Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων"

Transcript

1 Πανεπιστημιο Κυπρου Τμημα Βιολογικων Επιστημων Σημειωσεις μαθηματος ΒΙΟ101 Ιωάννης Κυρμιτζόγλου Αν. Καθ. Λεόντιος Κωστρίκης Λευκωσια,

2 Ε Ι Σ Α Γ Ω Γ Η Σ Τ Ι Σ Σ Υ Γ Χ Ρ Ο Ν Ε Σ Β Ι Ο Λ Ο Γ Ι Κ Ε Σ Ε Π Ι Σ Τ Η ΜΕΣ ΕΙΣΑΓΩΓΗ ΣΤΑ ΚΥΤΤΑΡΑ (ΠΑΡΑΣΚΕΥΗ, 7 ΣΕΠΤΕΜΒΡΙΟΥ 2007) Όλοι οι ζωντανοί οργανισμοί αποτελούνται από κύτταρα ο αριθμός των οποίων ποικίλει από ένα (π.χ. στα βακτήρια) μέχρι αρκετά τρισεκατομμύρια (π.χ. στον άνθρωπο). Είναι εμφανές λοιπόν ότι τα κύτταρα έχουν πολύ μικρό μέγεθος (συνήθως από 2 200μm) και μπορούν να παρατηρηθούν μόνο με την χρήση ειδικών οργάνων που ονομάζουμε μικροσκόπια. Εξαίρεση σε αυτό τον κανόνα αποτελούν μερικές κατηγορίες κυττάρων, όπως τα λιπώδη κύτταρα, τα οποία βρίσκονται στο όριο της διακριτικής ικανότητας του ανθρώπινου ματιού ( 200μm) και συνεπώς μπορούν, έστω και δύσκολα, να παρατηρηθούν δια γυμνού οφθαλμού. Ανά πάσα στιγμή, τόσο στο περιβάλλον μας όσο και στον ίδιο τον οργανισμό μας, υπάρχουν χιλιάδες διαφορετικοί τύποι και μορφές κυττάρων. Μπορούμε ωστόσο να ομαδοποιήσουμε όλες αυτές τις μορφές σε δύο μεγάλες κατηγορίες: τα προκαρυωτικά και τα ευκαρυωτικά κύτταρα. Η βασικότερη διαφορά τους είναι ότι στα ευκαρυωτικά κύτταρα υπάρχει ο πυρήνας ο οποίος βρίσκεται συνήθως στο κέντρο του κυττάρου και βασικός σκοπός του είναι η προστασία του κυτταρικού γενετικού υλικού. Όλο το κύτταρο περιβάλλεται από την κυτταροπλασματική μεμβράνη, μια δυναμική δομή που ως λόγο ύπαρξης έχει την απομόνωση του κυττάρου από το περιβάλλον του. Δύο από τις βασικότερες λειτουργίες της κυτταροπλασματικής μεμβράνης είναι η εισαγωγή υλικών από το περιβάλλον μέσα στο κύτταρο (εσωκύττωση) αλλά και η εξαγωγή υλικών από το κύτταρο στο περιβάλλον (εξωκύττωση). Μέσα στο κύτταρο και γύρω από τον πυρήνα βρίσκεται το κυτταρόπλασμα μέσα στο οποίο βρίσκονται μια σειρά από μικροσκοπικές δομές (100nm 10μm), τα οργανίδια. Τα βασικότερα οργανίδια του ευκαρυωτικού κυττάρου είναι τα μιτοχόνδρια, το ενδοπλασματικό δίκτυο, τα ριβοσώματα και η συσκευή Golgi. Κάθε τύπος οργανιδίων έχει και μια διαφορετική λειτουργία, έτσι για παράδειγμα το μιτοχόνδριο είναι το εργοστάσιο παραγωγής ενέργειας του κυττάρου. Τέλος, ένα ακόμα σημαντικό συστατικό του κυττάρου είναι ο κυτταρικός σκελετός που αποτελείται από 3 διαφορετικές κατηγορίες επιμηκών μορίων: τα ινίδια ακτίνης, τους μικροσωληνίσκους και τα ενδιάμεσα ινίδια. Όπως και με τα οργανίδια, κάθε κατηγορία μορίων του κυτταρικού σκελετού επιτελεί και διαφορετικές λειτουργίες μέσα στο κύτταρο. Ο πυρήνας διαχωρίζεται από το κυτταρόπλασμα με την πυρηνική μεμβράνη η οποία ελέγχει σχολαστικά την κυκλοφορία μορίων από και προς τον πυρήνα. Με τον τρόπο αυτό ο πυρήνας καταφέρνει και διατηρεί ένα πολύ πιο ομοιογενές περιεχόμενο το οποίο είναι απαραίτητο για την προστασία του γενετικού υλικού του κυττάρου. Το γενετικό υλικό αποτελείται από μεγάλα, επιμήκη μόρια DNA. Το DNA θα μπορούσε να παρομοιαστεί με τα αρχιτεκτονικά σχέδια του κυττάρου μιας και όλη η πληροφορία που χρειάζεται για την κατασκευή, την αναπαραγωγή αλλά και την εύρυθμη λειτουργία του κυττάρου βρίσκεται κωδικοποιημένη μέσα του. Αυτός είναι και ο λόγος για τον οποίο το γενετικό υλικό δεν είναι ποτέ στάσιμο αλλά αλλάζει συνεχώς μορφές (αλλά όχι περιεχόμενο!!) ανάλογα με τη φάση

3 στην οποία βρίσκεται το κύτταρο, προκειμένου οι πληροφορίες που περιέχει να είναι προσβάσιμες όποτε το κύτταρο τις χρειάζεται. Το DNA διαθέτει μια ακόμα μοναδική ιδιότητα, την ικανότητα να αντιγράφει τον εαυτό δηλ. να αναπαράγεται. Με τον τρόπο αυτό μπορούν από ένα αρχικό κύτταρο να παραχθούν, με διαδοχικές διαιρέσεις, εκατομμύρια κύτταρα τα οποία θα περιέχουν το ίδιο γενετικό υλικό. Αυτός είναι και ο λόγος που όλα τα κύτταρα του σώματος μας περιέχουν αποθηκευμένη την ίδια πληροφορία, δηλ. τα ίδια μόρια DNA. Για την διαίρεση του κυττάρου και το διαχωρισμό του γενετικού υλικού απαιτούνται μια μεγάλη σειρά από δραστικές αλλαγές (όπως η συμπύκνωση του DNA σε σχηματισμούς που ονομάζονται χρωμοσώματα) αλλά και μηχανισμούς (όπως η μεταφορά των χρωμοσωμάτων στα άκρα του διαιρούμενου κυττάρου με τη βοήθεια των μικροσωληνίσκων). Όλα τα κύτταρα, όσο διαφορετικά και αν είναι μεταξύ τους, χρησιμοποιούν σχεδόν πανομοιότυπους μηχανισμούς προκειμένου να επιτελέσουν τις διάφορες λειτουργίες τους. Κάτι τέτοιο μαρτυρά την κοινή καταγωγή όλων των κυττάρων και συνεπώς των οργανισμών. Η διαδικασία με την οποία κατάφερε η φύση να δημιουργήσει μια ατελείωτη ποικιλία οργανισμών από ένα αρχικό κύτταρο ονομάζεται εξέλιξη. Ο βασικός μηχανισμός με τον οποίο λειτουργεί η εξέλιξη είναι αυτός της φυσικής επιλογής: όταν τα κύτταρα αναπαράγονται μπορεί να προκληθούν μικρές αλλαγές στο γενετικό τους υλικό οι οποίες μπορεί να προκαλέσουν διαφοροποιήσεις σε κάποιες από τις λειτουργίες του κυττάρου αν οι αλλαγές αυτές βοηθούν το κύτταρο να προσαρμοστεί καλύτερα στο περιβάλλον του τότε περνάνε και σε άλλα κύτταρα μέσω της αναπαραγωγής. Με την πάροδο του χρόνου οι αλλαγές αυτές συσσωρεύονται και προκαλούν αυτή την τεράστια ποικιλία μορφών ζωής που υπάρχει σήμερα. Ουσιαστικά λοιπόν, η εξέλιξη είναι μια διαδικασία που γίνεται από μόνη της, στηρίζεται στην επιβίωση και αυξημένη αναπαραγωγή των καλύτερα προσαρμοσμένων ατόμων σε ένα συγκεκριμένο περιβάλλον και οδηγεί στην τελειοποίηση ενός οργανισμού. Έτσι, σύμφωνα με τις σύγχρονες απόψεις, όλοι οι οργανισμοί φαίνεται ότι προήλθαν από ένα αρχέγονο προκαρυωτικό κύτταρο. Το ευκαρυωτικό κύτταρο φαίνεται ότι σχηματίστηκε από τη συμβίωση ενός προκαρυωτικού κυττάρου μέσα σε ένα άλλο. Το κύτταρο αυτό είναι το σημερινό μιτοχόνδριο. Ακόμα και μικρές αλλαγές στο γενετικό υλικό μπορεί να οδηγήσουν σε μεγάλες αλλαγές στη μορφή και τη λειτουργία ενός οργανισμού. Για παράδειγμα αν και ο άνθρωπος διαφέρει πολύ από το χιμπατζή, το γενετικό τους υλικό διαφέρει μόνο κατά 3% και για να δημιουργηθεί αυτή η διαφορά χρειάστηκε να περάσουν πάνω από χρόνια. Δεν αλλάζουν όμως όλοι οι οργανισμοί το ίδιο. Έτσι, ο κροκόδειλος και ο καρχαρίας παρέμειναν ουσιαστικά απαράλλακτοι κατά τη διάρκεια αυτού του τεράστιου χρονικού διαστήματος και ο βασικός λόγος είναι ότι ήταν (και είναι!) πολύ καλά προσαρμοσμένοι στο περιβάλλον τους και έτσι δεν χρειάστηκε να αλλάξουν, δηλ. να εξελιχθούν. Περισσότερη ανάγνωση: Κεφ. 1 «Εισαγωγή στα κύτταρα» από Alberts, B., Bray, D., Johnson, A., Lewis, J., Raff, M., Roberts, K., et al. (2000). Βασικές Αρχές Κυτταρικής Βιολογίας: Εισαγωγή στη Μοριακή Βιολογία του Κυττάρου (Χ. Ζιούδρου, Μεταφ.). Αθήνα: Ιατρικές Εκδόσεις Π.Χ. Πασχαλίδη.

4 Ε Ι Σ Α Γ Ω Γ Η Σ Τ Ι Σ Σ Υ Γ Χ Ρ Ο Ν Ε Σ Β Ι Ο Λ Ο Γ Ι Κ Ε Σ Ε Π Ι Σ Τ Η ΜΕΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ: ΧΗΜΙΚΗ ΔΟΜΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ (ΤΡΙΤΗ, 11 ΣΕΠΤΕΜΒΡΙΟΥ 2007) Όλα τα ζωντανά κύτταρα προκειμένου να καλύψουν τις ενεργειακές, δομικές και λειτουργικές τους ανάγκες χρησιμοποιούν μεγάλα πολυμερή μόρια, δηλ. μόρια που αποτελούνται από μικρότερες δομικές μονάδες. Τα μόρια αυτά ονομάζονται βιολογικά μακρομόρια και διακρίνονται σε 3 μεγάλες κατηγορίες: τους πολυσακχαρίτες, τα νουκλεϊκά οξέα και τις πρωτεΐνες. Οι πολυσακχαρίτες, όπως π.χ. το άμυλο και η ζάχαρη, παρέχουν στο κύτταρο όλη την απαραίτητη ενέργεια για την επιβίωση και την αναπαραγωγή του. Τα νουκλεϊκά οξέα, δηλ. το DNA και το RNA, αποτελούν την αποθήκη όλων των πληροφοριών του κυττάρου που μεταβιβάζονται από γενιά σε γενιά και αυτός είναι και ο λόγος που ονομάζονται γενετικό υλικό. Για το σχηματισμό των νουκλεϊκών οξέων χρησιμοποιούνται 5 μονομερή μόρια, τα νουκλεοτίδια. Στο σχηματισμό του DNA συμμετέχουν 4 νουκλεοτίδια: αδενίνη, θυμίνη, κυτοσίνη και γουανίνη τα οποία συμβολίζονται αντίστοιχα με τέσσερα γράμματα A, T, C, G. Στο RNA χρησιμοποιούνται επίσης 4 νουκλεοτίδια μόνο που σε αυτή την περίπτωση αντί της θυμίνης χρησιμοποιείται η ουρακίλη (U). Για όλες τις υπόλοιπες ανάγκες του το κύτταρο χρησιμοποιεί τις πρωτεΐνες, τα βιολογικά μακρομόρια με την μεγαλύτερη ποικιλία και αφθονία μέσα στο κύτταρο. Οι πρωτεΐνες είναι τα μόρια που παράγονται χρησιμοποιώντας τις πληροφορίες που βρίσκονται αποθηκευμένες μέσα στο γενετικό υλικό του κυττάρου, αποτελούν δηλ. τα εργαλεία που κατασκευάζει το κύτταρο προκειμένου να επιβιώσει. Έτσι για να μπορέσει να διασπάσει τους πολυσακχαρίτες και να πάρει την αποθηκευμένη ενέργεια ή για να μπορέσει να διπλασιάσει το γενετικό του υλικό το κύτταρο θα πρέπει πρώτα να κατασκευάσει μια σειρά από πρωτεΐνες. Επιπλέον, οι πρωτεΐνες χρησιμοποιούνται για την προστασία του κυττάρου, ως δομικά υλικά, για την επικοινωνία με άλλα κύτταρα (π.χ. ως υποδοχείς) κλπ. Ο αριθμός των πρωτεϊνών που βρίσκονται μέσα σε κάθε κύτταρο ποικίλει ανάλογα με τον οργανισμό, τον τύπο του κυττάρου αλλά και τη φάση του κύκλου ζωής στην οποία βρίσκεται. Έτσι αν και το ανθρώπινο γενετικό υλικό περιέχει τις πληροφορίες για την σύνθεση διαφορετικών πρωτεϊνών μέσα σε ένα τυπικό κύτταρο συνθέτονται μόνο ένα μέρος από αυτές. Στον αντίποδα, το γενετικό υλικό του ιού HIV (που είναι 2 μόρια RNA) κωδικοποιεί μόλις 9 διαφορετικές πρωτεΐνες εκ των οποίων οι 3 χρησιμοποιούνται για την κατασκευή του ιού ενώ οι υπόλοιπες 6 είναι υπεύθυνες για την αναπαραγωγή και τη μολυσματικότητα του. Όλες οι πρωτεΐνες είναι απαραίτητες για τη σωστή αναπαραγωγή του ιού και για το λόγο αυτό όταν ένα κύτταρο μολυνθεί από τον ιό υποχρεώνεται να κατασκευάσει όλες του τις πρωτεΐνες σε εκατομμύρια αντίγραφα. Αυτός είναι και ο λόγος για τον οποίο οι ιοί έχουν τόσο μικρό γενετικό υλικό: η ικανότητα τους να χρησιμοποιούν τους μηχανισμούς του οργανισμού που προσβάλουν για την αναπαραγωγή και τη σύνθεση των πρωτεϊνών τους.

5 Για την σύνθεση όλων των γνωστών πρωτεϊνών χρησιμοποιούνται μόλις 20 διαφορετικά απλά μόρια, τα αμινοξέα. Για να κατανοήσουμε πως κάτι τέτοιο είναι εφικτό θα μπορούσαμε να φανταστούμε την πρωτεΐνη σαν ένα κομπολόι και τα 20 διαφορετικά αμινοξέα σαν 20 διαφορετικές χάντρες που μπορούμε να χρησιμοποιήσουμε για να κατασκευάσουμε το κομπολόι. Οποιαδήποτε αλλαγή στον αριθμό, την ποσότητα και τη σειρά των χαντρών που χρησιμοποιούμε θα οδηγήσει στην κατασκευή ενός διαφορετικού κομπολογιού έστω και κάποια από αυτά θα μοιάζουν πολύ μεταξύ τους. Όπως φαίνεται και από τις σχετικές διαφάνειες όλα τα αμινοξέα έχουν την ίδια γενική δομή: ένας κεντρικό άτομο άνθρακα (α άνθρακας) που συνδέεται με ένα υδρογόνο, μια αμινομάδα, μια καρβοξυλομάδα και μια πλευρική αλυσίδα. Η αλυσίδα αυτή είναι που διαφοροποιεί τα αμινοξέα αλλάζοντας τις φυσικές και χημικές ιδιότητες και συνεπώς τη λειτουργικότητα του κάθε αμινοξέως. Έτσι, με βάση το φορτίο της πλευρικής αλυσίδας τα αμινοξέα διαχωρίζονται σε 4 κατηγορίες: τα όξινα (αρνητικό φορτίο), τα βασικά (θετικό φορτίο), τα αμινοξέα χωρίς φορτίο αλλά των οποίων η πλευρική αλυσίδα έχει 2 περιοχές με αντίθετο φορτίο (πολικά) και τέλος τα μη πολικά (τα οποία φυσικά δεν έχουν φορτίο). Όλα τα αμινοξέα όταν βρίσκονται ελεύθερα σε φυσιολογικές συνθήκες ph (και με τον όρο φυσιολογικές εννοούμε αυτές που επικρατούν μέσα σε ένα κύτταρο) έχουν τη αμινομάδα τους φορτισμένη θετικά και την καρβοξυλομάδα τους φορτισμένη αρνητικά, συμπεριφέρονται δηλ. σαν δίπολα. Αυτό επιτρέπει την εύκολη σύνδεση των αμινοξέων μεταξύ τους με πεπτιδικούς δεσμούς για το σχηματισμό πρωτεϊνών. Κατά την σύνδεση δύο αμινοξέων μεταξύ τους με πεπτιδικό δεσμό παράγεται ένα μόριο νερού. Το βασικότερο χαρακτηριστικό του πεπτιδικού δεσμού είναι ότι όλα τα άτομα που συμμετέχουν στο σχηματισμό του είναι υποχρεωμένα να βρίσκονται στο ίδιο επίπεδο, γεγονός που σημαίνει ότι τα αμινοξέα που βρίσκονται μέσα σε μια πρωτεΐνη δεν μπορούν να περιστραφούν γύρω από τον εαυτό τους και γενικά ότι έχουν περιορισμένο εύρος κινήσεων. Από τη στιγμή που ενσωματώνονται σε μια πρωτεΐνη και μετά τα μόνα φορτία που παραμένουν στα αμινοξέα είναι αυτά της πλευρικής αλυσίδας. Ωστόσο το αμινοτελικό και το καρβοξυτελικό άκρο της πρωτεΐνης (δηλ. η αμινομάδα του πρώτου αμινοξέως και η καρβοξυλομάδα του τελευταίου αμινοξέως) παραμένουν φορτισμένα με θετικό και αρνητικό φορτίο αντίστοιχα. Οι πρωτεΐνες είναι πολύπλοκα μόρια και αναπαριστώνται στο χαρτί από εξίσου πολύπλοκους χημικούς τύπους. Είναι ωστόσο εύκολο να βρούμε από πόσα αμινοξέα αποτελείται μία πρωτεΐνη μετρώντας τους α άνθρακές της. Για να ξεχωρίσουμε τους ά άνθρακες αναζητούμε εκείνα τα άτομα άνθρακα που συνδέονται από τη μια μεριά με ένα υδρογόνο και από την άλλη με μια πλευρική αλυσίδα. Περισσότερη ανάγνωση: Κεφ. 2 «Χημική σύσταση του κυττάρου» από Alberts, B., Bray, D., Johnson, A., Lewis, J., Raff, M., Roberts, K., et al. (2000). Βασικές Αρχές Κυτταρικής Βιολογίας: Εισαγωγή στη Μοριακή Βιολογία του Κυττάρου (Χ. Ζιούδρου, Μεταφ.). Αθήνα: Ιατρικές Εκδόσεις Π.Χ. Πασχαλίδη.

6 Ε Ι Σ Α Γ Ω Γ Η Σ Τ Ι Σ Σ Υ Γ Χ Ρ Ο Ν Ε Σ Β Ι Ο Λ Ο Γ Ι Κ Ε Σ Ε Π Ι Σ Τ Η ΜΕΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ (ΠΑΡΑΣΚΕΥΗ, 14 ΣΕΠΤΕΜΒΡΙΟΥ 2007) Τα 20 αμινοξέα που χρησιμοποιούνται για την σύνθεση των πρωτεϊνών είναι: Βασικά Όξινα Πολικά Μη πολικά Λυσίνη (Lys, K) Αργινίνη (Arg, R) Ιστιδίνη (His, H) Ασπαρτικό οξύ (Asp, D) Γλουταμικό οξύ (Glu, Ε) Ασπαραγίνη (Asn, N) Γλουταμίνη (Gln, Q) Σερίνη (Ser, S) Θρεονίνη (Thr, T) Τυροσίνη (Tyr, Y) Αλανίνη (Ala, A) Βαλίνη (Val, V) Λευκίνη (Leu, L) Ισολευκίνη (Ile, I) Προλίνη (Pro, P) Φαινυλαλανίνη (Phe, F) Μεθειονίνη (Met, M) Τρυπτοφάνη (Trp, W) Γλυκίνη (Gly, G) Κυστεΐνη (Cys, C) Άξια αναφοράς είναι η ύπαρξη ενός ατόμου θείου (S) στο μόριο της κυστεΐνης το οποίο επιτρέπει τη δημιουργία δισουλφιδικών δεσμών μεταξύ δύο κυστεϊνών. Όπως και στην περίπτωση των πρωτεϊνών, έτσι και για το γενετικό υλικό η φύση έχει επιλέξει τη στρατηγική της σύνθεσης πολύπλοκων μορίων από λίγα βασικά μόρια. Στην περίπτωση του γενετικού υλικού (δηλ. του DNA και του RNA) τα μόρια αυτά ονομάζονται νουκλεοτίδια. Τα νουκλεοτίδια έχουν μια απλή χημική δομή που αποτελείται από ένα σάκχαρο με 5 άτομα άνθρακα (πεντόζη) και ένα αζωτούχο δακτύλιο (βάση) που συνδέονται μαζί τους με ένα γλυκοσιδικό δεσμό καθώς και 1 3 φωσφορικές ομάδες. Στο σχηματισμό του DNA συμμετέχουν διαφορετικά σάκχαρα από αυτά του RNA. Έτσι στο DNA χρησιμοποιούνται νουκλεοτίδια που περιέχουν δεοξυριβόζη, ενώ στο RNA ριβόζη. Η διαφορά των δύο σακχάρων βρίσκεται στο 2 άτομο της ανθρακικής αλυσίδας που στην μεν ριβόζη συνδέεται με 2 άτομα υδρογόνου ενώ στη ριβόζη με ένα υδρογόνο και ένα υδροξύλιο. Ενώ όμως τον τύπο του γενετικού υλικού τον καθορίζει το σάκχαρο, τις ιδιότητες του νουκλεοτιδίου τις καθορίζει η αζωτούχος βάση που χρησιμοποιείται. Οι αζωτούχες βάσεις διακρίνονται σε δύο κατηγορίες της πουρίνες που περιέχουν 2 α ρωματικούς δακτύλιους και τις πυριμιδίνες που περιέχουν ένα αρωματικό δακτύλιο. Η αδενίνη, η γουανίνη και η κυτοσίνη χρησιμοποιούνται τόσο από το DNA όσο και από το RNA, ενώ η θυμίνη και η ουρακίλη μόνο από το DNA και το RNA αντίστοιχα. Συνεπώς τα δύο μόρια που μπορούν να χρησιμοποιηθούν ως γενετικό υλικό διαφέρουν τόσο στα σάκχαρα όσο και στις βάσεις που περιέχουν. Επιπλέον, η μεγάλη δραστικότητα τόσο του υδροξυλίου της ριβόζης όσο και της ουρακίλης έ χουν ως αποτέλεσμα την εξαιρετική αστάθεια του RNA, ειδικά εκτός του κυττάρου, σε αντί

7 θεση με το DNA που είναι πάρα πολύ σταθερό και μπορεί να διατηρηθεί ακόμα και για χιλιάδες χρόνια κάτω από τις κατάλληλες συνθήκες (π.χ. ζώα θαμμένα σε παγετώνες). Προκείμενου να σχηματιστούν τα νουκλεϊκά οξέα, τα διάφορα νουκλεοτίδια συνδέονται μεταξύ τους με φωσφοδιεστερικούς δεσμούς και πάντοτε με κατεύθυνση 5 προς 3. Η ε νέργεια που απαιτείται για την δημιουργία του φωσφοδιεστερικού δεσμού προέρχεται από τη διάσπαση ενός νουκλεοτιδίου, του ATP, σε ADP. Είναι φανερό λοιπόν ότι τα νουκλεοτίδια δεν έχουν ως μόνο ρόλο τη σύνθεση του γενετικού υλικού αφού το κύτταρο τα χρησιμοποιεί και για άλλους σκοπούς, όπως αυτός του ενεργειακού νομίσματος. Αυτό για άλλη μια φορά αποδεικνύει την οικονομία που εφαρμόζει η φύση, επιμένοντας να χρησιμοποιεί όσον το δυνατό λιγότερα και απλούστερα υλικά μπορεί για να εκπληρώνει όλες τις διαδικασίες της ζωής. Με βάση τα παραπάνω λοιπόν τα νουκλεϊκά οξέα, όπως και οι πρωτεΐνες, έχουν δύο άκρα και πρέπει πάντοτε να γράφονται με τη σωστή κατεύθυνση. Ένας εύκολος τρόπος να γράψουμε (ή να αποθηκεύσουμε στον υπολογιστή) ένα μόριο DNA είναι χρησιμοποιώντας τις συντμήσεις A, C, T, G. Έτσι όταν γράφουμε AGGCCT εννοούμε ένα μόριο DNA που αποτελείται από μια αδενίνη, 2 γουανίνες, 2 κυτοσίνες και 1 θυμίνη. ΟΝΟΜΑΤΟΛΟΓΙΑ ΤΩΝ ΝΟΥΚΛΕΟΤΙΔΙΩΝ Τα νουκλεοτίδια ονομάζονται με ένα μικρό και τρία κεφαλαία γράμματα ανάλογα με: α) το σάκχαρο, β) την αζωτούχο βάση και γ) των αριθμό των φωσφορικών ομάδων περιέχουν. Παραδείγματα νουκλεοτιδίων αποτελούν τα: AMP = Adenosine monophosphate (Μονοφωσφορική Αδενοσίνη) damp = deoxyadenosine monophosphate (Μονοφωσφορική δεοξυαδενοσίνη) UDP = Uridine diphosphate (Διφωσφορική ουραδίνη) ATP = adenosine triphosphate (Τριφωσφορική αδενοσίνη) Περισσότερη ανάγνωση: Κεφ. 2 «Χημική σύσταση του κυττάρου» από Alberts, B., Bray, D., Johnson, A., Lewis, J., Raff, M., Roberts, K., et al. (2000). Βασικές Αρχές Κυτταρικής Βιολογίας: Εισαγωγή στη Μοριακή Βιολογία του Κυττάρου (Χ. Ζιούδρου, Μεταφ.). Αθήνα: Ιατρικές Εκδόσεις Π.Χ. Πασχαλίδη.

8 Ε Ι Σ Α Γ Ω Γ Η Σ Τ Ι Σ Σ Υ Γ Χ Ρ Ο Ν Ε Σ Β Ι Ο Λ Ο Γ Ι Κ Ε Σ Ε Π Ι Σ Τ Η Μ Ε Σ ΤΟ ΣΧΗΜΑ, Η ΔΟΜΗ ΚΑΙ Ο ΤΡΟΠΟΣ ΛΕΙΤΟΥΡΓΙΑΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ (Ι) (ΤΡΙΤΗ, 18 ΣΕΠΤΕΜΒΡΙΟΥ 2007) ΤΟ ΤΕΛΙΚΟ ΣΧΗΜΑ ΜΙΑΣ ΠΡΩΤΕΪΝΗΣ ΚΑΘΟΡΙΖΕΤΑΙ ΑΠΟ ΤΗΝ ΑΛΛΗΛΟΥΧΙΑ ΤΩΝ ΑΜΙΝΟΞΕΩΝ ΤΗΣ Έχουμε ήδη αναφέρει ότι ένας απλός και οικονομικός τρόπος για να δείξουμε και να αποθηκεύσουμε τη σύσταση μιας πρωτεΐνης είναι να την γράψουμε σαν μια μεγάλη λέξη χρησιμοποιώντας ένα αλφάβητο 20 γραμμάτων (όσα είναι δηλ. τα αμινοξέα). Ωστόσο, αυτός ο τρόπος απεικόνισης μας δίνει πληροφορίες μόνο για την αλληλουχία των αμινοξέων της πρωτεΐνης (πρωτοταγής δομή) και όχι για το τελικό σχήμα της. Αυτό συμβαίνει γιατί οι πρωτεΐνες είναι τρισδιάστατα αντικείμενα το τελικό σχήμα των οποίων στο χώρο ονομάζεται τριτοταγής δομή. Επιπρόσθετα, αν και είναι σχετικά εύκολο να βρούμε την πρωτοταγή δομή μιας πρωτεΐνης είναι πολύ δυσκολότερο να κάνουμε το ίδιο για την τριτοταγή δομή, κάτι που επιτυγχάνεται μόνο με την χρήση δαπανηρών και πολύπλοκων τεχνικών όπως είναι η κρυσταλλογραφία ακτίνων Χ. Τι είναι όμως αυτό που καθορίζει το τελικό σχήμα μιας πρωτεΐνης στο χώρο; Οφείλεται αποκλειστικά στα αμινοξέα που περιέχει η μήπως παίζουν ρόλο και κάποιοι άλλοι παράγοντες (π.χ. υπάρχουν κάποια μόρια τα οποία διπλώνουν τις πρωτεΐνες με ένα καθορισμένο τρόπο); Στην ερώτηση αυτή δόθηκε απάντηση με το εξής απλό πείραμα: Αν βάλουμε μια πρωτεΐνη μέσα σε ένα πυκνό διάλυμα ουρίας τότε η πρωτεΐνη αυτή χάνει το σχήμα της, δηλ. μετουσιώνεται. Η λογική λέει πως αν το τελικό σχήμα καθορίζεται και από άλλους παράγοντες εκτός της πρωτοταγούς δομής, τότε αν αφαιρέσουμε την πρωτεΐνη από την ουρία και την εισάγουμε σε καθαρό νερό δεν θα αποκτήσει το αρχικό της σχήμα. Το πείραμα όμως έδειξε ότι τελικά η μετουσιωμένη πρωτεΐνη αποκτά το αρχικό της σχήμα. Επιπλέον, άλλα πειράματα έδειξαν ότι μικρές αλλαγές στη πρωτοταγή δομή (π.χ. αλλαγή στη σειρά των αμινοξέων) έχουν ως αποτέλεσμα αλλαγές στο τελικό σχήμα της πρωτεΐνης. Τα παραπάνω αποδεικνύουν ότι για το τελικό σχήμα μιας πρωτεΐνης στο χώρο αποκλειστικά υπεύθυνη είναι η αλληλουχία των αμινοξέων της. ΙΔΙΟΤΗΤΕΣ ΤΩΝ ΑΜΙΝΟΞΕΩΝ ΠΟΥ ΣΥΜΒΑΛΛΟΥΝ ΣΤΗ ΔΙΑΜΟΡΦΩΣΗ ΤΗΣ ΔΟΜΗΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ Το τελικό σχήμα μιας πρωτεΐνης επομένως καθορίζεται από τις φυσικές και χημικές ιδιότητες των αμινοξέων που την αποτελούν και κυρίως εξαιτίας των μεταξύ τους αλληλεπιδράσεων. Η σημαντικότερη αλληλεπίδραση μεταξύ των αμινοξέων μιας πρωτεΐνης είναι ο πεπτιδικός δεσμός μιας και αυτός κρατά τα αμινοξέα ενωμένα μεταξύ τους αποτρέποντας να αλλάξει η σειρά τους. Τα άτομα μιας πρωτεΐνης που συμμετέχουν στο σχηματισμό πεπτιδικών δεσμών σχηματίζουν τον πολυπεπτιδικό σκελετό. Υπό αυτή την έννοια η πρωτεΐνη θα μπορούσε να θεωρηθεί ως ένας πολυπεπτιδικός σκελετός πάνω στον οποίο αναρτούνται οι πλευρικές αλυσίδες. Επιπλέον, ο πεπτιδικός δεσμός εγκλωβίζει τα άτομα που συμμετέχουν σε αυτόν σε ένα επίπεδο και με τον τρόπο αυτό περιορίζει την κίνηση τους και άρα τις πιθανές διαμορφώσεις που μπορεί να αποκτήσει η πρωτεΐνη. Σε αντίθεση με αυτά τα άτομα, ο α ανθρακας (και επομένως οι πλευρικές αλυσίδες) έχουν μια σχεδόν πλήρη ελευθερία κινήσεων που περιορίζεται μόνο από το μέγεθος της κάθε πλευρικής αλυσίδας. Όταν λοιπόν συντίθεται μια πρωτεΐνη οι πλευρικές αλυσίδες των αμινοξέων αλληλεπιδρούν μεταξύ τους οδηγώντας στο τελικό σχήμα του μορίου. Οι αλληλεπιδράσεις αυτές έχουν την μορφή ασθενών έλξεων και απωθήσεων μεταξύ ατόμων τόσο του πολυπεπτιδικού σκελετού όσο και των πλευρικών

9 αλυσίδων και ονομάζονται μη ομοιοπολικοί δεσμοί. Οι βασικότεροι από αυτούς τους δεσμούς φαίνονται στο παρακάτω σχήμα. Υδρόφοβες αλληλεπιδράσ εις Σχηματίζονται μεταξύ μη πολικών αμινοξέων Ουσιαστικά τα αμινοξέα αναγκάζονται να έρθουν σε επαφή επειδή αποστρέφονται το νερό (εξού και το όνομα) Σχεδόν πάντα τα υδρόφοβα αμινοξέα βρισκονται στο εσωτερικό μιας πρωτεΐνης (δεδομένου ότι μόνο εκεί δεν υπάρχει νερό) Πρόκειται για απωθητικές δυνάμεις, σε αντίθεση με όλους τους υπόλοιπους δεσμούς που οφείλονται σε ελκτικές δυνάμεις Ιοντικός δεσμός Έλξη αντίθετων φορτίων Δημιουργείται συνήθως μεταξύ των πλευρικών αλυσιδών δύο φορτισμένων αμινοξέων Είναι ο ισχυρότερος από τους μη ομοιοπολικούς δεσμούς, μετά τις υδρόφοβες αλληλεπιδράσεις που υπερτερούν λόγω του τεράστιου αριθμού μορίων νερού που υπάρχουν στο κύτταρο Δεσμός Υδρογόνου Σχηματίζονται όταν ένα άτομο υδρογόνου (Η) παρεμβάλεται μεταξύ δύο ατόμων που έχουν την ικανότητα να προσελκύουν ηλεκτρόνια όπως το οξυγόνο (Ο) ή το άζωτο (Ν) Είναι σύνηθες να σχηματίζονται μεταξύ ενός Ο και ενός Η δύο πεπτιδικών δεσμών Έλξεις van der Waals Σχηματίζονται όταν δύο οποιαδήποτε άτομα βρίσκονται πολύ κοντά Είναι πολυ κοινές μεταξύ των αμινοξέων με αρωματικό χαρακτήρα Είναι οι ασθενέστεροι απο όλους τους δεσμούς, αλλά αποκτούν μεγάλη σημασία όταν οι επιφάνειες δύο μεγάλων μορίων ή πλευρικών αλυσιδών εφαρμόσουν πολύ καλά μεταξύ τους Τέλος, εκτός των παραπάνω μη ομοιοπολικών δεσμών, μπορούν να σχηματιστούν και σιδουλφιδρυλικοί δεσμοί. Οι δεσμοί αυτοί είναι ομοιοπολικοί και σχηματίζονται μόνο μεταξύ των ατόμων θείου (S) δύο κυστεϊνών και για το λόγο αυτό ονομάζονται και γέφυρες θείου. Εξαιτίας του ομοιοπολικού τους χαρακτήρα είναι πολύ ισχυροί και μπορούν να επηρεάσουν καθοριστικά το τελικό σχήμα μιας πρωτεΐνης. ΠΡΟΒΛΕΨΗ ΤΗΣ ΤΡΙΤΟΤΑΓΟΥΣ ΔΟΜΗΣ ΜΙΑΣ ΠΡΩΤΕΪΝΗΣ Με βάση όλα τα παραπάνω, θα μπορούσε να υποθέσει κανείς ότι αφού γνωρίζουμε όλες τους τύπους αλληλεπιδράσεων μεταξύ των αμινοξέων θα μπορούμε να προβλέψουμε και την τριτοταγή δομή γνωρίζοντας μόνο την πρωτοταγή. Στην πραγματικότητα ωστόσο συμβαίνει το αντίθετο: σήμερα δεν υπάρχει επιστήμονας ή τεχνική που να μπορεί να προβλέψει με ακρίβεια την τελική διαμόρφωση μιας πρωτεΐνης με βάση την αλληλουχία των αμινοξέων της. Αυτό οφείλεται κυρίως στην έλλειψη γνώσης σχετικά με αυτές τις αλληλεπιδράσεις στο μικροσκοπικό επίπεδο αλλά και τον τεράστιο αριθμό πιθανών αλληλεπιδράσεων που μπορούν να σχηματιστούν μεταξύ των αμινοξέων μιας πρωτεΐνης. Η φύση όμως τα καταφέρνει πολύ καλύτερα από εμάς μιας και η διαδικασία της αναδίπλωσης μιας πρωτεΐνης στο χώρο είναι εξαιρετικά γρήγορη (της τάξης των 0, δευτερολέπτων) και κάτω από ίδιες συνθήκες δίνει πάντα το ίδιο αποτέλεσμα.

10 Είναι φανερό λοιπόν ότι για άλλη μια φορά η ζωή καταφέρνει να χρησιμοποιεί τους οικονομικότερους και αποτελεσματικότερους φυσικούς και χημικούς μηχανισμούς τόσο για την αποθήκευση της πληροφορίας όσο και για τη δημιουργία των προϊόντων της. ΠΕΡΙΣΣΟΤΕΡΗ ΑΝΑΓΝΩΣΗ Κεφ. 5 «Δομή και λειτουργία των πρωτεϊνών» από Alberts, B., Bray, D., Johnson, A., Lewis, J., Raff, M., Roberts, K., et al. (2000). Βασικές Αρχές Κυτταρικής Βιολογίας: Εισαγωγή στη Μοριακή Βιολογία του Κυττάρου (Χ. Ζιούδρου, Μεταφ.). Αθήνα: Ιατρικές Εκδόσεις Π.Χ. Πασχαλίδη. ΠΡΟΑΙΡΕΤΙΚΗ ΑΝΑΓΝΩΣΗ (ΣΤΑ ΑΓΓΛΙΚΑ) Θεμά Πρωτοταγής δομή Τριτοταγής δομή Κρυσταλλογραφία ακτινών Χ Πεπτιδικός δεσμός Ομοιοπολικός δεσμός Μη ομοιοπολικοί δεσμοί Πρόβλεψη τριτοταγούς δομής Αρωματικός χαρακτήρας χημικών ενώσεων Πηγή ray_crystallography

11 Ε Ι Σ Α Γ Ω Γ Η Σ Τ Ι Σ Σ Υ Γ Χ Ρ Ο Ν Ε Σ Β Ι Ο Λ Ο Γ Ι Κ Ε Σ Ε Π Ι Σ Τ Η Μ Ε Σ ΤΟ ΣΧΗΜΑ, Η ΔΟΜΗ ΚΑΙ Ο ΤΡΟΠΟΣ ΛΕΙΤΟΥΡΓΙΑΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ(ΙΙ) (ΠΑΡΑΣΚΕΥΗ, 21 ΣΕΠΤΕΜΒΡΙΟΥ 2007) ΕΠΙΠΕΔΑ ΟΡΓΑΝΩΣΗΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ Ακόμα και η μικρότερη πρωτεΐνη είναι ένα πολύπλοκο μόριο. Αν και οι πρωτεΐνες απαντιούνται στην φύση μόνο στην τελική τρισδιάστατη διαμόρφωσή τους είναι βολικό να διακρίνουμε κάποια επίπεδα οργάνωσης τους προκειμένου να διευκολύνουμε τη παρατήρηση και τη κατανόηση της δομής και λειτουργίας (βλ. σχήμα). Αυτά τα επίπεδα οργάνωσης τα απεικονίζουμε και εξετάζουμε με τη χρήση προγραμμάτων ηλεκτρονικού υπολογιστή. Το πρώτο και βασικό επίπεδο είναι αυτό της αμινοξικής αλληλουχίας (πρωτοταγής δομή). Το συντριπτικά μεγαλύτερο ποσοστό της πληροφορίας που διαθέτουμε για τις πρωτεΐνες αφορά τη πρωτοταγή τους δομή μιας και αυτή μπορεί να βρεθεί εύκολα από τη μετάφραση του γενετικού υλικού ενός οργανισμού. Ακολουθεί η δευτεροταγής δομή που περιγράφει τα τμήματα εκείνα της πολυπεπτιδικής αλυσίδας που σχηματίζουν γνωστά δομικά μοτίβα όπως οι α έλικες και τα β πτυχωτά φύλλα. Τέλος το τρισδιάστατο σχήμα μιας πρωτεΐνης περιγράφεται με τη χρήση της τριτοταγούς (αν αποτελείται από μια μόνο πολυπεπτιδική αλυσίδα) ή της τεταρτοταγούς δομής (αν πρόκειται για σύμπλοκο). Τεταρτοταγής δομή Τριτοταγής δομή Δευτεροταγής δομή Πρωτοταγής δομή Η τρισδιάστατη διαμόρφωση ενός συμπλόκου πολυπεπτιδικών αλυσίδων Προκύπτει με τη χρήση κρυσταλλογραφικών τεχνικών Η τρισδιάστατη διαμόρφωση μιας πολυπεπτιδικής αλυσίδας Προκύπτει με τη χρήση κρυσταλλογραφικών τεχνικών Τμήματα της πολυπεπτιδικής αλυσίδας που σχηματίζουν α έλικες και β πτυχωτά φύλλα Προκύπτει από την τρισδιάστατη δομή ή από τη πρωτοταγή δομή με τη χρήση ειδικών λογισμικών Αμινοξική αλληλουχία Προκύπτει εύκολα από τη μετάφραση του γενετικού υλικού Ανώτατο Κατώτατο Επίπεδα οργάνωσης των πρωτεϊνών

12 Αναφέραμε ήδη ότι τα βασικά δομικά μοτίβα που σχηματίζουν οι αμινοξικές ακολουθίες είναι οι α έλικες και τα β πτυχωτά φύλλα. Όπως φανερώνει και το όνομά της η α έλικα έχει τη μορφή μιας σπείρας. Δηλαδή οι ιδιότητες των αμινοξέων του συγκεκριμένου τμήματος του πολυπεπτιδικού σκελετού τον αναγκάζουν να περιστραφεί γύρω από το διαμήκη άξονά του. Τα β πτυχωτά φύλλα θα μπορούσαν να παρομοιαστούν με ένα επίπεδο πάνω στο οποίο διατάσσονται τα αμινοξέα του πεπτιδικού σκελετού. Τα συστατικά του β πτυχωτού φύλλου ονομάζονται β κλώνοι και μπορούν να έχουν ίδια ή αντίστροφη κατεύθυνση σχηματίζοντας, αντίστοιχα, παράλληλα ή αντιπαράλληλα β πτυχωτά φύλλα. Οι διάφορες δευτεροταγές δομές συνδυάζονται σε πολλαπλά επίπεδα για να σχηματίσουν τελικά την τριτοταγή ή τεταρτοταγή δομή μιας πρωτεΐνης. Από τα παραπάνω προκύπτει εύκολα ότι αν έχουμε την τρισδιάστατη δομή μιας πρωτεΐνης τότε μπορούμε να βρούμε και τη δευτεροταγή της δομή. Κάτι τέτοιο ωστόσο δεν είναι και πολύ βολικό μιας και είναι πολύ δύσκολο να λυθεί η τριτοταγής ή τεταρτοταγής δομή μιας πρωτεΐνης. Για το λόγο αυτό έχουν αναπτυχθεί λογισμικά τα οποία προβλέπουν με μεγάλη ακρίβεια τη δευτεροταγή δομή από την αμινοξική αλληλουχία. ΣΗΜΑΣΙΑ ΤΟΥ ΤΕΛΙΚΟΥ ΣΧΗΜΑΤΟΣ ΜΙΑΣ ΠΡΩΤΕΪΝΗΣ Αν υποθέσουμε ότι μια πρωτεΐνη αποτελείται από n αμινοξέα τότε μπορούν να σχηματιστούν 20 n διαφορετικές πολυπεπτιδικές αλυσίδες. Στην περίπτωση μιας πρωτεΐνης μέσου μήκους (π.χ. 300 αμινοξέων) οι πιθανές πολυπεπτιδικές αλυσίδες είναι δηλ περισσότερες από τα άτομα του σύμπαντος!!! Ο αριθμός αυτός γίνεται ακόμα μεγαλύτερος αν μιλήσουμε για την τελική τρισδιάστατη δομή γιατί πρέπει να συνυπολογίσουμε τις πιθανές αλληλεπιδράσεις μεταξύ των αμινοξέων της κάθε μιας από τις πολυπεπτιδικές αλυσίδες. Αυτός είναι και ο βασικός λόγος που δεν μπορούμε να προβλέψουμε με σιγουριά την τελική τρισδιάστατη δομή μιας πρωτεΐνης με τη χρήση λογισμικών. Ωστόσο η φύση καταφέρνει και κατασκευάζει πάντα τις ίδιες πρωτεΐνες, με το ίδιο τελικό σχήμα και την ίδια ακριβώς λειτουργία. Πως το καταφέρνει κάτι τέτοιο; Ο μηχανισμός που χρησιμοποιεί είναι και πάλι η εξέλιξη. Μέσω της εξέλιξης η φύση έχει απορρίψει όλες εκείνες τις πρωτεΐνες που δεν μπορούν να πάρουν μια μοναδική και σταθερή διαμόρφωση και κρατά μόνο εκείνες των οποίων η αμινοξική αλληλουχία εξασφαλίζει μια μοναδική και εξαιρετικά σταθερή διαμόρφωση η οποία δίνει στην πρωτεΐνη τη δυνατότητα να διεκπεραιώσει μια συγκεκριμένη δομική η καταλυτική λειτουργία στο κύτταρο. Όπως ήδη αναφέραμε μια πρωτεΐνη μπορεί να αποτελείται από μια ή περισσότερες πολυπεπτιδικές αλυσίδες. Στην τελευταία περίπτωση μιλάμε για πρωτεΐνες σύμπλοκα η οποίες είναι εξίσου κοινές με τις «απλές» πρωτεΐνες. Για να σχηματιστεί ένα πρωτεϊνικό σύμπλοκο το κύτταρο παράγει κάθε πολυπεπτιδική αλυσίδα ξεχωριστά και μετά τις ενώνει εκμεταλλευόμενο τη δημιουργία μηομοιοπολικών δεσμών μεταξύ αμινοξέων ή δευτεροταγών δομών των διαφόρων αλυσίδων. Ένα κλασικό παράδειγμα πρωτεϊνικού συμπλόκου είναι η αιμοσφαιρίνη, η πρωτεΐνη των ερυθροκυττάρων (ερυθρά αιμοσφαίρια) που είναι υπεύθυνη για τη δέσμευση και τη μεταφορά οξυγόνου. Η αιμοσφαιρίνη αποτελείται από δυο πρωτεϊνικές υπομονάδες α σφαρίνης και δύο β σφαιρίνης οι οποίες διατάσσονται συμμετρικά. Η κάθε υπομονάδα σφαιρίνης συνδέεται με ένα μόριο αίμης που με τη σειρά του περιέχει ένα άτομο σιδήρου. Ο σίδηρος είναι αυτός που δεσμεύει το οξυγόνο αλλά και αυτός που δίνει το χαρακτηριστικό κόκκινο χρώμα στο αίμα. Είτε πρόκειται για πρωτεϊνικό σύμπλοκο ή όχι, αυτό που στο τέλος καθορίζει με ποια μόρια είναι ικανή να συνδεθεί και να αλληλεπιδράσει μια πρωτεΐνη είναι η συνολική της διαμόρφωση. Όπως ακριβώς μια κλειδαρότρυπα δέχεται μόνο ένα συγκεκριμένο κλειδί έτσι και μια πρωτεΐνη δεν αλληλεπιδρά με όλα τα μόρια αλλά μόνο με αυτά ή αυτό που είναι σχεδιασμένη να αλληλεπιδρά. Από τη στιγμή που επιστήμονες συνειδητοποίησαν το μηχανισμό πίσω από την εξειδίκευση των πρωτεϊνών άρχισαν να κατασκευάζουν φάρμακα τα οποία εκμεταλλευόντουσαν αυτό το μηχανισμό. Έτσι, σήμερα, πάρα πολλά φάρμακα είναι ουσίες που μιμούνται τους υποκατάστατες μιας πρωτεΐνης ξεγελώντας την και κάνοντας την να συνδεθεί μαζί τους. Τα φάρμακα αυτά είναι πολλές φορές σχεδιασμένα με τέτοιο τρόπο ώστε να αποσυνδέονται πολύ δύσκολα από την πρωτεΐνη στόχο, απενεργο

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ MAΘΗΜΑ 4 ο AMIΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ Αλανίνη (Αla) Αλανυλοσερίνη (Αla-Ser) Αλβουµίνη ρα. Κουκουλίτσα Αικατερίνη Χηµικός Εργαστηριακός Συνεργάτης Τ.Ε.Ι Αθήνας ckoukoul@teiath.gr AMIΞΕΑ 2 λειτουργικές οµάδες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΑΠΕΙΚΟΝΙΣΗ ΜΟΡΙΑΚΩΝ ΔΟΜΩΝ ΜΟΡΙΑΚΑ ΜΟΝΤΕΛΑ 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING) 1: ΧΩΡΟΠΛΗΡΩΤΙΚΟ ΜΟΝΤΕΛΟ (SPACE-FILLING)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα