ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ"

Transcript

1 ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ << Ευαγγελισµός >>

2 ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης (PCR) Αντίστροφης Μεταγραφάσης Αλυσιδωτή Αντίδραση Πολυµεράσης (ReverseTranscriptase PCR) (RT PCR) Ποσοτική PCR Πραγµατικου Χρόνου (Real Time Quantitative PCR) Ανάλυση αλληλουχίας νουκλεοτιδίων (Sequencing) Mικροδιατοµή ιστού µε ακτίνες Laser (Laser Microdissection)

3 Πλεονεκτήµατα µοριακών τεχνικών εν εξαρτώνται από αντιγονική έκφραση Πληροφορίες σχετικά µε παθογένεση διάγνωση και πρόγνωση αιµατολογικών νόσων

4 Μειονεκτήµατα Χρονοβόρο σταντάρισµα Υψηλό κόστος Κατάργηση κυτταρικής µορφολογίας

5 Αλυσιδωτή Αντίδραση της Πολυµεράσης Polymerase Chain Reaction

6 Αρχικό δίκλωνο µόριο (DNA template) RT

7 Αποδιάταξη º C

8 Επικόλληση Επιµήκυνση º C 72º C

9 ιπλασιασµένο µόριο DNA

10 Μετα από 40 κυκλους PCR Tο PCR προιόν ανιχνεύεται µε ηλεκτροφόρηση

11 Είδη PCR Aπλή PCR Φωλιασµένη PCR (Nested PCR) Ηµιφωλιασµένη PCR (Seminested PCR) ReverseTranscriptase PCR Real Time PCR

12 Target region Initial PCR Target region P P3 Second PCR amplification

13 Πλεονεκτήµατα Αύξηση της ευαισθησίας Η περιοχή στόχος είναι σε λίγα αντίγραφα Κατεστραµένο DNA λόγω µονιµοποίησης Μειονεκτήµατα Κίνδυνος επιµόλυνσης!!

14 Εφαρµογές της PCR σε λεµφοϋπερπλαστικές εξεργασίες Aνίχνευση κλωνικότητας σε Β- ή Τ- κυτταρικής προέλευσης εξεργασίες ιαφορική διάγνωση µεταξύ µονοκλωνικής και πολυκλωνικής λεµφοϋπερπλασίας Ανίχνευση ελαχίστης ή υπολειµµατικής νόσου Ανίχνευση χρωµοσωµικών µεταθέσεων πχ JH/BCL2,JH/BCL1 σε Οζώδες Λέµφωµα και Λέµφωµα Μανδύα Ανίχνευση ιών π.χ. ΕΒV

15 ΑΛΥΣΙ ΩΤΗ ΑΝΤΙ ΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ

16 Υποδοχέας Β-λεµφοκυττάρων (ανοσοσφαιρίνες) Υποδοχέας Τ-λεµφοκυττάρων Aνίχνευση κλωνικότητας σε Β- ή Τ- κυτταρικής προέλευσης εξεργασίες

17

18 BIOMED-2 Concerted Action BMH4-CT : PCR-based clonality studies VH DH JH 6 VH-FR1 primers J H primer Heteroduplex analysis MW Monoclonal Monoclonal Polyclonal HO 2 polyclonal GeneScan analysis CTGTGCAAGAG CGGGCTATGGTTCAGGGAGTTAT GGCTACTACGGTATGGACGTCTGG CTGTGCAAGAG GACGAAACAGTAACT GCCTACTACTACTACGGTATGGACGTCTGG CTGTGCAAGAGA GATAGTATAGCAGCTCGT ACAACTGGTTCGACTCCTGG CTGTGCAAGAGA TCCGGGCAGCTCGTTT TGCTTTTGATATCTGG CTGTGCAAGAG CCTCTCTCCACTGGGATGGGGGG CTACTGG CTGTGCAAGAG CAGCAGCTCGGCCCCCTTTGACTACTGG CTGTGCAAGAG GACTTTGGATGCTTTTGATATCTGG CTGTGCAAGAG GGTGGGAGCTACTA GACTACTGG CTGTGCAAG GGTAGCTAAAC CTTTGACTACTGG CTGTGCAA TATCTACTTTGACTACTGG monoclonal Απο Σταµατόπουλος και συν.

19 Φχ / Hae III CD20 Smear H2O IgH Ανίχνευση κλωνικότητας για IgH µε PCR

20 ιαφορική διάγνωση µεταξύ µονοκλωνικής και πολυκλωνικής λεµφοϋπερπλασίας MARKER λέµφωµα Γαστρίτιδα? / λέµφωµα? 120 bp 80 bp γαστρίτιδα Η ανίχνευση Β-µονοκλωνικότητας σε µοριακό επίπεδο µε την µέθοδο της PCR µπορεί να ανιχνεύσει πολύ πρώιµα στάδια λεµφώµατος ή πολύ πρώιµες υποτροπές

21 Aνίχνευση υπολειµµατικής νόσου

22 Ανίχνευση ελαχίστης νόσου Βιοψία στοµάχου Β-Λέµφωµα από µεγάλα κύτταρα Οστεοµυελική βιοψία σταδιοποίησης Παρουσία µικρών Β-Λεµφοκυττάρων ιήθηση??

23 Παρακολούθηση ασθενών για έλεγχο πιθανής υποτροπής Περίπτωση δερµατικού Τ-λεµφώµατος Phix/HaeIII Positive Control IGH NC Πρώτη βιοψία Ιδιος ασθενής υποτροπή bp άλλος ασθενής 10% Acrylamide Gel (Mc Carthy)

24 Πλεονεκτήµατα PCR Μεγάλη ευαισθησία (1/ ) Αυτοµατοποίηση Χρήση υλικού αρχείου

25 Mειονεκτήµατα Ύπαρξη ψευδώς αρνητικών DΝΑ κακής ποιότητας και ανεπαρκούς ποσότητας Ανεπαρκής κυτταρικός πληθυσµός Κακή πρόσδεση των εκκινητών στην περιοχή στόχο Ύπαρξη ψευδώς θετικών στην PCR Επιµολύνσεις στην PCR Έπιλεκτικός πολλαπλασιασµός ορισµένων γονιδιακών περιοχών.. ( (Eπιβεβαίωση του αποτελεσµατος PCR µε SEQUENCING ) Κατάργηση κυτταρικής µορφολογίας

26 DNA απο παραφίνη µυελός ΟΒ Ο ΒΛ PHIX Κακη ποιοτητα

27 Αντίστροφης Μεταγραφάσης Αλυσιδώτη Αντίδραση Πολυµεράσης Reverse Transcriptase Polynucleotide Chain Reaction (RT PCR)

28 RT PCR Eφαρµογές Ανίχνευση χιµαιρικών µεταγράφων πχ (Bcr/abl) Ανίχνευση ιικού RNA (ρετροιί( ρετροιί,ιικόιικό φορτίο) Ανίχνευση υπολειµµατικής νόσου συνδεόµενης µε χιµαιρικά γονίδια Μελέτη γονιδιακής έκφρασης

29 RT PCR Πλεονεκτήµατα Μεγάλη ευαισθησία (1/ ) Αυτοµατοποίηση Ανίχνευση χιµαιρικών γονιδίων Μειονεκτήµατα Κατάργηση κυτταρικής µορφολογίας Χρήση νωπού υλικού RNA κακής ποιότητας από παραφινωµένους ιστούς (200 bp µέγιστη περιοχή που µπορεί να ενισχυθεί ) Eνίσχυση άσχετων τµηµάτων (ψευδώς θετικά) Επιβεβαίωση του αποτελέσµατος µε Sequencing

30 Ποσοτική PCR Πραγµατικού Χρόνου Real Time Quantitative PCR Ποσοτική µέθοδος Ανιχνεύει αρχικό αριθµό DNA RNA µορίων στο δείγµα

31

PCR Εφαρμογές-2. RACE Site directed mutagenesis

PCR Εφαρμογές-2. RACE Site directed mutagenesis PCR Εφαρμογές-2 RACE Site directed mutagenesis Σκοπός της αντίδρασης PCR (Polymerase Chain Reaction) είναι το να φτιάξει ένα μεγάλο αριθμό αντιγράφων. BHMATA 1. ΑΠΟΔΙΑΤΑΞΗ 2. ΥΒΡΙΔΙΣΜΟΣ 3. ΕΠΙΜΗΚΥΝΣΗ Επειδή

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ

Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ DNA ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Τεχνολογία ανασυνδυαζόμενου DNA ή Γενετική Μηχανική Κατασκευή τεχνητών μορίων DNA (ανασυνδυασμένο DNA) Τροποποίηση γονιδιωμάτων Μεταφορά γονιδίου/ων

Διαβάστε περισσότερα

ΥΠΟΛΕΙΜΜΑΤΙΚΗ ΝΟΣΟΣ ΣΤΗ Β-ΧΡΟΝΙΑ ΛΕΜΦΟΚΥΤΤΑΡΙΚΗ ΛΕΥΧΑΙΜΙΑ

ΥΠΟΛΕΙΜΜΑΤΙΚΗ ΝΟΣΟΣ ΣΤΗ Β-ΧΡΟΝΙΑ ΛΕΜΦΟΚΥΤΤΑΡΙΚΗ ΛΕΥΧΑΙΜΙΑ ΥΠΟΛΕΙΜΜΑΤΙΚΗ ΝΟΣΟΣ ΣΤΗ Β-ΧΡΟΝΙΑ ΛΕΜΦΟΚΥΤΤΑΡΙΚΗ ΛΕΥΧΑΙΜΙΑ ΛΕΥΚΟΘΕΑ Σ. ΝΤΟΒΑ Βιοχημικός, Msc, PhD Επιστημονικός συνεργάτης Μονάδας Μοριακής Βιολογίας- Αιματολογικό Εργαστηρίο, Πανεπιστημιακό Γενικό Νοσοκομείο

Διαβάστε περισσότερα

Οργάνωση των NA σε ιούς. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Οργάνωση των NA σε ιούς. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Οργάνωση των NA σε ιούς 09/04/2014 1 Η οργάνωση των ιών γίνεται µε βάση το εύρος των ξενιστών που µπορούν να µολύνουν και συµπεριφέρονται σαν παράσιτα: Μόνο βακτήρια: βακτηριοφάγος ή φάγος (phage) Ζωϊκά

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ

Διαβάστε περισσότερα

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc Εισαγωγή στη Real Time PCR Καραπέτσας Θανάσης PhD, MSc Μειονεκτήματα της κλασικής PCR Ανάλυση ύστερα από ηλεκτροφόρηση(συνήθως αγαρόζης) Τεχνική τελικού σημείου(end-point detection), Σύγκριση της έντασης

Διαβάστε περισσότερα

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR)

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) Α. ΘΕΩΡΗΤΙΚΟ ΜΕΡΟΣ Σταμάτης Κουσίσης, Δημοσθένης Κίζης, Δήμητρα Χούχουλα Βασική αρχή της Αλυσιδωτής Αντίδρασης της Πολυμεράσης

Διαβάστε περισσότερα

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Τεχνικές Μοριακής Ενδοκρινολογίας Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Εισαγωγή σε μεταβολικά νοσήματα της Παιδιατρικής

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

Βιολογία. Θετικής Κατεύθυνσης

Βιολογία. Θετικής Κατεύθυνσης Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 4ο ΤΕΧΝΟΛΟΓΊΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΈΝΟΥ DNA Γενετική Μηχανική 3 Είναι ο κλάδος της Βιολογίας που περιλαμβάνει τις τεχνικές με τις οποίες ο άνθρωπος επεμβαίνει στο γενετικό

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ Χρυσούλα Νικολάου Μονοκλωνικές ελεύθερες ελαφρές αλύσεις Οι μονοκλωνικές ελεύθερες ελαφρές αλύσεις οι οποίες είναι γνωστές ως πρωτεΐνη Bence

Διαβάστε περισσότερα

Ιδιαίτερες νοσολογικές οντότητες στα λεμφώματα υψηλού βαθμού κακοηθείας

Ιδιαίτερες νοσολογικές οντότητες στα λεμφώματα υψηλού βαθμού κακοηθείας Ιδιαίτερες νοσολογικές οντότητες στα λεμφώματα υψηλού βαθμού κακοηθείας Απαρτιωμένη διδασκαλία στην Αιματολογία 2015 Αργύρης Σ. Συμεωνίδης Οντότητες μη Hodgkin λεμφωμάτων που θα αναφερθούν Πρωτοπαθές Β-λέμφωμα

Διαβάστε περισσότερα

Πρωτόκολλο Επεξεργασίας Λεµφικών Ιστών. Θεοδώρα Παπαδάκη Αιµοπαθολογοανατοµικό Εργαστήριο

Πρωτόκολλο Επεξεργασίας Λεµφικών Ιστών. Θεοδώρα Παπαδάκη Αιµοπαθολογοανατοµικό Εργαστήριο Πρωτόκολλο Επεξεργασίας Λεµφικών Ιστών Θεοδώρα Παπαδάκη Αιµοπαθολογοανατοµικό Εργαστήριο Νοσ. «Ο Ευαγγελισµός» ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ: ΙΑΓΝΩΣΤΙΚΑ ΙΛΗΜΑΤΑ ΜΕ ΑΜΕΣΕΣ ΚΛΙΝΙΚΟΠΡΓΝΩΣΤΙΚΕΣ ΠΡΟΕΚΤΑΣΕΙΣ ιαφορική

Διαβάστε περισσότερα

Ενότητα 2011: Λεμφώματα

Ενότητα 2011: Λεμφώματα Κλινικοεργαστηριακή Εκπαίδευση στην Αιματολογία Ενότητα 2011: Λεμφώματα 23-24 Σεπτεμβρίου 2011 Ηράκλειο, Κρήτη Διοργάνωση Ίδρυμα Ελληνικής Αιματολογικής Εταιρείας και Αιματολογική Κλινική Ιατρικής Σχολής

Διαβάστε περισσότερα

Λίγα λόγια για τις αιματολογικές νεοπλασίες

Λίγα λόγια για τις αιματολογικές νεοπλασίες Λίγα λόγια για τις αιματολογικές νεοπλασίες Αιματολογικές νεοπλασίες είναι τα είδη καρκίνου που επηρεάζουν το αίμα, το μυελό των οστών και τους λεμφαδένες. Δεδομένου ότι και τα τρία είναι άρρηκτα συνδεδεμένα

Διαβάστε περισσότερα

Γονιδιωματική. G. Patrinos

Γονιδιωματική. G. Patrinos Γονιδιωματική Η μεταγονιδιωματική εποχή... Σημαντικότερα επιτεύγματα POST GENOME ERA Ολοκλήρωση της αποκρυπτογράφησης της αλληλουχίας των γονιδιωμάτων πολλών οργανισμών. Προτύπωση μεθοδολογιών για προσδιορισμό

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

ΑΠΟΦΑΣΗ Ο ΠΡΟΕΔΡΟΣ ΔΣ - ΔΙΟΙΚΗΤΗΣ

ΑΠΟΦΑΣΗ Ο ΠΡΟΕΔΡΟΣ ΔΣ - ΔΙΟΙΚΗΤΗΣ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ YΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ 1 η ΥΓΕΙΟΝΟΜΙΚΗ ΠΕΡΙΦΕΡΕΙΑ ΑΤΤΙΚΗΣ ΓΕΝΙΚΟ ΑΝΤΙΚΑΡΚΙΝΙΚΟ OΓΚΟΛΟΓΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΑΘΗΝΩΝ «Ο ΑΓΙΟΣ ΣΑΒΒΑΣ» Δ/νση: Λεωφ. Αλεξάνδρας 171 115 22 ΑΘΗΝΑ Τηλ:. 210 64 09 000,

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ

ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΡΜΗΝΕΙΑ ΙΟΛΟΓΙΚΩΝ ΙΑΓΝΩΣΤΙΚΩΝ ΕΞΕΤΑΣΕΩΝ Dr Α. Μεντής, Ιατρός Βιοπαθολόγος, Κλινικός Μικροβιολόγος ιευθυντής ιαγνωστικού Τμήματος ιευθυντής Εργαστηρίου Ιατρικής Μικροβιολογίας ιευθυντής Εθνικού Εργαστηρίου

Διαβάστε περισσότερα

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου

Δ. Ιακωβίδης. Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Δ. Ιακωβίδης Πνευμονολόγος Aν. Διευθυντής Μονάδα επεμβατικής Πνευμονολογίας Γ.Π.Ν. «Γ. Παπανικολάου Νέα διαγνωστικά μέσα για τη λανθάνουσα φυματίωση Η στοχευμένη δοκιμασία δερματικής φυματινοαντίδρασης

Διαβάστε περισσότερα

ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος. Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας

ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος. Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας H.M. Παράγοντες κινδύνου καρκινώματος τραχήλου Ηλικία κατά την πρώτη

Διαβάστε περισσότερα

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Οι περιοριστικές ενδονουκλεάσες

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1.

Διαβάστε περισσότερα

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι Β Προβλήματα Φαινότυπος Β(Α): ασθενής αντίδραση με αντι-α, έντονη αντίδραση με αντι-β, και ο ορός αντιδρά με ερυθρά Α₁. Ο αντιορός Α περιέχει τον κλώνο ΜΗΟ4? Επίκτητος Β φαινότυπος: έντονη αντίδραση με

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ 1 ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ άμεση πρόσβαση στο γενετικό υλικό εφαρμογές στην υγεία, βελτίωση φυτών και ζώων, προστασία

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (2/2), 2ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Α. Μεντής ιαγνωστικό Εργαστήριο Λοιμωδών Νοσημάτων Εθνικό Εργαστήριο Αναφοράς Γρίπης Νοτίου Ελλάδος Εθνικό Εργαστήριο Αναφοράς Ερυθράς/Ιλαράς Ελλάδος, Εθνικό

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Department of Biochemistry

Διαβάστε περισσότερα

ΛΕΜΦΑ ΕΝΙΚΟ ΛΕΜΦΩΜΑ ΟΡΙΑΚΗΣ ΖΩΝΗΣ ΙΣΤΟΛΟΓΙΚΗ ΕΙΚΟΝΑ

ΛΕΜΦΑ ΕΝΙΚΟ ΛΕΜΦΩΜΑ ΟΡΙΑΚΗΣ ΖΩΝΗΣ ΙΣΤΟΛΟΓΙΚΗ ΕΙΚΟΝΑ ΛΕΜΦΑ ΕΝΙΚΟ ΛΕΜΦΩΜΑ ΟΡΙΑΚΗΣ ΖΩΝΗΣ ΙΣΤΟΛΟΓΙΚΗ ΕΙΚΟΝΑ Μικρά ή µεσαίου µεγέθους λεµφοειδή κύτταρα Πυρήνες στρογγυλοί ή ανωµάλου σχήµατος (µονοκυτταροειδείς ή σαν κεντροκύτταρα) ιαυγές κυτταρόπλασµα ΛΕΜΦΑ

Διαβάστε περισσότερα

ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων

ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων ΑΤΕΙΘ Β ΕΞΑΜΗΝΟ 15/10/2015 Πέμπτη ( Ηλεκτρονικά) 16.00 18.00 Πεδίο Β2-Μοριακή προ- και μετα-γεννητική διάγνωση ασθενειών Συμμετρίες και μοριακή θερμοδυναμική βιομορίων Γενική επισκόπηση μεθόδων που χρησιμοποιούνται

Διαβάστε περισσότερα

ΑΝΟΣΟΒΙΟΛΟΓΙΑ. Εξεταστική Ιανουαρίου 2010

ΑΝΟΣΟΒΙΟΛΟΓΙΑ. Εξεταστική Ιανουαρίου 2010 Εξεταστική Ιανουαρίου 2010 Ποιες είναι οι διαφορές μιας πρωτογενούς από μια δευτερογενή χυμική ανοσολογική απόκριση; Περιγράψετε τους μηχανισμούς ενεργοποίησης στις δυο περιπτώσεις. ΘΕΜΑ 2 (1 μονάδα) Περιγράψετε

Διαβάστε περισσότερα

ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR)

ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) Σκοπός της άσκησης Η εκμάθηση των βασικών σταδίων και συστατικών

Διαβάστε περισσότερα

Βασικές Αρχές Μοριακής Βιολογίας

Βασικές Αρχές Μοριακής Βιολογίας Βασικές Αρχές Μοριακής Βιολογίας Χριστίνα Κοτταρίδη, Βιολόγος, MSc, PhD Εργαστήριο Διαγνωστικής Κυτταρολογίας, ΠΓΝ ATTIKON Εκπαιδευτικό Πρόγραμμα, Α εξάμηνο 28 Απριλίου 2014 Το Κυτταρολογικό εργαστήριο

Διαβάστε περισσότερα

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΖΩΟΛΟΓΙΑ Δ. ΜΑΤΘΟΠΟΥΛΟΣ 1 ΠΑΡΑΓΟΝΤΕΣ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗΝ ΕΞΕΛΙΞΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΔΙΑΔΙΚΑΣΙΑ

Διαβάστε περισσότερα

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 2 Θεωρία (4 Ο Κεφάλαιο) 3 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 1 2 3 ΚΛΩΝΟΠΟΙΗΣΗ 4 5 6 ορισμός:

Διαβάστε περισσότερα

Ιδιαίτερες νοσολογικές οντότητες στα λεμφώματα υψηλού βαθμού κακοηθείας

Ιδιαίτερες νοσολογικές οντότητες στα λεμφώματα υψηλού βαθμού κακοηθείας Ιδιαίτερες νοσολογικές οντότητες στα λεμφώματα υψηλού βαθμού κακοηθείας Απαρτιωμένη διδασκαλία στην Αιματολογία 2013 Αργύρης Σ. Συμεωνίδης Οντότητες μη Hodgkin λεμφωμάτων που θα αναφερθούν Πρωτοπαθές Β-λέμφωμα

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

ΑΝΟΣΟΑΙΜΑΤΟΛΟΓΙΑ ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΣΤΑΤΙΚΟΥ ΗΜΗΤΡΗΣ ΚΑΛΑΝΤΖΗΣ ΑΙΜΑΤΟΛΟΓΟΣ

ΑΝΟΣΟΑΙΜΑΤΟΛΟΓΙΑ ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΣΤΑΤΙΚΟΥ ΗΜΗΤΡΗΣ ΚΑΛΑΝΤΖΗΣ ΑΙΜΑΤΟΛΟΓΟΣ ΑΝΟΣΟΑΙΜΑΤΟΛΟΓΙΑ ΠΑΡΟΥΣΙΑΣΗ ΠΕΡΙΣΤΑΤΙΚΟΥ ΗΜΗΤΡΗΣ ΚΑΛΑΝΤΖΗΣ ΑΙΜΑΤΟΛΟΓΟΣ ΠΕΡΙΣΤΑΤΙΚΟ 1-ΑΣΥΜΦΩΝΙΑ ΜΕΤΑΞΥ ΟΡΟΛΟΓΙΚΟΥ ΚΑΙ Επίτοκος 36 ετών προσέρχεται στο Νοσοκομείο με φαινόμενα τοκετού Προσκομίζει ομάδα αίματος

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ:

ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ: ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ: Ανάλυση γονιδιακών πολυμορφισμών Σταυροπούλου Χρύσα,PhD Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας Ινστιτούτο Πυρηνικής

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Επιστηµονικό Πρόγραµµα

Επιστηµονικό Πρόγραµµα Επιστηµονικό Πρόγραµµα Υπεύθυνοι διοργάνωσης κ.κ.: Π. Παναγιωτίδης Αναπληρωτής Καθηγητής Αιματολογίας Ιατρικής Σχολής Ε.Κ.Π.Α., Α Προπαιδευτική Παθολογική Κλινική Γ.Ν.Α. «Λαϊκό» Κ. Σταματόπουλος Αιματολόγος,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΑΝΟΣΟΙΣΤΟΧΗΜΙΚΕΣ ΚΑ! ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΟΓΚΟΛΟΓΙΑ. Β. Ζουμπουρλήςΐ

ΑΝΟΣΟΙΣΤΟΧΗΜΙΚΕΣ ΚΑ! ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΟΓΚΟΛΟΓΙΑ. Β. Ζουμπουρλήςΐ ΑΝΟΣΟΙΣΤΟΧΗΜΙΚΕΣ ΚΑ! ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΟΓΚΟΛΟΓΙΑ Β. Ζουμπουρλήςΐ 1. Εργαστήριο Μοριακής Ογκολογίας και Βιοτεχνολογίας, Εθνικό Ίδρυμα Ερευνών, Αθήνα. Η Μοριακή Βιολογία και κατ' επέκταση η Μοριακή

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΑΞΟΝΑ ΤΕΛΟΜΕΡΑΣΗΣ/ΤΕΛΟΜΕΡΩΝ ΣΕ ΜΕΣΕΓΧΥΜΑΤΙΚΑ ΚΥΤΤΑΡΑ ΜΥΕΛΟΥ ΤΩΝ ΟΣΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΡΕΥΜΑΤΟΕΙ Η ΠΝΕΥΜΟΝΑ

ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΑΞΟΝΑ ΤΕΛΟΜΕΡΑΣΗΣ/ΤΕΛΟΜΕΡΩΝ ΣΕ ΜΕΣΕΓΧΥΜΑΤΙΚΑ ΚΥΤΤΑΡΑ ΜΥΕΛΟΥ ΤΩΝ ΟΣΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΡΕΥΜΑΤΟΕΙ Η ΠΝΕΥΜΟΝΑ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΑΞΟΝΑ ΤΕΛΟΜΕΡΑΣΗΣ/ΤΕΛΟΜΕΡΩΝ ΣΕ ΜΕΣΕΓΧΥΜΑΤΙΚΑ ΚΥΤΤΑΡΑ ΜΥΕΛΟΥ ΤΩΝ ΟΣΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΡΕΥΜΑΤΟΕΙ Η ΠΝΕΥΜΟΝΑ ΓΙΩΡΓΟΣ Α. ΜΑΡΓΑΡΙΤΟΠΟΥΛΟΣ 1,2, ΑΘΑΝΑΣΙΑ ΠΡΟΚΛΟΥ 1,2, ΚΩΣΤΑΣ ΚΑΡΑΓΙΑΝΝΗΣ 2, ΙΣΜΗΝΙ ΛΑΣΗΘΙΩΤΑΚΗ

Διαβάστε περισσότερα

ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ

ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΑΠΟΣΤΟΛΟΣ ΒΑΝΤΑΡΑΚΗΣ ΒΙΟΛΟΓΟΣ (M.Sc, Ph.D) Επιδημίες μολυσματικών ασθενειών συχνά οφείλονται σε έκθεση σε μία κοινή πηγή ενός αιτιολογικού παράγοντα.

Διαβάστε περισσότερα

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο E M E D N L C SCIENCES BIOMEDICAL E N T E R Kέντρο Μέντελ για Βιοιατρικές Επιστήμες Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο Βασίλειος Τάνος MD PhD www.mendelcenter.org Picture taken from leaflet

Διαβάστε περισσότερα

ΚΑΤΕΥΘΥΝΤΗΡΙΕΣ ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΕΛΑΧΙΣΤΗΣ ΥΠΟΛΕΙΜΜΑΤΙΚΗΣ ΝΟΣΟΥ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΚΑΚΟΗΘΗ ΑΙΜΑΤΟΛΟΓΙΚΑ ΝΟΣΗΜΑΤΑ

ΚΑΤΕΥΘΥΝΤΗΡΙΕΣ ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΕΛΑΧΙΣΤΗΣ ΥΠΟΛΕΙΜΜΑΤΙΚΗΣ ΝΟΣΟΥ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΚΑΚΟΗΘΗ ΑΙΜΑΤΟΛΟΓΙΚΑ ΝΟΣΗΜΑΤΑ ΚΑΤΕΥΘΥΝΤΗΡΙΕΣ ΟΔΗΓΙΕΣ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΕΛΑΧΙΣΤΗΣ ΥΠΟΛΕΙΜΜΑΤΙΚΗΣ ΝΟΣΟΥ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΚΑΚΟΗΘΗ ΑΙΜΑΤΟΛΟΓΙΚΑ ΝΟΣΗΜΑΤΑ ΓΕΝΙΚΕΣ ΣΥΣΤΑΣΕΙΣ Κατά τη διάγνωση Φύλαξη DNA, RNA, ορού και ζωντανών κυττάρων (σε βαθιά

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ Β ΤΡΙΜΗΝΟΥ Γ 4 23.1.12 ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΕΡΓΑΣΤΗΚΑΝ: ΑΛΕΞΑΝΔΡΟΣ ΔΕΛΗΜΙΧΑΛΗΣ ΑΡΤΕΜΗΣ ΑΝΑΣΤΑΣΙΑΔΗΣ 1 ΕΙΣΑΓΩΓΗ Το δεοξυριβονουκλεϊκό οξύ (Deoxyribonucleic acid -

Διαβάστε περισσότερα

Tρίτη, 3 Ιουνίου 2003 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ

Tρίτη, 3 Ιουνίου 2003 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 3 Ιουνίου 2003 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν

Διαβάστε περισσότερα

EΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ ΓΡΑΜΜΑΤΕΙΑ ΕΠΙΤΡΟΠΗΣ ΕΡΕΥΝΩΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΚΗΜΔΗΣ & ΣΤΗ ΔΙΑΥΓΕΙΑ

EΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ ΓΡΑΜΜΑΤΕΙΑ ΕΠΙΤΡΟΠΗΣ ΕΡΕΥΝΩΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΚΗΜΔΗΣ & ΣΤΗ ΔΙΑΥΓΕΙΑ EΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ ΓΡΑΜΜΑΤΕΙΑ ΕΠΙΤΡΟΠΗΣ ΕΡΕΥΝΩΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΚΗΜΔΗΣ & ΣΤΗ ΔΙΑΥΓΕΙΑ Πρόσκληση εκδήλωσης ενδιαφέροντος 16144/2016 στο πλαίσιο

Διαβάστε περισσότερα

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 28/02/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Γενική Μικροβιολογία Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ ΜΑΘΗΜΑΤΟΣ

Διαβάστε περισσότερα

ΛΕΜΦΩΜΑ ΗΟDGKIN. Αλεξάνδρα Κουράκλη-Συμεωνίδου Απαρτιωμένη διδασκαλία 2015

ΛΕΜΦΩΜΑ ΗΟDGKIN. Αλεξάνδρα Κουράκλη-Συμεωνίδου Απαρτιωμένη διδασκαλία 2015 ΛΕΜΦΩΜΑ ΗΟDGKIN Αλεξάνδρα Κουράκλη-Συμεωνίδου Απαρτιωμένη διδασκαλία 2015 ΛΕΜΦΩΜΑ ΗΟDGKIN Επιδημιολογία - Αιτιοπαθογένεια Δικόρυφη καμπύλη εμφάνισης κορυφές: 15-40 έτη, >60 έτη : = Μικρή υπεροχή (1.5-2.0/1)

Διαβάστε περισσότερα

Το δόγμα της Μοριακής Βιολογίας

Το δόγμα της Μοριακής Βιολογίας Το δόγμα της Μοριακής Βιολογίας To DNA είναι το βασικό μόριο φορέας και διατηρησης της γενετικής πληροφορίας. Με τη διαδικασία της αντιγραφής του DNA το μητρικό μόριο διπλασιάζετα σε δυο θυγατρικά και

Διαβάστε περισσότερα

εργαστηριακό έλεγχο Κατσιαφλάκα Άννα Βιοπαθολόγος,Msc Επικ. Επιμελήτρια Β Εργαστήριο Υγιεινής κι Επιδημιολογίας

εργαστηριακό έλεγχο Κατσιαφλάκα Άννα Βιοπαθολόγος,Msc Επικ. Επιμελήτρια Β Εργαστήριο Υγιεινής κι Επιδημιολογίας Κλασσικές και νέες μέθοδοι στον εργαστηριακό έλεγχο Κατσιαφλάκα Άννα Βιοπαθολόγος,Msc Επικ. Επιμελήτρια Β Εργαστήριο Υγιεινής κι Επιδημιολογίας Π.Γ.Ν.Λάρισας ΝΕΡΑ Περιορισμοί στον προσδιορισμό της μικροβιολογικής

Διαβάστε περισσότερα

15PROC003177823 2015-10-16. Fax: 213 204 1838 E-mail: karetou@0304.syzefxis.gov.gr

15PROC003177823 2015-10-16. Fax: 213 204 1838 E-mail: karetou@0304.syzefxis.gov.gr ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ 1 Η ΥΠΕ ΑΤΤΙΚΗΣ Γ.Ν.Α «Ο ΕΥΑΓΓΕΛΙΣΜΟΣ- ΟΦΘΑΛΜΙΑΤΡΕΙΟ ΑΘΗΝΩΝ- ΠΟΛΥΚΛΙΝΙΚΗ» Ν.Π.. ΥΠΗΡΕΣΙΑ: ΙΟΙΚΗΤΙΚΗ ΥΠΟ /ΝΣΗ: ΟΙΚΟΝΟΜΙΚΟΥ ΤΜΗΜΑ: ΟΙΚΟΝΟΜΙΚΟ ΓΡΑΦΕΙΟ: ΠΡΟΜΗΘΕΙΩΝ Πληροφορίες:. Καρέτου

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΕΘΝΙΚΟΥ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΜΟΝΑΔΑ ΕΡΕΥΝΑΣ Β'ΠΡΟΠΑΙΔΕΥΤΙΚΗΣ ΠΑΘΟΛΟΓΙΚΗΣ ΚΛΙΝΙΚΗΣ ΚΑΘΗΓΗΤΗΣ Θ.

ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΕΘΝΙΚΟΥ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΜΟΝΑΔΑ ΕΡΕΥΝΑΣ Β'ΠΡΟΠΑΙΔΕΥΤΙΚΗΣ ΠΑΘΟΛΟΓΙΚΗΣ ΚΛΙΝΙΚΗΣ ΚΑΘΗΓΗΤΗΣ Θ. ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΕΘΝΙΚΟΥ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΜΟΝΑΔΑ ΕΡΕΥΝΑΣ Β'ΠΡΟΠΑΙΔΕΥΤΙΚΗΣ ΠΑΘΟΛΟΓΙΚΗΣ ΚΛΙΝΙΚΗΣ ΚΑΘΗΓΗΤΗΣ Θ. ΟΙΚΟΝΟΜΟΠΟΥΛΟΣ 1 ΙΕΡΙΛΗΨΗ ΔΙΔΑΚΤΟΡΙΚΗΣ ΔΙΑΤΡΙΒΗΣ ΒΙΟΛΟΓΟΣ: ΕΡΙΦΥΛΗ ΚΥΡΙΑΖΗ

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 24 η ΙΟΙ ΒΑΚΤΗΡΙΩΝ, ΦΥΤΩΝ ΚΑΙ ΖΩΩΝ

Γενική Μικροβιολογία. Ενότητα 24 η ΙΟΙ ΒΑΚΤΗΡΙΩΝ, ΦΥΤΩΝ ΚΑΙ ΖΩΩΝ Γενική Μικροβιολογία Ενότητα 24 η ΙΟΙ ΒΑΚΤΗΡΙΩΝ, ΦΥΤΩΝ ΚΑΙ ΖΩΩΝ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ

Διαβάστε περισσότερα

ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ»

ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ» ΚΑΤΣΑΤΟΥ ΜΑΡΙΑΝΝΑ ΑΙΜΑΤΟΛΟΓΟΣ ΑΙΜΑΤΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Ν.Υ. ΑΙΜΟΔΟΣΙΑΣ Π.Γ.Ν. «ΑΤΤΙΚΟΝ» 1 η ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ ΑΣΥΜΦΩΝΙΑ ΜΕΤΑΞΥ ΟΡΟΛΟΓΙΚΟΥ ΚΑΙ ΕΡΥΘΡΟΚΥΤΤΑΡΙΚΟΥ ΠΡΟΣΔΙΟΡΙΣΜΟΥ ΤΗΣ ΑΒΟ ΟΜΑΔΑΣ Επίτοκος 36 ετών

Διαβάστε περισσότερα

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Γενετική Βακτηρίων Κατανόηση μηχανισμών λειτουργίας ευκαρυωτικών κυττάρων Ταξινόμηση βακτηρίων Διάγνωση λοιμωδών νοσημάτων Επιδημιολογική μελέτη

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 22 (+κεφ. 17 Hartwell) Γενετική του καρκίνου Η πρωτεΐνη p53 προσδένεται στο DNA. 2 ΕΙΚΟΝΑ 22.1 Μαστογραφία που απεικονίζει έναν όγκο. Όγκος 3 Κύρια σημεία: Καρκίνος

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Eφη Πετεινάκη ΠΡΟΒΛΗΜΑΤΑ ΡΟΥΤΙΝΑΣ ΕΝΟΣ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ταυτοποίηση κάποιων βακτηρίων ο έλεγχος ευαισθησίας διάγνωση λοιμώξεων από μικροοργανισμούς

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Θέση περιορισμού συμμετρική ως προς τον άξονα που περνά από το μέσο της. Στην εικόνα φαίνεται η θέση αναγνώρισης της EcoRI RI. Η αλληλουχία είναι παλίνδρο- μη: είναι

Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα

Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία

Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία. β-θαλασσαιμία Νικολακοπούλου Κωνσταντίνα Κάτσα Ελένη-Μαρία Δάσκου Μαρία β-θαλασσαιμία Θάλασσα + αίμα = θαλασσαιμία Εισαγωγή Η πιο κοινή γενετική νόσος που κληρονομείται Mενδελικά ~ 1 : 100.000 παγκοσμίως ~ 1 : 10.000

Διαβάστε περισσότερα

PCR quantitative PCR (qpcr)

PCR quantitative PCR (qpcr) PCR quantitative PCR (qpcr) Ε. Λιανίδου, Ph.D. Καθηγήτρια Εργαστήριο Αναλυτικής Χημείας, Τμήμα Χημείας, Πανεπιστήμιο Αθηνών lianidou@chem.uoa.gr DNA A:T (2 δεσμοί Η), C:G (3δεσμοί Η) Αλυσιδωτή αντίδραση

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DNA... 2

ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DNA... 2 ΚΕΦΑΛΑΙΟ 4 ο ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DN... 2 ΚΕΦΑΛΑΙΟ 4 ο I. Τεχνολογία του ανασυνδυασµένου DN Εκπαιδευτικοί στόχοι: Μετά την ολοκλήρωση της µελέτης αυτού του κεφαλαίου ο µαθητής

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA κεφάλαιο Κατασκευή ανασυνδυασμένου DNA 4. Τεχνολογία του ανασυνδυασμένου DΝΑ Από το 1953, που οι Watson και Crick πρότειναν το μοντέλο της τρισδιάστατης δομής του DNA,

Διαβάστε περισσότερα

4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011

4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011 4 ο Πανελλήνιο Συμπόσιο Φυματίωσης Εταιρεία Μελέτης Πνευμονοπαθειών και Επαγγελματικών Παθήσεων Θώρακος Σάββατο 19 Μαρτίου 2011 ΕΡΓΑΣΤΗΡΙΑΚΗ ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΦΥΜΑΤΙΩΣΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ Γ.Ν.Θ «Γ.

Διαβάστε περισσότερα

ΛΕΜΦΩΜΑΤΑ ΟΡΙΑΚΗΣ ΖΩΝΗΣ

ΛΕΜΦΩΜΑΤΑ ΟΡΙΑΚΗΣ ΖΩΝΗΣ ΛΕΜΦΩΜΑΤΑ ΟΡΙΑΚΗΣ ΖΩΝΗΣ Πηνελόπη Κορκολοπούλου Αν. Καθηγήτρια Παθολογικής Ανατοµικής Παν/µίου Αθηνών 1 Β-ΛΕΜΦΩΜΑ ΑΠO ΤΟ ΚΥΤΤΑΡΟ ΤΗΣ ΟΡΙΑΚΗΣ ΖΩΝΗΣ (MZL) (WHO 2001) Tρεις τύποι λεµφωµάτων τα οποία αποτελούν

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

ΔΙΑΤΡΙΒΗ. για την απόκτηση ΜΕΤΑΠΤΥΧΙΑΚΟΥ ΔΙΠΛΩΜΑΤΟΣ ΕΙΔΙΚΕΥΣΗΣ

ΔΙΑΤΡΙΒΗ. για την απόκτηση ΜΕΤΑΠΤΥΧΙΑΚΟΥ ΔΙΠΛΩΜΑΤΟΣ ΕΙΔΙΚΕΥΣΗΣ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ ΦΑΡΜΑΚΕΥΤΙΚΕΣ ΕΠΙΣΤΗΜΕΣ ΚΑΙ ΤΗ ΤΕΧΝΟΛΟΓΙΑ ΔΙΑΤΡΙΒΗ για την απόκτηση ΜΕΤΑΠΤΥΧΙΑΚΟΥ ΔΙΠΛΩΜΑΤΟΣ ΕΙΔΙΚΕΥΣΗΣ Φαρμακογονιδιωματική και λειτουργική μελέτη

Διαβάστε περισσότερα

ΦΑΡΜΑΚΕΥΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ

ΦΑΡΜΑΚΕΥΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ ΦΑΡΜΑΚΕΥΤΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ H ΒΙΟΛΟΓΙΑ ΤΩΝ IΩΝ ΙΟΙ ΓΕΝΙΚΕΣ ΙΔΙΟΤΗΤΕΣ Είναι ΔΟΜΕΣ στο όριο μεταξύ ζωντανού και μη ζωντανού. Χρησιμοποιούμε τον όρο ενεργοί-μη ενεργοί παρά ζωντανοί-νεκροί Δεν έχουν κυτταρική

Διαβάστε περισσότερα

HPV : Θα πρέπει να γίνεται έλεγχος ρουτίνας; Νικηφόρος Καπράνος Τµήµα Μοριακής Ιστοπαθολογίας Μαιευτικό και Χειρουργικό κέντρο ΜΗΤΕΡΑ

HPV : Θα πρέπει να γίνεται έλεγχος ρουτίνας; Νικηφόρος Καπράνος Τµήµα Μοριακής Ιστοπαθολογίας Μαιευτικό και Χειρουργικό κέντρο ΜΗΤΕΡΑ HPV : Θα πρέπει να γίνεται έλεγχος ρουτίνας; Νικηφόρος Καπράνος Τµήµα Μοριακής Ιστοπαθολογίας Μαιευτικό και Χειρουργικό κέντρο ΜΗΤΕΡΑ ΟΜΗ ΙΩΝ HPV Κυκλικό δίκλωνο DNA µήκους 8Kb Εικοσαεδρικό πρωτεϊνικό

Διαβάστε περισσότερα

ΕΙΔΙΚΗ ΠΑΘΟΛΟΓΙΚΗ ΑΝΑΤΟΜΙΚΗ

ΕΙΔΙΚΗ ΠΑΘΟΛΟΓΙΚΗ ΑΝΑΤΟΜΙΚΗ ΕΙΔΙΚΗ ΠΑΘΟΛΟΓΙΚΗ ΑΝΑΤΟΜΙΚΗ Εργαστήριο Γεν. Παθολογίας και Παθολογικής Ανατομικής Α.Π.Θ. 5o ΦΡΟΝΤΙΣΤΗΡΙΟ ΛΕΜΦΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ Διδάσκοντες: Αγγελική Χέβα Παθολογοανατόμος, ΠΓΝΘ «Γ. Παπανικολάου» Επιστημονικός

Διαβάστε περισσότερα

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

-Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ -Ανοσονεφελομετρική μέθοδος ΓΕΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ ΠΡΟΟΡΙΖΟΜΕΝΗ ΧΡΗΣΗ Διαγνωστική ανοσονεφελομετρική εξέταση για τον ποσοτικό προσδιορισμό της Ανοσοσφαιρίνης A (IGA) σε ανθρώπινο ορό ή πλάσμα με το σύστημα

Διαβάστε περισσότερα

Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση

Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση Ο καρκίνος είναι μια ιδιαίτερα ετερογενής νόσος, που προκύπτει από συσσώρευση μεταλλάξεων του DNA. Η αιτιολογία του καρκίνου είναι πολυπαραγοντική,

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα