«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα»

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα»"


1 «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα»

2 «Τι είναι Μετάλλαξη» Γενικά με τον όρο μετάλλαξη ονομάζουμε τις αλλαγές στο γενετικό υλικό, το DNA δηλαδή ενός ζωντανού οργανισμού και πρόκειται για τυχαία και σπάνια φαινόμενα που μπορεί να συμβούν σε οποιοδήποτε κύτταρο είτε σωματικό είτε γεννητικό. Οι μεταλλάξεις μπορούν να γίνουν είτε τυχαία, δηλαδή λόγω κάποιας ανωμαλίας, αλλά μπορεί να συμβούν και με την επίδραση παραγόντων από το περιβάλλον.

3 «Είδη Μεταλλάξεων» Οι μεταλλάξεις χωρίζονται από τους γενετιστές (επιστήμονες που ασχολούνται με τις μεταλλάξεις), στις εξείς κατηγορίες: 1. τις γονιδιακές: των οποίων η έκταση αφορά μικρό αριθμό βάσεων, στις οποίες συμβαίνει αντικατάσταση, προσθήκη ή έλλειψη. 2. τις χρωμοσωμικές: των οποίων η έκταση αφορά αλλαγές σε μεγαλύτερο τμήμα του χρωμοσώματος (= το χρωμόσωμα όπως ήδη γνωρίζουμε είναι το DNA που βρίσκεται στον πυρήνα των ευκαριωτικών κυττάρων.

4 ΧΡΩΜΟΣΩΜΑ Διάγραμμα ευκαριωτικού χρωμοσώματος. 1) χρωματίδα/ινίδιο/δομή DNA 2) κεντρομερίδιο - το σημείο όπου οι δύο χρωματίδες αγγίζουν. 3) κοντός βραχίονας. 4) μακρύς βραχίονας.

5 Οι χρωμοσωμικές ανωμαλίες-μεταλλάξεις χωρίζονται στις: Αριθμητικές: Οι αριθμητικές χρωμοσωμικές ανωμαλίες είναι ο μη διαχωρισμός των ομόλογων χρωμοσωμάτων (= ομόλογα χρωμοσώματα ονομάζουμε τα ζεύγη χρωμοσωμάτων με ίδιο σχήμα, μέγεθος και ιδιότητες). Δομικές: Οι δομικές χρωμοσωμικές ανωμαλίες αλλάζουν την διάταξη ή την ποσότητα του DNA και τα είδη τους είναι:

6 Έλλειψη : απώλεια γενετικού υλικού. Διπλασιασμός Αναστροφή: αλλάζει η διάταξη των γονιδίων στο χρωμόσωμα. Μετατόπιση Αμοιβαία μετατόπιση: ανταλλαγή θέσεων χρωμοσωμικών τμημάτων μη ομολόγων χρωμοσωμάτων. 3) τις ουδέτερες: των οποίων η αλλαγή γίνεται σε ένα μόνο αμινοξύ. 4) τις σιωπηλές: των οποίων δεν αλλάζει η αλληλουχία των αμινοξέων της δημιουργούμενης πρωτεΐνης.



9 «Παράγοντες Μεταλλάξεων» Οι μεταλλάξεις προφανώς δεν συμβαίνουν από μόνες τους. Υπάρχουν παράγοντες από τους οποίους προκαλούνται και ονομάζονται «μεταλλαξογόνοι παράγοντες». Αυτοί είναι:

10 Χρωμοσ ώματα Παράγοντες Χημικές Ουσίες Ακτινοβ ολίες

11 Χρωμοσώματα: Όταν τα χρωμοσώματα παρουσιάσουν τις ανωμαλίες που αναφέραμε τότε μπορούν να προκαλέσουν μετάλλαξη. Ακτινοβολίες: Ο ανθρώπινος πληθυσμός εκτίθεται με πολλούς τρόπους σε ακτινοβολίες π.χ. για ιατρικούς σκοπούς ή για επαγγελματικούς λόγους, είτε ακόμη για μια απλή βόλτα στη θάλασσα. Επίσης εκτίθεται στην ακτινοβολία, που φθάνει στη Γη από το διάστημα, και στην ακτινοβολία που εκπέμπουν τα ραδιενεργά κοιτάσματα. Λόγω λοιπόν της έκθεσης του ανθρώπου στον ήλιο, υπάρχει τεράστια πιθανότητα μετάλλαξης (μετάλλαξη από ακτινοβολία, μπορεί να θεωρηθεί ακόμα και μια ελιά που μετατράπηκε σε μελάνωμα).

12 Χημικές ουσίες: Σε κάποια επαγγέλματα που ασχολούνται με βαρέα μέταλλα και βλαβερές χημικές ουσίες είναι περισσότερο επιρρεπή στην εμφάνιση καρκίνου σε κάποια όργανα του οργανισμού π.χ. ένα σύνηθες παράδειγμα στους πνεύμονες.

13 «Συνέπειες Μεταλλάξεων» Οι μεταλλάξεις μπορούν να προκαλέσουν: Δρεπανοκυτταρική Αναιμία: Η πρώτη γενετική ασθένεια που βρέθηκε ότι είναι αποτέλεσμα συγκεκριμένης γονιδιακής μετάλλαξης ήταν η δρεπανοκυτταρική αναιμία. Το 1949, ο Linus Pauling και οι συνεργάτες του ανακάλυψαν ότι η αιμοσφαιρίνη των ενηλίκων, HbA, που αποτελείται από τέσσερις πολυπεπτιδικές αλυσίδες, δύο α και δύο β, διέφερε στα φυσιολογικά άτομα σε σχέση με εκείνα που έπασχαν από δρεπανοκυτταρική αναιμία. Η μελέτη της δρεπανοκυτταρικής αναιμίας αποτελεί σταθμό στην κατανόηση των μηχανισμών δημιουργίας των μεταλλάξεων.

14 Η δρεπανοκυτταρική αναιμία δημιουργείται από μια μετάλλαξη του γονιδίου που κωδικοποιεί τη β- πολυπεπτιδική αλυσίδα της αιμοσφαιρίνης, α. Στο μοντέλο του μορίου της αιμοσφαιρίνης φαίνεται η θέση της μετάλλαξης, β. φυσιολογικό ερυθροκύτταρο, επάνω και δρεπανοειδές ερυθροκύτταρο, κάτω.

15 Στους ανθρώπους προκαλείται δρεπάνωση μόνο σε συνθήκες μεγάλης έλλειψης οξυγόνου, όπως σε υψόμετρο μεγαλύτερο από m. Το παράδειγμα της δρεπανοκυτταρικής αναιμίας δείχνει ότι μία ασθένεια μπορεί να είναι το αποτέλεσμα αντικατάστασης μίας μόνο από τα δισεκατομμύρια βάσεων DNA! Αλλαγή αυτού του τύπου ονομάζεται αντικατάσταση βάσης, και μπορεί να έχει ποικίλα αποτελέσματα στην πρωτεΐνη που παράγεται από το αντίστοιχο γονίδιο.

16 Σύνδρομο down (τρισωμία 21) : Το σύνδρομο Down,περιγράφει μια χρωμοσωμική ανωμαλία, που περικλείει ένα σύνολο χαρακτηριστικών, τα οποία υπάρχουν εκ γενετής στους φορείς της γενετικής αυτής βλάβης και αφορούν ανωμαλίες στη σωματική διάπλαση, τη νοητική ανάπτυξη και την ψυχοκοινωνική εξέλιξή τους.

17 ~Καρκίνος: Άναρχος πολλαπλασιασμός των καρκινικών κυττάρων που υπάρχουν ήδη στον οργανισμό του κάθε ανθρώπου. Αιμορροφιλία: Πάθηση του αιμοποιητικού συστήματος και αφορά την πηκτικότητα του αίματος.

18 Κυστική ίνωση: Είναι γονίδιο που παράγει μια ρυθμιστική πρωτεΐνη που ελέγχει την διέλευση του χλωρίου στις μεμβράνες των επιθηλιακών κυττάρων των διαφόρων οργάνων του σώματος (πνεύμονες,πάγκρεας,έντερο).

19 Σύνδρομο Turner: Το σύνδρομο Τurner είναι µια γενετική ανωμαλία που σχετίζεται µε την έλλειψη ενός φυλετικού χρωµοσώµατος σε θηλυκά άτοµα. Φυσιολογικά, ο άνθρωπος έχει 46 χρωμοσώματα. Συμπτώματα του συνδρόμου: Διόγκωση των χεριών και των ποδιών Αναπαραγωγική στειρότητα Προβλήματα καρδιάς κ.τ.λ. Πλατύ λαιμό Παχυσαρκία

20 Οι μεταλλάξεις προκαλούν δεκάδες ακόμη ασθένειες όπως θαλασσαιμία-β, θαλασσαιμία-α, φαινυλκετονουρία, αλφισμός, σύνδρομο Klinefelter, και πολλές ακόμη.

21 «Μεταλλάξεις και η χρήση τους στην γενετική ποικιλότητα» Ο όρος γενετική ποικιλότητα αναφέρεται στη διαφοροποίηση του DNA μεταξύ των ατόμων του ίδιου είδους. Εύκολα αντιληπτά παραδείγματα - αποτελέσματα γενετικής ποικιλότητας είναι οι παρατηρούμενες διαφορές μεταξύ ανθρώπων διαφορετικών φυλών και μεταξύ ατόμων της ίδιας φυλής. Στα είδη που αναπαράγονται με αμφιγονία η γενετική ποικιλότητα εμπλουτίζεται περισσότερο καθώς οι απόγονοι (φυτικοί ή ζωικοί οργανισμοί) κληρονομούν από τους γονείς τους ένα μοναδικό πρακτικά συνδυασμό γονιδίων.

22 Οι μεταλλάξεις λοιπόν δεν είναι πάντοτε βλαβερές μολονότι οι περισσότερες μεταλλάξεις οδηγούν σε αποτέλεσμα που δεν είναι ευνοϊκό για τον οργανισμό, μερικές από αυτές παρόλα αυτά εμφανίζουν πλεονεκτήματα. Παράλληλα οι μεταλλάξεις δημιουργούν τα αλληλόμορφα γονίδια (= αλληλόμορφα γονίδια είναι αυτά που δρουν για το ίδιο γνώρισμα αλλά με διαφορετικό τρόπο. Για παράδειγμα αν υπάρχουν δύο διαφορετικά γονίδια που ελέγχουν το χρώμα του άνθους ενός φυτού, τότε μεταξύ τους είναι αλληλόμορφα).

23 Χωρίς τις μεταλλάξεις, η γενετική ποικιλότητα θα περιοριζόταν αρκετά και η εξέλιξη, όπως τη γνωρίζουμε σήμερα, δε θα είχε συμβεί. Με τις μεταλλάξεις δημιουργούνται νέα αλληλόμορφα που προσδίδουν νέες ιδιότητες στους οργανισμούς, έτσι αυξάνεται η γενετική ποικιλότητα. Χωρίς τις μεταλλάξεις δεν θα υπήρχε γενετική ποικιλότητα στους οργανισμούς.

24 «Βιβλιογραφία» %BB%CE%BB%CE%B1%CE%BE%CE%B7 &biw=1365&bih=665&q=μεταλλάξεις&o Βιβλίο Βιολογία γ γυμνάσιου C112/479/3165,12735/ 8C%CF%83%CF%89%CE%BC%CE%B1 me..69i57j69i59j0l4.7622j0j7&sourceid=chr 8C%CF%83%CF%89%CE%BC%CE%B1 malies.pdf

25 «ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ» ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ Μια εργασία των: Μπούρλα Ελένη Μακρυδάκη Ελευθερία Τμήμα: Γ 3 Ημερομηνία: 27/1/2015

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ Μια εργασία των: Μακρυδάκη Ελευθερία Μπούρλα Ελένη Τμήμα: Γ 3 Ημερομηνία: 27/1/2015 Γενικά με

Διαβάστε περισσότερα

Κεφάλαιο 6: Μεταλλάξεις

Κεφάλαιο 6: Μεταλλάξεις Κεφάλαιο 6: Μεταλλάξεις ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Τι ονομάζονται μεταλλάξεις και ποια τα κυριότερα είδη τους; 2. Ποιες οι διαφορές μεταξύ γονιδιακών και χρωμοσωμικών μεταλλάξεων; 3. Οι μεταλλάξεις στα σωματικά

Διαβάστε περισσότερα

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής Κεφάλαιο 6: ΜΕΤΑΛΛΑΞΕΙΣ -ΘΕΩΡΙΑ- Μεταλλάξεις είναι οι αλλαγές που συμβαίνουν στο γενετικό υλικό ενός οργανισμού, τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις) όσο και σε χρωμοσωμικό επίπεδο (χρωμοσωμικές

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα


ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΜΕΤΑΛΛΑΞΕΙΣ Γίνονται μόνο στο γενετικό υλικό των κυττάρων, δηλαδή στο DNA και έχουν μόνιμο χαρακτήρα. Δεν θεωρούνται μεταλλάξεις, μεταβολές των προϊόντων της έκφρασης του γενετικού

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/2015 29 12 2016 ΘΕΜΑ 1 ο Επιλέξτε τη σωστή απάντηση που συμπληρώνει τις παρακάτω προτάσεις: 1. Η περιοριστική

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού ΠΡΟΣΟΜΟΙΩΣΗ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΥΡΙΑΚΗ 4 ΜΑΪΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. α, Α2. β, Α3. δ, Α4. β, Α5. β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 6 ο...2 I. Μεταλλάξεις...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΚΕΦΑΛΑΙΟ 6 ο ΚΕΦΑΛΑΙΟ 6 ο...2 I. Μεταλλάξεις...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 1 ΚΕΦΑΛΑΙΟ 6 ο I. Μεταλλάξεις Εκπαιδευτικοί στόχοι: Μετά την ολοκλήρωση της µελέτης αυτού του κεφαλαίου ο µαθητής θα πρέπει

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος:

Διαβάστε περισσότερα

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις ΚΒφόίΙοιο 6 ΜειαΠΠά^εις 1. Ενας γενετιστής βρήκε ότι μια μετάλλαξη σε ένα γονίδιο δεν είχε επίδραση στην πολυπεπτιδική αλυσίδα που κωδικοποιείται από αυτό. Σε τι μπορεί να οφείλεται η συγκεκριμένη μετάλλαξη;

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 29/12/2016 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 29/12/2016 ΘΕΜΑ 1 ο 1. α 2. β 3. γ 4. γ 5. δ ΘΕΜΑ 2ο Β1. Σημειώστε κάθε πρόταση με Σωστό ή Λάθος παραθέτοντας μια σύντομη δικαιολόγηση

Διαβάστε περισσότερα

Εργασία στη Βιολογία

Εργασία στη Βιολογία Εργασία στη Βιολογία Τι είναι το χρωμόσωμα? Το χρωμόσωμα είναι μια οργανωμένη δομή DNA και πρωτεϊνών που βρίσκεται στα κύτταρα. Είναι ένα μοναδικό κομμάτι DNA που περιλαμβάνει πολλά γονίδια και άλλες ακολουθίες

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α. Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση.

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α. Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση. ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση. 1. Έχοντας στη διάθεσή μας στο εργαστήριο αμιγή στελέχη για ένα συγκεκριμένο χαρακτηριστικό

Διαβάστε περισσότερα

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B Βιολογία προσανατολισμού Α. 1. β 2. γ 3. δ 4. γ 5. δ ΘΕΜΑ Α B1. 4,1,2,6,8,3,5,7 ΘΕΜΑ B B2. Σχολικό βιβλίο σελ. 103 Η γενετική καθοδήγηση είναι.υγιών απογόνων. Σχολικό βιβλίο σελ. 103 Παρ ότι γενετική καθοδήγηση

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα


3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Διαγώνισμα Βιολογίας Προσανατολισμού Γ Λυκείου

Διαγώνισμα Βιολογίας Προσανατολισμού Γ Λυκείου Διαγώνισμα Βιολογίας Προσανατολισμού Γ Λυκείου ΘΕΜΑ Α Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. Α1. Ουδέτερη μετάλλαξη μπορεί να είναι:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία. Δ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Μάρτιος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Δ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Μάρτιος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1.Σε ένα σωματικό κύτταρο ανθρώπου στο στάδιο της μετάφασης υπάρχουν: α. 4 γονίδια για την α-αλυσίδα της αιμοσφαιρίνης β. 8 γονίδια για

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

3. Η μέθοδος αλυσιδωτής αντίδρασης πολυμεράσης (PCR) επιτρέπει την επιλεκτική αντιγραφή μορίων DNA, χωρίς τη μεσολάβηση ζωικών κυττάρων.

3. Η μέθοδος αλυσιδωτής αντίδρασης πολυμεράσης (PCR) επιτρέπει την επιλεκτική αντιγραφή μορίων DNA, χωρίς τη μεσολάβηση ζωικών κυττάρων. ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 3 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4) Α. Να γράψετε τον αριθμό της

Διαβάστε περισσότερα


Τρίτη, 30 Μαΐου 2006 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 30 Μαΐου 2006 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. β 2. β 3. α 4. α 5. β


Διαβάστε περισσότερα

βάσεων στις οποίες συµβαίνει: περισσοτέρων βάσεων περισσοτέρων βάσεων περισσοτέρων βάσεων ανωµαλίες χρωµοσωµικές

βάσεων στις οποίες συµβαίνει: περισσοτέρων βάσεων περισσοτέρων βάσεων περισσοτέρων βάσεων ανωµαλίες χρωµοσωµικές ΚΕΦΑΛΑΙΟ 6ο: ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία του DNA ηµιουργούν συνήθως ένα διαφορετικό φαινότυπο χωρίς όµως πάντοτε αυτό να είναι απαραίτητο Αυτό εξαρτάται από τον τρόπο µε τον

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2010 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2010 ΘΕΜΑ Α 1. δ 2. β 3. α 4. β 5. γ ΘΕΜΑ Β 1. Σελ. 17 σχολ. Βιβλίου: Το γενετικό υλικό ενός κυττάρου αποτελεί το γονιδίωμά του όπως είναι τα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Ο Mendel καλλιέργησε φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας

ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Ο Mendel καλλιέργησε φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Ο Mendel καλλιέργησε 28.000 φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας Λόγοι επιτυχίας των πειραμάτων του Mendel 1. Μελέτησε μία ή δύο

Διαβάστε περισσότερα


ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ II ΕΠΑ.Λ. (ΟΜΑ Α Β ) 2010 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ÏÑÏÓÇÌÏ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ. Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου.

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ. Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου. ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. α, Α2 γ, Α3 γ, Α4 δ, Α5 β ΘΕΜΑ Β Β1. 1Γ, 2Β, 3Α, 4Α, 5Γ, 6Α Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου.»

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ.

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. Απαντήσεις: βιολογια κατευθυνσης 24/02/2013 ΘΕΜΑ 1 ο Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. ΘΕΜΑ 2 ο Α. Σελ 69 σχολικού βιβλίου: «Το μοσχομπίζελο έχει πολλά πλεονεκτήματα... έως και σελ 70 σχολικού..των αποτελεσμάτων».

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα


ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση:

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Α1. Ο Griffith απέδειξε: Α. ότι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΡΩΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΓΙΑ ΤΗΝ ΕΠΑΝΑΛΗΨΗ ΤΗΣ ΘΕΩΡΙΑΣ) 1 ο ΚΕΦΑΛΑΙΟ 1. Να περιγράψετε τα πειράµατα του Griffith. Σε ποιο συµπέρασµα κατέληξε µε τα πειράµατά του; 2. Ποια δεδοµένα υποστήριζαν

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Ταυτοποίηση χρωμοσωμικών ανωμαλιών με χρήση καρυότυπου

Ταυτοποίηση χρωμοσωμικών ανωμαλιών με χρήση καρυότυπου Ταυτοποίηση χρωμοσωμικών ανωμαλιών με χρήση καρυότυπου Θεωρητικό Υπόβαθρο Καρυότυπος Καρυότυπος είναι η απεικόνιση των μεταφασικών χρωμοσωμάτων ενός οργανισμού κατά ελαττούμενο μέγεθος, όπου φαίνονται

Διαβάστε περισσότερα


ÈÅÌÅËÉÏ ÅËÅÕÓÉÍÁ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 ο. ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο 1 - γ 2 - α 3 - α 4 - β 5 - δ ΘΕΜΑ 2 ο 1. Ένας τρόπος βελτίωσης της φυτικής και ζωικής παραγωγής είναι οι ελεγχόµενες από τον άνθρωπο διασταυρώσεις φυτών και ζώων. Για το σκοπό αυτό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα 3 ο 12 Θέμα

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 12/04/2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ο.Π. ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΟΧΤΩ (8) ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΜΕ ΜΕΤΑΛΛΑΓΕΣ Μεταλλαγή ή Μετάλλαξη Οποιαδήποτε αλλαγή του γενετικού υλικού που δεν οφείλεται σε ανασυνδυασµό ή σε διάσχιση των γονιδίων και η οποία

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Κεφάλαιο 5: ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Κεφάλαιο 5: ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ -ΘΕΩΡΙΑ- Κληρονομικότητα: Η ιδιότητα των ατόμων να μοιάζουν με τους προγόνους τους. Κληρονομικοί χαρακτήρες: Οι ιδιότητες που κληρονομούνται στους απογόνους. Γενετική:

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 9 Μαρτίου 2014 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 9 Μαρτίου 2014 ΘΕΜΑ Α Α1. β, Α2. δ, Α3. γ, Α4. δ, Α5. γ. ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 90-91: «Το παράδειγμα της δρεπανοκυτταρικής

Διαβάστε περισσότερα

Χρωμοσώματα & κυτταροδιαιρέσεις

Χρωμοσώματα & κυτταροδιαιρέσεις Δασική Γενετική Χρωμοσώματα & κυτταροδιαιρέσεις Χειμερινό εξάμηνο 2014-2015 Σύνοψη Το DNA αναπαράγεται, εκφράζεται και μεταλλάσσεται Το DNA είναι οργανωμένα σε χρωμοσώματα Τα ευκαρυωτικά γενώματα έχουν

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 6 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα