«ΠΡΟΕΜΦΥΤΕΥΤΙΚΗ ΔΙΑΓΝΩΣΗ: ΕΝΔΕΙΞΕΙΣ, ΣΚΟΠΙΜΟΤΗΤΑ, ΤΕΧΝΙΚΗ ΚΑΙ ΕΦΑΡΜΟΓΕΣ»

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "«ΠΡΟΕΜΦΥΤΕΥΤΙΚΗ ΔΙΑΓΝΩΣΗ: ΕΝΔΕΙΞΕΙΣ, ΣΚΟΠΙΜΟΤΗΤΑ, ΤΕΧΝΙΚΗ ΚΑΙ ΕΦΑΡΜΟΓΕΣ»"

Transcript

1 «ΠΡΟΕΜΦΥΤΕΥΤΙΚΗ ΔΙΑΓΝΩΣΗ: ΕΝΔΕΙΞΕΙΣ, ΣΚΟΠΙΜΟΤΗΤΑ, ΤΕΧΝΙΚΗ ΚΑΙ ΕΦΑΡΜΟΓΕΣ» ΣΙΜΟΠΟΥΛΟΥ ΜΑΡΑ Κλινική Εμβρυολόγος/Γενετίστρια ΛΕΚΤΟΡΑΣ ΦΥΣΙΟΛΟΓΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΘΝΙΚΟ & ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ

2 ΠΓΔ Ανιχνεύει γενετικές ανωμαλίες σε έμβρυα προ της εμφύτευσης. Επιτρέπει επιλεκτική μεταφορά στη μήτρα φυσιολογικών εμβρύων. Απαιτεί δημιουργία εμβρύων in vitro. Πραγματοποιείται κατόπιν αφαίρεσης και γενετικής ανάλυσης πολικών σωματίων, 1-2 βλαστομεριδίων στο στάδιο της αυλάκωσης, ή τροφοεξωδέρματος στο στάδιο της βλαστοκύστης.

3 ΠΓΔ MΕΘΟΔΟΣ Δημιουργία εμβρύων in vitro με IVF Βιοψία πολικών σωματίων, βλαστομεριδίων FISH, PCR, CGH, ή microarrays για γενετική διάγνωση. ΑΣΘΕΝΕΙΣ Καθ έξιν αποβολές-αδιευκρίνιστης αιτιολογίας. Καθ έξιν αποβολές λόγω χρωμοσωμικής ανωμαλίας. Ηθικές η θρησκευτικές ενστάνσεις για διακοπή κυήσεως. Υπογόνιμα ζευγάρια.

4 ΠΓΔ Το ζευγάρι φέρει κάποια γενετική ανωμαλία. Έχουν ήδη ένα παιδί που νοσεί Άλλα μέλη της οικογένειας μπορεί να φέρουν τη νόσο. ΕΠΙΛΟΓΕΣ Παραμένουν άτεκνοι Αναπαραγωγική ρουλέτα Προγεννητική Διάγνωση Υιοθεσία Χρήση ξένων γαμετών ΠΓΔ

5 Είδη Ασθενειών Αυτοσωματική υπολειπόμενη (Κυστική Ίνωση, β-θαλασσαιμία, Δρεπανοκυτταρική αναιμία, Νόσος Tay-Sachs, κ.α.) Αυτοσωματική επικρατής (Νόσος Huntington, Μυοτονική Δυστροφία, κ.α.) X-φυλοσύνδετη (Μυϊκή Δυστροφία Becker, Duchenne, Σύνδρομο Εύθραυστου Χ, κ.α.). Χρωμοσωμικές ανωμαλίες (Δομικές & Αριθμητικές) Aνευπλοειδία

6 Γενετική Συμβουλευτική Όλοι οι ασθενείς το χρειάζονται πριν ξεκινήσουν ΠΓΔ. Η Αμερικάνικη Κοινότητα Ανθρώπινης Γενετικής όρισε τη Γενετική Συμβουλευτική ως: Μια διαδικασία επικοινωνίας που ασχολείται με τα ανθρώπινα προβλήματα που συνδέονται με περιστατικά γενετικής ανωμαλίας η την πιθανότητα περιστατικών μίας γενετικής ανωμαλίας σε μια οικογένεια.

7 Αναπαραγωγικό Ιστορικό Περιστατικών για ΠΓΔ Φυσιολογικό νεογνό 70% 7% 9%. 14% Νεογνό με χρωμοσωμική ανωμαλια Διακοπή κύησης λόγω χρωμοσωμικής ανωμαλίας Αυτόματη Αποβολή

8 ΒΙΟΨΙΑ 1. Πολικού Σωματίου 2. Στάδιο Αυλάκωσης 3. Βλαστοκύστης

9 Εξετάζει μόνο τα μητρικά χρωμοσώματα Θετικά: Preconception Diagnosis.Doesn t affect actual embryo Βιοψία Πολικού Σωματίου 2 ομάδες στις Η.Π.Α Χρειάζεται 1ο & 2ο σωμάτιο Χρονοβόρα & επίπονη διαδικασία

10 Βιοψία Πολικού Σωματίου

11 2 κύτταρα 2η Μέρα 4 κύτταρα

12 8 κύτταρα- 3η Μέρα

13 Δεν επηρεάζει μετέπειτα ανάπτυξη. Βιοψία στην 3η μέρα της ζωής Του εμβρύου Στάδιο ανάπτυξης 6-10 βλαστομερίδια. Βλαστομερίδια ολοδύναμα. Πρόβλημα: Συνείληση & πιθανότητα κυτταρικής διάσπασης 1-2 βλαστομερίδια απαραίτητα για ανάλυση.

14 Βιοψία στο στάδιο της αυλάκωσης Δύο στάδια: Διάνοιξη διάφανης ζώνης Αφαίρεση βλαστομεριδίων

15 Βιοψία Α Β Δ

16 Βιοψία στο στάδιο της αυλάκωσης Διάνοιξη διάφανης ζώνης Τρείς μέθοδοι έχουν αναφερθεί: 1.Acid Tyrodes (Οξύ) 2.Μηχανικά 3.Laser

17 Βιοψία στο στάδιο της αυλάκωσης Αφαίρεση Βλαστομεριδίου Τρείς μέθοδοι: 1.Αναρρόφηση (Aspiration) 2.Εξώθηση (Extrusion) 3.Εκτόπιση (Displacement)

18 Βιοψία στο στάδιο της αυλάκωσης Αφαίρεση Βλαστομεριδίου- Αναρρόφηση (Aspiration) Η περισσότερο κοινή μέθοδος μέχρι πρόσφατα Χρειάζονται 2 μικροπιππέτες. Είσοδος πιππέτας μέσα από το άνοιγμα & αναρρόφηση βλαστομεριδίου

19 Βιοψία Βλαστοκύστης 5-6 μέρα- Βιοψία κυττάρων από το τροφοεξώδερμα. Μειονεκτήματα Μόνο 40% των εμβρύων φτάνουν το στάδιο της βλαστοκύστης. Μη ικανοποιητικός αριθμός εμβρύων για ΠΓΔ. Ανεπαρκείς χρόνος για τη διάγνωση. Τα κύτταρα του τροφοεξωδέρματος μπορεί να διαφέρουν από αυτά της εσωκυτταρικής μάζας λόγω μωσαϊκισμού Μειωμένη διαγνωστική αξιοπιστία. Η διάφανη ζώνη είναι λεπτή & τα κύτταρα μπορεί ν διαφύγουν από το άνοιγμα.

20 Βιοψία Βλαστοκύστης 5-6 μέρα- Βιοψία κυττάρων από το τροφοεξώδερμα. Γιατί αποτελεί πλέον την καλύτερη επιλογή Περισσότερα κύτταρα μπορούν να αφαιρεθούν Περισσότερες πληροφορίες από την ανάλυση τους. Βελτιωμένες συνθήκες καλλιέργειας εμβρύων ενισχύουν τη δημιουργία βλαστοκύστης στο εργαστήριο Σε συνδυασμό με την εφαρμογή υαλοποίησης εξασφαλίζοντας εξαιρετικά ποσοστά επιβίωσης η βιοψία βλαστοκύστης γίνεται η καλύτερη επιλογή-το θέμα του χρόνου δεν αποτελεί πρόβλημα.

21 Διάγνωση 1. Ακριβής 2. Ευαίσθητη 3. Γρήγορη (όχι απαραίτητα λόγω υαλοποίησης)

22 Διάγνωση (αρχική προσέγγιση) Αλυσιδωτή Αντίδραση Πολυμεράσης (PCR) Αναλύει τη συγκεκριμένη μετάλλαξη Μονογονιδιακά νοσήματα Χ-Φυλοσύνδετες ασθένειες Φθορίζων Υβριδισμός in situ (FISH) Χρωμοσωμική ανάλυση Χρωμοσωμικές ανωμαλίες PGD-AS (ΠΓΔ για ανευπλοειδία)

23 c Locus-specific ανιχνευτής- Ειδικών γονιδίων. d Sub-telomeric probes Ανιχνευτής τελομεριδίου. Ανιχνευτές Πολυχρωμικής FISH a Ανιχνευτής για ολόκληρο το χρωμόσωμα b α-satellite Αλφοειδής Ανιχνευτής επαναλαμβανομένων αλληλουχιών κεντρομεριδίων

24 Δομικές Χρωμοσωμικές Ανωμαλίες Μεταθέσεις Robertsonian-Κεντρική Σύντηξη Στα ακροκεντρικά χρωμοσώματα 13, 14, 15, 21, 22. Σπάσιμο στο κεντρομερίδιο Έλλειψη η Πλεονασμός ολόκληρου χρωμοσώματος. Αμοιβαίες Οποιαδήποτε χρωμοσώματα & σπασίματα Μετάθεση ένθεσης η παρεμβολής Αναστροφές (Περικεντρικές η παρακεντρικές) Δεν έχουν φαινοτυπικό αποτέλεσμα μόνο γονοτυπικό!

25 Αμοιβαία Μετάθεση - 46,XX,t(5:11)(q34;q25) 5q der 5 der q2 5 5p LSI D5S23 control chromosome 11 centromere 11q sub telomeric probe

26 Στρατηγική Χρήσης Ανιχνευτών Δοκιμάζονται σε λεμφοκύτταρα κανονικού καρυότυπου. Στα λεμφοκύτταρα του ατόμου που φέρει τη μετατόπιση. Προκειμένου να εξασφαλιστεί η αποτελεσματικότητα τους στο να μπορούν να δίνουν διαφορετικούς χρωματικούς συνδυασμούς στα κανονικά χρωμοσώματα & στα παράγωγα τους.

27 Αμοιβαία Μετάθεση - 46,XX,t(5:11)(q34;q25) - FISH work-up Φυσιολογικός πυρήνας μεσόφασης. Πυρήνας μεσόφασης που φέρει τη μετάθεση der11 der 5 der5 Χρωμοσώματα μετάφασης Χρωμοσώματα μετάφασης που φέρουν τη μετάθεση.

28 Aποτέλεσμα αναφορών για ΠΓΔ για χρωμοσωμικές ανωμαλίες. Στάδιο βιοψίας ΠΓΔ Αναμονή για ΠΓΔ 17% 3% 21% IVF/PGD ακύρωση για κλινικούς λόγους Φυσιολογικό κύημα 8% Απόφαση κατά ΠΓΔ για ηθικούς, οικογενειακούς η οικονομικούς λόγους. 3% 13% 7% 8% 20% Χρήση γαμετών δότη Αποφάσισαν υπέρ του Προγεννητικού Ελέγχου Έχασαν επαφή με το κέντρο

29 Ποσοστό Χρωμοσωμικά φυσιολογικών και μη εμβρύων από 11 κύκλους ΠΓΔ No εμβρύων Chromosomally Balanced Embryos* Chromosomally Abnormal Embryos Περιστατικά ΠΓΔ Για τα χρωμοσώματα που εξετάστηκαν

30 Περιορισμοί στην ΠΓΔ Οι ασθενείς πρέπει να υποβληθούν σε IVF Κόστος Όλα τα έμβρυα ενδέχεται να είναι ακατάλληλα προς εμβρυομεταφορά Τα ποσοστά επιτυχίας χαμηλότερα από IVF

31 Περιορισμοί στην ΠΓΔ Τυπικό περιστατικό 12 ωάρια 10 Γονιμοποιούνται 8 Κατάλληλα για βιοψία 7 Αποτέλεσμα από την ανάλυση 5 Μη φυσιολογικά 2 Φυσιολογικά 1 καλής μορφολογίας 1 κακής μορφολογίας

32 Ηθικά Διλήμματα IVF Έρευνα σε έμβρυα (Νομοθεσία, Θρησκευτικές ενστάσεις) ΠΓΔ Designer Babies Ασθένειες όψιμης έναρξης?? (Alzheimer s, Parkinson s) Εξισορρόπηση οικογενείας?? Xαρακτηριστικά?? Για όσο περισσότερα γονίδια μπορούμε να ελέγχουμε τόσο λιγότερα έμβρυα θα θεωρούνται κατάλληλα

33

34 AMA-RIF-RM Mεγαλύτερες σε ηλικία γυναίκες παράγουν μεγαλύτερο ποσοστό χρωμοσωμικά ανώμαλων ωοκυττάρων Χρωμοσωμικά ανώμαλα έμβρυα Χαμηλά ποσοστά κυήσεων αυξημένες αυτόματες αποβολές. Επιλογή κατάλληλων εμβρύων:μορφολογία & χρωμοσωμική κατάσταση. Χρωμοσωμικές ανωμαλίες συναντώνται σε αποβολές αφορούν τα χρωμοσώματα: 13, 16, 18, 21, X, Y. Χρησιμοποιούμε ανιχνευτές για αυτά τα χρωμοσώματα Βελτιώνοντας % επιτυχίας IVF με ΠΓΔ για ανευπλοειδία PGD-AS

35 ΠΓΔ για ανευπλοειδία Σκοπός Αύξηση ποσοστού εμφύτευσης Μείωση αυτομάτων αποβολών Ενδείξεις Άυξημένη ηλικία >35 ετών Προηγούμενες αποτυχημένες προσπάθειες IVF Καθ έξιν αποβολές. Προβλήματα σπερματικού ελέγχου.

36 FISH 5 χρωμάτων Έλεγχος ανευπλοειδίας a b X (χρυσό), Y (μπλέ), 13 (πράσινο), 18 (τυρκουάζ) and 21 (κόκκινο) 13(κόκκινο), 16(τυρκουάζ), 18(μπλέ) 21(πράσινο) and 22(χρυσό) From Santiago Munne

37 Χρωμοσώματα σε Χαοτικά- Διαφορετική χρωμοσωμική διάταξη σε κάθε πυρήνα έμβρυα αυλάκωσης Φυσιολογικά Όλα τα κύτταρα είναι ομοιόμορφα διπλοειδή Aνώμαλα - Όλα τα κύτταρα είναι ομοιόμορφα ανώμαλα π.χ.:μονοσωμία 18. Μωσαϊκά Δύο η περισσότερες κυτταρικές σειρές που διαφέρουν χρωμοσωμικά συνυπάρχουν στο έμβρυο. Συνήθως απλοειδή η τετραπλοειδή κύτταρα παρατηρούνται.

38 Παράγοντες που επηρεάζουν τις χρωμοσωμικές Ηλικία ανωμαλίες. Μορφολογία εμβρύου Προδιάθεση ασθενών Έμβρυα ανεσταλμένης ανάπτυξης. Κύτταρα με πολλαπλούς πυρήνες.

39 Ηλικία & το επίπεδο των χρωμοσωμικών ανωμαλιών Ηλικία % Ανώμαλα % % % Munne et al, Fert and Sterl 1995

40 Φυσιολογικά αναπτυσσόμενα έμβρυα Φυσιολογικά Ανώμαλα Μωσαϊκά Χαοτικά 1 45% 6% 49% 2 69% 2% 22% 7% 3 48% 2% 24% 26% 1. Munne et al, Fert and Ster, Harper et al, Prenatal Diagnosis, Delhanty et al, Human Genetics, 1997

41 Μορφολογία & Χρωμοσωμικές ανωμαλίες Φυσιολογικά Ανώμαλα Μωσαϊκά Χαοτικά I 69% 0 19% 2% II 42% 4% 31% 23% III 48% 0 12% 40% Delhanty et al, Human Genetics, 1997

42

43 To Μέλλον είναι εδώ! Εξάλειψη αιτιών εσφαλμένης διάγνωσης Μέθοδοι προς εξέταση όλων των ρωμοσωμάτων

44 SKY FISH στο 1ο πολικό σωμάτιο

45 Συγκριτικός Γενομικός Υβριδισμός Comparative Genomic Hybridisation (CGH)

46 Συγκριτικός Γενομικός Υβριδισμός (CGH) Test DNA (Πρός έλεγχο) Normal/Control DNA 46 XY (Φυσιολογικό) Φυσιολογικό Τρισωμία 21 Μονοσωμία 21 1:1 3:2 1:2

47 CGH ανάλυση

48 CGH σε προεμφυτευτικά έμβρυα CGH πείραμα ανακαλύπτοντας μονοσωμία 1 σε ένα θηλυκό έμβρυο.

49 Microarrays DNA chips DNA επισυνάπτεται σε μία αδιάλυτη επιφάνεια. Δυνατή η ανάλυση για: 1. Gene expression-γονιδιακή έκφραση 2. DNA sequence-αλληλουχία DNA 3. Ανευπλοειδία. Ταυτόχρονη ανάλυση χιλιάδων αλληλουχιών DNA

50 Microarrays Test DNA DNA προς έλεγχο Control DNA Φυσιολογικό DNA Μειωμένη έκφραση Ίση έκφραση Αυξημένη έκφραση.

51 Microarrays DNA chips Ακριβή τεχνική Όχι διαθέσιμο εμπορικά για χρήση ρουτίνας Τεχνολογικά προβλήματα υποστήριξης ΌΧΙ ΠΛΕΟΝ

52 ΠΙΣΤΟΠΟΙΗΣΗ Η διαγνωστική ποιότητα της τεχνικής πρέπει να δοκιμαζεται σε κυτταρικές σειρές που φέρουν γνωστές ανευπλοϊδίες, επιθηλιακά κύτταρα και καρκινικές σειρές

53

54

55

56

57

58 Καίρια ερωτήματα Είναι ασφαλές για τα έμβρυα? Σε ποιο στάδιο να πραγματοποιείται η βιοψία Τελευταίες τάσεις προς blastocyst and PB biopsy Issues surrounding bl. Biopsy is it right for PGD? Μπορεί ο ΠΓΕ να αυξήσει τα ποσοστά εγκυμοσύνης? Το ζητούμενο παραμένει Take home healthy baby rate More Data is required ESHRE task force

59

Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα

Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα MAΡΙΑ ΠΑΠΑΛΟΥΚΑ Κλινική Εμβρυολόγος Μονάδα Αναπαραγωγικής Ιατρικής Περιεχόμενα Ορισμός Ιστορική Αναδρομή Γενετική

Διαβάστε περισσότερα

Προεμφυτευτική Γενετική Διάγνωση. Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος

Προεμφυτευτική Γενετική Διάγνωση. Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος Προεμφυτευτική Γενετική Διάγνωση Μιχαλόπουλος Γιάννης Μαιευτήρας - Γυναικολόγος Στάδια Προεμφυτευτικής Γενετικής Διάγνωσης (P.G.D) Διέγερση ωοθηκών για την ωρίμανση μεγάλου αριθμού (ει δυνατόν ) ωοθυλακίων

Διαβάστε περισσότερα

Χρωμοσωματικές ανωμαλίες

Χρωμοσωματικές ανωμαλίες Χρωμοσωματικές ανωμαλίες ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΕΥΘΥΝΟΝΤΑΙ ΓΙΑ: 50% ΤΩΝ ΑΥΘΟΡΜΗΤΩΝ ΑΠΟΒΟΛΩΝ ΠΕΡΙΣΣΟΤΕΡΑ ΑΠΟ 60 ΣΥΝΔΡΟΜΑ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ ~0.7% ΤΩΝ ΒΡΕΦΩΝ ΕΜΦΑΝΙΖΟΝΤΑΙ ΣΤΟ 2 % ΤΩΝ ΚΥΗΣΕΩΝ ΜΗΤΕΡΩΝ ΑΝΩ ΤΩΝ

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα

Προεμφυτευτικός Γενετικός έλεγχος (ΠΓΔ) Ε.Καναβάκης Καθηγητής Ιατρικής Γενετικής

Προεμφυτευτικός Γενετικός έλεγχος (ΠΓΔ) Ε.Καναβάκης Καθηγητής Ιατρικής Γενετικής Προεμφυτευτικός Γενετικός έλεγχος (ΠΓΔ) Ε.Καναβάκης Καθηγητής Ιατρικής Γενετικής Εργαστήριο Ιατρικής Γενετικής Επίπτωση Γενετικών Νοσημάτων 50% αποβολών 1ου τριμήνου υπάρχει χρωμοσωμική ανωμαλία 2% νεογνών,

Διαβάστε περισσότερα

Διαδικασία με την οποία εντοπίζονται και μεταφέρονται στη μήτρα τα γενετικά φυσιολογικά έμβρυα που γονιμοποιούνται εξωσωματικά (IVF)

Διαδικασία με την οποία εντοπίζονται και μεταφέρονται στη μήτρα τα γενετικά φυσιολογικά έμβρυα που γονιμοποιούνται εξωσωματικά (IVF) Σύγχρονη Προσέγγιση στην Προεμφυτευτική Γενετική Διάγνωση (PGD (PGD)) Το παρόν Χριστίνα Βρεττού Ε.ΔΙ.Π. Εργαστήριο Ιατρικής Γενετικής Πανεπιστημίου Αθηνών Διευθύντρια: Καθηγήτρια Σοφία Κίτσιου Κίτσιου--Τζέλη

Διαβάστε περισσότερα

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ

ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ 1) ΑΝΩΜΑΛΙΕΣ ΣΤΟΝ ΑΡΙΘΜΟ ΤΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΕΥΠΛΟΕΙΔΙΑ: ΚΑΘΕ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΑΡΙΘΜΟΥ Ν (ΑΠΛΟΕΙΔΕΣ ΓΟΝΙΔΙΩΜΑ) 3Ν ΑΥΘΟΡΜΗΤΕΣ ΑΠΟΒΟΛΕΣ 4Ν τριπλοειδία Α) Γονιμοποίηση ωαρίου

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης

ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης Οι ανιχνευτικές εξετάσεις (screening test) έχουν ευρεία εφαρμογή και μεγάλη πρακτική χρησιμότητα στον προγεννητικό έλεγχο. Ο προγεννητικός έλεγχος

Διαβάστε περισσότερα

ΣΥΜΒΟΛΗ ΣΤΗΝ ΠΡΟΕΜΦΥΤΕΥΤΙΚΗ ΧΡΩΜΟΣΩΜΙΚΗ ΔΙΑΓΝΩΣΗ ΑΝΕΥΠΛΟΕΙΔΙΩΝ ΚΑΙ ΦΥΛΟΥ ΜΕ ΤΗΝ ΜΕΘΟΔΟΛΟΓΙΑ ΤΟΥ ΣΥΓΚΡΙΤΙΚΟΥ ΓΟΝΙΔΙΩΜΑΤΙΚΟΥ ΥΒΡΙΔΙΣΜΟΥ (CGH)

ΣΥΜΒΟΛΗ ΣΤΗΝ ΠΡΟΕΜΦΥΤΕΥΤΙΚΗ ΧΡΩΜΟΣΩΜΙΚΗ ΔΙΑΓΝΩΣΗ ΑΝΕΥΠΛΟΕΙΔΙΩΝ ΚΑΙ ΦΥΛΟΥ ΜΕ ΤΗΝ ΜΕΘΟΔΟΛΟΓΙΑ ΤΟΥ ΣΥΓΚΡΙΤΙΚΟΥ ΓΟΝΙΔΙΩΜΑΤΙΚΟΥ ΥΒΡΙΔΙΣΜΟΥ (CGH) ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Πρόγραμμα Μεταπτυχιακών Σπουδών Στις Εφαρμογές Βασικών Ιατρικών Επιστημών ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΣΥΜΒΟΛΗ ΣΤΗΝ ΠΡΟΕΜΦΥΤΕΥΤΙΚΗ ΧΡΩΜΟΣΩΜΙΚΗ

Διαβάστε περισσότερα

Έλεγχος φορέων. Πληροφορίες για Ασθενείς και Οικογένειες

Έλεγχος φορέων. Πληροφορίες για Ασθενείς και Οικογένειες 16 Έλεγχος φορέων Αισθανόµαστε ιδιαίτερη υποχρέωση στα άτοµα που µας επέτρεψαν να τους πάρουµε συνεντεύξεις για να φτιαχτεί αυτό το φυλλάδιο. Τα ονόµατα έχουν τροποποιηθεί για την προστασία προσωπικών

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

cell-free DNA στο μητρικό αίμα

cell-free DNA στο μητρικό αίμα cell-free DNA στο μητρικό αίμα Εφαρμογή στην κλινική πράξη στην Ελλάδα Παπαϊωάννου Γεώργιος-Κων/νος, PhD Υπεύθυνος Ιατρικής Εμβρύου Maιευτική & Γυναικολογική Κλινική ΓΑΙΑ Cell free DNA / Εισαγωγή στην

Διαβάστε περισσότερα

Αλέξανδρος Δ. Τζεφεράκος

Αλέξανδρος Δ. Τζεφεράκος Κλασσική Εξωσωματική Γονιμοποίηση και Εμβρυομεταφορά στο στάδιο της βλαστοκύστης Αλέξανδρος Δ. Τζεφεράκος «ΜΟΝΑΝΑΔΑ ΑΝΑΠΑΡΑΓΩΓΙΚΗΣ ΙΑΤΡΙΚΗΣ» μαιευτήρια «ΜΗΤΕΡΑ» και «ΛΗΤΩ» 2002 Κατά τη διαδικασία της εξωσωματικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008 ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ Δρ.Δ.Λάγγας Αθήνα 2008 Ορισμοί Γενετική: μελέτη της κληρονομικότητας και των παραλλαγών της Ιατρική γενετική: η γενετική του ανθρώπινου είδους Κλινική γενετική:

Διαβάστε περισσότερα

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη.

Γενετικό γλωσσάριο. Πληροφορίες για Ασθενείς και Οικογένειες. Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. 12 Γενετικό γλωσσάριο Μεταφρασµένο από την Κατερίνα Πουγούνια και την Μαρία Τζέτη. Ιανουάριος 2009 Τροποποιηµένο από το γλωσσάριο που αρχικά δηµιουργήθηκε από το Πάρκο Γενετικής Γνώσης London IDEAS (London

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

Μη επεμβατικός Προγεννητικός έλεγχος

Μη επεμβατικός Προγεννητικός έλεγχος Μη επεμβατικός Προγεννητικός έλεγχος Α. Κολιαλέξη, Βιοπαθολόγος PhD Εργαστήριο Ιατρικής Γενετικής Πανεπιστημίου Αθηνών Μη επεμβατικός ΠΕ από cffdna στο πλάσμα εγκύου Ελεύθερο Εμβρυϊκό DNA στη μητρική κυκλοφορία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

KΕΝΤΡΟ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ & ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΗΣ

KΕΝΤΡΟ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ & ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΗΣ KΕΝΤΡΟ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ & ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΗΣ η υπεροχή, η πρωτοπορία και η αξιοπιστία βρίσκονται στο DNA μας αντί εισαγωγής Η δημιουργία και η διεύθυνση ενός από τα κορυφαία Κέντρα Μοριακής Βιολογίας και

Διαβάστε περισσότερα

Προεμφυτευτική γενετική διάγνωση (PGD) και προεμφυτευτικός γενετικός έλεγχος (PGS): ειδικές εξετάσεις, ή εφαρμογές ρουτίνας;

Προεμφυτευτική γενετική διάγνωση (PGD) και προεμφυτευτικός γενετικός έλεγχος (PGS): ειδικές εξετάσεις, ή εφαρμογές ρουτίνας; ΕΘΝΙΚΗ ΕΠΙΤΡΟΠΗ ΒΙΟΗΘΙΚΗΣ Ελεύθερο Σεμινάριο για τη Βιοηθική και το Δίκαιο Αθήνα, 31 Ιανουαρίου 2012 Προεμφυτευτική γενετική διάγνωση (PGD) και προεμφυτευτικός γενετικός έλεγχος (PGS): ειδικές εξετάσεις,

Διαβάστε περισσότερα

ΥΠΟΓΟΝΙΜΟΤΗΤΑ ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ ΛΕΚΤΟΡΑΣ Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ: ΚΑΘ. Α.

ΥΠΟΓΟΝΙΜΟΤΗΤΑ ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ ΛΕΚΤΟΡΑΣ Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ: ΚΑΘ. Α. ΥΠΟΓΟΝΙΜΟΤΗΤΑ ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ ΛΕΚΤΟΡΑΣ Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ: ΚΑΘ. Α. ΑΝΤΣΑΚΛΗΣ ΥΠΟΓΟΝΙΜΟΤΗΤΑ Η ανικανότητα σύλληψης μετά από ένα χρόνο σεξουαλικών

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΑΝΔΡΙΚΗ ΥΠΟΓΟΝΙΜΟΤΗΤΑ

ΑΝΔΡΙΚΗ ΥΠΟΓΟΝΙΜΟΤΗΤΑ Μεσογείων 6, Αμπελόκηποι 115 27 ΑΝΔΡΙΚΗ ΥΠΟΓΟΝΙΜΟΤΗΤΑ [1]/[6] ΑΝΔΡΙΚΗ ΥΠΟΓΟΝΙΜΟΤΗΤΑ Εισαγωγή Περίπου το 15% των ζευγαριών δεν είναι σε θέση να συλλάβουν μετά από ένα χρόνο ελεύθερων σεξουαλικών επαφών.

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX

ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ ΒΑΣ. ΣΙΔΕΡΗΣ, ΜΕΣΟΓΕΙΩΝ 6, ΑΜΠΕΛΟΚΗΠΟΙ 115 27, ΑΘΗΝΑ, ΤΗΛ: 210 7777.654, FAX ΔΙΑΓΝΩΣΤΙΚΗ ΑΘΗΝΩΝ Μικροβιολογικό & Ερευνητικό Εργαστήριο Καθ έξιν Αποβολές Οι καθ 'έξιν αποβολές είναι μια ασθένεια σαφώς διακριτή από τη στειρότητα, και που ορίζεται ως δύο ή περισσότερες αποτυχημένες

Διαβάστε περισσότερα

Σήµερα η τεχνική αυτή είναι καταξιωµένη και µοναδική για την ανίχνευση γονιδιακών και χρωµοσωµατικών γενετικών διαταραχών όπως η µεσογειακή

Σήµερα η τεχνική αυτή είναι καταξιωµένη και µοναδική για την ανίχνευση γονιδιακών και χρωµοσωµατικών γενετικών διαταραχών όπως η µεσογειακή Π ρ ό σ κ λ η σ η Αγαπητοί Συνάδελφοι, Η Προεµφυτευτική Γενετική ιάγνωση (ΠΓ ) βρίσκεται στη φαρέτρα της Υποβοηθούµενης Αναπαραγωγής (Υπ Αν) για περισσότερα από 20 χρόνια. Ύστερα από πολλές φάσεις αµφισβήτησης,

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Πρόγραμμα Μεταπτυχιακών Σπουδών «Βιολογία της Αναπαραγωγής» Ωρολόγιο Πρόγραμμα Εαρινού Εξαμήνου Ακαδημαϊκού έτους 2009-2010

Πρόγραμμα Μεταπτυχιακών Σπουδών «Βιολογία της Αναπαραγωγής» Ωρολόγιο Πρόγραμμα Εαρινού Εξαμήνου Ακαδημαϊκού έτους 2009-2010 Πρόγραμμα Μεταπτυχιακών Σπουδών «Βιολογία της Αναπαραγωγής» Ωρολόγιο Πρόγραμμα Εαρινού Εξαμήνου Ακαδημαϊκού έτους 2009-2010 Εβδ. Μήνας/Ημέρα MAΘΗΜΑ ιάλεξη ΕΡΓΑΣΤΗΡΙΟ Ώρα Εισηγητής 1 η 1/2/10 2/2/10 Ορισμοί,

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr. Πίνακας 1.

Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr. Πίνακας 1. Ενημερωτικό Δελτίο Τεύχος 1 Δεκέμβριος 2007 Εργαστήριο Κλινικής Βιοχημείας και Εργαστηριακής Ιατρικής Οδός Ξενίας 1, 115 27 Αθήνα, T ηλ.: 210 7775444 Fax: 210 7775420 e-mail: info@diamedica.gr http://www.diamedica.gr

Διαβάστε περισσότερα

Ωρολόγιο Πρόγραμμα Εαρινού Εξαμήνου Ακαδημαϊκό Έτος 2012-2013

Ωρολόγιο Πρόγραμμα Εαρινού Εξαμήνου Ακαδημαϊκό Έτος 2012-2013 ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «ΒΙΟΛΟΓΙΑ ΤΗΣ ΑΝΑΠΑΡΑΓΩΓΗΣ» Βιόπολις, 41110 Λάρισα E-mail: messinis@med.uth.gr Τηλ. 2413502795, 2413502796 Fax.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΔΙΕΥΘΥΝΤΡΙΑ: ΚΑΘΗΓΗΤΡΙΑ Α. ΑΘΑΝΑΣΙΑΔΟΥ «ΣΥΜΒΟΛΗ ΣΤΗ ΜΟΡΙΑΚΗ ΠΡΟΓΕΝΝΗΤΙΚΗ ΔΙΑΓΝΩΣΗ ΑΝΕΥΠΛΟΕΙΔΙΩΝ ΚΑΙ ΦΥΛΟΥ ΜΕ ΧΡΗΣΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης

ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Μαλτέζος Ιωάννης ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΑΙ ΣΥΝΔΡΟΜΟ DOWN ΥΠΟ ΤΗΝ ΑΙΓΊΔΑ ΤΗΣ ΙΕΡΗΣ ΜΗΤΡΟΠΟΛΗΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ Μαλτέζος Ιωάννης Κληρονομικότητα Το σώμα μας αποτελείται από εκατομμύρια κύτταρα εκ των οποίων τα περισσότερα εξ αυτών

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΕΚΑ (10) Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής?

Τι συµβαίνει σε ένα Εργαστήριο Γενετικής? 12 εργαστήριο ίσως ελέγξει τα αποθηκευµένα δείγµατα (ιδιαίτερα εάν ο αρχικός έλεγχος δεν έδωσε αποτέλεσµα), αλλά µόνο εάν έχετε δώσει τη γραπτή σας συγκατάθεση για κάτι τέτοιο. Με αυτό τον τρόπο οι ασθενείς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΚΑΙ ΠΟΛΥΔΥΝΑΜΑ ΚΥΤΤΑΡΑ (STEM CELLS).

ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΚΑΙ ΠΟΛΥΔΥΝΑΜΑ ΚΥΤΤΑΡΑ (STEM CELLS). ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΚΑΙ ΠΟΛΥΔΥΝΑΜΑ ΚΥΤΤΑΡΑ (STEM CELLS). ΚΩΝΣΤΑΝΤΙΝΟΣ ΣΤΕΦΑΝΙΔΗΣ Επικ. Καθηγητής Α ΜΑΙΕΥΤΙΚΗ & ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΔΙΕΥΘΥΝΤΗΣ ΚΑΘ. Α. ΑΝΤΣΑΚΛΗΣ ΜΕΛΛΟΝΤΙΚΟΙ ΣΤΟΧΟΙ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Το έμβρυο ως «ασθενής»: Προεμφυτευτική Γενετική Διάγνωση και επιλογή εμβρύου. Βιοηθική προσέγγιση. Aλεξάνδρα Ντρουμπογιάννη

Το έμβρυο ως «ασθενής»: Προεμφυτευτική Γενετική Διάγνωση και επιλογή εμβρύου. Βιοηθική προσέγγιση. Aλεξάνδρα Ντρουμπογιάννη Το έμβρυο ως «ασθενής»: Προεμφυτευτική Γενετική Διάγνωση και επιλογή εμβρύου. Βιοηθική προσέγγιση The embryo as patient. Preimplantation Genetic Diagnosis and the selection of embryos. A Bioethical approach

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Δηλώσεις συμμετοχής: grammateia@gmail.com locus_medicus@yahoo.gr

Δηλώσεις συμμετοχής: grammateia@gmail.com locus_medicus@yahoo.gr Δηλώσεις συμμετοχής: grammateia@gmail.com locus_medicus@yahoo.gr ΠΕΜΠΤΗ 31 ΜΑΪΟΥ 2012 16:00-17:00 Διαδικασίες Ίδρυσης και Λειτουργίας Ιδιωτικών Εργαστηρίων Κώστας Τυροσβούτης, Βιολόγος, Ιδρυτής Εργαστηρίου

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα

Στην κεντρική σελίδα του δικτυακού τόπου www.embio.com.gr. μπορείτε να δείτε video της μονάδας embio

Στην κεντρική σελίδα του δικτυακού τόπου www.embio.com.gr. μπορείτε να δείτε video της μονάδας embio Στην κεντρική σελίδα του δικτυακού τόπου www.embio.com.gr μπορείτε να δείτε video της μονάδας embio 2 3 Ηλίας Θ. Γάτος MD Χειρουργός Γυναικολόγος - Μαιευτήρας Eιδικός στην εξωσωματική γονιμοποίηση και

Διαβάστε περισσότερα

ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΓΙΑ ΤΗΝ ΘΕΡΑΠΕΙΑ ΤΩΝ ΕΠΑΝΕΙΛΗΜΜΕΝΩΝ ΑΠΟΒΟΛΩΝ

ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΓΙΑ ΤΗΝ ΘΕΡΑΠΕΙΑ ΤΩΝ ΕΠΑΝΕΙΛΗΜΜΕΝΩΝ ΑΠΟΒΟΛΩΝ ΣΥΓΧΡΟΝΕΣ ΑΠΟΨΕΙΣ ΓΙΑ ΤΗΝ ΘΕΡΑΠΕΙΑ ΤΩΝ ΕΠΑΝΕΙΛΗΜΜΕΝΩΝ ΑΠΟΒΟΛΩΝ Σ. ΔΕΝΔΡΙΝΟΣ ΑΝ. ΚΑΘΗΓΗΤΗΣ Β ΜΑΙΕΥΤΙΚΗΣ-ΓΥΝΑΙΚΟΛΟΓΙΚΗΣ ΚΛΙΝΙΚΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΟΡΙΣΜΟΣ 2 ή 3 αποβολές προ των 20 wks ΠΟΣΟΣΤΟ ΕΜΦΑΝΙΣΗΣ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Μονάδα Ιατρικώς Υποβοηθούμενης Αναπαραγωγής ΕΜΒΡΥΟΓΕΝΕΣΙΣ, Κηφισίας 49 & Ζηρίδη, 15123 Μαρούσι. 2

Μονάδα Ιατρικώς Υποβοηθούμενης Αναπαραγωγής ΕΜΒΡΥΟΓΕΝΕΣΙΣ, Κηφισίας 49 & Ζηρίδη, 15123 Μαρούσι. 2 ΕΛΛΗΝΙΚΟ ΠΕΡΙΟΔΙΚΟ ΓΥΝΑΙΚΟΛΟΓΙΑΣ & MΑΙΕΥΤΙΚΗΣ TΟΜ. 11, TΕΥΧ. 1, ΣΕΛ. 01-06, 2012 ΕΝΔΙΑΦΕΡΟΥΣΑ ΠΕΡΙΠΤΩΣΗ Γέννηση ύστερα από βιοψία πολικών σωματίων και προεμφυτευτικό γενετικό έλεγχο για ανευπλοειδία με

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Εργαστήριο Ιστολογίας & Εμβρυολογίας. Α. Κοτσίνας Επικ. Καθηγητής

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Εργαστήριο Ιστολογίας & Εμβρυολογίας. Α. Κοτσίνας Επικ. Καθηγητής ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Εργαστήριο Ιστολογίας & Εμβρυολογίας Α. Κοτσίνας Επικ. Καθηγητής Τι είναι οι συγγενείς ανωμαλίες Ανατομικές ανωμαλίες οι οποίες υπάρχουν ήδη από

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

Χρήσιμες πληροφορίες για την εξωσωματική γονιμοποίηση

Χρήσιμες πληροφορίες για την εξωσωματική γονιμοποίηση Χρήσιμες πληροφορίες για την εξωσωματική γονιμοποίηση Περιεχόμενα Μιχάλης Φραγκουλίδης ΜSc, DFFP, BSCCP σύντομο βιογραφικό σημείωμα 11 λόγοι για να εμπιστευτείτε το γέννημα Ενότητα 1 Η θεραπεία εξωσωματικής

Διαβάστε περισσότερα

Διαχείριση του ζευγαριού που θέλει να τεκνοποιήσει

Διαχείριση του ζευγαριού που θέλει να τεκνοποιήσει Διαχείριση του ζευγαριού που θέλει να τεκνοποιήσει Υπογονιµότητα: αδυναµία σύλληψης µετά από 1 χρόνο ελεύθερων σεξουαλικών επαφών Ικανότητα σύλληψης/µήνα: ~20% 10-15% των ζευγαριών: πρόβληµα υπογονιµότητας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες 12 Φυλοσύνδετη στο Χ Ή την τοπική σας κλινική γενετικής διάγνωσης: κληρονοµικότητα Εργαστήριο Ιατρικής Γενετικής Πανεπιστήµιο Αθηνών Νοσοκοµείο Παίδων " Αγία Σοφία" Αθήνα Τηλ: +210 7795553 http://iatriki-genetiki.med.uoa.gr

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

ΑΝΑΠΑΡΑΓΩΓΙΚΟ. 2. (α) Ποια μέρη του γεννητικού συστήματος του άνδρα δείχνουν οι αριθμοί 1-8 στο σχήμα;

ΑΝΑΠΑΡΑΓΩΓΙΚΟ. 2. (α) Ποια μέρη του γεννητικού συστήματος του άνδρα δείχνουν οι αριθμοί 1-8 στο σχήμα; ΑΝΑΠΑΡΑΓΩΓΙΚΟ 1. (α) Τι αντιπροσωπεύουν οι αριθμοί 1-6 στο σχήμα; (β) Εξηγήστε τι είναι τα ωοθυλάκια και ποιος είναι ο ρόλος τους. (γ) Σε ποιο μέρος του γεννητικού συστήματος της γυναίκας αρχίζει η ανάπτυξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία

Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία β-θαλασσαιμία Θάλασσα + αίμα = θαλασσαιμία Εισαγωγή Η πιο κοινή γενετική νόσος που κληρονομείται Mενδελικά ~ 1 : 100.000 παγκοσμίως ~ 1 : 10.000

Διαβάστε περισσότερα

ΓΥΜΝΑΣΙΟ ΚΙΤΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2008-2009 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2009

ΓΥΜΝΑΣΙΟ ΚΙΤΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2008-2009 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2009 ΓΥΜΝΑΣΙΟ ΚΙΤΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2008-2009 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2009 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ(40 μονάδες) ΗΜΕΡΟΜΗΝΙΑ: / / 2009 ΤΑΞΗ: Γ ΓΥΜΝΑΣΙΟΥ ΔΙΑΡΚΕΙΑ: 2 ώρες(βιολογία-χημεία) Όνομα μαθητή /

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον

Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον 1 Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον > JM COSTA Εργαστήριο Cerba Aθήνα 11 Φεβρουαρίου, 2012 2 Η NIPD προτείνεται στην κλινική πράξη ως διαδικασία ρουτίνας Ναι Όχι Η NIPD γίνεται

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Γενετικός Έλεγχος για Λόγους Υγείας

Γενετικός Έλεγχος για Λόγους Υγείας Γενετικός Έλεγχος για Λόγους Υγείας ΚΆΤΩ ΑΠΌ ΠΟΙΕΣ ΣΥΝΘΉΚΕΣ ΠΡΟΒΛΈΠΕΤΑΙ Ο ΓΕΝΕΤΙΚΌΣ ΈΛΕΓΧΟΣ; ΕΠΑΓΓΕΛΜΑΤΙΚΉ ΓΕΝΕΤΙΚΉ ΣΥΜΒΟΥΛΕΥΤΙΚΉ ΤΙ ΨΆΧΝΟΥΜΕ ΜΕ ΤΟΝ ΓΕΝΕΤΙΚΌ ΈΛΕΓΧΟ; Η ΔΙΚΉ ΣΑΣ ΑΠΌΦΑΣΗ Γενετικός Έλεγχος

Διαβάστε περισσότερα

Γενετικοί παράγοντες και η αντιμετώπιση της υπογονιμότητας

Γενετικοί παράγοντες και η αντιμετώπιση της υπογονιμότητας Γενετικοί παράγοντες και η αντιμετώπιση της υπογονιμότητας Δρ. Ελένη Κοντογιάννη Εμβρυολόγος-Γενετιστής Επιστημονική Διευθύντρια Ινστιτούτου Γυναικολογίας και Υποβοηθούμενης Αναπαραγωγής «IVF and Genetics»

Διαβάστε περισσότερα

Μίτωση - Μείωση. Γαµετογένεση και Αναπαραγωγή. Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr)

Μίτωση - Μείωση. Γαµετογένεση και Αναπαραγωγή. Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr) Μίτωση - Μείωση Γαµετογένεση και Αναπαραγωγή Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr) Σήµερα... Ορολογία Κυτταρικός κύκλος Μίτωση Μείωση Γαµετογένεση Βιολογικοί κύκλοι ΗΓενετική είναι ο κλάδος της Βιολογίας

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του 1 Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του μαστού. Ο καρκίνος του μαστού είναι με μεγάλη διαφορά

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Τμήμα Καθ' έξιν Αποβολών

Τμήμα Καθ' έξιν Αποβολών Τμήμα Καθ' έξιν Αποβολών Αν. Καθηγητής Σ. Δενδρινός 1 / 7 Το Τμήμα Επανειλημμένων Αποβολών αποτελεί ειδικό Τμήμα της Β Μαιευτικής και Γυναικολογικής Κλινικής του Πανεπιστημίου Αθηνών με αντικείμενο τη

Διαβάστε περισσότερα

Μαυροματάκης Γιώργος Βιολόγος

Μαυροματάκης Γιώργος Βιολόγος Βιολογία Γ'Λυκείου Κατεύθυνσης Εικονογραφημένη Επανάληψη Μαυροματάκης Γιώργος Βιολόγος (gmavromat@gmail.com) Χανιά 2009-2010 1 Κεφάλαιο 1ο Το γενετικό υλικό 2 3 Με τη βοήθεια της φωτογραφίας που ακολουθεί

Διαβάστε περισσότερα

Τι είναι ο προληπτικός έλεγχος?

Τι είναι ο προληπτικός έλεγχος? 16 EuroGentest Ιστοσελίδα ελεύθερης πρόσβασης που παρέχει πληροφορίες για τον γενετικό έλεγχο και συνδέσµους για οµάδες υποστήριξης σε ολόκληρη την Ευρώπη. Ιστοσελίδα: www.eurogentest.org Τι είναι ο προληπτικός

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

ΤΟ ΜΕΛΛΟΝ ΤΩΝ ΠΑΙ ΙΩΝ ΤΗΣ ΕΞΩΣΩΜΑΤΙΚΗΣ ΓΟΝΙΜΟΠΟΙΗΣΗΣ. Μανουρά Αντωνία. Νεογνολογική Κλινική Πανεπιστηµίου Κρήτης

ΤΟ ΜΕΛΛΟΝ ΤΩΝ ΠΑΙ ΙΩΝ ΤΗΣ ΕΞΩΣΩΜΑΤΙΚΗΣ ΓΟΝΙΜΟΠΟΙΗΣΗΣ. Μανουρά Αντωνία. Νεογνολογική Κλινική Πανεπιστηµίου Κρήτης ΤΟ ΜΕΛΛΟΝ ΤΩΝ ΠΑΙ ΙΩΝ ΤΗΣ ΕΞΩΣΩΜΑΤΙΚΗΣ ΓΟΝΙΜΟΠΟΙΗΣΗΣ Μανουρά Αντωνία Νεογνολογική Κλινική Πανεπιστηµίου Κρήτης Σχεδόν τριάντα χρόνια έχουν περάσει από τη γέννηση του πρώτου «µωρού του σωλήνα». Από τότε,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα