1 ο Φροντιστήριο Υπολογιστική Νοημοσύνη 2

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "1 ο Φροντιστήριο Υπολογιστική Νοημοσύνη 2"

Transcript

1 1 ο Φροντιστήριο Υπολογιστική Νοημοσύνη 2

2

3

4

5

6 Άσκηση Δίνεται ο αρχικός πληθυσμός, στην 1 η στήλη στον παρακάτω πίνακα και οι αντίστοιχες καταλληλότητες (στήλη 2). Υποθέστε ότι, το ζητούμενο είναι η μεγιστοποίηση της καταλληλότητας. Η πιθανότητα διασταύρωσης είναι 0.8 και η πιθανότητα μετάλλαξης 0.1. Τα ζευγάρια προς διασταύρωση σχηματίζονται με βάση τη σειρά επιλογής. Πριν τον προσδιορισμό του σημείου διασταύρωσης, γίνεται έλεγχος αν όντως το ζευγάρι θα διασταυρωθεί. Αρχικός Πληθυσμός Καταλληλότητα Καταλληλότητα (μετασχ/σμένη) Νέος Πληθυσμός Αν χρειαστείτε τυχαίους αριθμούς, χρησιμοποιείστε τους παρακάτω, με τη σειρά που δίνονται: 0.86, 0.59, 0.67, 0.14, 0.34, 0.08, 0.11, 0.29, 0.85, 0.76, 0.43, 0.47, 0.89, 0.80, 0.98, 0.58, 0.03, 0.57, 0.49, 0.92 Επαναλάβετε από την αρχή, αν χρειαστείτε περισσότερους. 1. Στη στήλη 3 του πίνακα, δίνονται οι μετασχηματισμένες καταλληλότητες, του αρχικού πληθυσμού. Τι μετασχηματισμός έχει γίνει; Να αιτιολογήσετε (σε 2-3 σειρές) τι χρειάζεται. Για να μπορέσουμε να βρούμε την συσσωρευμένη πιθανότητα κάθε ατόμου του πληθυσμού, θα πρέπει να μετατοπίσουμε τις τιμές καταλληλότητας έτσι ώστε να έχουν όλες θετικές τιμές. Επιλέγουμε να προσθέσουμε τον αριθμό 21 (επειδή όταν f(x)<0, τότε ορίζουμε g(x): max g(x) = max (f(x) +C), (σελ. 62 του Γ τόμου) σε όλα τα άτομα του πληθυσμού, έτσι ώστε να μην μεγαλώσει πολύ το εύρος τιμών και να διατηρηθεί η

7 ποιότητα της διαφοράς μεταξύ των ατόμων του πληθυσμού. Έτσι έχουμε: 2. Να υπολογίσετε την επόμενη γενιά, που προκύπτει από μία επανάληψη του Γ.Α., χρησιμοποιώντας τις νέες καταλληλότητες. Βρίσκουμε την συνολική καταλληλότητα του πληθυσμού: = 131 Άρα η πιθανότητα επιλογής κάθε ατόμου του πληθυσμού είναι η παρακάτω: P A = 25/131 = P Β = 11/131 = P Γ = 15/131 = P Δ = 22/131 = P Ε = 16/131 = P Ζ = 42/131 = Οι αντίστοιχες αθροιστικές πιθανότητες είναι: q Α=0.191 q Β= q Γ= q Δ= q Ε= q Ζ= 1

8 Επιλέγουμε τα άτομα που θα περάσουν στον επόμενο (προσωρινό) πληθυσμό χρησιμοποιώντας τους έξι πρώτους τυχαίους αριθμούς που μας έχουν δοθεί: Έχουμε: 0.672< 0.86 < 1 οπότε επιλέγεται το Ζ < 0.59 < οπότε επιλέγεται το Ε < 0.67 < οπότε επιλέγεται το Ε 0 < 0.14 < οπότε επιλέγεται το Α < 0.34 < οπότε επιλέγεται το Γ 0 < 0.08 < οπότε επιλέγεται το Α Άρα ο προσωρινός πληθυσμός είναι ο εξής: Ζ= Ε= Ε= Α= Γ= Α= Και τα ζευγάρια που προέκυψαν για διασταύρωση είναι τα εξής: Ζ= Ε= Ε= Α= Γ=

9 Α= Παίρνουμε το πρώτο ζευγάρι. Η πιθανότητα διασταύρωσης είναι 0.8. Ο επόμενος τυχαίος αριθμός είναι το 0.11 <0.8 οπότε θα πραγματοποιηθεί διασταύρωση. Μας απομένει τώρα να προσδιοριστεί το σημείο διασταύρωσης. Υποθέτουμε ότι όλα τα ψηφία είναι ισοπίθανα να επιλεχθούν σαν σημεία διασταύρωσης. Ο επόμενος τυχαίος αριθμός είναι το άρα το σημείο διασταύρωσης είναι μετά το τρίτο ψηφίο. Έτσι : όπου η κάθετη γραμμή ( ) δηλώνει το σημείο διασταύρωσης. Οι απόγονοι που προκύπτουν είναι οι: Κάνουμε την ίδια εργασία και για το δεύτερο ζευγάρι. Ο επόμενος τυχαίος αριθμός είναι ο 0.85 > 0.8 οπότε δεν θα πραγματοποιηθεί διασταύρωση στο δεύτερο ζευγάρι. Οπότε, προχωράμε στο τρίτο ζευγάρι. Ο επόμενος τυχαίος αριθμός είναι ο 0.76 < 0.8 οπότε θα πραγματοποιηθεί διασταύρωση στο τρίτο ζευγάρι. Ο επόμενος τυχαίος αριθμός είναι το 0.43 άρα το σημείο διασταύρωσης είναι μετά το τρίτο ψηφίο. Έτσι : όπου η κάθετη γραμμή ( ) δηλώνει το σημείο διασταύρωσης. Οι απόγονοι που προκύπτουν είναι οι: Ο προσωρινός πληθυσμός, μετά την διασταύρωση είναι ο παρακάτω: Α = Β = Γ = Δ =

10 Ε = Ζ = Μετάλλαξη Στην συνέχεια προχωράμε στον τελεστή μετάλλαξης. Θα χρησιμοποιήσουμε τους υπόλοιπους αριθμούς για κάθε ψηφίο (γονίδιο) των μελών του πληθυσμού προκειμένου να υπολογίσουμε τα ψηφία που θα υποστούν μετάλλαξη (ένα γονίδιο θα υποστεί μετάλλαξη όταν ο τυχαίος αριθμός που του αντιστοιχεί είναι μικρότερος του 0.1). Για το Α = οι τυχαίοι αριθμοί που αντιστοιχούν στα γονίδια του είναι: 0.47, 0.89, 0.80, 0.98, 0.58, 0.03, 0.57, 0.49, 0.92 Άρα, μόνο το έκτο ψηφίο θα υποστεί μετάλλαξη. Οπότε έχουμε Α = Για το Β = οι τυχαίοι αριθμοί που αντιστοιχούν στα γονίδια του είναι: 0.86, 0.59, 0.67, 0.14, 0.34, 0.08, 0.11, 0.29, 0.85, Άρα, μόνο το έκτο ψηφίο θα υποστεί μετάλλαξη. Οπότε έχουμε Β = Για το Γ = οι τυχαίοι αριθμοί που αντιστοιχούν στα γονίδια του είναι: 0.76, 0.43, 0.47, 0.89, 0.80, 0.98, 0.58, 0.03, 0.57, Άρα, μόνο το όγδοο ψηφίο θα υποστεί μετάλλαξη. Οπότε έχουμε Γ = Για το Δ = οι τυχαίοι αριθμοί που αντιστοιχούν στα γονίδια του είναι: 0.49, 0.92, 0.86, 0.59, 0.67, 0.14, 0.34, 0.08, 0.11, Άρα, μόνο το όγδοο ψηφίο θα υποστεί μετάλλαξη. Οπότε έχουμε Δ = Για το Ε = οι τυχαίοι αριθμοί που αντιστοιχούν στα γονίδια του είναι: 0.29, 0.85, 0.76, 0.43, 0.47, 0.89, 0.80, 0.98, 0.58 Άρα κανένα ψηφίο δεν θα υποστεί μετάλλαξη. Οπότε έχουμε Ε = Για το Ζ = οι τυχαίοι αριθμοί που αντιστοιχούν στα γονίδια του είναι:

11 0.03, 0.57, 0.49, 0.92, 0.86, 0.59, 0.67, 0.14, 0.34 Άρα, μόνο το πρώτο ψηφίο θα υποστεί μετάλλαξη. Οπότε έχουμε Ζ = Οπότε ο ζητούμενος πληθυσμός της γενεάς 1 όπως προέκυψε από τις διασταυρώσεις και τις μεταλλάξεις γίνεται: Α = Β = Γ = Δ = Ε = Ζ =

Γενετικοί Αλγόριθμοι. Εισαγωγή

Γενετικοί Αλγόριθμοι. Εισαγωγή Τεχνητή Νοημοσύνη 08 Γενετικοί Αλγόριθμοι (Genetic Algorithms) Εισαγωγή Σε αρκετές περιπτώσεις το μέγεθος ενός προβλήματος καθιστά απαγορευτική τη χρήση κλασικών μεθόδων αναζήτησης για την επίλυσή του.

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Ολοκλήρωση - Μέθοδος Monte Carlo

Ολοκλήρωση - Μέθοδος Monte Carlo ΦΥΣ 145 - Διαλ.09 Ολοκλήρωση - Μέθοδος Monte Carlo Χρησιμοποίηση τυχαίων αριθμών για επίλυση ολοκληρωμάτων Η μέθοδος Monte Carlo δίνει μια διαφορετική προσέγγιση για την επίλυση ενός ολοκληρώμτατος Τυχαίοι

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 ΔΙΑΤΑΞΕΙΣ, ΜΕΤΑΘΕΣΕΙΣ, ΣΥΝΔΥΑΣΜΟΙ

ΚΕΦΑΛΑΙΟ 2 ΔΙΑΤΑΞΕΙΣ, ΜΕΤΑΘΕΣΕΙΣ, ΣΥΝΔΥΑΣΜΟΙ ΚΕΦΑΛΑΙΟ ΔΙΑΤΑΞΕΙΣ ΜΕΤΑΘΕΣΕΙΣ ΣΥΝΔΥΑΣΜΟΙ Εισαγωγή. Οι σχηματισμοί που προκύπτουν με την επιλογή ενός συγκεκριμένου αριθμού στοιχείων από το ίδιο σύνολο καλούνται διατάξεις αν μας ενδιαφέρει η σειρά καταγραφή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2010 ΕΚΦΩΝΗΣΕΙΣ

ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2010 ΕΚΦΩΝΗΣΕΙΣ ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 00 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Α. Έστω t, t,..., t ν οι παρατηρήσεις µιας ποσοτικής µεταβλητής Χ ενός δείγµατος µεγέθους ν, που έχουν µέση τιµή x. Σχηµατίζουµε

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΣΤΑΤΙΣΤΙΚΗ ΤΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ. Κεφάλαιο 6. Πιθανότητες

ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΣΤΑΤΙΣΤΙΚΗ ΤΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ. Κεφάλαιο 6. Πιθανότητες ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ ΤΜΗΜΑ ΔΙΟΙΚΗΣΗΣ ΕΠΙΧΕΙΡΗΣΕΩΝ ΠΑΤΡΑΣ Εργαστήριο Λήψης Αποφάσεων & Επιχειρησιακού Προγραμματισμού Καθηγητής Ι. Μητρόπουλος ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΣΤΑΤΙΣΤΙΚΗ ΤΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 008 ΘΕΜΑ o ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ ΜΑΪΟΥ 008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

Διαβάστε περισσότερα

Τα παρακάτω σύνολα θα τα θεωρήσουμε γενικά γνωστά, αν και θα δούμε πολλές από τις ιδιότητές τους: N Z Q R C

Τα παρακάτω σύνολα θα τα θεωρήσουμε γενικά γνωστά, αν και θα δούμε πολλές από τις ιδιότητές τους: N Z Q R C Κεφάλαιο 1 Εισαγωγικές έννοιες Στο κεφάλαιο αυτό θα αναφερθούμε σε ορισμένες έννοιες, οι οποίες ίσως δεν έχουν άμεση σχέση με τους διανυσματικούς χώρους, όμως θα χρησιμοποιηθούν αρκετά κατά τη μελέτη τόσο

Διαβάστε περισσότερα

Μιχάλης Λάμπρου Νίκος Κ. Σπανουδάκης. τόμος 1. Καγκουρό Ελλάς

Μιχάλης Λάμπρου Νίκος Κ. Σπανουδάκης. τόμος 1. Καγκουρό Ελλάς Μιχάλης Λάμπρου Νίκος Κ. Σπανουδάκης τόμος Καγκουρό Ελλάς 0 007 (ο πρώτος αριθµός σε µια γραµµή αναφέρεται στη σελίδα που αρχίζει το άρθρο και ο δεύτερος στη σελίδα που περιέχει τις απαντήσεις) Πρόλογος

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ 5 ΠΕΡΙΟΔΩΝ ΗΜΕΡΟΜΗΝΙΑ: 8 ΙΟΥΝΙΟΥ 2009

ΜΑΘΗΜΑΤΙΚΑ 5 ΠΕΡΙΟΔΩΝ ΗΜΕΡΟΜΗΝΙΑ: 8 ΙΟΥΝΙΟΥ 2009 ΕΥΡΩΠΑΙΚΟ ΑΠΟΛΥΤΗΡΙΟ 2009 ΜΑΘΗΜΑΤΙΚΑ 5 ΠΕΡΙΟΔΩΝ ΗΜΕΡΟΜΗΝΙΑ: 8 ΙΟΥΝΙΟΥ 2009 ΔΙΑΡΚΕΙΑ ΕΞΕΤΑΣΗΣ: 4 ώρες (240 λεπτά) ΕΠΙΤΡΕΠΟΜΕΝΑ ΒΟΗΘΗΜΑΤΑ Ευρωπαικό τυπολόγιο Μη προγραμματιζόμενος υπολογιστής, χωρίς γραφικά

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2003

ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2003 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 00 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ ο Α Να αποδείξετε ότι η παράγωγος της συνάρτησης f(x) x είναι f (x) Β Πότε µια συνάρτηση f σε ένα διάστηµα

Διαβάστε περισσότερα

8ο Φροντιστηριο ΗΥ217

8ο Φροντιστηριο ΗΥ217 8ο Φροντιστηριο ΗΥ217 Επιµέλεια : Γ. Καφεντζής 10 Ιανουαρίου 2014 Ασκηση 0.1 Εστω ότι η τ.µ. X ακολουθεί Γκαουσιανή κατανοµή µε µέση τιµή 10 και διασπορά σ 2 = 4, δηλαδή X N( 10, 4). Να υπολογίσετε τις

Διαβάστε περισσότερα

Διακριτά Μαθηματικά. Απαρίθμηση: Εισαγωγικά στοιχεία Αρχή του Περιστεριώνα

Διακριτά Μαθηματικά. Απαρίθμηση: Εισαγωγικά στοιχεία Αρχή του Περιστεριώνα Διακριτά Μαθηματικά Απαρίθμηση: Εισαγωγικά στοιχεία Αρχή του Περιστεριώνα Συνδυαστική ανάλυση μελέτη της διάταξης αντικειμένων 17 ος αιώνας: συνδυαστικά ερωτήματα για τη μελέτη τυχερών παιχνιδιών Απαρίθμηση:

Διαβάστε περισσότερα

Είμαστε σίγουροι πως έχετε ακούσει πολλές φορές ότι τα παιδιά παίρνουν από 7 γενιές. Αυτό αποτέλεσε αφετηρία για την παρουσίαση μας με θέμα τη

Είμαστε σίγουροι πως έχετε ακούσει πολλές φορές ότι τα παιδιά παίρνουν από 7 γενιές. Αυτό αποτέλεσε αφετηρία για την παρουσίαση μας με θέμα τη Είμαστε σίγουροι πως έχετε ακούσει πολλές φορές ότι τα παιδιά παίρνουν από 7 γενιές. Αυτό αποτέλεσε αφετηρία για την παρουσίαση μας με θέμα τη κληρονομικότητα στον άνθρωπο. 1 Καταρχήν, η πρώτη επιστημονική

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 00 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΘΕΜΑ Α Α. Έστω t,t,...,t ν οι παρατηρήσεις μιας ποσοτικής μεταβλητής Χ ενός δείγματος μεγέθους ν,

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ 5 ΠΕΡΙΟΔΩΝ

ΜΑΘΗΜΑΤΙΚΑ 5 ΠΕΡΙΟΔΩΝ ΕΥΡΩΠΑΙΚΟ ΑΠΟΛΥΤΗΡΙΟ 010 ΜΑΘΗΜΑΤΙΚΑ 5 ΠΕΡΙΟΔΩΝ ΗΜΕΡΟΜΗΝΙΑ: 4 Ιουνίου 010 ΔΙΑΡΚΕΙΑ ΕΞΕΤΑΣΗΣ: 4 ώρες (40 λεπτά) ΕΠΙΤΡΕΠΟΜΕΝΑ ΒΟΗΘΗΜΑΤΑ Ευρωπαικό τυπολόγιο Μη προγραμματιζόμενος υπολογιστής, χωρίς γραφικά

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Απαντήσεις Λύσεις σε Θέματα από την Τράπεζα Θεμάτων. Μάθημα: Άλγεβρα Α Λυκείου

Απαντήσεις Λύσεις σε Θέματα από την Τράπεζα Θεμάτων. Μάθημα: Άλγεβρα Α Λυκείου Απαντήσεις Λύσεις σε Θέματα από την Τράπεζα Θεμάτων Μάθημα: Άλγεβρα Α Λυκείου Παρουσιάζουμε συνοπτικές λύσεις σε επιλεγμένα Θέματα («Θέμα 4ο») από την Τράπεζα θεμάτων. Το αρχείο αυτό τις επόμενες ημέρες

Διαβάστε περισσότερα

Στατιστική Ι-Θεωρητικές Κατανομές ΙΙ

Στατιστική Ι-Θεωρητικές Κατανομές ΙΙ Στατιστική Ι-Θεωρητικές Κατανομές ΙΙ Γεώργιος Κ. Τσιώτας Τμήμα Οικονομικών Επιστημών Σχολή Κοινωνικών Επιστημών Πανεπιστήμιο Κρήτης 12 Δεκεμβρίου 2012 Περιγραφή 1 Θεωρητικές Κατανομές ΙΙ Περιγραφή 1 Θεωρητικές

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ

ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ 3.1 Τυχαίοι αριθμοί Στην προσομοίωση διακριτών γεγονότων γίνεται χρήση ακολουθίας τυχαίων αριθμών στις περιπτώσεις που απαιτείται η δημιουργία στοχαστικών

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Α) Κριτήριο Προσδοκώμενης Χρηματικής Αξίας Expected Monetary Value (EMV)

Α) Κριτήριο Προσδοκώμενης Χρηματικής Αξίας Expected Monetary Value (EMV) 5. ΘΕΩΡΙΑ ΑΠΟΦΑΣΕΩΝ (Decision Analysis) Επιχειρήσεις, Οργανισμοί αλλά και μεμονωμένα άτομα αντιμετωπίζουν σχεδόν καθημερινά το δύσκολο πρόβλημα της λήψης αποφάσεων. Τα προβλήματα αυτά έχουν σαν αντικειμενικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

ÑÏÕËÁ ÌÁÊÑÇ. Εποµένως η συνάρτηση είναι γνησίως αύξουσα και άρα δεν έχει ακρότατα. δ. Με x 1 είναι

ÑÏÕËÁ ÌÁÊÑÇ. Εποµένως η συνάρτηση είναι γνησίως αύξουσα και άρα δεν έχει ακρότατα. δ. Με x 1 είναι ΘΕΜΑ ο Α.. Βλέπε σχολικό βιβλίο σελίδα 9.. Βλέπε σχολικό βιβλίο σελίδα 87. Β. Βλέπε σχολικό βιβλίο σελίδα 0. Γ. Σ, Σ, Σ, 4 Σ, Λ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑΤΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ ο α. Πρέπει x > 0,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΘΕΜΑ Α Α. Αν οι συναρτήσεις f, g είναι παραγωγίσιμες στο R, να αποδείξετε ότι (f() + g() )=f ()+g (), R Μονάδες 7 Α. Σε

Διαβάστε περισσότερα

ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ

ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ Ανάπτυξη Εφαρµογών σε Προγραµµατιστικό Περιβάλλον ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ κ ΙΑΓΩΝΙΣΜΑ Α ΘΕΜΑ 1 Α. Να γράψετε τους αριθµούς της στήλης Α και δίπλα το γράµµα της Στήλης Β που αντιστοιχεί

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 0 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΘΕΜΑ Α Α. Αν η συνάρτηση f είναι παραγωγίσιμη στο R και c σταθερός πραγματικός αριθμός, να αποδείξετε με τη χρήση του

Διαβάστε περισσότερα

Δίαυλος Πληροφορίας. Δρ. Α. Πολίτης

Δίαυλος Πληροφορίας. Δρ. Α. Πολίτης Δίαυλος Πληροφορίας Η λειτουργία του διαύλου πληροφορίας περιγράφεται από: Τον πίνακα διαύλου μαθηματική περιγραφή. Το διάγραμμα διάυλου παραστατικός τρόπος περιγραφής. Πίνακας Διαύλου Κατασκευάζεται με

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Ενδεικτικές ασκήσεις ΔΙΠ 50

Ενδεικτικές ασκήσεις ΔΙΠ 50 Ενδεικτικές ασκήσεις ΔΙΠ 50 Άσκηση 1 (άσκηση 1 1 ης εργασίας 2009-10) Σε ένα ράφι μιας βιβλιοθήκης τοποθετούνται με τυχαία σειρά 11 διαφορετικά βιβλία τεσσάρων θεματικών ενοτήτων. Πιο συγκεκριμένα, υπάρχουν

Διαβάστε περισσότερα

ΜΕ ΝΕΟ ΣΥΣΤΗΜΑ 2014 Θ ΕΩΡΙA 10

ΜΕ ΝΕΟ ΣΥΣΤΗΜΑ 2014 Θ ΕΩΡΙA 10 ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΑΛΓΕΒΡΑΣ Α ΛΥΚΕΙΟΥ ΜΕ ΝΕΟ ΣΥΣΤΗΜΑ 04 Θ ΕΩΡΙA 0 ΘΕΜΑ A Α Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στην κόλλα σας δίπλα στο γράμμα που αντιστοιχεί σε κάθε πρόταση τη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΦΥΣ 114 - Διαλ.01 1 Θεωρία - Πείραμα Μετρήσεις - Σφάλματα

ΦΥΣ 114 - Διαλ.01 1 Θεωρία - Πείραμα Μετρήσεις - Σφάλματα ΦΥΣ 114 - Διαλ.01 1 Θεωρία - Πείραμα Μετρήσεις - Σφάλματα q Θεωρία: Η απάντηση που ζητάτε είναι αποτέλεσμα μαθηματικών πράξεων και εφαρμογή τύπων. Το αποτέλεσμα είναι συγκεκριμένο q Πείραμα: Στηρίζεται

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Κεφάλαιο 5. Θεμελιώδη προβλήματα της Τοπογραφίας

Κεφάλαιο 5. Θεμελιώδη προβλήματα της Τοπογραφίας Κεφάλαιο 5 Θεμελιώδη προβλήματα της Τοπογραφίας ΚΕΦΑΛΑΙΟ 5. 5 Θεμελιώδη προβλήματα της Τοπογραφίας. Στο Κεφάλαιο αυτό περιέχονται: 5.1 Γωνία διεύθυνσης. 5. Πρώτο θεμελιώδες πρόβλημα. 5.3 εύτερο θεμελιώδες

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ. ΤΕΛΙΚΕΣ ΕΞΕΤΑΣΕΙΣ (Ημερομηνία, ώρα)

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ. ΤΕΛΙΚΕΣ ΕΞΕΤΑΣΕΙΣ (Ημερομηνία, ώρα) ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Πρόγραμμα Σπουδών Θεματική Ενότητα Διοίκηση Επιχειρήσεων & Οργανισμών ΔΕΟ 13 Ποσοτικές Μέθοδοι Ακαδημαϊκό Έτος 008-009 ΤΕΛΙΚΕΣ ΕΞΕΤΑΣΕΙΣ (Ημερομηνία, ώρα) Να απαντηθούν 5

Διαβάστε περισσότερα

Φροντιστήριο 9 Λύσεις

Φροντιστήριο 9 Λύσεις Άσκηση 1 Φροντιστήριο 9 Λύσεις Να κατασκευάσετε μια μηχανή Turing με δύο ταινίες η οποία να αποδέχεται στην πρώτη της ταινία μια οποιαδήποτε λέξη w {a,b} * και να γράφει τη λέξη w R στη δεύτερη της ταινία.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Α Πότε λέμε ότι η συνάρτηση είναι παραγωγίσιμη στο σημείο 0 του πεδίου ορισμού της; Α Αν οι συναρτήσεις και g είναι παραγωγίσιμες στο

Διαβάστε περισσότερα

Γνωστό: P (M) = 2 M = τρόποι επιλογής υποσυνόλου του M. Π.χ. M = {A, B, C} π. 1. Π.χ.

Γνωστό: P (M) = 2 M = τρόποι επιλογής υποσυνόλου του M. Π.χ. M = {A, B, C} π. 1. Π.χ. Παραδείγματα Απαρίθμησης Γνωστό: P (M 2 M τρόποι επιλογής υποσυνόλου του M Τεχνικές Απαρίθμησης Πχ M {A, B, C} P (M 2 3 8 #(Υποσυνόλων με 2 στοιχεία ( 3 2 3 #(Διατεταγμένων υποσυνόλων με 2 στοιχεία 3 2

Διαβάστε περισσότερα

Π Α Ν Ε Λ Λ Η Ν Ι Ε Σ 2 0 1 5 Μ Α Θ Η Μ Α Τ Ι Κ Α K A I Σ Τ Ο Ι Χ Ε Ι Α Σ Τ Α Τ Ι Σ Τ Ι Κ Η

Π Α Ν Ε Λ Λ Η Ν Ι Ε Σ 2 0 1 5 Μ Α Θ Η Μ Α Τ Ι Κ Α K A I Σ Τ Ο Ι Χ Ε Ι Α Σ Τ Α Τ Ι Σ Τ Ι Κ Η Π Α Ν Ε Λ Λ Η Ν Ι Ε Σ 0 Μ Α Θ Η Μ Α Τ Ι Κ Α K A I Σ Τ Ο Ι Χ Ε Ι Α Σ Τ Α Τ Ι Σ Τ Ι Κ Η Ε π ι μ ε λ ε ι α : Τ α κ η ς Τ σ α κ α λ α κ ο ς o ΘΕΜΑ Π α ν ε λ λ α δ ι κ ε ς Ε ξ ε τ α σ ε ι ς ( 0 ) A. Aν οι συναρτησεις

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥ ΩΝ ΠΛΗΡΟΦΟΡΙΚΗΣ

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥ ΩΝ ΠΛΗΡΟΦΟΡΙΚΗΣ Θεµατική Ενότητα ΠΡΟΓΡΑΜΜΑ ΣΠΟΥ ΩΝ ΠΛΗΡΟΦΟΡΙΚΗΣ Ακαδηµαϊκό Έτος 2006 2007 Γραπτή Εργασία #2 Ηµεροµηνία Παράδοσης 28-0 - 2007 ΠΛΗ 2: Ψηφιακά Συστήµατα ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ Άσκηση : [5 µονάδες] Έχετε στη

Διαβάστε περισσότερα

ΔΕΣΜΕΥΜΕΝΕΣ Ή ΥΠΟ ΣΥΝΘΗΚΗ ΠΙΘΑΝΟΤΗΤΕΣ

ΔΕΣΜΕΥΜΕΝΕΣ Ή ΥΠΟ ΣΥΝΘΗΚΗ ΠΙΘΑΝΟΤΗΤΕΣ ΔΕΣΜΕΥΜΕΝΕΣ Ή ΥΠΟ ΣΥΝΘΗΚΗ ΠΙΘΑΝΟΤΗΤΕΣ Έστω ότι επιθυμούμε να μελετήσουμε ένα τυχαίο πείραμα με δειγματικό χώρο Ω και έστω η πιθανότητα να συμβεί ένα ενδεχόμενο Α Ω Υπάρχουν περιπτώσεις όπου ενώ δεν γνωρίζουμε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Περιεχόµενα της διάλεξης. Ποιος παίρνει τις αποφάσεις; Ηπρακτική µέθοδος διδασκαλίας Ο ΕΚΠΑΙ ΕΥΤΙΚΟΣ ΣΤΟΧΟΣ

Περιεχόµενα της διάλεξης. Ποιος παίρνει τις αποφάσεις; Ηπρακτική µέθοδος διδασκαλίας Ο ΕΚΠΑΙ ΕΥΤΙΚΟΣ ΣΤΟΧΟΣ ΕΠΕΑΕΚ: ΑΝΑΜΟΡΦΩΣΗ ΤΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣ ΣΠΟΥ ΩΝ ΤΟΥ ΤΕΦΑΑ, ΠΘ - ΑΥΤΕΠΙΣΤΑΣΙΑ Ένα βήµα µετά τη δασκαλοκεντρική διδασκαλία: Η πρακτική µέθοδος διδασκαλίας ιγγελίδης Νικόλαος Πανεπιστήµιο Θεσσαλίας ΤΕΦΑΑ, Τρίκαλα

Διαβάστε περισσότερα

3.2 3.3 3.4 ΠΡΑΞΕΙΣ ΜΕ ΕΚΑ ΙΚΟΥΣ

3.2 3.3 3.4 ΠΡΑΞΕΙΣ ΜΕ ΕΚΑ ΙΚΟΥΣ 1 3.2 3.3 3.4 ΠΡΑΞΕΙΣ ΜΕ ΕΚΑ ΙΚΟΥΣ ΥΠΟΛΟΓΙΣΜΟΙ ΜΕ ΚΟΜΠΙΟΥΤΕΡΑΚΙ ΤΥΠΟΠΟΙΗΜΕΝΗ ΜΟΡΦΗ ΑΡΙΘΜΩΝ ΘΕΩΡΙΑ 1. Πρόσθεση αφαίρεση δεκαδικών Γίνονται όπως και στους φυσικούς αριθµούς. Προσθέτουµε ή αφαιρούµε τα ψηφία

Διαβάστε περισσότερα

Γ ε ν ι κ ό Λ ύ κ ε ι ο Ε λ ε υ θ ε ρ ο ύ π ο λ η ς. Α λ γ ό ρ ι θ μ ο ι

Γ ε ν ι κ ό Λ ύ κ ε ι ο Ε λ ε υ θ ε ρ ο ύ π ο λ η ς. Α λ γ ό ρ ι θ μ ο ι Α λ γ ό ρ ι θ μ ο ι Αριθμητικοί τελεστές Οι αριθμητικοί τελεστές είναι: πρόσθεση, αφαίρεση, πολλαπλασιασμός και διαίρεση +,-,*,/ ύψωση σε δύναμη ^ πηλίκο ακέραιης διαίρεσης δύο ακεραίων αριθμών div υπόλοιπο

Διαβάστε περισσότερα

Παρατηρήσεις. Προβλήματα είχαν οι ασκήσεις:

Παρατηρήσεις. Προβλήματα είχαν οι ασκήσεις: ΑΛΓΕΒΡΑ Α ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΕΚΦΩΝΗΣΕΙΣ ΚΑΙ ΛΥΣΕΙΣ Στέλιιος Μιιχαήλογλου-Δημήτρης Πατσιιμάς Εκκφωννήήσσεει ιςς κκααι ι λλύύσσεει ιςς θθεεμμάάττωνν Άλλγγεεββρρααςς Τρράάππεεζζααςς θθεεμμάάττωνν

Διαβάστε περισσότερα

ΑΓΓΛΙΚΗ ΣΧΟΛΗ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2012. Χρόνος: 1 ώρα και 30 λεπτά

ΑΓΓΛΙΚΗ ΣΧΟΛΗ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2012. Χρόνος: 1 ώρα και 30 λεπτά ΑΓΓΛΙΚΗ ΣΧΟΛΗ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2012 ΜΑΘΗΜΑΤΙΚΑ ΠΡΩΤΗ ΤΑΞΗ Χρόνος: 1 ώρα και 30 λεπτά Να απαντήσετε σε ΟΛΕΣ τις ερωτήσεις. Όπου χρειάζεται να γίνουν πράξεις για να βρεθεί η απάντηση, να τις κάνετε

Διαβάστε περισσότερα

υαδικό Σύστημα 192.168.0.0-11000000.10101000.00000000.00000000

υαδικό Σύστημα 192.168.0.0-11000000.10101000.00000000.00000000 υαδικό Σύστημα Για να μπορέσουμε να καταλάβουμε πως γίνεται το Subnetting, πρέπει πρώτα να γνωρίζουμε καλά το δυαδικό σύστημα, τις Classes των δικτύων και τι ακριβώς γίνεται στην καθεμία. Όπως γνωρίζουμε

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Συσχέτιση μεταξύ δύο συνόλων δεδομένων

Συσχέτιση μεταξύ δύο συνόλων δεδομένων Διαγράμματα διασποράς (scattergrams) Συσχέτιση μεταξύ δύο συνόλων δεδομένων Η οπτική απεικόνιση δύο συνόλων δεδομένων μπορεί να αποκαλύψει με παραστατικό τρόπο πιθανές τάσεις και μεταξύ τους συσχετίσεις,

Διαβάστε περισσότερα

ΣΤΟΙΧΕΙΑ ΑΛΓΕΒΡΑΣ. 1. Συνδυαστική ανάλυση. 1.1. Μεταθέσεις

ΣΤΟΙΧΕΙΑ ΑΛΓΕΒΡΑΣ. 1. Συνδυαστική ανάλυση. 1.1. Μεταθέσεις 1 ΣΤΟΙΧΕΙΑ ΑΛΓΕΒΡΑΣ 1 Συνδυαστική ανάλυση Η συνδυαστική ανάλυση είναι οι διάφοροι μέθοδοι και τύποι που χρησιμοποιούνται στη λύση προβλημάτων εκτίμησης του πλήθους των στοιχείων ενός πεπερασμένου συνόλου

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΙΘΑΝΟΤΗΤΩΝ του Παν. Λ. Θεοδωρόπουλου 0

ΑΣΚΗΣΕΙΣ ΠΙΘΑΝΟΤΗΤΩΝ του Παν. Λ. Θεοδωρόπουλου 0 ΑΣΚΗΣΕΙΣ ΠΙΘΑΝΟΤΗΤΩΝ του Παν. Λ. Θεοδωρόπουλου 0 Η Θεωρία Πιθανοτήτων είναι ένας σχετικά νέος κλάδος των Μαθηματικών, ο οποίος παρουσιάζει πολλά ιδιαίτερα χαρακτηριστικά στοιχεία. Επειδή η ιδιαιτερότητα

Διαβάστε περισσότερα

Θέμα: ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΓΙΑ ΤΙΣ ΔΙΑΚΡΙΤΕΣ ΚΑΤΑΝΟΜΕΣ ΠΙΘΑΝΟΤΗΤΩΝ ΚΕΦΑΛΑΙΟ 7 ΒΙΒΛΙΟ KELLER

Θέμα: ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΓΙΑ ΤΙΣ ΔΙΑΚΡΙΤΕΣ ΚΑΤΑΝΟΜΕΣ ΠΙΘΑΝΟΤΗΤΩΝ ΚΕΦΑΛΑΙΟ 7 ΒΙΒΛΙΟ KELLER ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ ΤΜΗΜΑ: ΔΙΟΙΚΗΣΗΣ ΕΠΙΧΕΙΡΗΣΕΩΝ (Πάτρας) Διεύθυνση: Μεγάλου Αλεξάνδρου 1, 263 34 ΠΑΤΡΑ Τηλ.: 2610 369051, Φαξ: 2610 396184, email: mitro@teipat.gr Καθηγητής

Διαβάστε περισσότερα

ΕΠΙΧΕΙΡΗΣΙΑΚΗ ΕΡΕΥΝΑ

ΕΠΙΧΕΙΡΗΣΙΑΚΗ ΕΡΕΥΝΑ ΤΜΗΜΑ ΜΑΘΗΜΑΤΙΚΩΝ ΣΕΠΤΕΜΒΡΙΟΣ 2008 ΤΟΜΕΑΣ ΣΤΑΤΙΣΤΙΚΗΣ, ΠΙΘΑΝΟΤΗΤΩΝ & ΕΠΙΧΕΙΡΗΣΙΑΚΗΣ ΕΡΕΥΝΑΣ ΕΠΙΧΕΙΡΗΣΙΑΚΗ ΕΡΕΥΝΑ ΘΕΜΑ 1 ο Σε μία γειτονιά, η ζήτηση ψωμιού η οποία ανέρχεται σε 1400 φραντζόλες ημερησίως,

Διαβάστε περισσότερα

1-3 10 1-3 6 3-5 40 3-5 30 5-7 20 5-7 20 7-9 20 7-9 30 9-11 8 9-11 10 11-13 2 11-13 4 Σύνολο 100 Σύνολο 100

1-3 10 1-3 6 3-5 40 3-5 30 5-7 20 5-7 20 7-9 20 7-9 30 9-11 8 9-11 10 11-13 2 11-13 4 Σύνολο 100 Σύνολο 100 1. (Εξεταστ. Φεβ. 2004) Μια µεγάλη εταιρία θέλει να εξετάσει εάν το εκπαιδευτικό πρόγραµµα που ακολουθήσανε οι 100 πωλητές της ήταν αποτελεσµατικό (δηλαδή εάν αυξήθηκαν οι πωλήσεις). Οι δύο παρακάτω πίνακες

Διαβάστε περισσότερα

Ρόδος, Μαρτιος 2014. Εργασία Προόδου #1. ίνονται Οµάδες Ερωτήσεων, Προβληµάτων και Ασκήσεων, Α,Β,Γ,,Ε,Ζ,Η

Ρόδος, Μαρτιος 2014. Εργασία Προόδου #1. ίνονται Οµάδες Ερωτήσεων, Προβληµάτων και Ασκήσεων, Α,Β,Γ,,Ε,Ζ,Η ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΠΑΙ ΑΓΩΓΙΚΟ ΤΜΗΜΑ ΗΜΟΤΙΚΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΑΚΑ ΗΜΑΪΚΟ ΕΤΟΣ 2013-2014 Eaρινό Εξάµηνο Ρόδος, Μαρτιος 2014 ΕΡΓΑΣΤΗΡΙΟ ΜΑΘΗΜΑΤΙΚΩΝ, Ι ΑΚΤΙΚΗΣ και ΠΟΛΥΜΕΣΩΝ Μάθηµα: ΥΓ00003 "ΕΙΣΑΓΩΓΗ στις ΒΑΣΕΙΣ

Διαβάστε περισσότερα

ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ

ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ Φροντιστήριο #: Εύρεση Ελαχίστων Μονοπατιών σε Γραφήματα που Περιλαμβάνουν και Αρνητικά Βάρη: Αλγόριθμος

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΚΑΔΗΜΑΪΚΟ ΕΤΟΣ 2014-2015 ΘΕΜΑΤΙΚΗ ΕΝΟΤΗΤΑ. Βασικά Εργαλεία και Μέθοδοι για τον Έλεγχο της Ποιότητας [ΔΙΠ 50]

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΚΑΔΗΜΑΪΚΟ ΕΤΟΣ 2014-2015 ΘΕΜΑΤΙΚΗ ΕΝΟΤΗΤΑ. Βασικά Εργαλεία και Μέθοδοι για τον Έλεγχο της Ποιότητας [ΔΙΠ 50] ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΚΑΔΗΜΑΪΚΟ ΕΤΟΣ 2014-2015 ΘΕΜΑΤΙΚΗ ΕΝΟΤΗΤΑ Βασικά Εργαλεία και Μέθοδοι για τον Έλεγχο της Ποιότητας [ΔΙΠ 50] 1η ΓΡΑΠΤΗ ΕΡΓΑΣΙΑ Προσοχή: Η καταληκτική ημερομηνία για την παραλαβή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΕΞΙΣΩΣΕΙΣ ΖΗΤΗΣΗΣ ΑΣΚΗΣΗ 1 Δίνεται ο παρακάτω πίνακας : Α. Να σχεδιάσετε την καμπύλη ζήτησης Β. Να βρεθεί η εξίσωση ζήτησης Γ.

ΕΞΙΣΩΣΕΙΣ ΖΗΤΗΣΗΣ ΑΣΚΗΣΗ 1 Δίνεται ο παρακάτω πίνακας : Α. Να σχεδιάσετε την καμπύλη ζήτησης Β. Να βρεθεί η εξίσωση ζήτησης Γ. ΕΞΙΣΩΣΕΙΣ ΖΗΤΗΣΗΣ ΑΣΚΗΣΗ 1 Δίνεται ο παρακάτω πίνακας : ΣΥΝΔΥΑΣΜΟΙ P Α 24 80 Β 35 64 Γ 45 50 Δ 55 36 Ε 60 29 Ζ 70 14 90 80 70 60 50 40 30 20 10 0 0 10 20 30 40 50 60 70 80 Α. Να σχεδιάσετε την καμπύλη

Διαβάστε περισσότερα

Α Λυκείου Άλγεβρα Τράπεζα Θεμάτων Το Δεύτερο Θέμα

Α Λυκείου Άλγεβρα Τράπεζα Θεμάτων Το Δεύτερο Θέμα Α Λυκείου Άλγεβρα Τράπεζα Θεμάτων Το Δεύτερο Θέμα Θεωρούμε την ακολουθία (α ν ) των θετικών περιττών αριθμών: 1, 3, 5, 7, α) Να αιτιολογήσετε γιατί η (α ν ) είναι αριθμητική πρόοδος και να βρείτε τον εκατοστό

Διαβάστε περισσότερα

Έντυπο Υποβολής Αξιολόγησης Γ.Ε.

Έντυπο Υποβολής Αξιολόγησης Γ.Ε. Έντυπο Υποβολής Αξιολόγησης Γ.Ε. O φοιτητής συμπληρώνει την ενότητα «Υποβολή Εργασίας» και αποστέλλει το έντυπο σε δύο μη συρραμμένα αντίγραφα (ή ηλεκτρονικά) στον Καθηγητή-Σύμβουλο. Ο Καθηγητής-Σύμβουλος

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ: ΔΥΝΑΜΕΙΣ ΚΑΙ ΡΟΠΕΣ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ: ΔΥΝΑΜΕΙΣ ΚΑΙ ΡΟΠΕΣ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ: ΔΥΝΑΜΕΙΣ ΚΑΙ ΡΟΠΕΣ Σ ένα στερεό ασκούνται ομοεπίπεδες δυνάμεις. Όταν το στερεό ισορροπεί, δηλαδή ισχύει ότι F 0 και δεν περιστρέφεται τότε το αλγεβρικό άθροισμα των ροπών είναι μηδέν Στ=0,

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

18 ος Πανελλήνιος Διαγωνισμός Αστρονομίας και Διαστημικής 2013. 4 η φάση: «ΠΤΟΛΕΜΑΙΟΣ» Ανάλυση Δεδομένων

18 ος Πανελλήνιος Διαγωνισμός Αστρονομίας και Διαστημικής 2013. 4 η φάση: «ΠΤΟΛΕΜΑΙΟΣ» Ανάλυση Δεδομένων 18 ος Πανελλήνιος Διαγωνισμός Αστρονομίας και Διαστημικής 2013 4 η φάση: «ΠΤΟΛΕΜΑΙΟΣ» Ανάλυση Δεδομένων Παρακαλούμε, διαβάστε προσεκτικά τα παρακάτω: 1. Μπορείτε να χρησιμοποιήσετε τον χάρακα και το κομπιουτεράκι

Διαβάστε περισσότερα

ΟΚΙΜΑΣΙΕΣ χ 2 (CHI-SQUARE)

ΟΚΙΜΑΣΙΕΣ χ 2 (CHI-SQUARE) ΔΟΚΙΜΑΣΙΕΣ χ (CI-SQUARE) ΟΚΙΜΑΣΙΕΣ χ (CI-SQUARE). Εισαγωγή Οι στατιστικές δοκιμασίες που μελετήσαμε μέχρι τώρα ονομάζονται παραμετρικές (paramtrc) διότι χαρακτηρίζονται από υποθέσεις σχετικές είτε για

Διαβάστε περισσότερα

Ανάλυση Δεδομένων με χρήση του Στατιστικού Πακέτου R

Ανάλυση Δεδομένων με χρήση του Στατιστικού Πακέτου R Ανάλυση Δεδομένων με χρήση του Στατιστικού Πακέτου R, Επίκουρος Καθηγητής, Τομέας Μαθηματικών, Σχολή Εφαρμοσμένων Μαθηματικών και Φυσικών Επιστημών, Εθνικό Μετσόβιο Πολυτεχνείο. Περιεχόμενα Εισαγωγή στο

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από

Διαβάστε περισσότερα

w w w.k z a c h a r i a d i s.g r

w w w.k z a c h a r i a d i s.g r ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ασκήσεις με δοκό που ισορροπεί, και το ένα άκρο της συνδέεται με άρθρωση Έστω ότι έχουμε ομογενή δοκό η οποία συνδέεται στο ένα άκρο της με άρθρωση.

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥ ΩΝ ΠΛΗΡΟΦΟΡΙΚΗΣ

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥ ΩΝ ΠΛΗΡΟΦΟΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥ ΩΝ ΠΛΗΡΟΦΟΡΙΚΗΣ Θεµατική Ενότητα ΠΛΗ 21: Ψηφιακά Συστήµατα Ακαδηµαϊκό Έτος 2009 2010 Γραπτή Εργασία #3 Παράδοση: 28 Μαρτίου 2010 Άσκηση 1 (15 µονάδες) Ένας επεξεργαστής υποστηρίζει τόσο

Διαβάστε περισσότερα

α) γνησίως αύξουσα σε ένα διάστημα Δ του πεδίου ορισμού της (Σχ.α), όταν β) γνησίως φθίνουσα σε ένα διάστημα Δ του πεδίου ορισμού της (Σχ.

α) γνησίως αύξουσα σε ένα διάστημα Δ του πεδίου ορισμού της (Σχ.α), όταν β) γνησίως φθίνουσα σε ένα διάστημα Δ του πεδίου ορισμού της (Σχ. ΜΟΝΟΤΟΝΙΑ. ΙΔΙΟΤΗΤΕΣ ΣΥΝΑΡΤΗΣΕΩΝ. ΜΟΝΟΤΟΝΙΑ - ΑΚΡΟΤΑΤΑ - ΣΥΜΜΕΤΡΙΕΣ Μια συνάρτηση f λέγεται: α) γνησίως αύξουσα σε ένα διάστημα Δ του πεδίου ορισμού της (Σχ.α), όταν για οποιαδήποτε χ,χ Δ με χ

Διαβάστε περισσότερα

ΘΕΜΑ 2. Θεωρούμε την ακολουθία (α ν ) των θετικών περιττών αριθμών: 1, 3, 5, 7,

ΘΕΜΑ 2. Θεωρούμε την ακολουθία (α ν ) των θετικών περιττών αριθμών: 1, 3, 5, 7, Θεωρούμε την ακολουθία (α ν ) των θετικών περιττών αριθμών: 1, 3, 5, 7, α) Να αιτιολογήσετε γιατί η (α ν ) είναι αριθμητική πρόοδος και να βρείτε τον εκατοστό όρο της. (Μονάδες 15) β) Να αποδείξετε ότι

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα

Μεθοδολογία Επίλυσης Προβλημάτων ============================================================================ Π. Κυράνας - Κ.

Μεθοδολογία Επίλυσης Προβλημάτων ============================================================================ Π. Κυράνας - Κ. Μεθοδολογία Επίλυσης Προβλημάτων ============================================================================ Π. Κυράνας - Κ. Σάλαρης Πολλές φορές μας δίνεται να λύσουμε ένα πρόβλημα που από την πρώτη

Διαβάστε περισσότερα

Ε ανάληψη. Α ληροφόρητη αναζήτηση

Ε ανάληψη. Α ληροφόρητη αναζήτηση ΠΛΗ 405 Τεχνητή Νοηµοσύνη Το ική Αναζήτηση Local Search Τµήµα Ηλεκτρονικών Μηχανικών και Μηχανικών Υ ολογιστών Πολυτεχνείο Κρήτης Ε ανάληψη Α ληροφόρητη αναζήτηση σε πλάτος, οµοιόµορφου κόστους, σε βάθος,

Διαβάστε περισσότερα

Α) 4 Β) 5 Γ) 7 Δ) 6 Ε) Κανένα από τα πιο πάνω.

Α) 4 Β) 5 Γ) 7 Δ) 6 Ε) Κανένα από τα πιο πάνω. η Κυπριακή Μαθηματική Ολυμπιάδα Απρίλιος 200 Χρόνος: 60 λεπτά ΣΤ ΔΗΜΟΤΙΚΟΥ ΑΣΚΗΣΗ Ο πενταψήφιος αριθμός 45Β7Α, στον οποίο τα ψηφία των μονάδων και των εκατοντάδων είναι σημειωμένα με Α και Β, διαιρείται

Διαβάστε περισσότερα

ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑΤΙΚΑ ΚΟΙΝΟΥ ΚΟΡΜΟΥ

ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑΤΙΚΑ ΚΟΙΝΟΥ ΚΟΡΜΟΥ ΚΥΠΡΙΑΚΗ ΜΑΘΗΜΑΤΙΚΗ ΕΤΑΙΡΕΙΑ Στασίνου 6, Γραφ. 102, Στρόβολος 200, Λευκωσία Τηλ. 57-2278101 Φαξ: 57-2279122 cms@cms.org.cy, www.cms.org.cy ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 201 ΜΑΘΗΜΑΤΙΚΑ ΚΟΙΝΟΥ ΚΟΡΜΟΥ Ημερομηνία:

Διαβάστε περισσότερα

Μετατόπιση, είναι η αλλαγή (μεταβολή) της θέσης ενός κινητού. Η μετατόπιση εκφράζει την απόσταση των δύο θέσεων μεταξύ των οποίων κινήθηκε το κινητό.

Μετατόπιση, είναι η αλλαγή (μεταβολή) της θέσης ενός κινητού. Η μετατόπιση εκφράζει την απόσταση των δύο θέσεων μεταξύ των οποίων κινήθηκε το κινητό. Μετατόπιση, είναι η αλλαγή (μεταβολή) της θέσης ενός κινητού. Η μετατόπιση εκφράζει την απόσταση των δύο θέσεων μεταξύ των οποίων κινήθηκε το κινητό. Η ταχύτητα (υ), είναι το πηλίκο της μετατόπισης (Δx)

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 18. 18 Μηχανική Μάθηση

ΚΕΦΑΛΑΙΟ 18. 18 Μηχανική Μάθηση ΚΕΦΑΛΑΙΟ 18 18 Μηχανική Μάθηση Ένα φυσικό ή τεχνητό σύστηµα επεξεργασίας πληροφορίας συµπεριλαµβανοµένων εκείνων µε δυνατότητες αντίληψης, µάθησης, συλλογισµού, λήψης απόφασης, επικοινωνίας και δράσης

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΘΕΜΑΤΑ ΘΕΩΡΙΑΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΤΗΣ Α ΓΥΜΝΑΣΙΟΥ ΑΛΓΕΒΡΑ

ΕΡΩΤΗΣΕΙΣ ΘΕΜΑΤΑ ΘΕΩΡΙΑΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΤΗΣ Α ΓΥΜΝΑΣΙΟΥ ΑΛΓΕΒΡΑ 1 ο ΚΕΦΑΛΑΙΟ ΕΡΩΤΗΣΕΙΣ ΘΕΜΑΤΑ ΘΕΩΡΙΑΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΤΗΣ Α ΓΥΜΝΑΣΙΟΥ ΑΛΓΕΒΡΑ 1. α. Τι γνωρίζετε για την Ευκλείδεια διαίρεση; Πότε λέγεται τέλεια; β. Αν σε μια διαίρεση είναι Δ=δ, πόσο είναι το πηλίκο και

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ Β Γυμνασίου

ΜΑΘΗΜΑΤΙΚΑ Β Γυμνασίου ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΜΑΘΗΜΑΤΙΚΑ Β Γυμνασίου Ενότητα 3: Πραγματικοί αριθμοί Πυθαγόρειο Θεώρημα ΠΑΙΔΑΓΩΓΙΚΟ ΙΝΣΤΙΤΟΥΤΟ ΥΠΗΡΕΣΙΑ ΑΝΑΠΤΥΞΗΣ ΠΡΟΓΡΑΜΜΑΤΩΝ ΜΑΘΗΜΑΤΙΚΑ Β Γυμνασίου Ενότητα 2: Πραγματικοί

Διαβάστε περισσότερα

Εκφωνήσεις και λύσεις των ασκήσεων της Τράπεζας Θεμάτων στην Άλγεβρα Α ΓΕΛ

Εκφωνήσεις και λύσεις των ασκήσεων της Τράπεζας Θεμάτων στην Άλγεβρα Α ΓΕΛ Κοίταξε τις µεθόδους, τις λυµένες ασκήσεις και τις ασκήσεις προς λύση των ενοτήτων 6, 7 του βοηθήµατος Μεθοδολογία Άλγεβρας και Στοιχείων Πιθανοτήτων Α Γενικού Λυκείου των Ευσταθίου Μ. και Πρωτοπαπά Ελ.

Διαβάστε περισσότερα

Αβεβαιότητα (Uncertainty)

Αβεβαιότητα (Uncertainty) Αβεβαιότητα (Uncertainty) Παράδειγμα κατασκευής μοντέλου προβλήματος στο Excel και διαχείρισης της αβεβαιότητας που το ίδιο το πρόβλημα εμπεριέχει. Ανάλυση προβλήματος Βήμα 1: Καθορισμός του προβλήματος

Διαβάστε περισσότερα

ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ

ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ 1 ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ Φροντιστήριο #10: Αλγόριθμοι Διαίρει & Βασίλευε: Master Theorem, Αλγόριθμοι Ταξινόμησης, Πιθανοτικός

Διαβάστε περισσότερα

B. ΠΡΟΒΛΗΜΑΤΑ ΑΠΟ ΔΙΑΓΩΝΙΣΜΟΥΣ

B. ΠΡΟΒΛΗΜΑΤΑ ΑΠΟ ΔΙΑΓΩΝΙΣΜΟΥΣ Τα Μαθηματικά παίζουν κυρίαρχο ρόλο σε όλους τους χώρους της σύγχρονης κοινωνίας. Όλα σχεδόν τα επιτεύγματα της τεχνολογίας και της ε- πιστήμης στηρίζονται στην ανάπτυξη των Μαθηματικών. Αλλά και τα προβλήματα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 0 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΘΕΜΑ Α Α. Να αποδείξετε ότι για δύο συμπληρωματικά ενδεχόμενα Α και Α ισχύει: Ρ(Α )=-Ρ(Α) Μονάδες 7 Α. Να ορίσετε το μέτρο διασποράς εύρος ή

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ Γ ΛΥΚΕΙΟΥ ( ΘΕΡΙΝΑ )

ΔΙΑΓΩΝΙΣΜΑ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ Γ ΛΥΚΕΙΟΥ ( ΘΕΡΙΝΑ ) 5 1 1 1η σειρά ΔΙΑΓΩΝΙΣΜΑ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ Γ ΛΥΚΕΙΟΥ ( ΘΕΡΙΝΑ ) ΘΕΜΑ 1 Α. Ας υποθέσουμε ότι x 1,x,...,x κ είναι οι τιμές μιας μεταβλητής X, που αφορά τα άτομα ενός δείγματος μεγέθους

Διαβάστε περισσότερα