Δοµή και ιδιότητες του DNA

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Δοµή και ιδιότητες του DNA"


1 Δοµή και ιδιότητες του DNA Βακτηριακό χρωµόσωµα ευκαρυωτικό χρωµόσωµα και χρωµατίνη 28/02/2014 1

2 Tο βακτηριακό γονιδίωµα περιέχεται σε ένα κυκλικό DNA µήκους 1300 µm εντός του βακτηριακού κυττάρου που στην περίπτωση του E.coli έχει διαστάσεις 1Χ3 µm, συνεπώς είναι πολύ σφιχτά αναδιπλωµένο µέσα στο κύτταρο. Tο βακτηριακό χρωµόσωµα περιέχει: πολλές θηλιές από υπερελικωµένο DNA στο κέντρο του µια συµπαγή δοµή από RNA και πρωτείνες Σταδιακή πέψη του βακτηριακού χρωµοσώµατος µε DΝάση, RΝάση και θρυψίνη συνεπάγεται σε µια κεντρική ελάχιστη δοµή από 45±10 θηλιές που λέγεται σκαλωσιά (scaffold). 28/02/2014 2

3 Tο ευκαρυωτικό DNA είναι οργανωµένο σε γραµµικά χρωµοσώµατα που περιέχουν dsdna και πρωτείνες (ιστόνες) και βρίσκεται αποκλειστικά στον πυρήνα. Οι ιστόνες (histones) Η1, Η2Α, Η2Β, Η3, Η4 είναι µικρές βασικές πρωτεϊνες, θετικά φορτισµένες (υψηλό ποσοστό R, K) και δηµιουργούν ιονικούς δεσµούς µε το αρνητικά φορτισµένο DNA. Σύµπλοκο: DNA + ιστόνες = νουκλεόσωµα => χρωµατίνη 28/02/2014 3

4 Γιατί τα σπερµατοζάρια δεν έχουν ιστόνες? Οι ιστόνες είναι άψογα σχεδιασµένες για τη λειτουργία τους και ως εκ τούτου είναι πολύ συντηρηµένες µε κορωνίδα την H4. H H4 είναι 100Χ πιο συντηρηµένη από τα πλέον συντηρηµένα µόρια που είναι αιµοσφαιρίνη και κυτόχρωµα c. 28/02/2014 4

5 Εκτός των ιστονών, το πυρηνικό DNA περιέχει και άλλες, µη βασικές, πρωτεϊνες γνωστές ως µη ιστόνες (non-histone DNA binding proteins) όµως είναι σε µικρή ποσότητα. Οι πρωτείνες αυτές είναι: Πρωτείνες για αντιγραφή, µεταγραφή και επιδιόρθωση του DNA Πρωτείνες που σχετίζονται µε την µετάπτωση της χρωµατίνης από την ενεργό στην ανενεργό κατάσταση HMG (high mobility group) πρωτείνες που είναι κυρίως µεταγραφικοί παράγοντες. 28/02/2014 5

6 Η αλληλεπίδραση πρωτεϊνών µε DNA γίνεται µέσω δεσµών υδρογόνου και δεν επηρεάζει το ζευγάρωµα των βάσεων. Οι δεσµοί υδρογόνου σχηµατίζονται µεταξύ των βάσεων που εκτίθενται στη µικρή αλλά κυρίως µεγάλη αύλακα του DNA και συγκεκριµένων αµινοξέων που σχηµατίζουν χαρακτηριστικά µοτίβα (DNA binding domains) 28/02/2014 6

7 ΗTH: helix turn helix είναι ένα επίσης σηµαντικά διαδεδοµένο πρωτεϊνικό µοτίβο που αλληλεπιδρά µε την µεγάλη αύλακα του DNA σχηµατίζουν χαρακτηριστικά µοτίβα (DNA binding domains) 28/02/2014 7

8 Leucine-Zipper είναι ένα επίσης σηµαντικά διαδεδοµένο πρωτεϊνικό µοτίβο που αλληλεπιδρά µε την µεγάλη αύλακα του DNA σχηµατίζουν χαρακτηριστικά µοτίβα (DNA binding domains) 28/02/2014 8

9 Ξεδιπλωµένο ανθρώπινο DNA έχει µήκος ~2 m και χωράει στον πυρήνα που έχει διάµετρο 10-6 m, οπότε είναι σηµαντικά συµπυκνωµένο. Η βασική µονάδα δοµής του DNA στον πυρήνα είναι το νουκλεόσωµα. Το νουκλεοσώµατα σχηµατίζουν χάντρες διαµέτρου nm συνδεδεµένες µε γυµνό DNA που λέγεται συνδετικό DNA (linker DNA) συνολικού µήκους 200 bp, όπως µετρήθηκε από πειράµατα πέψης. 28/02/2014 9

10 Η χρωµατίνη που ελευθερώνεται από λυµένους πυρήνες αποτελείται από µια συµπαγώς οργανωµένη σειρά σωµατίων. 28/02/2014 Κατά την πέψη χρωµατίνης µε µικροκοκκική νουκλεάση, αποδεσµεύονται µεµονωµένα νουκλεοσώµατα. 10

11 Οι πυρήνες των νουκλεοσωµάτων (core particles) φτιάχνονται απο 146 bp αριστερόστροφα τυλιγµένες γύρω από ενα πρωτεϊνικό οκταµερές ιστονών 2Χ(Η2Α, Η2Β, Η3, Η4). Το νουκλεόσωµα αποτελείται από περίπου ίσες µάζες DNA και ιστονών (συµπεριλαµβανοµένης της H1). Το µοριακό βάρος του νουκλεοσώµατος είναι 262 kd. Η ιστόνη Η1 αλληλεπιδρά µε το συνδετικό DNA και σταθεροποιεί τα νουκλεοσώµατα το ένα κοντά στο άλλο. 28/02/

12 Σε ένα συµµετρικό µοντέλο για το νουκλεόσωµα, το τετραµερές Η32 Η42 παρέχει τον πυρήνα του σχήµατός του. Ένα µόνο διµερές Η2A H2B µπορεί να φανεί στην κάτοψη, γιατί το άλλο βρίσκεται κρυµµένο από κάτω. Οι Ν-τελικές ουρές των ιστονών είναι ευέλικτες και προεξέχουν από το νουκλεόσωµα, προβάλλοντας ανάµεσα από τις στροφές του DNA. 28/02/

13 Η κρυσταλλική δοµή του πυρηνικού οκταµερούς των ιστονών παρουσιάζεται σε ένα χωροπληρωτικό µοντέλο (space filling model). Το τετραµερές Η32 Η42 απεικονίζεται άσπρο και τα διµερή Η2A H2B µπλε. Μόνο ένα διµερές Η2A H2B είναι ορατό στην κάτοψη, διότι το άλλο είναι κρυµµένο από κάτω. Η πιθανή πορεία του DNA φαίνεται στην κάτοψη ως στενός σωλήνας (ένα τέταρτο της πραγµατικής διαµέτρου του DNA) και στην πλευρική άποψη ως δέσµη παράλληλων γραµµών µε εύρος 20 Å. 28/02/

14 Σε µοντέλλα µεταφασικών χρωµοσωµάτων οι θηλιές που σχηµατίζουν τα σωληνοειδή είναι προσκολληµένες σε ένα κεντρικό πυρήνα που ονοµάζεται ικρίωµα (σκαλωσιά) (scaffold). 28/02/

15 Το αντιγραφόµενο DNA ενσωµατώνεται αµέσως σε νουκλεoσώµατα. 28/02/

16 Η καθαρά δοµική εικόνα της χρωµατίνης µας παρέχει µόνο µια στατική περιγραφή της. Δυναµική εικόνα της χρωµατίνης µπορούµε να αποκτήσουµε έµµεσα. Δυναµική εικόνα της χρωµατίνης είναι η διευθέτηση των νουκλεοσωµάτων σε τυχαίες ή ειδικές θέσεις στην αλληλουχία του DNA. Ο όρος: νουκλεόσωµα σε φάση (phased nucleosomes) περιγράφει συγκεκριµένη διευθέτηση των νουκλεοσωµάτων στο DNA. 28/02/

17 Η οργάνωση της χρωµατίνης είναι ελαστική για να καλύψει τις δοµικές και λειτουργικές της ανάγκες. Η χρωµατίνη από φωτογραφίες ΗΜ είναι γνωστό οτι εµφανίζεται ως ευχρωµατίνη (ενεργός χρωµατίνη) και ετεροχρωµατίνη (ανενεργός χρωµατίνη) 28/02/

18 Η τροποποίηση µεθυλίωση - των κυτοσινών είναι ένας παράγοντας που επηρεάζει-ρυθµίζει την µεταγραφική ενεργότητα. Πώς: Η µεθυλίωση C σε ειδικές θέσεις εµποδίζει την πρόσδεση παραγόντων µεταγραφής (transcription factors) Tα ήδη ενεργά γονίδια δεν µεθυλιώνονται: Στα ενεργά γονίδια δουλεύουν µια σειρά από πρωτείνες. Είναι πιθανόν αυτές οι πρωτείνες να εµποδίζουν τα ένζυµα µεθυλίωσης (DNA methylases) να δράσουν. 28/02/

19 Η χρωµατίνη πακετάρεται µε τις ιστόνες σχηµατίζοντας τα νουκλεοσώµατα. Η συµπαγής δοµή της χρωµατίνης δεν επιτρέπει την ελεύθερη πρόσδεση πρωτεϊνών που σχετίζονται µε την µεταγραφική ενεργότητα και άρα τη γονιδιακή ρύθµιση. 28/02/

20 Η µηχανισµοί αποδόµησης (και όχι αποικοδόµησης) της χρωµατίνης, των νουκλεοσωµάτων, στόχο έχουν να αυξήσουν τη διαθεσιµότητα του DNA στις πρωτείνες που θα αναλάβουν την µεταγραφή και άρα τη γονιδιακή έκφραση. Μέσω συµπλόκων αναδόµησης της χρωµατίνη χρησιµοποιώντας ATP (chromatin remodeling complexes) Ενζυµική (χηµική) τροποποίηση των νουκλεοσωµάτων µέσω τροποποίησης των ιστονών µε στόχο την προγραµµατισµένη έκφραση/ αδρανοποίση γονιδίων ανταποκρινόµενη σε αναπτυξιακά και περιβαλλοντικά ερεθίσµατασήµατα. 28/02/

21 Η µηχανισµοί αποδόµησης (και οχι αποικοδόµησης) της χρωµατίνης, των νουκλεοσωµάτων: Τα συµπλόκα αναδόµησης της χρωµατίνη είναι σύµπλοκα πρωτεϊνικών υποµονάδων που χρησιµοποιούν ενέργεια (ATP) για να σπάσουν τη δοµή των νουκλεοσωµάτων ώστε να αυξηθεί η προσπελασιµότητα του DNA από µεταγραφικούς παράγοντες. Υπάρχουν πολλές οικογένειες τέτοιων συµπλόκων που η κάθε µια σχετίζεται µε οµάδες γονιδίων (άρα εξειδίκευση). 28/02/

22 Η µηχανισµοί αποδόµησης (και όχι αποικοδόµησης) της χρωµατίνης, των νουκλεοσωµάτων: Το δυναµικό µοντέλο για τη µεταγραφή της χρωµατίνης προβλέπει τη δράση παραγόντων οι οποίοι χρησιµοποιούν την ενέργεια που παράγεται από την υδρόλυση του ATP για να εκτοπίσουν τα νουκλεοσώµατα από συγκεκριµένες περιοχές του DNA. 28/02/

23 Ενζυµική (χηµική) τροποποίηση των νουκλεοσωµάτων µέσω τροποποίησης των ιστονών µε στόχο την προγραµµατισµένη έκφραση/αδρανοποίση γονιδίων ανταποκρινόµενη σε αναπτυξιακά και περιβαλλοντικά ερεθίσµατα-σήµατα. Η ακετυλίωση των ιστονών ενεργοποιεί τη χρωµατίνη Η µεθυλίωση του DNA απενεργοποιεί τη χρωµατίνη. Η µεθυλίωση των ιστονών απενεργοποιεί τη χρωµατίνη. 28/02/

24 Η ακετυλίωση των ιστονών H3 και H4 σχετίζεται µε την ενεργή ενώ η µεθυλίωση µε την ανενεργή κατάσταση της χρωµατίνης. 28/02/

25 Η ακετυλίωση λυσίνης και η φωσφορυλίωση σερίνης µειώνουν το συνολικό θετικό φορτίο µιας πρωτεΐνης. Αντίθετα, η µεθυλίωση ενισχύει την ηλεκτροθετικότητα της λυσίνης. 28/02/

Δοµή και ιδιότητες του DNA

Δοµή και ιδιότητες του DNA Δοµή και ιδιότητες του DNA Βακτηριακό χρωµόσωµα Ευκαρυωτικό χρωµόσωµα και χρωµατίνη 10/03/2015 1 Tο βακτηριακό γονιδίωµα περιέχεται σε ένα κυκλικό DNA µήκους 1300 µm εντός του βακτηριακού κυττάρου. Στην

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA σε επίπεδο χρωµατίνηςνουκλεοσώµατος. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA σε επίπεδο χρωµατίνηςνουκλεοσώµατος. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA σε επίπεδο χρωµατίνηςνουκλεοσώµατος 09/04/2014 1 09/04/2014 2 Η καθαρά δοµική εικόνα της χρωµατίνης µας παρέχει µόνο µια στατική περιγραφή της. Δυναµική εικόνα της χρωµατίνης

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 03 : Δομή και οργάνωση του γενετικού υλικού. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ

Κυτταρική Βιολογία. Ενότητα 03 : Δομή και οργάνωση του γενετικού υλικού. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 03 : Δομή και οργάνωση του γενετικού υλικού Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Εικόνα 22.1 Η γονιδιακή έκφραση ελέγχεται κυρίως κατά την έναρξη της µεταγραφής και σπάνια στα επόµενα στάδια της γονιδιακής έκφρασης, παρόλο που ο έλεγχος

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Η οργάνωση και οι αλληλουχίες των κυτταρικών γονιδιωμάτων

ΚΕΦΑΛΑΙΟ 5. Η οργάνωση και οι αλληλουχίες των κυτταρικών γονιδιωμάτων ΚΕΦΑΛΑΙΟ 5 Η οργάνωση και οι αλληλουχίες των κυτταρικών γονιδιωμάτων Όπου δεν αναφέρεται ρητά, οι αριθμημένες εικόνες, οι πίνακες και το αντίστοιχο κείμενό τους προέρχονται από το βιβλίο: Το κύτταρο-μια

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΟΣ ΚΥΤΚΛΟΣ. abee/biobk/biobookmeiosis.html. pdf

ΚΥΤΤΑΡΙΚΟΣ ΚΥΤΚΛΟΣ.  abee/biobk/biobookmeiosis.html. pdf ΚΥΤΤΑΡΙΚΟΣ ΚΥΤΚΛΟΣ http://www2.estrellamountain.edu/faculty/far abee/biobk/biobookmeiosis.html pdf https://www.youtube.com/watch?v=wy3n5nczbhq http://www.youtube.com/watch?v=lf9rcqifx34&feature=related

Διαβάστε περισσότερα

Τύποι νουκλεϊκών οξέων

Τύποι νουκλεϊκών οξέων Τύποι νουκλεϊκών οξέων DNA ένας τύπος, μια λειτουργία RNA - 4 τύποι, 4 λειτουργίες Ριβοσωμικό RNA Αγγελιαφόρο RNA Μεταφορικό RNA Καταλυτικό RNA Βιοχημεία Ι Δ-1 Βιοχημεία Ι Δ-2 3 5 φωσφοδιεστερικός δεσμός

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές

Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές Εικόνα 21.1 Ένα τυπικό γονίδιο που µεταγράφεται από την RNA πολυµεράση ΙΙ έχει έναν υποκινητή ο οποίος εκτείνεται ανοδικά από τη θέση έναρξης της µεταγραφής.

Διαβάστε περισσότερα


ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς Λειτουργίες Γενετικού Υλικού o Αποθήκευση της γενετικής πληροφορίας. Η οργάνωση της γενετικής πληροφορίας

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Κεντρικό δόγμα της βιολογίας

Κεντρικό δόγμα της βιολογίας Κεντρικό δόγμα της βιολογίας DNA RNA Πρωτεΐνη Μεταγραφή Σύνθεση (μονόκλωνου) RNA από ένα δίκλωνο μόριο DNA κυρίως με τη βοήθεια του ενζύμου RNA πολυμεράση Το προϊόν της μεταγραφής ονομάζεται πρωτογενές

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ρ. Θ. Σουρλίγκα Εργαστήριο Βιοχηµείας Ιστονών

ρ. Θ. Σουρλίγκα Εργαστήριο Βιοχηµείας Ιστονών Ιστονικές Ποικιλοµορφίες και Μεταφραστικές Τροποποιήσεις των ιστονών: Βασικοί Παράγοντες για την Στερεοδιαµόρφωση της Χρωµατίνης κατά την Γήρανση και Απόπτωση ρ. Θ. Σουρλίγκα Εργαστήριο Βιοχηµείας Ιστονών

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 19. Τα χρωμοσώματα

ΚΕΦΑΛΑΙΟ 19. Τα χρωμοσώματα ΚΕΦΑΛΑΙΟ 19 Τα χρωμοσώματα Παράγραφοι 19.1-19.4 (σελ. 771-780) Παράγραφοι 19.7-19.12 (σελ. 784-793) Παράγραφοι 19.16-19.17 (σελ. 797-799) Παράγραφοι 19.19-19.20 (σελ. 801-804) Το μήκος του νουκλεϊκού οξέος

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

Βασικοί μηχανισμοί προσαρμογής

Βασικοί μηχανισμοί προσαρμογής ΣΥΓΚΡΙΤΙΚΗ ΦΥΣΙΟΛΟΓΙΑ ΖΩΩΝ 23-24, 18/4/2016 Π.Παπαζαφείρη Βασικοί μηχανισμοί προσαρμογής Προσαρμογή σε μοριακό και γονιδιακό επίπεδο Επίπεδα ελέγχου 1. Πρωτεïνική δράση 2. Πρωτεïνοσύνθεση 3. Ρύθμιση της

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:


Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ. αναπαραγωγή. αύξηση αριθµού κυττάρων ανάπτυξη

ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ. αναπαραγωγή. αύξηση αριθµού κυττάρων ανάπτυξη ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ αναπαραγωγή αύξηση αριθµού κυττάρων ανάπτυξη επιδιόρθωση ιστών Κυτταρική οργάνωση του γενετικού υλικού Γονιδίωµα: Το σύνολο του γενετικού υλικού (DNA) ενός κυττάρου Στα προκαρυωτικά κύτταρα

Διαβάστε περισσότερα

Μοριακή Βιολογία. Ενότητα # (4): Ευκαρυωτική Μεταγραφή. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ

Μοριακή Βιολογία. Ενότητα # (4): Ευκαρυωτική Μεταγραφή. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Μοριακή Βιολογία Ενότητα # (4): Ευκαρυωτική Μεταγραφή Παναγιωτίδης Χρήστος Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

Genes VIII (Lewin) Κεφάλαιο 12 Κεφάλαιο , Μοριακή Βιολογία του γονιδίου Σελίδες

Genes VIII (Lewin) Κεφάλαιο 12 Κεφάλαιο , Μοριακή Βιολογία του γονιδίου Σελίδες Genes VIII (Lewin) Κεφάλαιο 12 Κεφάλαιο 20.1-20.14, 23.1-23.17 Μοριακή Βιολογία του γονιδίου Σελίδες 210-250 Genes VIII (Lewin) Κεφάλαιο 12 Κεφάλαιο 20.1-20.14, 23.1-23.17 Μοριακή Βιολογία του γονιδίου

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 23/02/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 23/02/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 23/02/2014 1 23/02/2014 2 Τόσο τα νεκρά (µε θερµική επεξεργασία) βακτήρια S όσο και τα ζωντανά βακτήρια R δεν µπορούν να θανατώσουν ποντικούς. Όµως, η ταυτόχρονη µόλυνση µε αυτά

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα


ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1 ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1. Κατά τον σχηματισμό ενός μορίου RNA αποβάλλονται 2008 μόρια νερού. Να βρεθεί το μήκος του. [2009b (βάσεις)]

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα


ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 05 : Η μεταγραφή του DNA και η ρύθμισή της. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ

Κυτταρική Βιολογία. Ενότητα 05 : Η μεταγραφή του DNA και η ρύθμισή της. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 05 : Η μεταγραφή του DNA και η ρύθμισή της Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά;

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; ΒΙΟΛΟΓΙΚΗ ΑΝΘΡΩΠΟΛΟΓΙΑ 12 26/10/2016 Κεφάλαιο 3 Α μέρος Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; Ποια είναι η δομή

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες

Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες Γένωμα vs Πρωτέωμα Όλη η αλληλουχία βάσεων στο DNA Τι είναι δυνατόν Συγκεκριμένο Στατικό Οι πρωτεΐνες που κωδικοποιούνται από το γένωμα Τι είναι

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Εργασία στην Βιολογία

Εργασία στην Βιολογία Εργασία στην Βιολογία Μεμβράνη του Πυρήνα του Κυττάρου Χρονιά: 2013-2014 Επιμέλεια: Σταμάτης Ορφανός, Μάριος Παναγιωτόπουλος [1] Πυρήνας του Κυττάρου Ο πυρήνας είναι το πιο μεγάλο και ευδιάκριτο οργανίδιο

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις


Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα


ΜΑΘΗΜΑΤΑ ΜΟΡΙΑΚΗΣ ΙΑΤΡΙΚΗΣ 9 ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΙΑΤΡΙΚΗΣ ΧΗΜΕΙΑΣ ΜΑΘΗΜΑΤΑ ΜΟΡΙΑΚΗΣ ΙΑΤΡΙΚΗΣ 9 ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΙΑΤΡΙΚΗΣ ΧΗΜΕΙΑΣ Αργυρώ Σγουρού, Assistant Prof. Laboratory of Biology School of Science and Technology Hellenic Open University 2016-2017 Επιγενετικές

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα


ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Πώς από το DNA φτάνουμε στις πρωτεΐνες Αντιγραφή του DNA o Ο μηχανισμός αντιγραφής του DNA ονομάζεται ημισυντηρητικός διότι κατά την αντιγραφή του

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η δοµή και η λειτουργία του κυτταροσκελετού: Ο κυτταροσκελετός είναι ένα δίκτυο από ινίδια που εκτείνονται σε όλο το κυτταρόπλασµα και σχηµατίζουν

Η δοµή και η λειτουργία του κυτταροσκελετού: Ο κυτταροσκελετός είναι ένα δίκτυο από ινίδια που εκτείνονται σε όλο το κυτταρόπλασµα και σχηµατίζουν Η δοµή και η λειτουργία του κυτταροσκελετού: Ο κυτταροσκελετός είναι ένα δίκτυο από ινίδια που εκτείνονται σε όλο το κυτταρόπλασµα και σχηµατίζουν ένα δυναµικό σκελετό που χρησιµεύει στη στήριξη και την

Διαβάστε περισσότερα

Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA

Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA Χρήστος Κρούπης, MSc, PhD Επίκουρος Καθηγητής Κλινικής Βιοχημείας Ιατρική Σχολή Πανεπιστημίου Αθηνών Αττικόν Πανεπιστημιακό Νοσοκομείο Lehninger

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΥ: ΜΙΚΡΟΪΝΙΔΙΑ- ΕΝΔΙΑΜΕΣΑ ΙΝΙΔΙΑ- ΜΙΚΡΟΣΩΛΗΝΙΣΚΟΙ Η δοµή και η λειτουργία του κυτταροσκελετού: Ο κυτταροσκελετός είναι ένα δίκτυο από ινίδια που εκτείνονται σε όλο

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

1. Αλληλεπιδράσεις μεταξύ βιομορίων

1. Αλληλεπιδράσεις μεταξύ βιομορίων 1. Αλληλεπιδράσεις μεταξύ βιομορίων Το αντικείμενο των αλληλεπιδράσεων μεταξύ των βιομορίων καλύπτει ένα τεράστιο σύνολο περιπτώσεων με αποτελέσματα από βιολογικές, βιοχημικές και βιοφυσικές μελέτες που

Διαβάστε περισσότερα

Κεφάλαιο 3. Δομές τάξης α

Κεφάλαιο 3. Δομές τάξης α Κεφάλαιο 3 Δομές τάξης α Κεφάλαιο 3 Δομές Τάξης α: Σπειρωμένα Σπειράματα Εικόνα 3.1 Σχηματικό διάγραμμα της δομής ενός σπειρωμένου σπειράματος α-ελίκων. Δύο α-έλικες συμπλέκονται και σταδιακά τυλίγονται

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2015 ΘΕΜΑ Α Α1. β, Α2. γ, Α3. α, Α4. δ, Α5. γ ΘΕΜΑ Β Β1. 1-Α, 2-Β, 3-Β, 4-Α, 5-Α, 6-Α, 7-Β, 8-Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

Χρωμοσώματα & κυτταροδιαιρέσεις

Χρωμοσώματα & κυτταροδιαιρέσεις Δασική Γενετική Χρωμοσώματα & κυτταροδιαιρέσεις Χειμερινό εξάμηνο 2014-2015 Σύνοψη Το DNA αναπαράγεται, εκφράζεται και μεταλλάσσεται Το DNA είναι οργανωμένα σε χρωμοσώματα Τα ευκαρυωτικά γενώματα έχουν

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α


Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β. Α1. Η α Α2. Η γ Α3. Η α Α4. Η δ Α5. Η γ Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β


Διαβάστε περισσότερα

Κεφάλαια 8 ο Ένζυμα και κατάλυση

Κεφάλαια 8 ο Ένζυμα και κατάλυση Κεφάλαια 8 ο Ένζυμα και κατάλυση Τα ένζυμα είναι βιομόρια που μεσολαβούν στους χημικούς μετασχηματισμούς και στη μετατροπή της ενέργειας Κύρια χαρακτηριστικά τους η ισχύς και η εξειδίκευση Πλέον θα τα

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα