυμεράση. Ο λόγος αυτής της διαφοράς αποσαφηνίστηκε το 1979, όταν ο Robert Roeder και οι συνεργάτες του ανακάλυψαν ότι η RNA πολυμεράση II ξεκινάει τη μεταγραφή μόνο αν προστεθούν στην αντίδραση επιπλέον πρωτεΐνες. Επομένως, η μεταγραφή στα ευκαρυωτικά συστήματα φαίνεται ότι χρειάζεται παράγοντες έναρξης, οι οποίοι (σε αντίθεση με τους βακτηριακούς παράγοντες σ) δεν αποτελούν συστατικά της πολυμεράσης. Μεταγενέστερα, με βιοχημική κλασμάτωση πυρηνικών εκχυλισμάτων, εντοπίστηκε μια σειρά από πρωτεΐνες οι οποίες ονομάστηκαν μεταγραφικοί παράγοντες (transcription factors) και είναι απαραίτητες για την έναρξη της μεταγραφής από την RNA πολυμεράση II. Οι γενικοί μεταγραφικοί παράγοντες (general transcription factors) συμμετέχουν στη μεταγραφή από όλους τους υποκινητές της RNA πολυμεράσης II και συνεπώς αποτελούν στοιχεία του βασικού μηχανισμού της μεταγραφής από το ένζυμο αυτό. Επιπρόσθετα, όπως θα δούμε και στη συνέχεια αυτού του κεφαλαίου, ειδικοί μεταγραφικοί παράγοντες προσδένονται ο καθένας σε ρυθμιστικές αλληλουχίες συγκεκριμένων γονιδίων και ελέγχουν την έκφραση τους. Έχει υπολογιστεί ότι περίπου το 10% των γονιδίων του ανθρώπινου γονιδιώματος κωδικοποιεί μεταγραφικούς παράγοντες, γεγονός ενδεικτικό της σημασίας αυτών των πρωτεϊνών. Οι υποκινητές των γονιδίων που μεταγράφονται από την πολυμεράση II περιέχουν αρκετά διαφορετικά ρυθμιστικά στοιχεία γύρω από τη θέση έναρξης της μεταγραφής (Εικ. 7.11). Το πρώτο από αυτά που εντοπίστηκε ήταν μια αλληλουχία παρόμοια με το ΤΑΤΑΑ, νουκλεοτίδια ανοδικά της θέσης έναρξης της μεταγραφής. Αυτή η αλληλουχία, που ονομάζεται πλαίσιο TATA (TATA box), μοιάζει με το στοιχείο -10 των βακτηριακών υποκινητών και αρχικά θεωρήθηκε ότι χαρακτηρίζει όλους τους υποκινητές των γονιδίων που μεταγράφονται από την RNA πολυμεράση II. Ωστόσο, πιο πρόσφατες μελέτες σε επίπεδο γονιδιώματος έδειξαν ότι πλαίσιο TATA υπάρχει μόνο στο 10-20% των υποκινητών της RNA πολυμεράσης II. Άλλες ρυθμιστικές αλληλουχίες των υποκινητών των γονιδίων που μεταγράφονται από την RNΑ πολυμεράση II είναι ο εναρκτής (Inr, initiator), που περιβάλλει τη θέση έναρξης της μεταγραφής, το στοιχείο αναγνώρισης του TFIIB (το BRE), που βρίσκεται ανοδικά της θέσης έναρξης της μεταγραφής, καθώς και αρκετά στοιχεία που βρίσκονται καθοδικά της θέσης έναρξης της μεταγραφής (όπως τα DPE, DCE και ΜΤΕ). Οι υποκινητές διαφορετικών γονιδίων περιέχουν ποικίλους συνδυασμούς αυτών των στοιχείων, τα οποία συμμετέχουν από κοινού στην πρόσδεση των γενικών μεταγραφικών παραγόντων. 12

13 ΕΙΚΟΝΑ 7.11: Ο σχηματισμός in vitro του προεναρκτήριου συμπλόκου της RNA πολυμεράσης ΙΙ. Οι υποκινητές της RNA πολυμεράσης ΙΙ περιλαμβάνουν διάφορες ρυθμιστικές αλληλουχίες, όπως το πλαίσιο ΤΑΤΑ (με πρότυπη αλληλουχία TATAA) νουκλεοτίδια ανοδικά της θέσης έναρξης της μεταγραφής, το στοιχείο αναγνώρισης του TFIIB (BRE) 35 νουκλεοτίδια ανοδικά της θέσης έναρξης της μεταγραφής, τον εναρκτή (Inr), ο οποίος περιβάλλει τη θέση έναρξης της μεταγραφής, καθώς και διάφορα στοιχεία τα οποία βρίσκονται καθοδικά της θέσης έναρξης της μεταγραφής (τα DCE, MTE και DPE). Ο σχηματισμός του μεταγραφικού συμπλόκου ξεκινά με την πρόσδεση του μεταγραφικού παράγοντα TFIID. Μια υπομονάδα του TFIID, η πρωτεΐνη πρόσδεσης στο ΤΑΤΑ (TBP), προσδένεται στο πλαίσιο ΤΑΤΑ. Άλλες υπομονάδες του TFIID, οι παράγοντες που συνδέονται με την TBP (TAF), προσδένονται στον εναρκτή, καθώς και στα στοιχεία που βρίσκονται καθοδικά της θέσης έναρξης της μεταγραφής. Κατόπιν, στρατολογείται ο TFIIB (B), ο οποίος προσδένεται στην TBP και στο στοιχείο BRE. Ακολουθεί η πρόσδεση της πολυμεράσης η οποία βρίσκεται ήδη συνδεδεμένη με τον TFIIF (F). Ο σχηματισμός του προεναρκτήριου συμπλόκου ολοκληρώνεται με την προσθήκη του TFIIE (E) και του TFIIH (H). 13

14 Τουλάχιστον πέντε γενικοί μεταγραφικοί παράγοντες απαιτούνται για την έναρξη της μεταγραφής από την RNA πολυμεράση II σε in vitro συστήματα (βλ. Εικ. 7.11). Το πρώτο βήμα για τον σχηματισμό του μεταγραφικού συμπλόκου είναι η πρόσδεση στον υποκινητή ενός γενικού μεταγραφικού παράγοντα, που ονομάζεται TFIID (τα αρχικά TF υποδηλώνουν πως πρόκειται για μεταγραφικό παράγοντα - Transcription Factor -, ενώ το II παραπέμπει στην RNA πολυμεράση II). Ο TFIID αποτελείται από πολλές υπομονάδες, συμπεριλαμβανομένης της πρωτεΐνης πρόσδεσης στο TATA (ΤΒΡ, TATA-Binding Protein) και άλλων 14 πολυπεπτιδίων, που ονομάζονται παράγοντες που συνδέονται με την ΤΒΡ (TAF, TBP-Associated Factors). Η ΤΒΡ προσδένεται στο πλαίσιο TATA, ενώ οι TAF προσδένονται στα στοιχεία Inr, DPE, DPC και ΜΤΕ. Η πρόσδεση του TFIID ακολουθείται από τη στρατολόγηση ενός δεύτερου γενικού μεταγραφικού παράγοντα, του TFIIB, ο οποίος αλληλεπιδρά με την ΤΒΡ αλλά και με το στοιχείο BRE. Στη συνέχεια, ο TFIIB λειτουργεί ως γέφυρα για την RNA πολυμεράση II, η οποία, αφού προηγουμένως προσδεθεί σε έναν τρίτο γενικό μεταγραφικό παράγοντα, του TFIIF, προσδένεται στο σύμπλοκο TBP-TFIIB. ΕΙΚΟΝΑ 7.12: Μοντέλο του προεναρκτήριου συμπλόκου της RNA πολυμεράσης ΙΙ. Ένα μοριακό μοντέλο της RNA πολυμεράσης ΙΙ (γκρι), της TBP (πράσινο), του TFIIB (κίτρινο), του TFIIE (μοβ), του TFIIF (μπλε) και του TFIIH (καφέ) στη μορφή του συμπλόκου που συγκροτούν πάνω σε έναν υποκινητή. Στη φωτογραφία αυτή, ο προσανατολισμός του προεναρκτήριου συμπλόκου πάνω στο DNA είναι αντίστροφος από αυτόν της Εικόνας (Bushnell D.A., et al., Science 303: 983). Μετά την πρόσδεση της RNA πολυμεράσης στον υποκινητή, η πρόσδεση δύο ακόμα γενικών μεταγραφικών παραγόντων, του TFIIE και του TFIIH, ολοκληρώνει τον σχηματισμό του λεγόμενου προεναρκτήριου συμπλόκου (preinitiation complex), ένα μοριακό μοντέλο του οποίου παρουσιάζεται στην Εικ O TFIIH αποτελείται από πολλές υπομονάδες και έχει δύο τουλάχιστον σημαντικούς ρόλους. Πρώτον, δύο υπομονάδες του είναι ελικάσες που ξετυλίγουν το DNA γύρω από την περιοχή έναρξης. Πρόκειται για τις πρωτεΐνες ΧΡΒ και XPD, που είναι απαραίτητες για την επιδιόρθωση με εκτομή νουκλεοτιδίου (nucleotide-excision repair), όπως αναφέρθηκε στο Κ6. Δεύτερον, μια άλλη υπομονάδα του ΤFIΙΗ έχει δράση κινάσης που φωσφορυλιώνει μια αμινοξική αλληλουχία η οποία επαναλαμβάνεται στην καρβοξυτελική επικράτεια (CTD, CarboxyTerminal Domain) της μεγαλύτερης υπομονάδας της RNA πολυμεράσης II. Η CTD της RNA πολυμεράσης II περιλαμβάνει διαδοχικές επαναλήψεις (27 στον σακχαρομύκητα και 52 στον άνθρωπο) επτά αμινοξέων με πρότυπη αλληλουχία την Tyr-Ser-Pro-Thr-Ser-Pro-Ser. Η φωσφορυλίωση από την πρωτεϊνική κινάση του ΤFIΙΗ των επαναλήψεων της CTD στη σερίνη της θέσης 5 της πρότυπης αλληλουχίας οδηγεί στην αποδέσμευση της RNA πολυμεράσης II από το προεναρκτήριο σύμπλοκο και προκαλεί την έναρξη της μεταγραφής. Οι πέντε γενικοί μεταγραφικοί παράγοντες και η RNA πολυμεράση II, που, όπως περιγράφηκε παραπάνω, στρατολογούνται διαδοχικά πάνω στον υποκινητή, συνιστούν το ελάχιστο απαιτούμενο σύστημα για τη μεταγραφή in vitro. Η πραγματοποίηση όμως της μεταγραφής στο κύτταρο προϋποθέτει την παρουσία επιπλέον παραγόντων. Μεταξύ αυτών περιλαμβάνεται ένα μεγάλο πρωτεϊνικό σύμπλοκο, ο Διαμεσολαβητής (Mediator), το οποίο αποτελείται από περισσότερες από 20 διαφορετικές υπομονάδες και αλληλεπιδρά τόσο με τους γενικούς μεταγραφικούς παράγοντες όσο και με την RNA πολυμεράση (Εικ. 7.13). 14

15 ΕΙΚΟΝΑ 7.13: Το σύμπλοκο της RNA πολυμεράσης ΙΙ με τον διαμεσολαβητή και η έναρξη της μεταγραφής. Η RNA πολυμεράση ΙΙ αλληλεπιδρά με τις πρωτεΐνες του Διαμεσολαβητή, καθώς και με τους γενικούς μεταγραφικούς παράγοντες στην περιοχή του υποκινητή. Ο Διαμεσολαβητής προσδένεται στη μη φωσφορυλιωμένη CTD της RNA πολυμεράσης ΙΙ. Η φωσφορυλίωση της CTD έχει ως αποτέλεσμα την απελευθέρωση του Διαμεσολαβητή και την έναρξη της μεταγραφής. Η φωσφορυλιωμένη CTD αλληλεπιδρά με παράγοντες επιμήκυνσης και επεξεργασίας του μεταγράφου που υποβοηθούν τη σύνθεση και επεξεργασία του mrna. Ο Διαμεσολαβητής όχι μόνο ενεργοποιεί την έναρξη της μεταγραφής από τους γενικούς μεταγραφικούς παράγοντες, αλλά και διαδραματίζει κύριο ρόλο στη σύνδεση των γενικών μεταγραφικών παραγόντων με τους ειδικούς για κάθε γονίδιο μεταγραφικούς παράγοντες που ρυθμίζουν τη γονιδιακή έκφραση. Οι πρωτεΐνες του Διαμεσολαβητή αποδεσμεύονται από την πολυμεράση μετά τη συναρμολόγηση του προεναρκτήριου συμπλόκου και τη φωσφορυλίωση της CTD της πολυμεράσης. Η φωσφορυλιωμένη CTD προσδένεται σε άλλες πρωτεΐνες που χρειάζονται για την επιμήκυνση και την ωρίμανση του mrna, όπως αναλύεται στη συνέχεια του κεφαλαίου. Μεταγραφή από τις RNA πολυμεράσες I και III Όπως αναφέρθηκε προηγουμένως, διαφορετικές RNA πολυμεράσες είναι υπεύθυνες για τη μεταγραφή των γονιδίων που κωδικοποιούν τα ριβοσωμικά RNΑ, τα μεταφορικά RNΑ και κάποια μικρά μη κωδικό RNA στα ευκαρυωτικά κύτταρα. Ωστόσο, και οι τρεις RNA πολυμεράσες χρειάζονται επιπρόσθετα και μεταγραφικούς παράγοντες για να συνδεθούν με τις κατάλληλες αλληλουχίες του υποκινητή. Η RNA πολυμεράση I εστιάζεται αποκλειστικά στη μεταγραφή των 28S, 18S και 5,8S γονιδίων του ριβοσωμικού RNA, τα οποία οργανώνονται σε διαδοχικές επαναλήψεις. Από τη μεταγραφή τους προκύπτει αρχικά ένα μεγάλο πρόδρομο pre-rrna, το 45S, από το οποίο στη συνέχεια αποκόπτονται τα 28S, 18S και 5,8S rrna (Εικ. 7.14). 15

16 ΕΙΚΟΝΑ 7.14: Τα γονίδια του ριβοσωμικού RNA. Το ριβοσωμικό DNA (rdna) μεταγράφεται σε ένα μεγάλο πρόδρομο μόριο RNA (το 45S prerrna), από το οποίο στη συνέχεια αποκόπτονται τα 28S, 18S και 5,8S rrna. Ο υποκινητής των γονιδίων του rrna εκτείνεται περίπου 150 ζεύγη βάσεων ανοδικά της θέσης έναρξης της μεταγραφής και αναγνωρίζεται από δύο μεταγραφικούς παράγοντες. Οι μεταγραφικοί αυτοί παράγοντες, που ονομάζονται ανοδικός παράγοντας πρόσδεσης (UBF, Upstream Binding Factor) και παράγοντας επιλεκτικότητας 1 (SL1, Selectivity factor 1), προσδένονται συνεργειακά στον υποκινητή και κατόπιν στρατολογούν την RNΑ πολυμεράση I, οπότε σχηματίζεται το σύμπλοκο έναρξης (Εικ. 7.15). Ο SL1 αποτελείται από τέσσερις πρωτεϊνικές υπομονάδες, μία από τις οποίες είναι η ΤΒΡ. Καθώς ο υποκινητής των γονιδίων του ριβοσωμικού RNΑ δεν περιέχει πλαίσιο TATA, η ΤΒΡ δεν προσδένεται σε μια συγκεκριμένη αλληλουχία του υποκινητή. Η σύνδεση της επιτυγχάνεται μέσω αλληλεπιδράσεων που αναπτύσσει με τις υπομονάδες του SL1. ΕΙΚΟΝΑ 7.15: Η έναρξη της μεταγραφής του rdna. Δύο μεταγραφικοί παράγοντες, ο UBF και ο SL1, συνδέονται συνεργειακά στον υποκινητή του rdna και στρατολογούν την RNA πολυμεράση Ι, προκειμένου να σχηματιστεί το σύμπλοκο έναρξης. Μια υπομονάδα του SL1 είναι η πρωτεΐνη πρόσδεσης στο ΤΑΤΑ (TBP). Τα γονίδια των trna, του 5S rrna και ορισμένων μικρών RNA που συμμετέχουν στο μάτισμα και στη μεταφορά πρωτεϊνών μεταγράφονται από την RNA πολυμεράση III. Υπάρχουν τρεις τύποι υποκινητών της RNA πολυμεράσης III, δύο από τους οποίους (αυτοί των trna και του 5S rrna) βρίσκονται στο εσωτερικό και όχι ανοδικά της μεταγραφόμενης αλληλουχίας (Εικ. 7.16). 16

17 ΕΙΚΟΝΑ 7.16: Η μεταγραφή από την RNA πολυμεράση ΙΙΙ. Υπάρχουν τρεις τύποι υποκινητών που χρησιμοποιούν την RNA πολυμεράση ΙΙΙ. Οι υποκινητές των γονιδίων του 5S rrna και των trna βρίσκονται καθοδικά από τη θέση έναρξης της μεταγραφής. Η μεταγραφή του γονιδίου του 5S rrna ξεκινά με την πρόσδεση του TFIIIA, η οποία ακολουθείται από την πρόσδεση του TFIIIC, του TFIIIB και της RNA πολυμεράσης ΙΙΙ. Οι υποκινητές των γονιδίων των trna δε φέρουν τη θέση πρόσδεσης για τον TFIIA. Η μεταγραφή τους ξεκινάει με την πρόσδεση του TFIIIC, η οποία ακολουθείται από την πρόσδεση του TFIIIB και της πολυμεράσης. Ο υποκινητής του γονιδίου του U6 snrna βρίσκεται ανοδικά της θέσης έναρξης της μεταγραφής και φέρει ένα πλαίσιο ΤΑΤΑ, που αναγνωρίζεται από την πρωτεΐνη πρόσδεσης στο ΤΑΤΑ (TBP) η οποία αποτελεί υπομονάδα του TFIIIB. Φέρει επίσης μια θέση πρόσδεσης ενός άλλου μεταγραφικού παράγοντα, του SNAP. Οι TFIIIB και SNAP προσδένονται συνεργειακά σε αυτόν τον υποκινητή. Τα περισσότερο μελετημένα γονίδια που μεταγράφονται από την RNA πολυμεράση III είναι αυτά του 5S RNA στον Xenopus. Η συναρμολόγηση του μεταγραφικού συμπλόκου ξεκινά με την πρόσδεση του TFIIIA (ο οποίος αποτελεί τον πρώτο μεταγραφικό παράγοντα που απομονώθηκε βιοχημικά) σε συγκεκριμένες αλληλουχίες του υποκινητή του 5S rrna. Ακολουθεί η διαδοχική πρόσδεση του TFIIIC, του TFIIIB και της πολυμεράσης. Οι υποκινητές των γονιδίων των trna διαφέρουν από τον υποκινητή του 5S rrna, καθώς δεν περιέχουν την αλληλουχία DNA που αναγνωρίζει ο TFIIIA. Πρώτος στον υποκινητή των γονιδίων των trna προσδένεται ο TFIIIC και ακολουθεί ο σχηματισμός του μεταγραφικού συμπλόκου με την πρόσδεση του TFIIIB και της πολυμεράσης. Ο τρίτος τύπος υποκινητή της RNΑ πολυμεράσης III βρίσκεται ανοδικά της θέσης έναρξης της μεταγραφής και περιέχει πλαίσιο TATA (όπως και οι υποκινητές κάποιων γονιδίων της RNA πολυμεράσης II), καθώς και μια περιοχή πρόσδεσης ενός άλλου παράγοντα που ονομάζεται SNAP. Σχετικά παραδείγματα αποτελούν οι υποκινητές κάποιων μικρών RNA, όπως των snrna που συμμετέχουν στη διαδικασία του ματίσματος. Ο SNAP και ο TFIIIB προσδένονται συνεργειακά σε αυτούς τους υποκινητές. Ο TFIIIB προσδένεται απευθείας στο πλαίσιο TATA μέσω της ΤΒΡ, που αποτελεί υπομονάδα του. Όπως συμβαίνει και στους υποκινητές των άλλων γονιδίων της RNA πολυμεράσης III, ο TFIIIB συνδέει την πολυμεράση στο μεταγραφικό σύμπλοκο. 17

18 7.3. Η ρύθμιση της μεταγραφής στους ευκαρυωτικούς οργανισμούς Ο έλεγχος της γονιδιακής έκφρασης είναι πολύ πιο σύνθετος στους ευκαρυώτες απ' ότι στα βακτήρια, αν και γενικά ισχύουν οι ίδιες βασικές αρχές. Όπως και στα βακτήρια, η μεταγραφή στα ευκαρυωτικά κύτταρα ελέγχεται από πρωτεΐνες που προσδένονται σε συγκεκριμένες ρυθμιστικές αλληλουχίες και μεταβάλλουν τη λειτουργία της RNA πολυμεράσης. Μια σημαντική διαφορά στη ρύθμιση της μεταγραφής ανάμεσα στους προκαρυώτες και τους ευκαρυώτες προκύπτει από το πακετάρισμα του ευκαρυωτικού DNA στη χρωματίνη, που περιορίζει τη διαθεσιμότητα του ως μήτρας για τη μεταγραφή. Έτσι, η τροποποίηση της δομής της χρωματίνης διαδραματίζει σημαντικό ρόλο στον έλεγχο της μεταγραφής στα ευκαρυωτικά κύτταρα. Ένα νέο και ιδιαίτερα συναρπαστικό ερευνητικό πεδίο έχει βασιστεί στη σχετικά πρόσφατη ανακάλυψη ότι στα ευκαρυωτικά κύτταρα τόσο ορισμένες πρωτεΐνες όσο και κάποια μικρά μη κωδικά RNΑ ρυθμίζουν τη μεταγραφή μέσω τροποποιήσεων στη δομή της χρωματίνης. cis-δραστικές ρυθμιστικές αλληλουχίες: Υποκινητές και Ενισχυτές Όπως έχει ήδη αναφερθεί, η μεταγραφή στα βακτήρια ρυθμίζεται από την πρόσδεση των πρωτεϊνών σε cis-δραστικές αλληλουχίες (όπως ο χειριστής του οπερονίου lac) που ελέγχουν τη μεταγραφή γειτονικών προς αυτές γονιδίων. Παρόμοια cis-δραστικά στοιχεία που ελέγχουν τη γονιδιακή έκφραση έχουν χαρακτηριστεί και στους ευκαρυωτικούς οργανισμούς, κυρίως με μεθόδους μεταφοράς γονιδίων (gene transfer assays), με τις οποίες ελέγχονται περιοχές κλωνοποιημένων γονιδίων που ενδέχεται να περιέχουν cis-δραστικές αλληλουχίες (Εικ. 7.17). ΕΙΚΟΝΑ 7.17: Ταυτοποίηση ευκαρυωτικών ρυθμιστικών αλληλουχιών. Η εν δυνάμει ρυθμιστική αλληλουχία ενός κλωνοποιημένου ευκαρυωτικού γονιδίου τοποθετείται σε ένα πλασμίδιο ανοδικά κάποιου γονιδίου αναφοράς το οποίο κωδικοποιεί ένα εύκολα ανιχνεύσιμο προϊόν. Κατόπιν, με το πλασμίδιο διαμολύνεται μια καλλιέργεια ευκαρυωτικών κυττάρων. Αν η υπό έλεγχο αλληλουχία περιλαμβάνει τη θέση αναγνώρισης ενός ενεργοποιητή της μεταγραφής, θα πρέπει στα διαμολυσμένα κύτταρα να ανιχνευτεί το προϊόν του γονιδίου αναφοράς. Στα πειράματα αυτά δημιουργούνται κατασκευές στις οποίες οι υπό έλεγχο αλληλουχίες συνδέονται με ένα γονίδιο αναφοράς (reporter gene) που κωδικοποιεί κάποιο εύκολα ανιχνεύσιμο προϊόν, όπως η λουσιφεράση της πυγολαμπίδας. Στη λουσιφεράση οφείλεται η βιοφωταύγεια που εμφανίζει το έντομο. Με τέτοιες κατασκευές είναι δυνατόν να διαμολυνθούν τα κύτταρα μιας καλλιέργειας, οπότε, για παράδειγμα, η ενδεχόμενη έκφραση του γονιδίου αναφοράς υποδεικνύει την παρουσία ενός βιολογικά ενεργού στοιχείου που επάγει τη μεταγραφή. Περαιτέρω μελέτες με in vitro μεταλλαξιγένεση είναι δυνατόν να επιτρέψουν τον ακριβή προσδιορισμό συγκεκριμένων βάσεων του DNA που είναι κρίσιμες για τη λειτουργία του cis-δραστικού στοιχείου (Βιοφωταύγεια ονομάζεται το φαινόμενο της εκπομπής φωτός κατά την επιτέλεση μιας βιολογικής αντίδρασης. Η λουσιφεράση καταλύει την οξείδωση της λουσιφερίνης, που συνοδεύεται από την εκπομπή φωτός). 18

19 ΕΙΚΟΝΑ 7.18: Ένας ευκαρυωτικός υποκινητής. Ο υποκινητής του γονιδίου της κινάσης της θυμιδίνης του HSV φέρει ανοδικά από το πλαίσιο ΤΑΤΑ τρία στοιχεία τα οποία χρειάζονται για τη μεταγραφή του σε φυσιολογικά επίπεδα: ένα πλαίσιο CCAAT και δύο πλαίσια GC των οποίων η πρότυπη αλληλουχία είναι GGGCGG. Τα μεταγραφόμενα από την RNA πολυμεράση II γονίδια διαθέτουν ειδικές περιοχές πρόσδεσης γενικών μεταγραφικών παραγόντων, συμπεριλαμβανομένων του πλαισίου TATA και του Inr. Άλλες cis-δραστικές αλληλουχίες λειτουργούν ως περιοχές πρόσδεσης ποικίλων ρυθμιστικών παραγόντων που ελέγχουν την έκφραση συγκεκριμένων γονιδίων. Αυτές οι cis-δραστικές ρυθμιστικές αλληλουχίες βρίσκονται συχνά, αλλά όχι πάντα, ανοδικά της θέσης έναρξης της μεταγραφής. Για παράδειγμα, δύο ρυθμιστικές αλληλουχίες παρούσες σε πολλά ευκαρυωτικά γονίδια εντοπίστηκαν κατά τη μελέτη του υποκινητή ενός γονιδίου του ιού του απλού έρπητα (HSV, Herpes Simplex Virus) το οποίο κωδικοποιεί την κινάση της θυμιδίνης (Εικ. 7.18). Τα δύο αυτά στοιχεία βρίσκονται σε μια περιοχή 100 ζευγών βάσεων ανοδικά της θέσης έναρξης της μεταγραφής. Οι πρότυπες αλληλουχίες τους είναι CCAAT και GGGCGG (ονομάζεται πλαίσιο GC). Έχουν ήδη ταυτοποιηθεί συγκεκριμένες πρωτεΐνες που προσδένονται με ειδικότητα σε αυτές τις αλληλουχίες και ενεργοποιούν τη μεταγραφή. ΕΙΚΟΝΑ 7.19: Ο ενισχυτής του SV40. Ο ενισχυτής του ιού SV40 που είναι υπεύθυνος για την έκφραση των πρώιμων γονιδίων φέρει ένα πλαίσιο ΤΑΤΑ και έξι πλαίσια GC τα οποία βρίσκονται ανά δύο σε μία αλληλουχία που επαναλαμβάνεται τρεις φορές. Προκειμένου τα επίπεδα της μεταγραφής να είναι φυσιολογικά, χρειάζεται και η παρουσία ενός ανοδικού ενισχυτή, ο οποίος αποτελείται από δύο επαναλήψεις των 72 ζευγών βάσεων. Σε αντίθεση με τη σχετικά απλή οργάνωση των πλαισίων CCAAT και GC του υποκινητή της κινάσης της θυμιδίνης του HSV, πολλά γονίδια των θηλαστικών ελέγχονται από ρυθμιστικές αλληλουχίες που βρίσκονται αρκετά μακριά (μερικές φορές περισσότερο από 50 χιλιάδες βάσεις) από τη θέση έναρξης της μεταγραφής. Τέτοιες αλληλουχίες, που ονομάζονται ενισχυτές (enhancers), εντοπίστηκαν αρχικά κατά τη μελέτη του υποκινητή ενός άλλου ιού, του SV40 (Εικ. 7.19). Για την αποτελεσματική μεταγραφή από αυτόν τον υποκινητή, εκτός από ένα πλαίσιο TATA και μια ομάδα έξι πλαισίων GC, χρειάζονται και δύο επαναλήψεις 72 ζευγών βάσεων που βρίσκονται ανοδικά και σε σχετικά μεγάλη απόσταση. Βρέθηκε ότι αυτές οι αλληλουχίες ενεργοποιούν τη μεταγραφή τόσο από αυτόν όσο και από άλλους υποκινητές. Διαπιστώθηκε μάλιστα τελείως απροσδόκητα ότι η δραστικότητα τους δεν εξαρτάται ούτε από την απόσταση τους από τη θέση έναρξης της μεταγραφής ούτε από τον προσανατολισμό τους σε σχέση με αυτή (Εικ. 7.20). Μπορούν να ενεργοποιήσουν τη μεταγραφή είτε τοποθετηθούν ανοδικά είτε καθοδικά σε σχέση με τον υποκινητή και ανεξάρτητα από τον προσανατολισμό τους. 19

20 ΕΙΚΟΝΑ 7.20: Η λειτουργία των ενισχυτών. Χωρίς τη δράση ενός ενισχυτή, ένα γονίδιο μεταγράφεται σε χαμηλά επίπεδα (Α). Παρουσία ενός ενισχυτή, Ε - για παράδειγμα, των δύο επαναλήψεων 72 ζευγών βάσεων του SV40 -, η μεταγραφή διεγείρεται. Ο ενισχυτής είναι ενεργός όχι μόνο όταν τοποθετείται ακριβώς ανοδικά σε σχέση με τον υποκινητή (Β) αλλά και όταν τοποθετείται αρκετές κιλοβάσεις είτε ανοδικά είτε καθοδικά της θέσης έναρξης της μεταγραφής (Γ και Δ). Επίσης, οι ενισχυτές είναι ενεργοί ανεξάρτητα από τον προσανατολισμό τους σε σχέση με τη θέση έναρξης της μεταγραφής (Ε). Η ικανότητα των ενισχυτών να δρουν ακόμα και όταν βρίσκονται μακριά από τις θέσεις έναρξης της μεταγραφής δημιούργησε αρχικά την εντύπωση ότι λειτουργούν με διαφορετικούς μηχανισμούς από τους υποκινητές. Ωστόσο, διαπιστώθηκε ότι αυτό δεν είναι σωστό. Οι ενισχυτές, όπως και οι υποκινητές, λειτουργούν προσδένοντας μεταγραφικούς παράγοντες οι οποίοι στη συνέχεια αλληλεπιδρούν με την RNA πολυμεράση. Αυτό πιθανώς επιτυγχάνεται μέσω της αναδίπλωσης του μορίου του DNA και του σχηματισμού ενός βρόχου, με αποτέλεσμα ένας μεταγραφικός παράγοντας που βρίσκεται συνδεδεμένος σε κάποιον απομακρυσμένο ενισχυτή να μπορεί να αλληλεπιδράσει στον χώρο με το σύμπλοκο μεταγραφικών παραγόντων-rna πολυμεράσηςδιαμεσολαβητή, που βρίσκεται στην περιοχή του υποκινητή (Εικ. 7.21). 20

ΚΕΦΑΛΑΙΟ 7. Σύνθεση και επεξεργασία του RNA. Ευάγγελος Κωλέττας

ΚΕΦΑΛΑΙΟ 7. Σύνθεση και επεξεργασία του RNA. Ευάγγελος Κωλέττας ΚΕΦΑΛΑΙΟ 7 Σύνθεση και επεξεργασία του RNA Ευάγγελος Κωλέττας Αναπληρωτής Καθηγητής Μοριακής Κυτταρικής Βιολογίας Εργαστήριο Γενικής Βιολογίας, Τμήμα Ιατρικής Σχολή Επιστημών Υγείας, Πανεπιστήμιο Ιωαννίνων

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές

Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές Εικόνα 21.1 Ένα τυπικό γονίδιο που µεταγράφεται από την RNA πολυµεράση ΙΙ έχει έναν υποκινητή ο οποίος εκτείνεται ανοδικά από τη θέση έναρξης της µεταγραφής.

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Πώς από το DNA φτάνουμε στις πρωτεΐνες Αντιγραφή του DNA o Ο μηχανισμός αντιγραφής του DNA ονομάζεται ημισυντηρητικός διότι κατά την αντιγραφή του

Διαβάστε περισσότερα

Κεντρικό δόγμα της βιολογίας

Κεντρικό δόγμα της βιολογίας Κεντρικό δόγμα της βιολογίας DNA RNA Πρωτεΐνη Μεταγραφή Σύνθεση (μονόκλωνου) RNA από ένα δίκλωνο μόριο DNA κυρίως με τη βοήθεια του ενζύμου RNA πολυμεράση Το προϊόν της μεταγραφής ονομάζεται πρωτογενές

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ 1 ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ Οι δύο πολυνουκλεοτιδικές αλυσίδες του DNA αποτελούνται από νουκλεοτίδια τα οποία ενώνονται με φωσφοδιεστερικούς δεσμούς. Πιο συγκεκριμένα

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 (+ κεφάλαιο 15 Hartwell) Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. igenetics 2

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 7. Σύνθεση και επεξεργασία του RNA

ΚΕΦΑΛΑΙΟ 7. Σύνθεση και επεξεργασία του RNA ΚΕΦΑΛΑΙΟ 7 Σύνθεση και επεξεργασία του RNA Όπου δεν αναφέρεται ρητά, οι αριθμημένες εικόνες, οι πίνακες και το αντίστοιχο κείμενό τους προέρχονται από το βιβλίο: Το κύτταρο-μια Μοριακή Προσέγγιση, Ακαδημαϊκές

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Μοριακή Βιολογία. Ενότητα # (3): Εισαγωγή στη Μεταγραφή. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ

Μοριακή Βιολογία. Ενότητα # (3): Εισαγωγή στη Μεταγραφή. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Μοριακή Βιολογία Ενότητα # (3): Εισαγωγή στη Μεταγραφή Παναγιωτίδης Χρήστος Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας Αντιγραφή του DNA Οι Watson & Crick το 1953 μαζί με το μοντέλο της διπλής έλικας, πρότειναν και έναν τρόπο

Διαβάστε περισσότερα

Μοριακή Βιολογία. Ενότητα # (4): Ευκαρυωτική Μεταγραφή. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ

Μοριακή Βιολογία. Ενότητα # (4): Ευκαρυωτική Μεταγραφή. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Μοριακή Βιολογία Ενότητα # (4): Ευκαρυωτική Μεταγραφή Παναγιωτίδης Χρήστος Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 2 Ιδιοστατικά γονίδια Ρυθμιζόμενα γονίδια

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Θέμα Α Α1) γ Α2) γ Α3) δ Α4) β Α5) β Θέμα Β Β1. Α = υδροξύλιο, Β = πρωταρχικό τμήμα, Γ = θέση έναρξης αντιγραφής, Δ = φωσφορική ομάδα, Ε = τμήμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA.

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 1 -Ρυθμιζόμενα, ιδιοστατικά γονίδια και γονίδια κυτταρικής οικονομίας:

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής: ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOY 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOY 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOY 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α I Β IV Γ VI

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. δ 3. β 4. δ 5. β ΘΕΜΑ 2ο 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις

Ενδεικτικές απαντήσεις ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ενδεικτικές απαντήσεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA

Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ) Η διαδικασία της μεταγραφής απαιτεί τη δράση του

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ (Γενετικό υλικό των βακτηρίων ρύθμιση της γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 Γενετικό υλικό των βακτηρίων Αποτελείται από ένα μόριο DNA σε υπερελιγμένη μορφή και τα άκρα του

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 5 ΣΕΠΤΕΜΒΡΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ!

ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! 14/03/2014! Καθηγητής Δρ. Κωνσταντίνος Ε. Βοργιάς! 1! 1.Ποιά είναι τα διάφορα είδη RNA 2.Ποιά είναι τα στάδια της µεταγραφής 3.Μεταγραφική ωρίµανση RNA 4.Ποιά είναι η ενζυµολογία

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

Α Τ Υ Ο Τ Ο Ι Π Ι Λ Π Α Λ Σ Α ΙΑ Ι Ζ Α Ε Ζ ΤΑ Τ Ι

Α Τ Υ Ο Τ Ο Ι Π Ι Λ Π Α Λ Σ Α ΙΑ Ι Ζ Α Ε Ζ ΤΑ Τ Ι ΚΕΦΑΛΑΙΟ 2ο: Σελίδες 27-43 ANTIΓΡΑΦΗ, ΕΚΦΡΑΣΗ & ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 1 O µηχανισµός µε τον οποίο το DNA αντιγράφεται χαρακτηρίζεται ηµισυντηρητικός Ο Watson και Crick φαντάστηκαν µια διπλή

Διαβάστε περισσότερα

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 16-06-2017 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α. φωσφορική ομάδα (Ι) E. υδροξύλιο (II) Β. mrna

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ

Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ Γίνεται σύνθεση DNA. Γίνεται σύνθεση RNA. Εξασφαλίζεται η διαιώνιση της γενετικής

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: 16 / 06 / 2017 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1: δ Α2:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Β, Α2. Β, Α3. Δ, Α4. Γ, Α5. γ ΘΕΜΑ Β Β1. 1 Α, 2 Γ, 3 Α,4 Β, 5 Α, 6 Α, 7 Γ Β2. Βλ. σχολικό βιβλίο, σελ.24(έκδοση 2014-15)

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 05 : Η μεταγραφή του DNA και η ρύθμισή της. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ

Κυτταρική Βιολογία. Ενότητα 05 : Η μεταγραφή του DNA και η ρύθμισή της. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 05 : Η μεταγραφή του DNA και η ρύθμισή της Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Κεφάλαιο 4: Ανασυνδυασμένο DNA

Κεφάλαιο 4: Ανασυνδυασμένο DNA Κεφάλαιο 4: Ανασυνδυασμένο DNA 1. Η ανάπτυξη της γενετικής μηχανικής επέτρεψε: α. την κατανόηση των μηχανισμών αντιγραφής του γενετικού υλικού β. την απομόνωση των πλασμιδίων από τα βακτήρια γ. την πραγματοποίηση

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΜΕΡΟΣ ΠΡΩΤΟ - ΠΕΡΙΓΡΑΜΜΑ 5.1 ΈΝΑ ΝΟΥΚΛΕΙΝΙΚΟ ΟΞΥ ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΌ ΤΕΣΣΕΡΑ ΕΙΔΗ ΒΑΣΕΩΝ, ΠΟΥ ΠΡΟΣΔΕΝΟΝΤΑΙ ΣΕ ΈΝΑ ΚΟΡΜΟ ΣΑΚΧΑΡΩΝ ΦΩΣΦΟΡΙΚΩΝ 5.2 ΈΝΑ ΖΕΥΓΟΣ

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ ËÁÌÉÁ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ ËÁÌÉÁ ΘΕΜΑ Α Α1: δ Α2: δ Α3: β Α4: γ Α5: α ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII - Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Αυτό

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Β1. Β2. ΘΕΜΑ 2ο 1. 2.

Β1. Β2. ΘΕΜΑ 2ο 1. 2. 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 20 ΣΕΠΤΕΜΒΡΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: BΙΟΛΟΓΙΑ (ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο Α1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 16 Ιουνίου 2017 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Εσπερινών Λυκείων Γενικών ΘΕΜΑ Α Α.1 δ Α.2 δ Α.3 β Α.4 γ Α.5 α ΘΕΜΑ B B.1 I. A II. E III. ΣΤ IV.

Διαβάστε περισσότερα

Τα γονίδια καθορίζουν τα είδη των πρωτεϊνών που συντίθενται στα κύτταρα

Τα γονίδια καθορίζουν τα είδη των πρωτεϊνών που συντίθενται στα κύτταρα Σύνθεση του RNA Δομή και σύνθεση του RNA Τα γονίδια όλων των κυττάρων αλλά και πολλών ιών αποτελούνται από DNA Τα γονίδια καθορίζουν τα είδη των πρωτεϊνών που συντίθενται στα κύτταρα Το μόριο όμως που

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕ 2017 ΑΠΑΝΣΗΕΙ ΣΟ ΜΑΘΗΜΑ ΣΗ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ

ΠΑΝΕΛΛΗΝΙΕ 2017 ΑΠΑΝΣΗΕΙ ΣΟ ΜΑΘΗΜΑ ΣΗ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ ΠΑΝΕΛΛΗΝΙΕ 2017 ΑΠΑΝΣΗΕΙ ΣΟ ΜΑΘΗΜΑ ΣΗ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ 16/06/2017 ΕΠΙΜΕΛΕΙΑ: ΑΝΔΡΙΑΝΗ ΠΑΡΑΧΗ ΘΕΜΑ Α A1. Δ Α2. Δ Α3. Β Α4. Γ Α5.Α ΘΕΜΑ Β Β1) I A II E III Σ IV Β V Ζ VI Γ VII Δ Β2) ε προκαρυωτικό γιατί

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογία ΙI Κυτταρική Επικοινωνία Διδάσκοντες: Σ. Γεωργάτος, Θ. Τζαβάρας, Π. Κούκλης, Χ. Αγγελίδης Υπεύθυνος μαθήματος: Σ. Γεωργάτος Άδειες Χρήσης Το

Διαβάστε περισσότερα

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 ΙΟΥΝΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν ΘΕΜΑ Α Α1-δ Α2-δ Α3-β

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΟ ΔΕΥΤΕΡΟ ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΣΚΗΣΕΙΣ ΣΤΟ ΔΕΥΤΕΡΟ ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1) Τμήμα μορίου βακτηριακού DNA έχει την ακόλουθη αλληλουχία βάσεων: 3 TACTGGAATGGTCGCCCCTGCATT 5 a. Ποια είναι η αλληλουχία του συμπληρωματικού κλώνου και ποιος είναι ο προσανατολισμός της. b. Ποιο είναι

Διαβάστε περισσότερα