Μεραληζκνί ξχζκηζεο ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Μεραληζκνί ξχζκηζεο ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο"

Transcript

1 Μεραληζκνί ξχζκηζεο ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο Βειηίσζε ηεο ζηαζεξφηεηαο ηνπ ζεξαπεπηηθνχ αλαζηνιέα ηνπ ζπκπιεξψκαηνο Compstatin Mechanisms of regulation of the alternative complement pathway Stability improvement of the therapeutic complement inhibitor Compstatin Γηδαθηνξηθή δηαηξηβή ηεο ΑΠΟΣΟΛΗΑ ΣΕΔΚΟΤ Απνθνίηνπ Μνξηαθήο Βηνινγίαο θαη Γελεηηθήο Α ΠΑΝΔΠΙΣΗΜΙΑΚΗ ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΓΙΔΤΘΤΝΣΡΙΑ: ΣΑΜΑΣΙΑ ΚΩΣΙΟΤ ΔΠΙΒΛΔΠΩΝ: ΚΩΝΣΑΝΣΙΝΟ ΡΙΣΗ ΑΛΔΞΑΝΓΡΟΤΠΟΛΗ 2011

2 2

3 ΓΖΜΟΚΡΗΣΔΗΟ ΠΑΝΔΠΗΣΖΜΗΟ ΘΡΑΚΖ ΣΜΖΜΑ ΗΑΣΡΗΚΖ ΣΟΜΔΑ ΓΔΝΗΚΖ ΠΑΘΟΛΟΓΗΑ Α ΠΑΝΔΠΗΣΖΜΗΑΚΖ ΠΑΘΟΛΟΓΗΚΖ ΚΛΗΝΗΚΖ ΓΗΔΤΘΤΝΣΡΗΑ: ΣΑΜΑΣΗΑ ΚΩΣΗΟΤ ΣΡΗΜΔΛΖ ΤΜΒΟΤΛΔΤΣΗΚΖ ΔΠΗΣΡΟΠΖ 1. ΚΩΝΣΑΝΣΗΝΟ ΡΗΣΖ (Καζ. Παζνινγίαο - Δπηβιέπσλ) 2. ΣΑΜΑΣΗΑ ΚΩΣΗΟΤ (Αλ. Καζ. Παζνινγίαο) 3. ΗΩΑΝΝΖ ΣΔΝΣΔ (Αλ. Καζ. Βηνρεκείαο) ΔΠΣΑΜΔΛΖ ΔΞΔΣΑΣΗΚΖ ΔΠΗΣΡΟΠΖ 1. ΚΩΝΣΑΝΣΗΝΟ ΡΗΣΖ (Καζ. Παζνινγίαο - Δπηβιέπσλ) 2. ΣΑΜΑΣΗΑ ΚΩΣΗΟΤ (Αλ. Καζ. Παζνινγίαο) 3. ΗΩΑΝΝΖ ΣΔΝΣΔ (Αλ. Καζ. Βηνρεκείαο) 4. ΗΩΑΝΝΖ ΠΝΔΤΜΑΣΗΚΟ (Καζ. Πλεπκνλνινγίαο) 5. ΒΑΗΛΔΗΟ ΒΔΡΓΔΜΔΕΖ (Καζ. Νεθξνινγίαο) 6. ΠΛΟΤΜΖ ΠΑΑΓΑΚΖ (Καζ. Νεθξνινγίαο) 7. ΓΔΩΡΓΗΟ ΚΟΛΗΟ (Αλ. Καζ. Φαξκαθνινγίαο) Ζ δηεμαγσγή ηεο έξεπλαο πξαγκαηνπνηήζεθε ζην εξγαζηήξην Πξσηετληθήο Υεκείαο ηνπ Καζ. Ησάλλε Λάκπξε ζην ηκήκα Παζνινγίαο θαη Δξγαζηεξηαθήο Ηαηξηθήο ηνπ Παλεπηζηεκίνπ ηεο Πελλζπιβάληα. ΑΛΔΞΑΝΓΡΟΤΠΟΛΖ

4 ηνλ Charles θαη ζηελ νηθνγέλεηά κνπ 4

5 ΠΔΡΗΔΥΟΜΔΝΑ Αληί πξνιφγνπ... 8 Πεξίιεςε...10 Abstract...11 Α. Δηζαγσγή...12 πκπιήξσκα...13 Ιζηνξία θαη νλνκαηνινγία...13 Οδνί ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο...14 Κιαζζηθή νδφο...14 Οδφο ιεθηίλεο...15 Δλαιιαθηηθή νδφο...16 Σειηθή νδφο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο...17 Άιιεο νδνί...18 Ρχζκηζε ηεο ιεηηνπξγίαο ηνπ ζπκπιεξψκαηνο...18 Φπζηνινγηθέο ιεηηνπξγίεο ηνπ ζπκπιεξψκαηνο...20 Δκπινθή ηνπ ζπκπιεξψκαηνο ζηελ παζνγέλεζε αζζελεηψλ...21 Σν ζπκπιήξσκα σο ζηφρνο ζεξαπείαο...23 Σν θεληξηθφ έλδπκν ηνπ ζπκπιεξψκαηνο...25 Γνκή ησλ ζπζηαηηθψλ ηεο θνλβεξηάζεο ηεο ελαιιαθηηθήο νδνχ...26 Πεξηνρέο αιιειεπίδξαζεο αλάκεζα ζηα ζπζηαηηθά ηεο θνλβεξηάζεο ηεο ελαιιαθηηθήο νδνχ 28 Παίξλνληαο καζήκαηα απφ έλαλ κηθξννξγαληζκφ Αλαζηνιέαο ηνπ ζπκπιεξψκαηνο ηνπ ηαθπιφθνθθνπ (Staphylococcal Complement INhibitor (SCIN))...33 Υξπζίδσλ ζηαθπιφθνθθνο γεληθά ζηνηρεία...33 Μεραληζκνί δηαθπγήο ηνπ ρξπζίδνληα ζηαθπιφθνθθνπ απφ ην ζπκπιήξσκα...35 SCIN...38 Compstatin - Έλαο πεπηηδηθφο αλαζηνιέαο ησλ θνλβεξηαζψλ ηνπ C Δμέιημε θαη ζεκαζία...40 Αληηθαηάζηαζε δηζνπιθηδηθνχ δεζκνχ κε ζεηναηζεξηθφ...44 Η ηερληθή ηνπ ζπληνληζκνχ επηθαλεηαθψλ πιαζκνλίσλ (Surface Plasmon Resonance SPR). 46 Β. θνπφο...48 Γ. Μέζνδνη θαη πιηθά...51 Πξσηεΐλεο...52 Αλαζπλδπαζκέλε έθθξαζε ηνπ Ba ηκήκαηνο ηνπ FB

6 Πξνεηνηκαζία ηνπ C3b γηα ηηο κειέηεο πξφζδεζεο θαη θξπζηάιισζεο κε ην SCIN...53 Λνηπέο πξσηεΐλεο...54 Αθαίξεζε ηνπ FD απφ αλζξψπηλν πιάζκα...54 Βηνρεκηθά πεηξάκαηα...55 Γνθηκαζίεο αλαζχζηαζεο ηεο ιεηηνπξγηθφηεηαο ηεο ελαιιαθηηθήο νδνχ ζε αλζξψπηλν πιάζκα απφ ην νπνίν έρεη αθαηξεζεί ν FD...55 Γνθηκαζία ηχπνπ ELISA ελαπφζεζεο ηνπ C3b...55 Αηκνιπηηθή δνθηκαζία...56 Γνθηκαζία ηχπνπ ELISA ελαπφζεζεο ηνπ C3b, ε νπνία μεθηλά κέζσ ηεο θιαζζηθήο νδνχ Μειέηεο πξσηετληθψλ αιιειεπηδξάζεσλ κε SPR...58 Γεληθά...58 Μειέηε απεπζείαο πξφζδεζεο ηνπ FB (ηνπ πιάζκαηνο) θαη ηνπ αλαζπλδπαζκέλνπ ηκήκαηνο Ba ζην C3b...60 Μειέηε απεπζείαο πξφζδεζεο ηνπ αλαζπλδπαζκέλνπ FB ζην C3b κε SPR θαη θηλεηηθή αλάιπζε κνλνχ θχθινπ...61 Μειέηε πξφζδεζεο ηνπ FD* ζην FB φηαλ απηφ είλαη πξνζδεδεκέλν ζε C3b...61 Μειέηε δεκηνπξγίαο ηεο θνλβεξηάζεο C3bBb...62 Μειέηε ελεξγνπνίεζεο ηεο πξν-θνλβεξηάζεο C3bB απφ ην FD...63 Μειέηε αιιειεπίδξαζεο αλαιφγσλ ηεο compstatin κε ην C3b...63 Δπηπηψζεηο έθζεζεο αλαιφγσλ ηεο compstatin ζε αλαγσγηθνχο θαη νμεηδσηηθνχο παξάγνληεο...64 Υαξαθηεξηζκφο πεπηηδίσλ...65 Γ. Απνηειέζκαηα...67 Πξνηεηνηκαζία πξσηετλψλ...68 Πξνηεηνηκαζία ηνπ C3b...68 Πξνεηνηκαζία ηνπ Ba...69 Αιιειεπίδξαζε ηνπ FB θαη ηνπ ζξαχζκαηνο Ba κε ην C3b Αιιειεπίδξαζε ηνπ SCIN κε ην C3b Γνκή ηεο θνλβεξηάζε C3bBb ζε ζχκπινθν κε ην SCIN θαη κεραληζκφο αλαζηνιήο ηνπ ζπκπιεξψκαηνο Γνκή θαη κεραληζκφο ελεξγνπνίεζεο ηνπ ζπκπιφθνπ ηεο πξν-θνλβεξηάζεο C3bB θαη ηνπ ζπκπιφθνπ ηεο κε ην FD (C3bBD) Γνκή ηεο πξν-θνλβεξηάζεο...77 Βηνθπζηθέο θαη βηνρεκηθέο κειέηεο πνπ ζηεξίδνπλ ηα απνηειέζκαηα ηεο θξπζηαιιηθήο δνκήο

7 Σν δηπιφ κεηάιιαγκα FB D254G N260D πξνζδέλεηαη ζην C3b κε πνιχ κεγαιχηεξε ζπγγέλεηα θαη απινπνηεκέλν θηλεηηθφ πξνθίι ζε ζχγθξηζε κε ην FB ηνπ πιάζκαηνο Σν FD* πξνζδέλεηαη κε ην FB κε πςειή ζπγγέλεηα, κφλν φηαλ ην ηειεπηαίν είλαη πξνζδεδεκέλν ζην C3b Μεηαιιάγκαηα ηνπ FD ησλ ζεκείσλ πξφζδεζεο ζην FB δελ ζρεκαηίδνπλ ηελ θνλβεξηάζε Μεηαιιάγκαηα ηνπ FD ησλ ζεκείσλ πξφζδεζεο ζην FB δελ κπνξνχλ αλαζπζηήζνπλ ηε ιεηηνπξγηθφηεηα ηεο ελαιιαθηηθήο νδνχ ζε πιάζκα απφ ην νπνίν έρεη αθαηξεζεί ν FD Βειηίσζε ηεο ζηαζεξφηεηαο ηνπ αλαζηνιέα ηνπ ζπκπιεξψκαηνο compstatin Κηλεηηθή αλάιπζε κε SPR αλαιφγσλ ηεο compstatin κε γέθπξα ζεηναηζέξα...87 Αλαζηνιή ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο απφ ηα αλάινγα ηεο compstatin κε γέθπξα ζεηναηζέξα...89 Δπαηζζεζία ησλ αλαιφγσλ ηεο compstatin ζε αλαγσγή θαη νμείδσζε θαη επίδξαζε ζηε ιεηηνπξγηθφηεηά ηνπο...91 Δ. πδήηεζε...95 Σ. πκπεξάζκαηα ΒΙΒΛΙΟΓΡΑΦΙΚΔ ΠΑΡΑΠΟΜΠΔ Βηνγξαθηθφ ζεκείσκα ηεο Απνζηνιίαο Σδέθνπ Λίζηα επηζηεκνληθψλ δεκνζηεχζεσλ

8 Αληί πξνιόγνπ Η παξνχζα δηδαθηνξηθή δηαηξηβή πξαγκαηνπνηήζεθε ζην εξγαζηήξην ηνπ θαζεγεηή Ισάλλε Λάκπξε ζην ηκήκα Παζνινγίαο θαη Δξγαζηεξηαθήο Ιαηξηθήο ηνπ Παλεπηζηεκίνπ ηεο Πελλζπιβάληα, ζε ζπλεξγαζία κε ηε ζρνιή Ιαηξηθήο ηνπ Γεκνθξηηείνπ Παλεπηζηεκίνπ Θξάθεο. πγθεθξηκέλα, ην έλαπζκα γηα ηε κειέηε απηή δφζεθε ιφγσ ησλ θνηλψλ ελδηαθεξφλησλ ηνπ θ. Κσλ/λνπ Ρίηε, πνπ εξεπλά ην ξφιν ηεο έκθπηεο αλνζίαο ζε δηάθνξεο θιεγκνλψδεηο θαη ζξνκβσηηθέο παζήζεηο ζην Δξγαζηήξην ηεο 1 εο Παλεπηζηεκηαθήο Κιηληθήο ηνπ Γ.Π.Θ. θαη ηνπ θ. Λάκπξε, ν νπνίνο εξεπλά ην ξφιν ηνπ ζπκπιεξψκαηνο ζηελ αλνζία θαη ηελ παζνγέλεζε αζζελεηψλ θαη αλέπηπμε ην ζεξαπεπηηθφ κφξην compstatin. Δλ κέζσ ηεο ζπλεξγαζίαο απηήο, είρα ηελ επθαηξία λα κειεηήζσ ηνπο κεραληζκνχο ελεξγνπνίεζεο θαη ξχζκηζεο ηνπ θεληξηθνχ ελδχκνπ ηνπ ζπκπιεξψκαηνο θαη δχν αλαζηνιείο ηνπ, ηελ compstatin θαη ηελ πξσηεΐλε βαθηεξηαθήο πξνέιεπζεο, SCIN. Αηζζάλνκαη πνιχ ηπρεξή πνπ είρα ηελ επθαηξία λα θάλσ έξεπλα πςεινχ επηπέδνπ, ε νπνία ζην κέιινλ πηζαλφλ λα δηεπθνιχλεη ηελ αλάπηπμε ζεξαπεηψλ γηα αζζέλεηεο ζηηο νπνίεο εκπιέθεηαη ην ζπκπιήξσκα. Γηα ην ιφγν απηφ ζα ήζεια λα επραξηζηήζσ ηνπο αλζξψπνπο πνπ ζπλεηέιεζαλ ζηελ νινθιήξσζε ηεο δηδαθηνξηθήο κνπ δηαηξηβήο. Καη αξράο επραξηζηψ ηελ ηξηκειή ζπκβνπιεπηηθή επηηξνπή κνπ, εθ ησλ νπνίσλ ηδηαηηέξσο ηνλ επηβιέπνληά κνπ θ. Ρίηε, γηα ηελ επθαηξία πνπ κνπ έδσζε. Υσξίο ηε βνήζεηά ηνπ θαη ηε ζπκβνπιή ηνπ δε ζα ήηαλ δπλαηή ε νινθιήξσζε απηήο ηεο δηαηξηβήο. Δπίζεο, επραξηζηψ ηνλ αείκλεζην θαζεγεηή Γεψξγην Καξηάιε, ηελ θαζεγήηξηα ηακαηία Κψηζηνπ θαη ηνλ αλαπιεξσηή θαζεγεηή Ισάλλε Σέληε γηα ηε βνήζεηά ηνπο, θαζψο θαη ηα ινηπά κέιε ηεο επηακεινχο εμεηαζηηθήο επηηξνπήο γηα ην ρξφλν πνπ δηέζεζαλ. Δπραξηζηψ ζεξκά ηνλ θ. Ισάλλε Λάκπξε γηα φζα κε δίδαμε θαη ηηο ζεκαληηθέο εξεπλεηηθέο επθαηξίεο πνπ κνπ πξνζέθεξε ζηα ρξφληα πνπ δνπιέςα ζην εξγαζηήξηφ ηνπ. Οη ζπκβνπιέο ηνπ θαη ε εξεπλεηηθή ηνπ πείξα απνηέιεζαλ έκπλεπζε θαη θαζνδήγεζε γηα κέλα αλνίγνληάο κνπ λένπο νξίδνληεο ζηελ αξρή ηεο εξεπλεηηθήο κνπ πνξείαο. Αλ δελ είρα ηελ ηχρε λα βξεζψ ζην εξγαζηήξηφ ηνπ, ηφηε ε παξνχζα δηαηξηβή δε ζα ήηαλ δπλαηή. Μέζα ζην εξγαζηήξην ηνπ θνπ Λάκπξε, ην νπνίν απνηειεί έλα πνιπ-πνιηηηζκηθφ πεξηβάιινλ, είρα ηελ επθαηξία λα δεκηνπξγήζσ θηιίεο θαη λα ζπλεξγαζηψ κε αλζξψπνπο απφ φιεο ηηο γσληέο ηνπ θφζκνπ. Απφ απηνχο ηδηαίηεξα επραξηζηψ ηελ πξψηε κνπ δαζθάια θαη θίιε, Γεσξγία θπξφεξα θαη ηνλ You-Qiang πνπ κνπ κεηέδσζαλ πνιχηηκεο γλψζεηο πάλσ ζε εξγαζηεξηαθέο ηερληθέο. Δπραξηζηψ επίζεο ζεξκά ηνλ επίθνπξν θαζεγεηή Daniel Ricklin πνπ κε δίδαμε ηί 8

9 ζεκαίλεη επηζηεκνληθή ζθέςε θαη πεηξακαηηθφο ζρεδηαζκφο θαζψο θαη ηελ ηερληθή ηνπ ζπληνληζκνχ ησλ επηθαλεηαθψλ πιαζκνλίσλ (SPR), ε νπνία απνηέιεζε ην πην ζεκαληηθφ εξγαιείν γηα ηε δηεθπεξαίσζε ηεο έξεπλάο κνπ. Απφ ηα ππφινηπα κέιε ηνπ εξγαζηεξίνπ επραξηζηψ ζεξκά ηελ Αληηγφλε Οπιληξένπ, ηελ Καηεξίλα Οηθνλνκνπνχινπ, ηνλ Ισάλλε Κνπξηδέιε θαη ην ηαχξν Ραθαήι, γηα ηε ζηήξημε θαη ηηο επράξηζηεο ζηηγκέο πνπ πεξάζακε καδί. Δπραξηζηψ επίζεο ηελ θα. Ρνδάλζε Λάκπξε γηα ηε θξνληίδα θαη ην ελδηαθέξνλ πνπ κνπ έδεημε. Δπηπιένλ, ζα ήζεια λα επραξηζηήζσ ζεξκά ηνπο Dr. Piet Gros, Dr. Brian Geisbrecht θαη ηδηαίηεξα ηνπο Patrick Knerr θαη Dr. Wilfred van der Donk γηα ηε δεκηνπξγηθή καο ζπλεξγαζία. Έλα κεγάιν επραξηζηψ νθείισ ζην θίιν κνπ Charles Lee γηα ηελ ακέξηζηε ζπκπαξάζηαζε θαη ππνκνλή ηνπ φια απηά ηα ρξφληα. Σέινο, επραξηζηψ ηελ νηθνγέλεηά κνπ, Μαξία, Γξεγφξε θαη Δπζχκην Σδέθν θαη ηελ Βαζηιηθή Κσζηίθα γηα ηελ αγάπε ηνπο θαη ηε ζηήξημε πνπ κνπ πξνζέθεξαλ. 9

10 Πεξίιεςε Σν ζχζηεκα ηνπ ζπκπιεξψκαηνο έρεη ηα ηειεπηαία ρξφληα ραξαθηεξηζηεί σο έλα «δίθνπν καραίξη», ην νπνίν απφ ηε κηα πιεπξά πξνζηαηεχεη ηνλ νξγαληζκφ απφ κνιχλζεηο ελψ απφ ηελ άιιε κπνξεί λα πξνθαιέζεη βιάβε ζε απηφλ φηαλ αθεζεί αλεμέιεγθην. ιν θαη πεξηζζφηεξεο θιεγκνλψδεηο θαη απηνάλνζεο παζήζεηο πξνζηίζεληαη ζηε ιίζηα απηψλ ζηηο νπνίεο έρεη βξεζεί φηη εκπιέθεηαη ε ππεξβνιηθή ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο (π.ρ. ειηθηαθή εθθχιηζε ηεο σρξάο θειίδαο, ζχλδξνκν αληηθσζθνιηπηδίσλ θ.ά.), δείρλνληαο ηελ αλάγθε γηα ηελ αλάπηπμε ζεξαπεπηηθψλ αλαζηνιέσλ. Απφ ηηο νδνχο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο ηδηαίηεξε ζεκαζία έρεη ε ελαιιαθηηθή, αθνχ πεξηιακβάλεη έλαλ θχθιν ζεηηθήο αλάδξαζεο πνπ πνιιαπιαζηάδεη ηελ απφθξηζε φισλ ησλ νδψλ θαη ελεξγνπνηεί πνιιαπιά κφξηα C3 ζε C3b θαη C3a. Η αλαζηνιή ηεο νδνχ απηήο πηζηεχεηαη φηη ζα ήηαλ πνιχ απνηειεζκαηηθή γηα ηελ αληηκεηψπηζε ζπγθεθξηκέλσλ αζζελεηψλ. Γηα ηελ αλάπηπμε αλαζηνιέσλ γηα απηή ηελ νδφ είλαη απαξαίηεηε κηα βαζχηεξε γλψζε ηνπ κεραληζκνχ ελεξγνπνίεζεο θαη ξχζκηζεο ηεο θνλβεξηάζεο ηνπ C3, C3bBb. Γηα ην ζθνπφ απηφ εδψ κειεηήζεθαλ νη δνκέο ηεο θνλβεξηάζεο θαη ηεο πξνθνλβεξηάζεο (C3bB - θαζψο θαη ζε ζπλδπαζκφ κε ην FD) θαη νη αιιειεπηδξάζεηο κεηαμχ ησλ ζπζηαηηθψλ ηνπ ελδχκνπ απηνχ ζε βηνθπζηθφ θαη βηνρεκηθφ επίπεδν. Σα απνηειέζκαηα αλέδεημαλ ηα δνκηθά ζηνηρεία πνπ πξνζδίδνπλ ηελ πςειή εηδηθφηεηα ηεο πξφζδεζεο ησλ πξσηετλψλ απηψλ θαη ηε βάζε ηνπ κεραληζκνχ ελεξγνπνίεζεο θαη ξχζκηζεο ηεο θνλβεξηάζεο. Απηέο νη γλψζεηο αλνίγνπλ ην δξφκν γηα ην ζρεδηαζκφ λέσλ αλαζηνιέσλ ηεο ελαιιαθηηθήο νδνχ γηα ζεξαπεπηηθή ρξήζε. Παξάιιεια κειεηήζεθαλ δχν ππάξρνληεο αλαζηνιείο ηνπ ζπκπιεξψκαηνο, ν βαθηεξηαθήο πξνέιεπζεο «αλαζηνιέαο ηνπ ζπκπιεξψκαηνο ηνπ ζηαθπιφθνθθνπ» (SCIN) θαη ε ηερλεηή compstatin. Σν πξψην κφξην είλαη έλα απφ πνιινχο ξπζκηζηέο ηνπ ζπκπιεξψκαηνο πνπ παξάγεη ν ρξπζίδνληαο ζηαθπιφθθνο γηα λα δηαθχγεη απφ απηφ. Δδψ βξέζεθε ε δνκηθή βάζε ηνπ κνλαδηθνχ κεραληζκνχ δξάζεο ηνπ πνπ ζπλίζηαηαη ζηελ παγίδεπζε ηνπ C3bBb ζε κηα αλελεξγφ κνξθή. Σν κφξην απηφ είλαη αλνζνγελέο θαη πηζαλψο αθαηάιιειν γηα θάξκαθν, αιιά ζα κπνξνχζε λα ρξεζηκεχζεη σο εθκαγείν γηα ην ζρεδηαζκφ λέσλ αλαζηνιέσλ. Η compstatin είλαη έλαο πνιιά ππνζρφκελνο πεπηηδηθφο αλαζηνιέαο πνπ βξίζθεηαη ζε θιηληθέο δνθηκέο γηα ηε ζεξαπεία ηεο ειηθηαθήο εθθχιηζεο ηεο σρξάο θειίδαο. Η απμαλφκελε ρξήζε ηεο ζε φιν θαη πεξηζζφηεξα κνληέια αζζελεηψλ επηβάιιεη ηε βειηίσζε ηεο δξαζηηθφηεηαο θαη ηεο ζηαζεξφηεηάο ηεο. Δδψ παξνπζηάδνληαη λέα αλάινγα ηεο compstatin, φπνπ ν δηζνπιθηδηθφο δεζκφο πνπ ζπγθξαηεί ην κφξην ζε θπθιηθή κνξθή έρεη αληηθαηαζηαζεί απφ έλαλ ζεηναηζεξηθφ δεζκφ ν νπνίνο είλαη αλζεθηηθφο ζηελ αλαγσγή (δηάζπαζε). Σα αλάινγα απηά πηζαλφλ λα θαλνχλ ρξήζηκα ζε θαηαζηάζεηο φπνπ ην αίκα εκθαλίδεη απμεκέλε «αλαγσγηθή δπλαηφηεηα», φπσο ε ζήςε θαη ε αηκφιπζε. 10

11 Abstract The complement system has been characterized as a double-edged sword, since on one hand it acts to protect the host from infection, but on the other hand it can cause harm when not effectively regulated. More and more inflammatory and autoimmune diseases are being added to the list of those in which complement is found to be involved such as age-related macular degeneration, anti-phopsholipid syndrome, etc., indicating the need for development of complement inhibitors. Among the complement activation pathways, the alternative is especially important since it includes a positive-feedback loop that amplifies the activation initiated by all pathways and results in the activation of multiple C3 molecules to C3a and C3b. It is believed that inhibition of the alternative pathway is an effective means of treatment of certain conditions. In order to develop these inhibitors it is necessary to gain a better understanding of the activation and regulation mechanisms of the C3 convertase of the alternative pathway, C3bBb. For that purpose, here I studied the structures of the convertase and pro-convertase (C3bB, as well as its complex with FD), and analysed the interactions among their constituents using biophysical and biochemical assays. The results indicate the structural features of these proteins that are responsible for their high binding specificity, as well as the basis of the convertase activation and regulation mechanisms. This knowledge opens the way for the rational design of alternative pathway inhibitors for therapeutic use. In parallel, I studied two existing complement inhibitors: the bacterial Staphylococcal Complement INhibitor (SCIN) and the synthetic peptide compstatin. The first molecule is one of many regulators produced by Staphylococcus aureus, in order to escape the complement attack. The structural basis of its unique inhibition mechanism (which is the entrapment of the the C3bBb convertase into an inactive state) is described here. Although SCIN itself is immunogenic and probably not appropriate as theurapeutic, it could function as a template for the design of new inhibitors. Compstatin is a promising peptidic inhibitor currently in clinical trials for the treatment of agerelated macular degeneration. Its increased use as a therapeutic in different disease models entails the search for new analogues with improved activity and stability. Here I present new analogues where the disulfide bond that keeps the molecule in a cyclized form has been replaced by a thioether bond which is stable against reduction (linearization). These analogues might prove useful in conditions in which the reductive capacity of the blood is increased, such as sepsis and hemolysis. 11

12 Α. Δηζαγσγή 12

13 πκπιήξσκα Σν ζπκπιήξσκα είλαη έλα ιεηηνπξγηθφ ζχζηεκα πξσηετλψλ πνπ βξίζθνληαη ζην πιάζκα θαη ζηηο κεκβξάλεο θπηηάξσλ θαη ζπκκεηέρνπλ ζηελ αλνζνινγηθή απφθξηζε ηνπ νξγαληζκνχ έλαληη παζνγφλσλ. Η ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο ζπκβαίλεη κέζσ κηαο ζεηξάο πξσηενιπηηθψλ αληηδξάζεσλ. Παξαδνζηαθά πεξηγξάθνληαη ηξεηο νδνί ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο αλάινγα κε ην αξρηθφ εξέζηζκα: Κιαζζηθή νδφο, πνπ ελεξγνπνηείηαη απφ αληίζσκα πξνζδεδεκέλν ζε αληηγφλν, ε νδφο Λεθηίλεο, πνπ ελεξγνπνηείηαη απφ πνιπζαθραξίηεο ζηελ επηθάλεηα παζνγφλσλ θαη ε Δλαιιαθηηθή νδφο πνπ μεθηλά ιφγσ ηεο ηπραίαο πδξφιπζεο ηεο θεληξηθήο πξσηεΐλεο C3. Η ηειεπηαία απηή νδφο απνηειεί θαη κέζνδν ελίζρπζεο ηεο απφθξηζεο απφ φιεο ηηο νδνχο, φπσο ζα εμεγεζεί παξαθάησ. Οη ηξεηο απηέο νδνί θαηαιήγνπλ ζηελ ελεξγνπνίεζε ηεο πξσηεΐλεο C3 θαη έπεηηα ηεο C5, κέζσ ηεο δξάζεο εηδηθψλ ελδχκσλ πνπ ιέγνληαη θνλβεξηάζεο. Η ηειηθή νδφο ελεξγνπνίεζεο κεηά ην C5, πνπ δελ πεξηιακβάλεη πξσηενιπηηθέο αληηδξάζεηο, νδεγεί ζηελ ζπλαξκνιφγεζε ελφο ζπκπιέγκαηνο πξσηετλψλ πνπ δεκηνπξγεί πφξνπο ζηηο κεκβξάλεο νξηζκέλσλ βαθηεξίσλ κε ζθνπφ ηε ιχζε ηνπο. Δπεηδή, φπσο ζα γίλεη θαηαλνεηφ αξγφηεξα, ε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο κπνξεί λα πξνθαιέζεη βιάβε ζηνλ νξγαληζκφ εάλ δε ζηακαηήζεη εγθαίξσο, ην ζχζηεκα πεξηιακβάλεη θαη πνιιέο ξπζκηζηηθέο πξσηεΐλεο, νη νπνίεο ειέγρνπλ θαη απνηξέπνπλ ηελ επίζεζε ηνπ ζπζηήκαηνο έλαληη ηνπ μεληζηή. Η ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο έρεη σο απνηέιεζκα κεηαμχ άιισλ ηελ νςσλνπνίεζε κηθξνβίσλ, ηελ εθθαζάξηζε απφ ηελ θπθινθνξία ζπκπιεγκάησλ αληηγφλνπ-αληηζψκαηνο θαη ηελ ελίζρπζε ηεο θιεγκνλήο κέζσ ησλ αλαθπιαηνμίλσλ (κηθξψλ πξσηετλψλ πνπ απειεπζεξψλνληαη θαηά ηελ πξσηεφιπζε ηνπ C3 θαη C5). (1-3) Ηζηνξία θαη νλνκαηνινγία Σν ζπκπιήξσκα πεξηγξάθεθε γηα πξψηε θνξά ζηα ηέιε ηνπ 19 νπ αηψλα. Ο Jules Bordet αλαθάιπςε φηη ππάξρεη ζην πιάζκα έλα ζπζηαηηθφ επαίζζεην ζηε ζέξκαλζε, ην νπνίν νλφκαζε «αιεμίλε» (απφ ηελ ειιεληθή ξίδα αιεμ- πνπ ζεκαίλεη απνηξέπσ) θαη ην νπνίν είλαη απαξαίηεην καδί κε ηα αληηζψκαηα γηα ηελ αληηκεηψπηζε ησλ βαθηεξίσλ. Έπεηηα, ν Paul Ehrlich ην 1899 εηζήγαγε ηνλ φξν «ζπκπιήξσκα» γηα λα πεξηγξάςεη ην ζπκπιεξσκαηηθφ ξφιν ηνπ ζπζηαηηθνχ απηνχ πξνο ηα αληηζψκαηα. Πεξίπνπ 50 ρξφληα αξγφηεξα αλαθαιχθζεθε φηη ην ζπκπιήξσκα δξα θαη κε ηξφπν αλεμάξηεην απφ ηα αληηζψκαηα (ελαιιαθηηθή νδφο), ελψ ε νδφο ηεο ιεθηίλεο αλαθαιχθζεθε πην πξφζθαηα. 13

14 Οη πξσηεΐλεο ηεο θιαζζηθήο νδνχ πνπ αλαθαιχθζεθαλ πξψηεο ζπκβνιίδνληαη κε ην γξάκκα C (Complement = ζπκπιήξσκα) θαη έλαλ αξηζκφ πνπ δειψλεη ηε ζεηξά αλαθάιπςήο ηνπο (κε εμαίξεζε ην C4 πνπ βξέζεθε 2 ν. Έπεηηα, νη πξσηεΐλεο ηεο ελαιιαθηηθήο νδνχ νλνκάζηεθαλ παξάγνληεο, αθνινπζνχκελνη απφ έλα θεθαιαίν γξάκκα (factor B, D, H, I, P). Η ελεξγνπνίεζε ησλ πξσηετλψλ C2 έσο C5 δεκηνπξγεί ζξαχζκαηα, εθ ησλ νπνίσλ ην κηθξφηεξν ζπκβνιίδεηαη κε a θαη απειεπζεξψλεηαη, ελψ ην κεγαιχηεξν κε b θαη κέλεη πξνζδεδεκέλν ζε ζχκπιεγκα κε άιιε πξσηεΐλε. Δμαίξεζε απνηειεί ην C2, αθνχ ζπρλά ζηε βηβιηνγξαθία πεξηγξάθεηαη ην C2a σο ην κεγάιν ζξαχζκα θαη ην C2b σο ην κηθξφ. Γηα απνθπγή ζχγρπζεο θαη γηα ζπκθσλία κε ηελ νλνκαηνινγία ησλ ππνινίπσλ κνξίσλ εδψ ζα γίλεηαη αλαθνξά ζην κεγάιν ζξαχζκα σο C2b θαη ζην κηθξφ σο C2a. Απνηθνδφκεζε ηνπ C3b θαη C4b παξάγεη κηθξφηεξα ζξαχζκαηα πνπ ζπκβνιίδνληαη κε c, d, θηι. Οη παξαπάλσ πξσηεΐλεο απνηεινχληαη απφ πεξηζζφηεξεο απφ κία πνιππεπηηδηθέο αιπζίδεο πνπ ζπκβνιίδνληαη κε ειιεληθά γξάκκαηα α, β, θηι. ηαλ ελεξγνπνηνχληαη απηέο νη πξσηεΐλεο, γηα παξάδεηγκα ην C3, κε ηελ πέςε θαη απνκάθξπλζε ηνπ C3a απφ ηελ αιπζίδα α, ηφηε ζην C3b απηή κεηνλνκάδεηαη ζε α. Σέινο, νη ηζφηππνη ζπκβνιίδνληαη κε θεθαιαία ιαηηληθά γξάκκαηα Α, Β, π.ρ. C4A, C4B. (2) Οδνί ελεξγνπνίεζεο ηνπ ζπκπιεξώκαηνο Κιαζζηθή νδόο Η θιαζζηθή νδφο ελεξγνπνηείηαη απφ ηελ αλαγλψξηζε θαη πξφζδεζε ηεο πξσηεΐλεο C1 ζε ζχκπιεγκα αληηγφλνπ-αληηζψκαηνο (IgG, IgM). Σν C1 απνηειείηαη απφ έλα C1q, θαη δχν C1r θαη δχν C1s θαη ην ζχκπιεγκα απηφ ζρεκαηίδεηαη κφλν παξνπζία θαηηφλησλ αζβεζηίνπ (Ca 2+ ). Οηαλ ην C1q πξνζδέζεη ην ηκήκα Fc ελφο αληηζψκαηνο, αιιάδεη ε δηακφξθσζε ηνπ. Απηφ πξνθαιεί ηελ απηνθαηάιπζε ηνπ C1r, γεγνλφο ην νπνίν ην ελεξγνπνηεί, νδεγψληαο ζηελ πξνηεφιπζε θαη ελεξγνπνίεζε ηνπ C1s. Σν ελεξγνπνηεκέλν C1s, ζηε ζπλέρεηα, θαηαιχεη ηε δηάζπαζε ησλ C4 θαη C2. Σν ζξαχζκα C4b πεξηέρεη έλαλ ελεξγφ ζεηνεζηεξηθφ δεζκφ κέζσ ηνπ νπνίνπ πξνζδέλεηαη νκνηνπνιηθά ζηελ επηθάλεηα ηνπ παζνγφλνπ, ελψ ην ζξαχζκα C4a απειεπζεξψλεηαη. Σν C4b κπνξεί ηφηε λα πξνζδέζεη C2 παξνπζία θαηηφλησλ καγλεζίνπ (Mg 2+ ), ην νπνίν επίζεο θφβεηαη απφ C1s ζε C2b θαη C2a (ην νπνίν απειεπζεξψλεηαη). Σν ζχκπιεγκα C4b2b απνηειεί ηελ θνλβεξηάζε ηνπ C3 ηεο θιαζζηθήο νδνχ, ε νπνία θφβεη ην C3 ζε C3a θαη C3b (Δηθφλα 1). (1-3) 14

15 Δηθόλα 1: ρεκαηηθή αλαπαξάζηαζε ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο κέζσ ηεο θιαζζηθήο νδνχ, φπσο πεξηγξάθεηαη παξαπάλσ. Δθηφο απφ αληηζψκαηα, έρεη βξεζεί φηη ην C1q κπνξεί λα αλαγλσξίζεη θαη λα πξνζδεζεί ζε παζνγφλα κέζσ άιισλ κνξίσλ, φπσο νη pentraxins. Δπίζεο, κπνξεί λα αλαγλσξίζεη δνκέο ζε απνπησηηθά ή ηξνπνπνηεκέλα θχηηαξα ηνπ μεληζηή, φπσο ηα β-ακπινεηδή ηλίδηα θαη ε παζνινγηθή κνξθή ηεο πξσηεΐλεο prion. Δπνκέλσο, ε θιαζζηθή νδφο κπνξεί λα μεθηλήζεη απφ πεξηζζφηεξα ηνπ ελφο αίηηα, κέζσ ηεο ηδηφηεηαο ηνπ C1q λα πξνζδέλεη πεξηζζφηεξα ηνπ ελφο κφξηα. (4, 5) Οδόο ιεθηίλεο Η νδφο ιεθηίλεο είλαη φκνηα κε ηελ θιαζηθή νδφ, κε δηαθνξά ηνλ ηξφπν ελεξγνπνίεζεο. Η ιεθηίλε πνπ πξνζδέλεη καλλφδε (mannan-binding lectin MBL) ή νη ficolins είλαη ηα αλαγλσξηζηηθά κφξηα γηα απηή ηελ νδφ. Δίλαη κφξηα νκφινγα ηνπ C1q, αιιά πξνζδέλνπλ πδαηάλζξαθεο αληί γηα αληηζψκαηα. Παξνπζία Ca 2+, πξνζδέλνληαη κε πξσηεάζεο πνπ ιέγνληαη MASPs (MBL-associated serine proteases) πνπ είλαη νκφινγεο ησλ C1r θαη C1s. ηαλ ε MBL πξνζδέζεη πδαηάλζξαθεο, ηα MASPs ελεξγνπνηνχληαη κε παξφκνην ηξφπν θαη έπεηηα κπνξνχλ λα ελεξγνπνηήζνπλ ηα C4 θαη C2 θαη λα ζρεκαηίζνπλ ηελ ίδηα θνλβεξηάζε κε ηελ θιαζζηθή νδφ. πγθεθξηκέλα, ην MASP-2 κπνξεί λα θφςεη θαη ην C2 θαη ην C4, ελψ ην MASP-1 θφβεη κφλν ην C2 (Δηθφλα 2). Δηθόλα 2: ρεκαηηθή αλαπαξάζηαζε ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο κέζσ ηεο νδνχ ιεθηίλεο, φπσο πεξηγξάθεηαη παξαπάλσ. 15

16 Δλαιιαθηηθή νδόο ηαλ γίλεηαη ιφγνο γηα ηελ ελαιιαθηηθή νδφ ηνπ ζπκπιεξψκαηνο, θαλείο κπνξεί λα αλαθέξεηαη ζε πεξηζζφηεξεο ηεο κίαο δηαδηθαζίεο (Δηθφλα 3). Η κία απφ απηέο μεθηλά κε ηελ ηπραία πδξφιπζε ηνπ C3 ζε C3(H 2 O), ην νπνίν κνηάδεη ζηε δηακφξθσζή ηνπ κε ην C3b. Σν C3(H 2 O) (φπσο θαη ην C3b) κπνξεί λα πξνζδεζεί κε ην factor B (FB) παξνπζία θαηηφλησλ καγλεζίνπ (Mg 2+ ). Απηφ πξνθαιεί αιιαγέο ζηε δηακφξθσζή ηνπ πνπ επηηξέπνπλ ζην factor D (FD) λα ην θφςεη ζε Ba θαη Bb. Σν πξψην απειεπξψλεηαη ελψ ην δεχηεξν παξακέλεη πξνζδεδεκέλν ζην C3(H 2 O) δεκηνπξγψληαο κηα C3 θνλβεξηάζε ηεο ελαιιαθηηθήο νδνχ, ε νπνία βξίζθεηαη θπξίσο ζην δηάιπκα, παξά ζηηο θπηηαξηθέο επηθάλεηεο. Απηή κε ηε ζεηξά ηεο θφβεη C3 ζε C3a θαη C3b. Σν C3b πξνζδέλεηαη νκνηνπνιηθά κέζσ ηνπ ζεηνεζηεξηθνχ δεζκνχ ζηηο επηθάλεηεο ησλ παζνγφλσλ θαη κπνξεί λα πξνζδέζεη λέν FB θαη FD, δεκηνπξγψληαο πεξηζζφηεξεο θνλβεξηάζεο, νη νπνίεο ζα θφςνπλ πεξηζζφηεξν C3, ζπληζηψληαο έλαλ θχθιν ζεηηθήο αλάδξαζεο. ηνλ θχθιν απηφ ζπλεηζθέξεη θαη ε properdin (ή factor P), ε νπνία είλαη ν κφλνο ζεηηθφο ξπζκηζηηθφο παξάγνληαο ηνπ ζπκπιεξψκαηνο θαη ε ιεηηνπξγία ηνπ είλαη φηη πξνζδέλεηαη ζηελ θνλβεξηάζε C3bBb θαη ηε ζηαζεξνπνηεί. Ο θχθινο ζεηηθήο αλάδξαζεο ζπκβαίλεη ζηηο κεκβξάλεο ησλ παζνγφλσλ επεηδή εθεί δελ ππάξρνπλ αξλεηηθνί ξπζκηζηηθνί παξάγνληεο νη νπνίνη ζα εκπνδίζνπλ ηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο. Αληίζεηα, ηα θχηηαξα ηνπ μεληζηή πξνζηαηεχνληαη απφ ηε δξάζε ηνπ ζπκπιεξψκαηνο κέζσ ηέηνησλ αξλεηηθψλ ξπζκηζηηθψλ παξαγφλησλ ζηνπο νπνίνπο ζα γίλεη αλαθνξά αξγφηεξα. Σέινο, νη θνλβεξηάζεο ρσξίο properdin είλαη αζηαζείο θαη δηαζπψληαη γξήγνξα ζηα επηκέξνπο ζπζηαηηθά ηνπο, γεγνλφο πνπ απνηειεί έλαλ επηπιένλ κεραληζκφ ξχζκηζεο, πνπ δηαζθαιίδεη φηη δε ζα πξνθιεζεί δεκηά ζηα θχηηαξα ηνπ μεληζηή ιφγσ αλεμέιεγθηεο ελεξγνπνίεζεο. Η δεχηεξε δηαδηθαζία πνπ ελεξγνπνηεί ηελ ελαιιαθηηθή νδφ είλαη ε αλαγλψξηζε απφ ηελ properdin δνκψλ ζε μέλα θχηηαξα θαη ζε απνπησηηθά θχηηαξα ηνπ μεληζηή. Μεηά ηελ αλαγλψξηζή απηή, ε properdin πξνζδέλεη θαη C3b ελεξγνπνηψληαο ηελ ζπλαξκνιφγεζε θνλβεξηάζεο C3bBb (6) ή πξνζδέλεη ήδε ππάξρνπζεο θνλβεξηάζεο γηα λα ηηο ζηαζεξνπνηήζεη. (7) Σέινο, ε ηξίηε δηαδηθαζία ζηελ νπνία αλαθέξεηαη ε ελαιιαθηηθή νδφο είλαη απηή πνπ ήδε αλαθέξζεθε: ε ζεηηθή αλάδξαζε ή ν πνιιαπιαζηαζκφο. Σν C3b πνπ παξάγεηαη κέζσ νπνηαζδήπνηε νδνχ κπνξεί λα ζρεκαηίζεη ηελ θνλβεξηάζε C3bBb ηεο ελαιιαθηηθήο νδνχ θαη λα θφςεη πεξηζζφηεξα κφξηα C3 ζε C3b. Γειαδή ή ελαιιαθηηθή νδφο κπνξεί λα εληζρχζεη ηελ απφθξηζε νπνηαζδήπνηε νδνχ. Μάιηζηα ζε ζπγθεθξηκέλεο πεξηπηψζεηο έρεη βξεζεί φηη κπνξεί λα επζχλεηαη γηα ην 80-90% ηεο ζπλνιηθήο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο, αθφκε θη αλ ην 16

17 αξρηθφ έλαπζκα πξνήιζε απφ ηελ θιαζζηθή ή ηελ νδφ ηεο ιεθηίλεο. (8) Γηα απηφ ην ιφγν ε ελαιιαθηηθή νδφο απνηειεί έλα ζεκαληηθφ ζηφρν ζηελ αλαδήηεζε αλαζηνιέσλ ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο. Δηθόλα 3: ρεκαηηθή αλαπαξάζηαζε ησλ ηξηψλ κεξηθψο αιιειεπηθαιππηφκελσλ δηαδηθαζηψλ ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο κέζσ ηεο ελαιιαθηηθήο νδνχ, φπσο πεξηγξάθεηαη παξαπάλσ. Σειηθή νδόο ελεξγνπνίεζεο ηνπ ζπκπιεξώκαηνο ηαλ ε παξαγσγή ηνπ C3b είλαη αξθεηά κεγάιε, ηφηε έλα αθφκα κφξην C3b πξνζδέλεηαη ζηηο θνλβεξηάζεο ηνπ C3 θαη δεκηνπξγεί ηξηπιά ζχκπινθα (C4b3b2b θαη C3b3bBb) ηα νπνία είλαη θνλβεξηάζεο κε δηαθνξεηηθφ ππφζηξσκα, ην C5, ην νπνίν θφβνπλ ζε C5a θαη C5b. Σν C5b κε ηε ζεηξά ηνπ μεθηλά ηελ ζπλαξκνιφγεζε ελφο ζπκπιφθνπ κε ηελ πξσηεΐλε C6 θαη θαηφπηλ ηε C7, κε ηε βνήζεηα ηεο νπνίαο ην ζχκπινθν απηφ εηζέξρεηαη ζηηο κεκβξάλεο. Έπεηηα πξνζδέλεηαη κε ην C8 θαη πνιιαπιέο κνλάδεο C9, νη νπνίεο ζρεκαηίδνπλ πφξνπο ζηηο επηθάλεηεο ζπγθεθξηκέλσλ βαθηεξίσλ (γέλνο Neisseria) νη νπνίνη νδεγνχλ ζηε ιχζε ηνπο. Σν ζχκπινθν C5b-9 ιέγεηαη γηα απηφ ην ιφγν κεκβξαλνιπηηθφ (membrane attack complex ή MAC) (Δηθφλα 4). (1-3, 9) 17

18 Δηθόλα 4: ρεκαηηθή αλαπαξάζηαζε ησλ ηειηθψλ βεκάησλ ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο φπσο πεξηγξάθεηαη παξαπάλσ. Οη παξαπάλσ πεξηγξαθέο ησλ ηξηψλ νδψλ ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο κπνξνχλ λα ζπλνςηζηνχλ ζηελ παξαθάησ εηθφλα. Δηθόλα 5: ρεκαηηθή αλαπαξάζηαζε ησλ ηξηψλ νδψλ ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο πνπ ζπγθιίλνπλ ζηελ ελεξγνπνίεζε ηνπ C3, φπσο πεξηγξάθεηαη παξαπάλσ. Σα ic3b θαη C3d είλαη πξντφληα πέςεο ηνπ C3b πνπ είλαη αλελεξγά σο πξνο ηε ζπκκεηνρή ζε θνλβεξηάζεο, αιιά κεζνιαβνχλ άιιεο ιεηηνπξγίεο, φπσο ζα αλαθεξζεί παξαθάησ. Άιιεο νδνί Πξνζθάησο έρνπλ πεξηγξαθεί θαη άιιεο κέζνδνη κε ηηο νπνίεο ελεξγνπνηείηαη ην ζπκπιήξσκα. Δθφζνλ απηέο δελ έρνπλ κειεηεζεί αθφκα εθηεηακέλα, κηα ζχληνκε κφλν αλαθνξά γίλεηαη ζε απηέο: Η «εμσγελήο νδφο ησλ πξσηεαζψλ» πεξηγξάθεη ηελ ελεξγνπνίεζε ηνπ C3 κέζσ πέςεο απφ πξσηεάζεο πνπ δελ αλήθνπλ ζην ζχζηεκα ηνπο ζπκπιεξψκαηνο, φπσο ε ζξνκβίλε, ε πιαζκίλε, ε ειαζηάζε θαη ε θαιιηθξεΐλε ηνπ πιάζκαηνο. (10) Απφ απηέο, ε ζξνκβίλε κπνξεί λα θφςεη θαη ην C5. (11) Δπίζεο, έρεη βξεζεί φηη ζηελ «νδφ παξάθακςεο ηνπ C2» ην MBL, κεηά ηελ πξφζδεζή ηνπ ζην ζηφρν, κπνξεί λα θφςεη ην C3 ρσξίο ηελ παξνπζία MASP-2, C2 ή C4 in vitro. (12, 13) Η θπζηνινγηθή ζεκαζία απηήο ηεο νδνχ δελ έρεη αθφκα κειεηεζεί εθηελψο. Ρύζκηζε ηεο ιεηηνπξγίαο ηνπ ζπκπιεξώκαηνο Αλ ε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο αθεζεί αλεμέιεγθηε, ηφηε κπνξεί λα επηηεζεί θαηά ηνπ μεληζηή θαη λα πξνθαιέζεη βιάβεο ζε απηφλ. Γηα ην ιφγν απηφ, ην ζχζηεκα ηνπ 18

19 ζπκπιεξψκαηνο πεξηιακβάλεη κηα πιεζψξα ξπζκηζηηθψλ παξαγφλησλ πνπ δξνπλ ζε θάζε νδφ, γηα λα ην ζέηνπλ ππφ έιεγρν. Γηα παξάδεηγκα, ε γιπθνπξσηεΐλε αλαζηνιέαο ηνπ C1 (C1 inhibitor ή C1-INH) ξπζκίδεη αξθεηέο πξσηεάζεο ζηε θιαζζηθή νδφ θαη ηελ νδφ ιεθηίλεο. Δπηπιένλ, ηα πξντφληα ελαιιαθηηθήο κεηαγξαθήο smap θαη MAP-1 ησλ γνληδίσλ MASP2 θαη MASP1/3 αληηζηνίρσο είλαη κε πξσηενιπηηθά θαη ζπλαγσλίδνληαη κε ηηο MASPs γηα ηελ πξφζδεζε ζην ζηφρνπο ηνπο (MBL, ficolins). Δπίζεο, ν αλαζηνιέαο C2 receptor inhibitor trispanning (CRIT) εκπνδίδεη ηελ ελεξγνπνίεζε ηνπ C2 απφ ην C1s. Οξηζκέλεο ξπζκηζηηθέο πξσηεΐλεο ηνπ ζπκπιεξψκαηνο (Regulators of Complement Activation ή RCA) απνηεινχληαη απφ πνιιαπιά δνκηθά κνηίβα 60 πεξίπνπ ακηλνμέσλ πνπ ιέγνληαη βξαρείεο επαλαιακβαλφκελεο αθνινπζίεο ακηλνμέσλ (Short Consensus Repeats ή SCRs). Παξάδεηγκα απηψλ απνηειεί ν παξάγνληαο H (factor H ή FH) πνπ ξπζκίδεη ηελ θνλβεξηάζε ηεο ελαιιαθηηθήο νδνχ κέζσ δχν κεραληζκψλ: επηηαρχλεη ηε δηάζηαζε ηνπ C3bBb ζηα ζπζηαηηθά ηνπ, κέζσ ηνπ ζπλαγσληζκνχ κε ην Bb θαη ιεηηνπξγεί σο ζπκπαξάγνληαο γηα ηελ απνηθνδφκεζε ηνπ C3b απφ ηελ πξσηεάζε παξάγνληα Ι (factor I ή FI). Η νκφινγνο πξσηεΐλε ηνπ FH (FH-like protein 1 ή FHL-1) έρεη παξφκνηεο ιεηηνπξγίεο. Η πξσηεΐλε πνπ πξνζδέλεη C4b (C4b-binding protein ή C4BP) παίδεη παξφκνην ξφιν ζηηο θνλβεξηάζεο ηεο θιαζζηθήο νδνχ θαη ηεο νδνχ ιεθηίλεο. Οη ηξεηο ηειεπηαίεο πξσηεΐλεο κπνξνχλ λα αλαγλσξίζνπλ θαη λα πξνζδεζνχλ ζε δνκέο ησλ θπηηάξσλ ηνπ μεληζηή, φπσο ην ζηαιηθφ νμχ θαη θάπνηεο γιπθνδακηλνγιπθάλεο θαη λα πξνζηαηέςνπλ ηα θχηηαξα απηά απφ ηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο ζηηο επηθάλεηέο ηνπο. Άιιεο ξπζκηζηηθέο πξσηεΐλεο είλαη κεκβξαληθέο θαη κπνξεί λα έρνπλ ιεηηνπξγία επηηάρπλζεο ηεο δηάζηαζεο ησλ θνλβεξηαζψλ ή ιεηηνπξγία ζπκπαξάγνληα ηνπ FI. ηελ πξψηε θαηεγνξία αλήθεη ν παξάγνληαο επηηάρπλζεο ηεο δηάζηαζεο (Decay Accelerating Factor ή DAF ή CD55), ζηε δεχηεξε ν πξσηετληθφο κεκβξαληθφο ζπκπαξάγνληαο (Membrane Cofactor Protein ή MCP ή CD46), ελψ θαη ηηο δχν ιεηηνπξγίεο έρεη ν ππνδνρέαο ζπκπιεξψκαηνο 1 (Complement Receptor 1 ή CR1). Ληγφηεξνη ξπζκηζηέο έρνπλ βξεζεί γηα ηα επφκελα ζηάδηα ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο. Σν FHL-1 αλαζηέιιεη ηελ θνλβεξηάζε ηνπ C5. Ο ππνδνρέαο ζπκπιεξψκαηνο ηεο ππεξνηθνγέλεηαο ησλ αλνζνζθαηξηλψλ (Complement Receptor of the Immunoglobulin superfamily ή CRIg) πηζηεχεηαη φηη ξπζκίδεη ηηο θνλβεξηάζεο ηνπ C3 θαη C5 πνπ πεξηέρνπλ C3. Δπίζεο, ε κεκβξαληθή ξπζκηζηηθή πξσηεΐλε CD59, φπσο θαη νη δηαιπηέο πξσηεΐλεο vitronectin θαη clusterin ξπζκίδνπλ ην MAC. Σέινο, ε θαξβνμππεπηηδάζε-ν θφβεη ηελ ηειηθή αξγηλίλε ησλ αλαθπιαηνμίλσλ, γεγνλφο ην νπνίν αιιάδεη ηε ιεηηνπξγία ηνπο. (1, 9) 19

20 Φπζηνινγηθέο ιεηηνπξγίεο ηνπ ζπκπιεξώκαηνο Σν ζχζηεκα ηνπ ζπκπιεξψκαηνο έρεη βξεζεί φηη είλαη θπινγελεηηθά ζπληεξεκέλν απφ ηνπο πξσηφγνλνπο νξγαληζκνχο, γεγνλφο ην νπνίν θαηαδεηθλχεη ηε ιεηηνπξγηθή ζεκαζία ηνπ. Πξάγκαηη ην ζπκπιήξσκα εθηειεί κηα πιεζψξα ιεηηνπξγηψλ πνπ επεθηείλνπλ ην ξφιν ηνπ πέξα απφ ηε θπζηθή θαη ηελ επίθηεηε αλνζία πξνο ηε γεληθή νκνηνζηαζία ηνπ νξγαληζκνχ, αιιά θαη ζε πην απξνζδφθεηνπο ξφινπο φπσο ζηελ αλαγέλλεζε ηνπ ήπαηνο θαη ηελ αλάπηπμε ηνπ εκβξχνπ. Δδψ ζα γίλεη κηα ζχληνκε αλαθνξά ζηηο βαζηθέο ιεηηνπξγίεο ηνπ ζπκπιεξψκαηνο θαη ζηνπο κεζνιαβεηέο ησλ ιεηηνπξγηψλ απηψλ. Ο νςσληζκφο ησλ παζνγφλσλ κέζσ ηεο ελαπφζεζεο C3b θαη C4b ζηελ επηθάλεηα ηνπο νδεγεί ζηελ αλαγλψξηζε ηνπο απφ θαγνθχηηαξα κέζσ εηδηθψλ ππνδνρέσλ (complement receptors - CRs) θαη ζηε θαγνθπηηάξσζε θαη θαηαζηξνθή ηνπο. Ο CR1 φπσο πξναλαθέξζεθε κπνξεί λα ιεηηνπξγήζεη σο ζπκπαξάγνληαο ηνπ factor I γηα ηελ απελεξγνπνίεζε ησλ πξνζδεηψλ ηνπ. Απηφ εκπνδίδεη ηελ πεξαηηέξσ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο, ελψ παξάιιεια δεκηνπξγεί ic3b θαη C3dg, νη νπνίνη αλαγλσξίδνληαη απφ άιινπο ππνδνρείο: νη CR3 (CD11b-CD18) θαη CR4 (CD11c-CD18) πξνζδέλνπλ ic3b θαη ζπλεηζθέξνπλ ζηελ θαγνθπηηάξσζε θαη άιιεο ιεηηνπξγίεο, ελψ ν CR2 πξνζδέλεη ic3b θαη C3dg θαη νδεγεί ζηελ ελεξγνπνίεζε θαη δηαθνξνπνίεζε ησλ B θπηηάξσλ. Ο CRIg απμάλεη ηε θαγνθπηηάξσζε κέζσ ηεο πξφζδεζήο ηνπ ζην C3b θαη ic3b, ελψ πξνζδέλεη θαη C3c κε αδηεπθξίληζηεο ζπλέπεηεο. Σέινο, ε νςσλίλε C1q αλαγλσξίδεηαη απφ δηάθνξνπο ππνδνρείο φπσο calreticulin, ελεξγνπνηψληαο ηελ θαγνθπηηάξσζε θαη άιιεο ιεηηνπξγίεο. Οη αλαθπιαηνμίλεο πνπ απειεπζεξψλνληαη απφ ηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο είλαη ηζρπξνί κεζνιαβεηέο θιεγκνλήο, νη νπνίνη ξπζκίδνπλ ηελ αγγεηνδηαζηνιή, απμάλνπλ ηε δηαπεξαηφηεηα ησλ ηξηρνεηδψλ αγγείσλ θαη επάγνπλ ηε ζχζπαζε ιείσλ κπηθψλ ηλψλ. Οη ρεκεηνηαθηηθέο ηνπο ηδηφηεηεο θαη ε αχμεζε ησλ ηδηνηήησλ πξνζθφιιεζεο νξηζκέλσλ θπηηάξσλ ηνπ αλνζνπνηεηηθνχ, ηελ νπνία πξνθαινχλ, επάγνπλ ηε δηεπθφιπλζε ηεο κεηαθίλεζεο απηψλ ησλ θπηηάξσλ έμσ απφ ηα ηξηρνεηδή θαη ηε κεηαθίλεζε ηνπο πξνο ηελ πεξηνρή ηεο κφιπλζεο (θαη ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο). Πξφζδεζε ηνπ C3a θαη C5a ζηνπο αληίζηνηρνπο ππνδνρείο ηνπο, C3a receptor (C3aR) θαη C5a receptor (C5aR) ζηε κεκβξάλε ζηηεπηηθψλ θπηηάξσλ θαη βαζεφθηισλ νδεγεί ζηελ ελεξγνπνίεζε ηνπο πξνο παξαγσγή ηζηακίλεο απφ ηα θχηηαξα απηά. ηελ πεξίπησζε ησλ καθξνθάγσλ, νπδεηεξφθηισλ θαη εσζηλφθηισλ, ε πξφζδεζε απηή νδεγεί ζε νμεηδσηηθφ ζηξεο, ελψ πξφζδεζε ηνπ C3a ζηνπο ππνδνρείο C3aR ησλ Β θπηηάξσλ θαη κνλνθπηηάξσλ ξπκίδεη ηε ζχλζεζε IL-6 θαη TNF-α. Έλαο επηπιένλ 20

21 ππνδνρέαο έρεη βξεζεί, ν C5L2, πνπ πξνζδέλεη C5a θαη C5a desarg, αιιά ν ξφινο ηνπ δελ έρεη μεθαζαξηζηεί αθφκα, αθνχ πηζηεχεηαη φηη κπνξεί λα ιεηηνπξγεί σο ξπζκηζηηθφο ππνδνρέαο, (14) σο δφισκα γηα ηελ πξφζδεζε ηνπ C5a θαη ηελ απνκάθξπλζε απφ ηνλ εμσθπηηάξην ρψξν, (15) είηε αληίζεηα φηη πξνάγεη ηε θιεγκνλή (16). Μηα άιιε ζεκαληηθή ιεηηνπξγία ηνπ ζπκπιεξψκαηνο είλαη ε απνκάθξπλζε αλνζνζπκπιεγκάησλ απφ ηελ θπθινθνξία, ε νπνία επηηπγράλεηαη κέζσ ηεο νςσλνπνίεζεο απηψλ ιφγσ ελεξγνπνίεζεο ηεο θιαζζηθήο νδνχ ηνπ ζπκπιεξψκαηνο. Η νςσλνπνίεζε νδεγεί ζηε δηάζπαζε ησλ κεγάισλ αλνζνζπκπιεγκάησλ ζε κηθξφηεξα ηκήκαηα θαζψο θαη ζηελ αλαγλψξηζή ηνπο απφ εξπζξνθχηηαξα ηα νπνία ηα κεηαθέξνπλ απφ ηελ πεξηθέξεηα πξνο ηε ζπιήλα θαη ην ζπθψηη γηα ηελ απνηθνδφκεζή ηνπο απφ ηα καθξνθάγα. Σέινο, ε απεπζείαο ιχζε νξηζκέλσλ Gram αξλεηηθψλ βαθηεξίσλ, εηδηθά ηνπ γέλνπο Neisseria, αιιά θαη νξηζκέλσλ ηψλ, κέζσ ηνπ ζρεκαηηζκνχ πφξσλ ζηελ κεκβξάλε ηνπο ιφγσ ηεο ζπλαξκνιφγεζεο ηνπ MAC, απνηειεί έλαλ ζεκαληηθφ κεραληζκφ άκπλαο πνπ πξνζθέξεη ε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο. Πνζφηεηεο MAC πνπ δελ επαξθνχλ γηα ιχζε ή ζρεκαηηζκφο κεξηθψλ ζπκπιφθσλ, φπσο ην C5b-8 πξνθαινχλ ελεξγνπνίεζε νξηζκέλσλ θπηηάξσλ. (1, 9, 17) Δκπινθή ηνπ ζπκπιεξώκαηνο ζηελ παζνγέλεζε αζζελεηώλ Η ιεηηνπξγία ηνπ ζπκπιεξψκαηνο φπσο πξναλαθέξζεθε πξέπεη λα ειέγρεηαη νχησο ψζηε λα κελ πξνθαιεί βιάβε ζηνλ ίδην ηνλ νξγαληζκφ. Τπεξβνιηθή ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο ή αλεπαξθήο ξχζκηζε κπνξεί λα νδεγήζεη ζε θιεγκνλή θαη ιχζε θπηηάξσλ ηνπ μεληζηή θαη ζρεηίδεηαη κε δηάθνξα θιεγκνλψδε, απηνάλνζα, λεπξνεθθπιηζηηθά θαη ινηκψδε λνζήκαηα θαζψο θαη επηπινθέο ζξφκβσζεο. Γηα παξάδεηγκα, ν ηξαπκαηηζκφο πνπ νθείιεηαη ζε ηζραηκία θαη επαλαηκάησζε ηζηψλ θαη ζπκβαίλεη ζε δηάθνξεο παζνινγηθέο θαηαζηάζεηο, φπσο ην νμχ έκθξαγκα ηνπ κπνθαξδίνπ, ην εγθεθαιηθφ, ην αηκνξξαγηθφ θαη ζεπηηθφ ζνθ θαη ε εγρείξεζε bypass ηεο ζηεθαληαίαο αξηεξίαο, έρεη ζπζρεηηζηεί κε ηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο θαη ηελ αλάπηπμε θιεγκνλήο πνπ ζπκβαίλεη θαηά ην ζηάδην ηεο επαλαηκάησζεο ηνπ ηζηνχ. Απηνάλνζα λνζήκαηα ζηα νπνία εκπιέθεηαη ε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο είλαη ν ζπζηεκαηηθφο εξπζεκαηψδεο ιχθνο θαη ε ξεπκαηνεηδήο αξζξίηηδα, φπνπ θαίλεηαη φηη ε ελαπφζεζε αλνζπκπιεγκάησλ ζηνλ ηζηφ ελεξγνπνηεί ηελ θιαζζηθή νδφ ηνπ ζπκπιεξψκαηνο θαη επνκέλσο ηελ θιεγκνλή. Παξνκνίσο έρεη βξεζεί ζπζρέηηζε κε ηηο λεπξνεθθπιηζηηθέο αζζέλεηεο 21

22 ηνπ Alzheimer, ηνπ Parkinson θαη ηνπ Huntington. Σν C5a ζρεηίδεηαη κε ηελ παζνγέλεζε ηνπ άζζκαηνο θαη ηεο ςσξίαζεο. (9) Αθφκα, πξφζθαηα βξέζεθε φηη ε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο εκπιέθεηαη ζην απηνάλνζν ζχλδξνκν αληηθσζθνιηπηδίσλ: ηα αληηζψκαηα έλαληη ησλ θσζθνιηπηδίσλ ελεξγνπνηνχλ ην ζπκπιήξσκα, θαη ην C5a πνπ παξάγεηαη ππξνδνηεί ηελ παξαγσγή ηζηηθνχ παξάγνληα απφ νπδεηεξφθηια, ν νπνίνο έπεηηα ελεξγνπνηεί ηε δηαδηθαζία ηεο πήμεο. Ο κεραληζκφο απηφο δείρλεη ηε δηαπινθή ηνπ ζπζηήκαηνο ηνπ ζπκπιεξψκαηνο κε απηφ ηεο πήμεο θαη εμεγεί ηελ πξνδηάζεζε ησλ αζζελψλ κε ζχλδξνκν αληηθσζθνιηπηδίσλ γηα ζξφκβσζε. (18) Η ππξνδφηεζε ηνπ ηζηηθνχ παξάγνληα απφ ηε ζεκαηνδφηεζεο ηνπ C5a βξέζεθε φηη επίζεο ιακβάλεη ρψξα θαηά ην ζχλδξνκν νμείαο αλαπλεπζηηθήο δπζρέξεηαο (Acute Respiratory Distress Syndrome - ARDS), (19) θαζψο θαη θαηά ηηο επηπινθέο ζξφκβσζεο ζε αζζελείο κε λεθξηθή αλεπάξθεηα ηειηθνχ ζηαδίνπ πνπ ππφθεηληαη ζε αηκνθάζαξζε, ιφγσ ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο απφ ην βηνυιηθφ ησλ θίιηξσλ αηκνθάζαξζεο. (20) Με απνηειεζκαηηθή ξχζκηζε ηνπ ζπκπιεξψκαηνο κπνξεί λα πξνθχςεη απφ κεηαιιάμεηο ή ζπγθεθξηκέλνπο πνιπκνξθηζκνχο ησλ γνληδίσλ ησλ ξπζκηζηψλ νδεγνχλ ζε ηξνπνπνίεζε ηεο ιεηηνπξγίαο ηνπο. Γηα παξάδεηγκα, δηάθνξνη πνιπκνξθηζκνί πνπ κεηψλνπλ ηελ ελεξγφηεηα παξάγνληα Η ζρεηίδνληαη κε ηελ παζνγέλεζε ηεο αζζέλεηαο ειηθηαθή εθθχιηζε ηεο σρξάο θειίδαο, ε νπνία απνηειεί ηελ θχξηα αηηία ηχθισζεο ζην δπηηθφ θφζκν. Οξηζκέλεο κεηαιιάμεηο ηεο ίδηαο πξσηεΐλεο πξνθαινχλ άηππν νπξαηκηθφ αηκνιπηηθφ ζχλδξνκν. Δπίζεο, ρακειά επίπεδα C1-INH ζην πιάζκα νδεγνχλ ζε θιεξνλνκηθφ αγγεηννίδεκα. Σέινο ε έιιεηςε ηνπ CD59 πάλσ ζηα εξπζξνθχηηαξα είλαη ππεχζπλε γηα ηελ παξνμπζκηθή λπθηεξηλή αηκνζθαηξηλνπξία. (9) Απφ ηηο νδνχο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο, ε ελαιιαθηηθή θαίλεηαη λα παίδεη ηδηαίηεξν ξφιν ζηελ παζνγέλεζε νξηζκέλσλ αζζελεηψλ, επεηδή είλαη ππεχζπλε γηα ηελ ελίζρπζε ηεο απφθξηζεο ησλ άιισλ νδψλ κέζσ ελφο θχθινπ ζεηηθήο αλάδξαζεο. Κιηληθέο ελδείμεηο γηα ηελ ελεξγνπνίεζή ηεο (αλίρλεπζε ελεξγνπνηεκέλσλ κνξθψλ ησλ ζπζηαηηθψλ ηεο) έρνπλ βξεζεί ζε παζνινγηθέο θαηαζηάζεηο φπσο ε ζπεηξακαηνλεθξίηηδα, ν ζπζηεκαηηθφο εξπζεκαηψδεο ιχθνο, δεξκαηηθέο αζζέλεηεο, θιεγκνλψδεηο αξζξίηηδεο θ.ά. Δπίζεο, ε εκπινθή ηεο ελαιιαθηηθήο νδνχ ζην ηξαπκαηηζκφ ησλ ηζηψλ έρεη βξεζεί ζε δηάθνξα πεηξακαηηθά κνληέια αζζελεηψλ κέζσ ηεο ρξήζεο γελεηηθά ηξνπνπνηεκέλσλ πνληηθψλ πνπ δελ εθθξάδνπλ FΒ ή FD ή κε ρξήζε αλαζηνιέσλ απηψλ ησλ πξσηετλψλ. Απηέο νη αζζέλεηεο πεξηιακβάλνπλ ηε ξεπκαηνεηδή αξζξίηηδα, ηνλ ηξαπκαηηζκφ ιφγσ ηζραηκίαο θαη επαλαηκάησζεο ηζηψλ, ην αληηθσζθνιηπηδηθφ ζχλδξνκν θ.ά. (21) 22

23 Καζψο ην ζπκπιήξσκα απνηειεί ζεκαληηθφ κεραληζκφ γηα ηελ θαηαπνιέκεζε ησλ κνιχλζεσλ, πνιινί ηνί θαη βαθηήξηα έρνπλ αλαπηχμεη κεραληζκνχο δηαθπγήο, θαηαζηξνθήο ή αθφκα θαη εθκεηάιιεπζεο ηνπ ζπκπιεξψκαηνο γηα ηελ επηβίσζή ηνπο, νδεγψληαο ζε απμεκέλε κνιπζκαηηθφηεηα. Παξαδείγκαηα απνηεινχλ ν ηφο ηεο επινγηάο θαη ν ρξπζίδσλ ζηαθπιφθνθθνο. (22, 23) Ο ηειεπηαίνο ζα αλαιπζεί παξαθάησ. Σν ζπκπιήξσκα σο ζηόρνο ζεξαπείαο Απφ ηα παξαπάλσ γίλεηαη θαηαλνεηφ φηη ζε πνιιέο παζνινγηθέο θαηαζηάζεηο ε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο πξνθαιεί βιάβε ζηνπο ηζηνχο ηνπ μεληζηή θαη φηη ε αλάπηπμε ζεξαπεηψλ πνπ ζηνρεχνπλ ην ζπκπιήξσκα ζα κπνξνχζε λα αληηκεησπίζεη απηή ηε βιάβε θαη ηηο επηπηψζεηο ηεο. Σν εξψηεκα πνπ πξνθχπηεη είλαη, πνηά απφ ηηο πνιιέο πξσηεΐλεο ηνπ ζπκπιεξψκαηνο ζα πξέπεη λα ζηνρεχζεη θαλείο, γηα λα επηηχρεη απνηειεζκαηηθή θαη εηδηθή ζεξαπεία, ρσξίο λα παξεκπνδίδεη ηηο επεξγεηηθέο θαη πξνζηαηεπηηθέο ιεηηνπξγίεο ηνπ ζπκπιεξψκαηνο γηα ηνλ νξγαληζκφ. πσο έρεη ζπδεηεζεί εθηελψο ζε αλαζθνπήζεηο πνπ ζπλνςίδνπλ φζα είλαη γλσζηά γηα ηνπο αλαζηνιείο ηνπο ζπκπιεξψκαηνο παιηφηεξα (24, 25), αιιά θαη πην πξφζθαηα (23, 26), ζε θάζε παζνινγηθή θαηάζηαζε, ν ζηφρνο γηα ζεξαπεία κπνξεί λα είλαη δηαθνξεηηθφο, αθνχ ε αηηία ηεο βιάβεο κπνξεί λα είλαη δηαθνξεηηθή. Αλ ε αηηία είλαη κηα ζπγθεθξηκέλε νδφο ελεξγνπνίεζεο, ηφηε θπζηθά απηή ε νδφο ζα πξέπεη λα γίλεη ν ζηφρνο γηα ζεξαπεία. Δάλ κάιηζηα είλαη δπλαηφλ λα αλαζηείιεη θαλείο εηδηθά ηε ζπγθεθξηκέλε αιιειεπίδξαζε πνπ πξνθαιεί ηελ ελεξγνπνίεζε, φπσο γηα παξάδεηγκα ηελ αιιειεπίδξαζε ηνπ C1q κε ηηο ακπινεηδείο πιάθεο, ζηελ πεξίπησζε ηεο αζζέλεηαο ηνπ Alzheimer, απηφ ζα ήηαλ αθφκα θαιχηεξν. Άιινπο ζηφρνπο απνηεινχλ νη πξσηεάζεο ηνπ ζπκπιεξψκαηνο, αθνχ σο έλδπκα είλαη πηζαλφλ λα αλαζηαινχλ κε κηθξά κφξηα θαη επίζεο, θαλείο κπνξεί λα αλαζηείιεη επηιεθηηθά ηηο πξσηεάζεο κίαο νδνχ ελεξγνπνίεζεο ε νπνία είλαη ππεχζπλε γηα ηε βιάβε. Αθφκα, νη θπηηαξηθέο απνθξίζεηο πνπ κεζνιαβνχληαη απφ ππνδνρείο ηνπ ζπκπιεξψκαηνο, φπσο ν C3aR θαη C5aR, κπνξνχλ λα αλαζηαινχλ κε ηε ρξήζε αληαγνληζηψλ. Έηζη ζα κπνξνχζε θαλείο λα θαηαπνιεκήζεη ηε θιεγκνλή, αιιά λα επηηξέςεη λα ιάβνπλ ρψξα ηα πξνεγνχκελα ζηάδηα ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο, ε νςσλνπνίεζε θαη θαηαζηξνθή ησλ κηθξνβίσλ. Σέινο, φηαλ έλα άηνκν εθθξάδεη έλαλ ξπζκηζηή, φπσο ηνλ FH, κε κηα κεηάιιαμε ή πνιπκνξθηζκφ πνπ κεηψλεη ηε δξαζηηθφηεηά νδεγψληαο ζε απμεκέλα επίπεδα ελεξγνπνίεζεο, ηφηε ε ρνξήγεζε ηεο θπζηνινγηθήο κνξθήο ηνπ ξπζκηζηή ζα κπνξνχζε λα πξνζθέξεη κηα απνηειεζκαηηθή ζεξαπεία. 23

24 Δλψ νη πεξηζζφηεξνη θπζηθνί ξπζκηζηέο ηνπ ζπκπιεξψκαηνο (FΗ, DAF, MCP, CR1) ζηνρεχνπλ ην θεληξηθφ κφξην ηνπ ζπζηήκαηνο, (C3) απηνί ηαπηφρξνλα ζηνρεχνπλ ηηο θπηηαξηθέο κεκβξάλεο ηνπ μεληζηή. Γξνπλ δειαδή κε εηδηθφηεηα γηα λα πξνζηαηέςνπλ ηα θχηηαξα ηνπ μεληζηή, αιιά επηηξέπνπλ ζην ζπκπιήξσκα λα θαηαπνιεκήζεη ηνπο παζνγφλνπο κηθξννξγαληζκνχο. Έλαο ηερλεηφο αλαζηνιέαο ηνπ C3 πηζαλψο ζα ζηακαηνχζε ηελ ελεξγνπνίεζε ζην επίπεδν ηνπ C3 ζπλνιηθά: ηελ ελεξγνπνίεζε ησλ ηξηψλ νδψλ, ηελ ελίζρπζε ηεο απφθξηζεο κέζσ ηεο ελαιιαθηηθήο νδνχ θαη ηελ ηειηθή νδφ ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο, ζε θπηηαξηθέο επηθάλεηεο θαη ζην κεζνθπηηάξην ρψξν. Απηφ ζηηο πεξηζζφηεξεο πεξηπηψζεηο κπνξεί λα κελ είλαη επηζπκεηφ ζε ζπζηεκαηηθφ επίπεδν, δηφηη ν νξγαληζκφο έηζη ζα είλαη εθηεζηκέλνο ζε κνιχλζεηο απφ κηθξννξγαληζκνχο. ε ηνπηθφ επίπεδν φκσο, γηα παξάδεηγκα ζε ζπγθεθξηκέλν φξγαλν, φπσο ην κάηη, γηα ηε ζεξαπεία ηεο ειηθηαθήο εθθχιηζεο ηεο σρξάο θειίδαο, ζα κπνξνχζε λα είλαη πνιχ απνηειεζκαηηθή πξνζέγγηζε. Ο αλαζηνιέαο compstatin, πνπ πξνζδέλεηαη ζην C3 θαη αλαζηέιιεη ηελ ελεξγνπνίεζή ηνπ θαη απφ ηηο ηξεηο νδνχο είλαη ζε θιηληθέο δνθηκέο γηα ηελ ζεξαπεία απηή ηεο αζζέλεηαο. Ο ζπγθεθξηκέλνο αλαζηνιέαο θαη ε ζεκαζία ηνπ ζα ζπδεηεζεί πεξηζζφηεξν παξαθάησ. πσο εμεγήζεθε παξαπάλσ είλαη επίζεο ζεκαληηθφ λα αλαπηπρζνχλ εηδηθνί αλαζηνιείο ηεο ελαιιαθηηθήο νδνχ, γηα παξάδεηγκα ηνπ FΒ ή ηνπ FD. Δπεηδή ν αθξηβήο κεραληζκφο ηεο ελεξγνπνίεζεο ηεο θνλβεξηάζεο απηήο ηεο νδνχ δελ είλαη γλσζηφο, γίλεηαη δπζθνιφηεξν λα ζρεδηάζεη θαλείο θαη λα αλαπηχμεη έλαλ αλαζηνιέα. Γηα απηφ ην ιφγν είλαη πνιχ ζεκαληηθφ λα αλαιπζεί ε αιιειεπίδξαζε ηνπ C3b κε ηνλ FΒ θαη ηνλ FD θαη λα βξεζνχλ ηα ζεκεία αιιειεπίδξαζήο ηνπο. Παξαθάησ ζα γίλεη ζχληνκε αλαδξνκή ηεο βηβιηνγξαθίαο πάλσ ζηε ζπζρέηηζε δνκήο θαη ιεηηνπξγίαο ησλ πξσηετλψλ ηεο ελαιιαθηηθήο νδνχ. Δθηφο απφ ηελ compstatin, παξαδείγκαηα θαξκάθσλ έλαληη ηνπ ζπκπιεξψκαηνο πνπ βξίζθνληαη ζηελ αγνξά ή ζε θιηληθέο ή πξνθιηληθέο δνθηκέο γηα ηε ζεξαπεία ζπγθεθξηκέλσλ αζζελεηψλ απνηεινχλ: έλα αληίζσκα έλαληη ηνπ C5 (Eculizumab / Soliris), γηα ηελ παξνμπζκηθή λπρηεξηλή αηκνζθαηξηλνπξία, θαζψο θαη ην PMX-53, ην JPE-1375 θαη ην JSM-7717, πνπ είλαη αληαγσληζηέο ηνπ C5aR, γηα δηάθνξεο παζήζεηο φπνπ εκπιέθεηαη θιεγκνλή. Δπίζεο, ππφ αλάπηπμε βξίζθνληαη αληηζψκαηα έλαληη ζπζηαηηθψλ ηεο ελαιιαθηηθήο νδνχ, αιιά θαη δηάθνξεο θπζηθέο ή αλαζπλδπαζκέλεο κνξθέο ησλ ξπζκηζηψλ ηνπ ζπκπιεξψκαηνο, ελψ ζηελ αγνξά βξίζθεηαη ήδε ν C1-INH (γηα ηε ζεξαπεία ηνπ θιεξνλνκηθνχ αγγεηννηδήκαηνο) (23, 26). 24

25 Σν θεληξηθό έλδπκν ηνπ ζπκπιεξώκαηνο Η θνλβεξηάζε ηνπ C3 ηεο ελαιιαθηηθήο νδνχ, φπσο θαη απηή ηεο θιαζζηθήο νδνχ ή ηεο νδνχ ιεθηίλεο είλαη ζχκπινθν δχν πξσηετλψλ. Η ζπλαξκνιφγεζή ηνπ πξνθχπηεη απφ ηηο αιιειεπηδξάζεηο αξρηθψλ κνξίσλ, αθνινπζνχκελε απφ πξσηενιπηηθή ελεξγνπνίεζε κέζσ ηεο δξάζεο πξσηεαζψλ ζεξίλεο πςειήο εηδηθφηεηαο. Δλψ ε κία απφ ηηο πξσηεΐλεο ηνπ ζπκπιφθνπ έρεη ηελ ελδπκηθή ελεξγφηεηα ηεο θνλβεξηάζεο, απηή ε ελδπκηθή δξαζηεξηφηεηα δελ κπνξεί λα ζπκβεί παξά κφλν ζηα πιαίζηα ηνπ ζπλαξκνινγεκέλνπ ζπκπιφθνπ. Απηφ απνηειεί έλαλ κεραληζκφ ξχζκηζεο, εθφζνλ, ε απνδηάηαμε ηνπ ζπκπιφθνπ νδεγεί ζηελ απψιεηα ηεο ελεξγφηεηαο. Η ελαιιαθηηθή νδφο, φπσο είπακε βξίζθεηαη ζην θέληξν ηεο δξάζεο ηνπ ζπκπιεξψκαηνο, ιφγσ ηνπ ξφινπ ηεο ζε πνιιαπιά επίπεδα (ζηελ δηαηήξεζε ρακεινχ επηπέδνπ ηπραίαο ελεξγνπνίεζεο, ζηελ εηδηθή αλαγλψξηζε θαη ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο θαη ζηνλ πνιιαπιαζηαζκφ ηεο απφθξηζεο φισλ ησλ νδψλ). Η θνλβεξηάζε απηήο ηεο νδνχ απνηειεί γηα απηφ ην ιφγν έλα βαζηθφ θνκκάηη κειέηεο ηεο παξνχζαο δηαηξηβήο. Η ζπλαξκνιφγεζή ηεο μεθηλά κε ηελ πξφζδεζε ηνπ C3b πάλσ ζε επηθάλεηα παζνγφλνπ κέζσ ελφο ζεηνεζηεξηθνχ δεζκνχ πνπ εθηίζεηαη θαηά ηελ κεηαηξνπή ηνπ απφ ην C3. Έπεηηα, ν FΒ πξνζδέλεηαη ζην C3b, κε ηελ πξνυπφζεζε φηη ηφληα καγλεζίνπ είλαη παξφληα, ζρεκαηίδνληαο ην ζχκπινθν ηεο πξνθνλβεξηάζεο C3bB. Απηή είλαη κηα αλαζηξέςηκε αληίδξαζε αθνχ ν FΒ κπνξεί λα απνδεζκεπηεί απφ ην C3b. Καηά ηελ πξφζδεζε ζην C3b ε ηξηζδηάζηαηε δηακφξθσζε ηνπ FΒ ππφθεηηαη ζε αιιαγέο, νη νπνίεο ηνλ θάλνπλ επαίζζεην ζε πξσηενιπηηθή δηάζπαζε απφ ηνλ FD κεηά ην θαηάινηπν Arg 234 πνπ νδεγεί ζηε απειεπζέξσζε ηνπ Ba. Σν Bb ζξαχζκα παξακέλεη πξνζδεδεκέλν ζην C3b ζρεκαηίδνληαο ηελ ελεξγφ θνλβεξηάζε C3bBb. Η θαηαιπηηθή δξάζε ηεο θνλβεξηάζεο βξίζθεηαη ζηε κία απφ ηηο δχν δνκηθέο επηθξάηεηεο (domain) ηνπ Bb, απηή ηεο πξσηεάζεο ζεξίλεο. Γηα λα ιεηηνπξγήζεη φκσο, είλαη απαξαίηεην ην Bb λα είλαη πξνζδεδεκέλν ζην C3b, ην νπνίν ιεηηνπξγεί σο ζπκπαξάγνληαο ηνπ ελδχκνπ. Η θνλβεξηάζε θαηαιχεη ηελ πέςε κνξίσλ C3 κεηά ην θαηάινηπν Arg 726 ηεο πνιππεπηηδηθήο ηνπο αιπζίδαο α, απειεπζεξψλνληαο ην C3a. Σν C3b πνπ πξνθχπηεη κπνξεί λα πξνζδεζεί ζηελ επηθάλεηα ηνπ παζνγφλνπ θαη λα πξνζδέζεη λέν FΒ μεθηλψληαο έλαλ λέν θχθιν ζρεκαηηζκνχ θνλβεξηάζεο θαη δεκηνπξγίαο C3b, γεγνλφο ην νπνίν νδεγεί ηαρχηαηα ζηνελ νςσλνπνίεζε ηνπ παζνγφλνπ. Η θνλβεξηάζε έρεη κηθξφ ρξφλν εκηδσήο θαη ε απνδέζκεπζε ηνπ Bb πηζηεχεηαη φηη είλαη κε αλαζηξέςηκε αληίδξαζε, αθνχ απηφ δελ κπνξεί λα πξνζδεζεί μαλά ζε C3b. ηελ πξαγκαηηθφηεηα, έρεη βξεζεί φηη in vitro ην Bb θαηέρεη ρακειή ελεξγφηεηα πέςεο ηνπ C3 θαη 25

26 αηκνιπηηθή ελεξγφηεηά ε νπνία είλαη 100 θνξέο κηθξφηεξε απφ απηή ηνπ παξάγνληα Β (27), αιιά ε θπζηνινγηθή ζεκαζία απηνχ ηνπ επξχκαηνο δελ είλαη γλσζηή. Γνκή ησλ ζπζηαηηθώλ ηεο θνλβεξηάζεο ηεο ελαιιαθηηθήο νδνύ Η δνκή ησλ επηκέξνπο πξσηετλψλ πνπ νδεγνχλ ζηε ζπλαξκνιφγεζε ηεο θνλβεξηάζεο ηεο ελαιιαθηηθήο νδνχ έρεη γίλεη γλσζηή κέζσ θξπζηαιινγξαθηθψλ αλαιχζεσλ θαη έηζη έρνπκε έξζεη πην θνληά ζην λα θαηαλνήζνπκε ηνπο κεραληζκνχο ελεξγνπνίεζεο θαη ξχζκηζεο ηεο θνλβεξηάζεο. Παξφια απηά θαη παξφιεο ηηο βηνρεκηθέο έξεπλεο θαη έξεπλεο κεηαιιαμηγέλεζεο, φπσο ζα γίλεη θαηαλνεηφ, δελ ππάξρνπλ αθφκε άκεζεο απνδείμεηο γηα απηνχο ηνπο κεραληζκνχο θαη γηα ηελ ηνπνινγία ησλ ζεκείσλ πξφζδεζεο κεηαμχ απηψλ ησλ πξσηετλψλ ψζηε ν ζρεδηαζκφο εηδηθψλ αλαζηνιέσλ ησλ αιιειεπηδξάζεψλ ηνπο λα είλαη πνιχ δχζθνινο. Η αξρηθή αλάιπζε ηεο δνκήο ηνπ C3 θαη C3c (28), θαζψο θαη ηνπ C3b αξγφηεξα (29) έδεημε ηελ νξγάλσζε ησλ δνκηθψλ επηθξαηεηψλ ηνπο θαη ην κεραληζκφ ελεξγνπνίεζεο ηνπ C3. Πεξηιεπηηθά, ην C3 απνηειείηαη απφ 13 δνκηθέο επηθξάηεηεο, εθ ησλ νπνίσλ νη 8 είλαη παξφκνηεο θαη νλνκάδνληαη καθξνζθαηξίλεο (MG). Απηέο ζρεκαηίδνπλ ηνλ δνκηθά ζηαζεξφ ππξήλα ηνπ κνξίνπ. Οη ππφινηπεο επηθξάηεηεο έρνπλ ηε δπλαηφηεηα κεηαθίλεζεο θαη πεξηιακβάλνπλ ηελ θαξβνμπηειηθή επηθξάηεηα C345C, ηελ αλαθπιαηνμίλε C3a θαη ην C3d (επηθξάηεηα TED), ην νπνίν πεξίερεη ην ζεηνεζηεξηθφ δεζκφ. ην C3, ν ζεηνεζηεξηθφο δεζκφο πξνζηαηεχεηαη ζην εζσηεξηθφ ηνπ κνξίνπ, ελψ ζην C3b εθηεηακέλε αλαδηάηαμε ηεο επηθξάηεηαο πνπ νλνκάδεηαη CUB θαη ηνπ C3d νδεγεί ζηελ έθζεζε ηνπ ζεηνεζηεξηθνχ δεζκνχ ζην εμσηεξηθφ ηνπ κνξίνπ, απφ φπνπ κπνξεί λα επηηεζεί ζηηο επηθάλεηεο ησλ παζνγφλσλ (Δηθφλα 6). Οη αιιαγέο δηακφξθσζεο θαηά ηε κεηάβαζε απφ C3 ζε C3b θαη έπεηηα ζε C3c επίζεο επεμήγεζαλ ηηο δηαθνξέο ζηε ζπγγέλεηα πξφζδεζεο πξνο ηνπο δηάθνξνπο παξάγνληεο, ξπζκηζηέο θαη ππνδνρείο ηνπ C3. (28) Σν πξνέλδπκν FΒ έρεη επίζεο θξπζηαιινγξαθεζεί γεγνλφο ην νπνίν επίζεο έξημε θσο ζηνλ πηζαλφ κεραληζκφ ελεξγνπνίεζήο ηνπ. Ο FΒ απνηειείηαη απφ ηξία SCRs ζην ακηλνηειηθφ άθξν, ηα νπνία αληηζηνηρνχλ ζην ηκήκα Ba, θαζψο θαη δχν άιιεο δνκηθέο επηθξάηεηεο, ηελ κεζαία Von Willebrand factor A (VWA) (30) θαη ηελ θαξβνμπηειηθή επηθξάηεηα πξσηεάζεο ζεξίλεο (serine protease (SP)) (31), νη νπνίεο αληηζηνηρνχλ ζην Bb. ηελ επηθξάηεηα VWA πεξηέρεηαη ε πξνβιεπφκελε πεξηνρή πξφζδεζεο ζην C3b πνπ εμαξηάηαη απφ ηφληα κεηάιισλ (metal iondependent adhesion site MIDAS). πγθεθξηκέλα, ηα ηφληα πνπ πξνζδέλνληαη ζην MIDAS ηνπ FΒ είλαη ηφληα καγλεζίνπ. ε απηφ ην ζεκείν πξέπεη λα αλαθεξζεί φκσο φηη έρεη βξεζεί πσο ηφληα ληθειίνπ επάγνπλ ηε δεκηνπξγία πην ζηαζεξήο θνλβεξηάζεο, (32) γεγνλφο ην νπνίν εθκεηαιιεπηήθακε γηα ηελ θξπζηαιινπνίεζε θαη ηε βηνρεκηθή κειέηε ηνπ ελδχκνπ, φπσο ζα γίλεη 26

27 θαηαλνεηφ παξαθάησ. χγθξηζε ηεο δνκήο ηνπ FB κε δνκέο άιισλ ελδχκσλ κε παξφκνηεο επηθξάηεηεο, θαζψο θαη κε πξνεγνχκελε δνκή ηξνπνπνηεκέλνπ Bb (33) πνπ ήηαλ ζηαζεξνπνηεκέλε ζηε ιεγφκελε «αλνηρηή» (ελεξγφ) δηακφξθσζε (φπνπ ε γσλία κεηαμχ ησλ επηθξαηεηψλ VWA θαη SP είλαη κεγάιε), έδεημε φηη ν ειεχζεξνο FΒ βξίζθεηαη ζε αλελεξγφ κνξθή. Η ππφζεζε πνπ δηαηππψζεθε ήηαλ φηη θαηά ηελ πξφζδεζε ζην C3b επέξρεηαη αιιαγή ηεο δηακφξθσζεο ηνπ FΒ, ε νπνία κεηαηνπίδεη ηα ηξία SCRs ηνπ Ba. Ωο απνηέιεζκα, κία α-έιηθα πνπ ιέγεηαη αl κεηαθηλείηαη απφ ηε ζέζε ηεο θαη επηηξέπεη ζε ηελ α7 λα ιάβεη ηε ζέζε απηή, γεγνλφο πνπ εθζέηεη ζην εμσηεξηθφ ηνπ κνξίνπ ηνλ πξνεγνπκέλσο θξπκκέλν δεζκφ πνπ ζα θνπεί απφ ηνλ FD θαη ζεκαηνδνηεί ηελ ελεξγφ κνξθή ηνπ ελδχκνπ (Δηθφλα 7). (34) Η δνκή ηνπ FD έρεη ήδε ιπζεί απφ ην (35) Έλαο ζεκαληηθφο φγθνο έξεπλαο θξπζηαιινγξαθίαο θαη κεηαιιαμηγέλεζεο πνπ ζπλνςίδνληαη ζηελ αλαζθφπεζε (36) έδεημε ηα δνκηθά ραξαθηεξηζηηθά πνπ επζχλνληαη γηα ηελ εηδηθφηεηα θαη ην κεραληζκφ δξάζεο ηνπ FD: Δίλαη κνλαδηθφο ζην φηη απνηειείηαη απφ κία κφλν επηθξάηεηα ε νπνία έρεη ηελ ελεξγφηεηα πξσηεάζεο ζεξίλεο θαη θπθινθνξεί ζην αίκα ζηελ ψξηκε κνξθή ηνπ θαη φρη σο πξνέλδπκν φπσο ν FΒ. Δπίζεο, θαίλεηαη φηη ηα δνκηθά ζηνηρεία ηεο αχιαθαο πξφζδεζεο ηνπ ππνζηξψκαηνο θαη ηνπ θαηαιπηηθνχ θέληξνπ έρνπλ άηππεο δηακνξθψζεηο. Γηα παξάδεηγκα, ν πξνζαλαηνιηζκφο ησλ ακηλνμέσλ ηεο θαηαιπηηθήο ηξηάδαο (His 41, Asp 89 θαη Ser 183, αξίζκεζε θαηά FD θαη φρη θαηά ρπκνηξπςίλε) δελ είλαη ζπκβαηφο κε θαηαιπηηθή ελεξγφηεηα. ηνλ κεραληζκφ πνπ θαζνξίδεη ηελ ιεηηνπξγία θαη εηδηθφηεηά ηνπ θαίλεηαη λα ζπλεηζθέξνπλ ζπγθεθξηκέλνη βξφγρνη ηεο πνιππεπηηδηθήο αιπζίδαο. Απφ απηνχο, ν έλαο (ακηλνμέα ) είλαη ηνπνζεηεκέλνο πάλσ απφ ην θαηαιπηηθφ θέληξν ηνπ ελδχκνπ θαη αλαζηέιιεη ηε δξάζε ηνπ (θαινχκελνο απην-αλαζηαιηηθφο βξφγρνο), ελψ ν άιινο βξίζθεηαη ζηελ επηθάλεηα ηνπ κνξίνπ θαη πξνβιέπεηαη λα είλαη ζεκαληηθφο γηα ηελ αιιαγή δηακφξθσζεο πνπ επέξρεηαη κε ηελ πξφζδεζε ζην ππφζηξσκα (δεο παξαθάησ θαη Δηθφλα 8). Παξφιε ηε ζεκαζία ηεο ζηε ζπλαξκνιφγεζε θαη ζηαζεξνπνίεζε ηεο θνλβεξηάζεο ηεο ελαιιαθηηθήο νδνχ, ε δνκή ηεο properdin δελ έρεη ιπζεί κε θξπζηαιινγξαθία. Δίλαη γλσζηφ φηη ππάξρεη ζε κνξθή νκν-δηκεξνχο, -ηξηκεξνχο ή -ηεηξακεξνχο. Η ππνκνλάδα ηεο απνηειείηαη απφ κηα ακηλνηειηθή αιιεινπρία πνπ δελ παξνπζηάδεη νκνινγία κε γλσζηέο δνκέο θαη έμη επηθξάηεηεο κε νκνινγία ζξνκβνζπνλδίλεο ηχπνπ Ι. (37) Έλα κνληέιν ηεο δνκήο ηνπ νκν-δηκεξνχο θαη - ηξηκεξνχο ηχπνπ έρεη δεκηνπξγεζεί κέζα απφ κειέηεο ζθέδαζεο αθηίλσλ Υ θαη ππεξθπγνθέληξεζεο, αιιά επεηδή δελ είλαη γλσζηφ θαηά πφζν ην κνληέιν απηφ αληαπνθξίλεηαη ζηελ πξαγκαηηθφηεηα, απηφ δε ζα ζπδεηεζεί εδψ. (38) Γεληθά απηφ ην κφξην έρεη κειεηεζεί 27

28 ιηγφηεξν ζε ζρέζε κε ηα πξναλαθεξζέληα θαη γηα ιφγνπο απινχζηεπζεο δελ ζπκπεξηιήθζεθε σο αληηθείκελν κειέηεο ζηελ παξνχζα δηαηξηβή. Πεξηνρέο αιιειεπίδξαζεο αλάκεζα ζηα ζπζηαηηθά ηεο θνλβεξηάζεο ηεο ελαιιαθηηθήο νδνύ εκαληηθή πξνζπάζεηα έρεη γίλεη γηα ηνλ πξνζδηνξηζκφ ησλ πεξηνρψλ αιιειεπίδξαζεο κεηαμχ ηνπ C3b, FB θαη FD. πγθεθξηκέλα ε πεξηνρή πξφζδεζεο ηνπ FB πάλσ ζην C3b έρεη δηεξεπλεζεί αξρηθά κέζσ πεηξακάησλ ζπλαγσληζκνχ πξφζδεζεο κε αληηζψκαηα θαη πεπηίδηα πνπ αλέδεημαλ ηελ αιιεινπρία σο πεξηνρή πξφζδεζεο ηνπ FB. (39) Έπεηηα, κε κηα κειέηε ζάξξσζεο βηβιηνζεθψλ πεπηηδίσλ πνπ θαιχπηνπλ ηελ παξαπάλσ αιιεινπρία ηνπ C3 ε πξφζδεζε ηνπ παξάγνληα Β πξνζδηνξίζηεθε ζηελ πεξηνρή (Δηθφλα 6). (40-42) Γε θαίλεηαη λα ππάξρεη έλδεημε γηα πξφζδεζε ηνπ FD ζην C3b. Δηθόλα 6: Αξηζηεξά θαίλεηαη ε δνκή ηνπ C3, ζηελ νπνία θαίλνληαη νη 13 επηθξάηεηεο ζχκθσλα κε (28). Σα ακηλνμέα ηνπ ζεηνεζηεξηθνχ δεζκνχ (δείρλνληαη κε θφθθηλεο ζθαίξεο) είλαη πξνζηαηεπκέλα ζην εζσηεξηθφ ηνπ κνξίνπ. Αληίζεηα, ζηε δνκή ηνπ C3b (δεμηά) βιέπνπκε φηη κε ηελ αλαδηάηαμε ησλ CUB θαη TED ν ζεηνεζηεξηθφο δεζκφο εθηίζεηαη, έηνηκνο λα επηηεζεί ζηηο θαηάιιειεο ρεκηθέο νκάδεο ηεο επηθάλεηαο ηνπ παζνγφλνπ. (29) Αθφκα δείρλνληαη κε κνξθή «stick» θαηά PyMol θαη ζθαίξεο νη πιεπξηθέο αιπζίδεο ησλ πξνβιεπφκελεσλ πεξηνρψλ πξφζδεζεο ηνπ FB νη νπνίεο πεξηιακβάλνπλ ην ηειηθφ ηκήκα ηνπ MG6 θαη ην α Ν-ηειηθφ άθξν (α ΝΣ) (D 730 -L 768 ). Με ζθαίξεο δείρλεηαη ην πην κηθξφηεξν πεπηηδηθφ ηκήκα γηα ην νπνίν δείρηεθε φηη πξνζδέλεηαη ζην FB (D 730 -I 739 ). 28

29 Γηα ην ζρεκαηηζκφ ηεο πξνθνλβεξηάζεο, έρεη πξνηαζεί φηη ν FΒ πξνζδέλεηαη ζην C3 κέζσ ζεκείσλ πξφζδεζεο θαη ζην Ba θαη ζην VWA. ε κηα κειέηε ζηελ νπνία ρξεζηκνπνηήζεθαλ αληηζψκαηα εηδηθά γηα ην Ba θαη ην Bb, βξέζεθε φηη ην θαη ηα δχν πεξηέρνπλ ζεκεία πξνζδεζεο ζην C3b θαη κάιηζηα ην Ba πηζαλψο ζπλεηζθέξεη ζηελ αξρηθή πξφζδεζε ηνπ FB ζην C3b, αθνχ ην αληη-ba αληίζσκα εκπφδηδε ην ζρεκαηηζκφ ηεο θνλβεξηάζεο, ελψ ην αληη-bb επηηάρπλε ηε δηάζπαζή ηεο. (43) Απηφ επηβεβαηψζεθε απφ κειέηε θαηά ηελ νπνία βξέζεθε φηη ην Ba κπνξεί λα εκπνδίζεη ην ζρεκαηηζκφ ηεο θνλβεξηάζεο, αιιά δε κπνξεί λα επηηαρχλεη ηε δηάζπαζή ηεο. ηελ ίδηα κειέηε επηβεβαηψζεθε κε πείξακα δηαζηαπξνχκελεο ζχλδεζεο ε εηδηθή θαη αλεμάξηεηε απφ ηφληα Mg 2+ πξφζδεζε ηνπ Ba ζην C3b. (44) Έπεηηα αθνινχζεζε κηα κειέηε νκφινγεο αληηθαηάζηαζεο ζηελ νπνία πεξηνρέο ηνπ Ba αληηθαηαζηάζεθαλ κε αληίζηνηρεο ηνπ C2 θαη εμεηάζζεθε ε ιεηηνπξγία ησλ παξαγφκελσλ ρεηκεξηθψλ κνξίσλ FB. Σα απνηειέζκαηα έδεημαλ φηη θαη ηα ηξία SCRs έρνπλ ιεηηνπξγηθή ζεκαζία θαη φηη νη πεξηνρέο 127 SGQTAI 132 ηνπ SCR-2 θαη 146 PIGTRKV 152 ηνπ SCR-3 είλαη ζεκαληηθέο γηα ηελ πξφζδεζε ηνπ Ba ζην C3b. (45) Ωζηφζν, νη αιιεινπρίεο απηέο είλαη θαηά θχξην ιφγν θξπκκέλεο ζην εζσηεξηθφ ηνπ κνξίνπ (Δηθφλα 7) θαη πηζαλψο ζηελ πξαγκαηηθφηεηα λα κε ζπκκεηέρνπλ απεπζείαο ζηελ πξφζδεζε ηνπ C3b, παξά κπνξεί λα είλαη ζεκαληηθέο γηα ηε δηαηήξεζε ηεο δηακφξθσζεο ηνπ ηκήκαηνο Ba πνπ είλαη απαξαίηεηε γηα ηελ αλαγλψξηζε απφ ην C3b. ε φ,ηη αθνξά ηελ επηθξάηεηα VWA νη πεξηνρέο πξφζδεζεο κε ην C3b πξνβιεπφηαλ λα είλαη νη κε ζπληεξεκέλνη βξφγρνη ηεο πνιππεπηηδηθήο αιπζίδαο πνπ βξίζθνληαη γχξσ απφ ην πηζαλφ κνηίβν MIDAS, κε ηελ έλλνηα φηη σο κε ζπληεξεκέλνη, απνδίδνπλ εηδηθφηεηα ζηελ αιιειεπίδξαζε C3b-FB. Με παξφκνην ζθεπηηθφ φπσο γηα ην Ba ινηπφλ νη βξφγρνη απηνί αληηθαηαζηάζεθαλ κε ηνπο αληίζηνηρνπο ηνπ C2 θαη ηα ρεηκεξηθά κφξηα κειεηήζεθαλ. Απφ ηελ αλάιπζε απηή πξνέθπςε φηη νη βξφγρνη 251 DGSDSIGASNFT 262 θαη 364 DGLHNMGGDP 373 ηνπ VWA ζπκκεηέρνπλ ζηελ πξφζδεζε ηνπ C3b. (46) Αξγφηεξα κε ηελ ίδηα κέζνδν νκφινγεο αληηθαηάζηαζεο κε ακηλνμέα ηνπ CR3 βξέζεθαλ κεηαιιάγκαηα (D254G N260D) κε απμεκέλε ιεηηνπξγία πνπ ζρεκαηίδνπλ ζρεδφλ 300 θνξέο πην ζηαζεξή θνλβεξηάζε ζε ζρέζε ην κφξηνπ άγξηνπ ηχπνπ. (47) Σέινο, ηξπςηλνπνίεζε ηνπ VWA ελφζσ απηφ ήηαλ πξνζδεδεκέλν κε C3(NH 3 ) (παξάγσγν ηνπ C3 κε δηακφξθσζε παξφκνηα κε ην C3b) θαη αλάιπζε ησλ πεπηηδίσλ πνπ πξνέθπςαλ κε θαζκαηνζθνπία κάδαο αλέδεημε ηα πεπηίδηα G 229 -K 265 θαη T 355 -R 381 σο πεξηνρέο πξφζδεζεο κε ην C3(NH 3 ) (48) ην νπνίν βξίζθεηαη ζε γεληθή ζπκθσλία κε ηηο αιιεινπρίεο πνπ αλαθέξζεθαλ παξαπάλσ. Οη πξνβιέςεηο απηέο αθνχγνληαη πεηζηηθέο αθνχ νη αιιεινπρίεο απηέο θαηά θχξην ιφγν εθηίζεληαη ζην εμσηεξηθφ ηνπ κνξίνπ (Δηθφλα 7) θαη πεξηιακβάλνπλ ηέζζεξα απφ ηα πέληε ακηλνμέα ηνπ MIDAS. 29

30 Δηθφλεο ειεθηξνληθνχ κηθξνζθνπίνπ έδεημαλ φηη ελψ δχν απφ ηηο ηξεηο ζθαηξηθέο πεξηνρέο (Ba, VWA θαη SP) ηνπ FB έκνηαδαλ λα είλαη πξνζδεδεκέλεο ζην C3b, ε κία απφ απηέο ήηαλ απνκαθξπζκέλε απφ απηφ θαη ππνηέζεθε φηη απηή ήηαλ ε επηθξάηεηα πξσηεάζεο ζεξίλεο. (49) Αξγφηεξα φκσο ππήξμε έλδεημε φηη απηή πξνζδέλεηαη ζην C3b αθνχ έλα ηκήκα ηεο πνπ παξάρζεθε κε πέςε ηνπ FB κε ειαζηάζε θαη είρε κνξηαθφ βάξνο 33 kda πξνζδελφηαλ ζην C3b κε πςειή ζπγγέλεηα αιιά είρε ρακειή αηκνιπηηθή ελεξγφηεηα. (50) Η θπζηνινγηθή ζεκαζία ηνπ επξχκαηνο δελ είλαη γλσζηή. Πάλησο είλαη πηζαλφλ φηη ε ζπγγέλεηα ηνπ 33 kda ηκήκαηνο ηνπ Bb πξνο ην C3b λα νθείιεηαη ζην φηη πεξηιακβάλεη ηελ αιιεινπρία πνπ ζπλδέεη ην VWA θαη ην SP. Δλαιιαθηηθά, κπνξεί λα πξνβιέςεη θαλείο φηη ην SP έρεη πην πνιχ λφεκα λα πξνζδέλεηαη κε ην C3 σο ππφζηξσκα, παξά κε ην C3b σο ζπκπαξάγνληα. Νεφηεξε δεκνζίεπζε ηεο ηξηζδηάζηαζεο δνκήο ηεο πξν-θνλβεξηάζεο C3bB θαη θνλβεξηάζεο C3bBb ζε ρακειή αλάιπζε πνπ πξνζδηνξίζηεθε κε ειεθηξνληθή κηθξνζθνπία ζπκθψλεζε κε ηνλ C.A. Smith θαη ηνπο ζπλεξγάηεο ηνπ (49) φηη ην SP εθηείλεηαη καθξηά απφ ην C3b. Δπίζεο ππνζηήξημε φηη ην VWA πξνζδέλεηαη ζηελ επηθξάηεηα C345C θαη ην Ba αιιειεπηδξά κε ην ακηλνηειηθφ άθξν θαη ην CUB ηνπ C3b. (51) Σέινο, βξέζεθε φηη παξνπζίᾳ ηνπ θπζηνινγηθνχ ηφληνο Mg 2+ κφλν ηα δχν ηξίηα ησλ ζπκπιφθσλ ηεο πξν-θνλβεξηάζεο C3bB βξίζθνληαη ζηε ιεγφκελε «αλνηρηή» (ελεξγφ) δηακφξθσζε θαη ην έλα ηξίην ζηελ «θιεηζηή», ελψ παξνπζίᾳ Ni 2+ ζρεδφλ φια (98%) βξίζθνληαη ζηελ αλνηρηή δηακφξθσζε. (52) Δηθόλα 7: Αξηζηεξά: H δνκή ηνπ FB, ζηελ νπνία θαίλνληαη νη 5 επηθξάηεηεο θαη ηα ζεκαληηθά δνκηθά ραξαθηεξηζηηθά ζχκθσλα κε (34). Σα ηκήκα Ba απνηειείηαη απφ ηα SCRs1-3 θαη ηελ έιηθα αl, ελψ ην Bb απφ ην VWA, ζην νπνίν εληνπίδεηαη ε πεξηνρή MIDAS θαη ηελ θαηαιπηηθή επηθξάηεηα SP. Γείρλεηαη επίζεο ην ακηλνμχ R

31 κεηά απφ ην νπνίν γίλεηαη ε πέςε γηα ηελ απνκάθξπλζε ηνπ Ba. Σα ζάθραξα απεηθνλίδνληαη κε γθξη γξακκέο. Με κνξθή «stick» θαηά PyMol θαη ζθαίξεο δείρλνληαη νη πιεπξηθέο αιπζίδεο ησλ πξνβιεπφκελεσλ πεξηνρψλ πξφζδεζεο ζην C3b νη νπνίεο πεξηιακβάλνπλ ηκήκα ηνπ SCR2, SCR3, ην γξακκηθφ ηκήκα ηνπ ζπλδέηε αλάκεζα ζην Ba θαη ην VWA θαζψο θαη ηκήκα ηνπ VWA. ηελ πεξίπησζε ηνπ VWA, κε ζθαίξεο απεηθνλίδνληαη νη πεξηνρέο πξφζδεζεο ηνπ C3b πνπ πξνέθπςαλ απφ πεηξάκαηα κεηαιιαμηγέλεζεο (D 251 -T 262 θαη D 364 -P 373 ), ελψ νη πεξηνρέο απηέο καδί κε ηηο αιιεινπρίεο πνπ δείρλνληαη κε sticks βξέζεθαλ κε ηελ αλάιπζε ηξπςηλνπνίεζεο (G 229 -K 265 θαη T 355 -R 381, πεξηιακβάλνπλ θαη ην γξακκηθφ ηκήκα ηνπ ζπλδέηε). Γεμηά: απεηθνλίζεηο επηθαλείαο ηνπ FB. Γεμηά-πάλσ: ηελ πεξίπησζε ησλ SCRs, ην κεγαιχηεξν κέξνο ησλ αιιεινπρηψλ πνπ πξνβιέπεηαη λα ζπκκεηέρνπλ ζηελ πξφζδεζε ηνπ C3b βξίζθεηαη θξπκκέλν ζην εζσηεξηθφ ηνπ κνξίνπ: κέζα απφ ηελ ηνκή ηνπ κνξίνπ θαίλνληαη ζε ζθαίξεο νη ίδηεο αιιεινπρίεο φπσο θαη ζην αξηζηεξφ ηκήκα ηεο θσηνγξαθίαο, κε ηε δηαθνξά φηη γηα δηεπθφιπλζε ηα ρξψκαηα έρνπλ αιιάμεη απφ πνξηνθαιί ζε ζαιαζζί γηα ηελ αιιεινπρία πάλσ ζην SCR2 (S 127 -I 132 ) θαη απφ θφθθηλν ζε βηνιεηί γηα ην SCR3 (P 146 -V 152 ). Γεμηά-θάησ: ηελ απεηθφληζε επηθαλείαο γηα ην VWA ηα ακηλνμέα ζε ζθαίξεο ρξσκαηίζηεθαλ κε ραθί θαη ηα ακηλνμέα ζε sticks κε θαθέ αληηζηνίρσο (δεμηά θαη θάησ) θαη είλαη θαηά θχξην θφγν εθηεζηκέλα ζηελ επηθάλεηα ηνπ κνξίνπ. Με θπαλφ δείρλνληαη ηα ακηλνμέα D 254 θαη N 260, ε κεηάιιαμε ησλ νπνίσλ ζε G θαη D αληίζηνηρα νδεγεί ζε θέξδνο ιεηηνπξγίαο, δει. ζρεκαηηζκφ πνιχ ζηαζεξφηεξεο θνλβεξηάζεο. Σα ηέζζεξα απφ ηα πέληε ακηλνμέα ηνπ MIDAS πεξηιακβάλνληαη ζηελ ραθί επηθάλεηα. Η πεξηνρή πξφζδεζεο ηνπ FB πάλσ ζην FD δελ έρεη βξεζεί θαη ιίγα πξάγκαηα είλαη γλσζηά γηα ηηο πεξηνρέο ηνπ FD πνπ είλαη ζεκαληηθέο γηα ηελ θαηαιπηηθή ηνπ ελεξγφηεηα. Έρεη βξεζεί φηη είλαη πνιχ εηδηθφ έλδπκν θαη δελ θφβεη κηθξά πεπηηδηθά ππνζηξψκαηα (ή θφβεη κε πνιχ κηθξή ελεξγφηεηα), νχηε θαλ φηαλ απηά αληηζηνηρνχλ ζηελ αιιεινπρία πέςεο ηνπ FB. (53, 54) Γηα απηφ ην ιφγν θαη επεηδή, φπσο πξναλαθέξζεθε, ηα δνκηθά ραξαθηεξηζηηθά ηνπ θαηαιπηηθνχ θέληξνπ ηνπ ελδχκνπ θαη ηεο πξνβιεπφκελεο αχιαθαο πξφζδεζεο ηνπ ππνζηξψκαηνο αληηζηνηρνχλ ζε αλελεξγφ κνξθή, έρεη ππνηεζεί φηη ν FD αιιάδεη δηακφξθσζε θαη απνθηά ηελ ελεξγφ ηνπ κνξθή κφλν κεηά ηελ πξφζδεζε ζην ππφζηξσκά ηνπ: FB πνπ είλαη πξνζδεδεκέλν ζε C3b (φρη ειεχζεξν FB). Μειέηεο κεηαιιαμηγέλεζεο ζηελ πξνβιεπφκελε αχιαθα πξφζδεζεο ηνπ ππνζηξψκαηνο έδεημαλ φηη πξέπεη λα ππάξρνπλ δνκηθά ζηνηρεία έμσ απφ απηήλ πνπ λα επζχλνληαη γηα ηε δηακφξθσζή ηεο θαη γηα ηελ εηδηθφηεηα ηνπ ελδχκνπ. εκαληηθά ζηνηρεία γηα ηε κεηάβαζε απφ ηελ αλελεξγφ ζε ελεξγφ κνξθή είλαη ην ακηλνμχ R 202 θαη ν βξφγρνο (Δηθφλα 8). (55) 31

32 Δηθόλα 8: H δνκή ηνπ FD ζηελ νπνία δείρλνληαη ηα ζεκαληηθά δνκηθά ραξαθηεξηζηηθά ζχκθσλα κε (35). Tα ζεκεία πξφζδεζεο ζην FB δελ είλαη γλσζηά. Ο βξφγρνο Δ 172 -R 176 θαη ην ακηλνμχ R 202 είλαη ζεκαληηθνί γηα ηελ κεηαηξνπή απφ ηελ αλελεξγφ ζε ελεξγφ κνξθή ηνπ ελδχκνπ. Ο βξφγρνο Σ 198 -R 202 αλαζηέιιεη ηελ ελδπκαηηθή δξάζε ηνπ κνξίνπ φηαλ απηφ είλαη ειεχζεξν (κε πξνζδεδεκέλν ζην FB). Παξφιεο ηηο παξαπάλσ ελδείμεηο γηα ηα ζεκεία αιιειεπίδξαζεο θαη ηνπο κεραληζκνχο ελεξγνπνίεζεο ησλ ζπζηαηηθψλ ηεο θνλβεξηάζεο ηεο ελαιιαθηηθήο νδνχ, δελ ππάξρεη άκεζε απφδεημε θαη αλαιπηηθή πεξηγξαθή ηνπο. Δπίζεο δελ έρεη γίλεη ζπζηεκαηηθφο θηλεηηθφο ραξαθηεξηζκφο ησλ αιιειεπηδξάζεσλ απηψλ γηα ηελ εμαγσγή θηλεηηθψλ παξακέηξσλ. ηαλ φκσο ν ζηφρνο είλαη ε αλάπηπμε θαη βειηίσζε αλαζηνιέσλ ηεο ελεξγνπνίεζεο ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο, ηφηε είλαη απαξαίηεηε ηέηνηνπ είδνπο γλψζε, ε νπνία λα επηηξέπεη ηε ζηφρεπζε ζπγθεθξηκέλεο αιιειεπίδξαζεο ή ζπγθεθξηκέλεο επηθάλεηαο επαθήο κεηαμχ ησλ πξσηετλψλ πνπ αιιειεπηδξνχλ. Η ηδαληθή πεξίπησζε ήηαλ ε εχξεζε ηεο δνκήο ηνπ ζπκπιφθνπ C3bBb. Ωζηφζν, ε θνλβεξηάζε απηή έρεη κηθξφ ρξφλν εκηδσήο κεηά ηε δεκηνπξγία ηεο θαη δηίζηαηαη ζχληνκα ζε C3b θαη Bb. Οπφηε είλαη δχζθνιν λα δεκηνπξγήζεη θαλείο θξχζηαιιν ηνπ ζπκπιφθνπ απηνχ θαη λα δεη ηε δνκή ηνπ κε θξπζηαιινγξαθία. Απηφ ην εκπφδην μεπεξάζηεθε φκσο, ρξεζηκνπνηψληαο ζπγθεθξηκέλα εξγαιεία φπσο ζα αλαιπζεί ζε απηή ηελ εξγαζία θαη ε εχξεζε ηεο δνκήο ηνπ ζπκπιφθνπ έγηλε δπλαηή. Παξάιιεια, πξαγκαηνπνηήζεθαλ θηλεηηθέο θαη βηνρεκηθέο αλαιχζεηο πνπ ζπκπιήξσζαλ θαη επέθηεηλαλ ηηο πιεξνθνξίεο πνπ έδσζε ε αλάιπζε ηεο δνκήο. Σα απνηειέζκαηα πνπ πξνέθπςαλ είλαη κέγηζηεο ζεκαζίαο γηα ηνλ ηνκέα ηνπ ζπκπιεξψκαηνο θαη ηεο αλνζνινγίαο γεληθφηεξα. 32

33 Παίξλνληαο καζήκαηα από έλαλ κηθξννξγαληζκό Αλαζηνιέαο ηνπ ζπκπιεξώκαηνο ηνπ ηαθπιόθνθθνπ (Staphylococcal Complement INhibitor (SCIN)) Ο ρξπζίδσλ ζηαθπιφθνθθνο είλαη έλα ζεηηθφ θαηά Γθξακ βαθηήξην ην νπνίν, ελψ απνηειεί κέξνο ηεο θπζηθήο ρισξίδαο ηνπ δέξκαηφο καο θαη ηεο ξηληθήο θνηιφηεηαο, ζε νξηζκέλεο πεξηπηψζεηο πξνθαιεί κνιχλζεηο πνπ κπνξεί λα είλαη είλαη απφ αθίλδπλεο κερξη πνιχ επηθίλδπλεο θαη λα πξνθαιέζνπλ αθφκα θαη ην ζάλαην. Λφγσ ηεο εκθάληζεο αλζεθηηθψλ ζε αληηβηνηηθά ζηειερψλ, ηα νπνία είλαη επηθίλδπλα γηα ηε δεκφζηα πγεία, έξεπλεο έρνπλ επηθεληξσζεί ζηε κειέηε ησλ κεραληζκψλ παζνγέλεζεο απηνχ ηνπ βαθηεξίνπ. Οη έξεπλεο απηέο έρνπλ επηδείμεη φηη ν ρξπζίδσλ ζηαθπιφθνθθνο δηαζέηεη κηα πιεζψξα κεραληζκψλ γηα λα δηαθεχγεη ηηο άκπλεο ηνπ νξγαληζκνχ, ζπκπεξηιακβαλνκέλνπ ηνπ ζπζηήκαηνο ηνπ ζπκπιεξψκαηνο. Έλα απφ ηα κφξηα πνπ έρεη βξεζεί φηη αλαζηέιιεη ηε δξάζε ηνπ ζπκπιεξψκαηνο είλαη ν «αλαζηνιέαο ηνπ ζπκπιεξψκαηνο ηνπ ηαθπιφθνθθνπ» (Staphylococcal Complement INhibitor (SCIN)). Παξαθάησ, αθνχ γίλεη ζχληνκε αλαθνξά ζηελ βηνινγία θαη παζνγέλεζε ηνπ ρξπζίδνληα ζηαθπιφθνθθνπ, ζα εζηηάζνπκε ηελ πξνζνρή καο ζην SCIN θαη ηηο ηδηφηεηέο ηνπ πνπ ηνλ θαηέζηεζαλ αληηθείκελν αιιά θαη εξγαιείν κειέηεο γηα ηελ παξνχζα δηαηξηβή. Υξπζίδσλ ζηαθπιόθνθθνο γεληθά ζηνηρεία Ο ρξπζίδσλ ζηαθπιφθνθθνο είλαη πξναηξεηηθά αλαεξφβην, ζθαηξηθφ βαθηήξην κε δηάκεηξν 1κm, ην νπνίν παίξλεη ην φλνκα ηνπ απφ ηελ εκθάληζε ηνπ θαηά ηελ παξαηήξεζε κε κηθξνζθφπην, ε νπνία πξνζνκνηάδεη ηζακπί ζηαθπιηνχ θαη ην θηηξηλσπφ-ρξπζίδνλ ρξψκα ησλ απνηθηψλ ηνπ ζε θαιιηέξγεηα (Δηθφλα 9). Πεξίπνπ ην έλα ηξίην ησλ αλζξψπσλ θέξεη ην βαθηήξην ζηε ξηληθή θνηιφηεηα ή θαη ην δέξκα σο κέξνο ηεο βαθηεξηαθήο ρισξίδαο, ρσξίο απηφ λα πξνθαιεί αζζέλεηα. Παξφια απηά είζνδνο ηνπ επθαηξηαθνχ απηνχ παζνγφλνπ ζηνλ ηζηφ κέζσ ζπιάθσλ ηξηρψλ, ακηρήο ή ηξαπκαηηζκνχ ηνπ δέξκαηνο κπνξεί λα πξνθαιέζεη κφιπλζε. Η κφιπλζε κπνξεί λα είλαη ήπηαο ή κέηξηαο κνξθήο, φπσο νη πεξηζζφηεξεο απφ ηηο παξαθάησ δεξκαηηθέο παζήζεηο: θξηζή ζην κάηη, ζπιαθίηηδα, κνιπζκαηηθφ θεξίν, δνζηήλαο, ςεπδάλζξαθαο, ζχλδξνκν ηρζχσζεο, θπηηαξίηηδα θαη απφζηεκα. Μνιχλζεηο ελ ησ βάζεη πξνθαινχλ ζνβαξφηεξεο αζζέλεηεο φπσο ε λεθξσηηθή πεξηηνλίηηδα, ε νζηενκπειίηηδα, ε ελδνθαξδίηηδα, ε πλεπκνλία θαη κεληγγίηηδα. Η απειεπζέξσζε ππεξαληηγφλσλ ζηελ θπθινθνξία πξνθαιεί ζχλδξνκν ηνμηθνχ ζνθ, ελψ ε θαηαλάισζε ηξνθίκσλ κνιπζκέλσλ κε ρξπζίδνληα ζηαθπιφθνθθν πξνθαιεί ζπκπηψκαηα ηξνθηθήο δειεηεξίαζεο, ιφγσ εληεξνηνμηλψλ πνπ έρεη 33

34 εθθξίλεη ζε απηά. Σέινο, ν ρξπζίδσλ ζηαθπιφθνθθνο απνηειεί κείδνπζα αηηία λνζνθνκεηαθψλ ινηκψμεσλ, αθνχ ζπρλά κνιχλεη κεηεγρεηξεηηθέο πιεγέο θαη ηερλεηέο ελδνπξνζζεηηθέο ζπζθεπέο (φπσο θαζεηήξεο). ε αθξαίεο πεξηπηψζεηο θαη εηδηθά φηαλ ζπλαληά εμαζζελεκέλν αλνζνπνηεηηθφ ζχζηεκα, ε κφιπλζε κε ρξπζίδνληα ζηαθπιφθνθθν κπνξεί λα πξνθαιέζεη βαθηεξηαηκία, ζήςε θαη αθφκα θαη ζάλαην. Δηθόλα 9: α. Απνηθίεο ρξπζίδνληα ζηαθπιφθνθθνπ ζε ζηεξεφ ζξεπηηθφ πνπ πεξηέρεη αίκα (http://www.healthhype.comlab-tests-for-staph.html). β. Ηιεθηξνληθή κηθξνγξαθία βαθηεξίσλ ρξπζίδνληα ζηαθπιφθνθθνπ (http://www.textbookofbacteriology.net/staph.html). Γίλεηαη επνκέλσο θαηαλνεηφ φηη ην κηθξφβην απηφ δηαζέηεη κεραληζκνχο πνπ ην βνεζνχλ λα πξνζαξκφδεηαη θαη λα αλαπηχζζεηαη ζε πνιιά δηαθνξεηηθά πεξηβάιινληα: δέξκα, ηξαχκαηα, καιαθά κφξηα, αξζξψζεηο, νζηά, αλαπλεπζηηθφ ζχζηεκα θαη θαξδηαγγεηαθφ ζχζηεκα. Γηα λα ην πεηχρεη απηφ ρξεζηκνπνηεί δηαθνξεηηθέο νκάδεο κνξίσλ πνπ παξάγεη ζηελ θαηάιιειε ζηηγκή θαη ζηνλ θαηάιιειν ηφπν. Γηα παξάδεηγκα, ηα ιεγφκελα «κηθξνβηαθά επηθαλεηαθά ζπζηαηηθά ηνπ (πξσηεΐλεο) ηα νπνία αλαγλσξίδνπλ κφξηα πξνζθφιιεζεο ζηε ζεκέιηα νπζία» (microbial surface components recognizing adhesive matrix molecules - MSCRAMMs), ην βνεζνχλ λα πξνζθνιεζεί ζηνπο ηζηνχο ή ζηελ επηθάλεηα ησλ ελδνπξνζζεηηθψλ ζπζθεπψλ. Μεηά ηελ πξνζθφιιεζε ζε κηα επηθάλεηα, ην βαθηήξην δεκηνπξγεί έλα βηνινγηθφ πκέλην πνπ θηηάρλεηαη απφ πνιπκεξή ζπζηαηηθά θαη ην πξνζηαηεχεη απφ ηελ άκπλα ηνπ νξγαληζκνχ θαη απφ ηα αληηβηνηηθά. Άιινη ινηκνγφλνη παξάγνληεο ηεο βαθηεξηαθήο επηθάλεηαο πνπ πξνζηαηεχνπλ ην βαθηήξην απφ ηε θαγνθπηηάξσζε είλαη νη εμήο: ε θάςνπια, θάπνηεο πξσηεΐλεο πνπ πξνζδέλνπλ ηλσδνλεθηίλε, θαζψο θαη ε πξσηεΐλε Α (S. aureus protein A SpA). Μία απφ ηηο ιεηηνπξγίεο ηεο ηειεπηαίαο είλαη φηη πξνζδέλεηαη κε ην Fc ηκήκα ησλ αληηζσκάησλ, παγηδεχνληάο ηα ζε αλάζηξνθε θαηεχζπλζε, εκπνδίδνληαο έηζη ηελ ηε θπζηνινγηθή νςσλνπνίεζε θαη αλαγλψξηζε απφ θαγνθχηηαξα. Δθθξηλφκελεο πξσηεΐλεο κε παξφκνην πξνζηαηεπηηθφ ξφιν είλαη ε πξσηεΐλε πνπ αλαζηέιιεη ηε ρεκεηνηαμία (chemotaxis inhibitory protein of S. aureus CHIPS) ησλ νπδεηεξνθίισλ ιεπθνθπηηάξσλ θαη νη ιεπθνθηφλεο πξσηεΐλεο (leukocidins) νη νπνίεο 34

35 δεκηνπξγνχλ πφξνπο ζηε κεκβξάλε ιεπθνθπηηάξσλ νδεγψληαο ζην ζάλαηφ ηνπο. Πνιιά εθθξηλφκελα έλδπκα ζπλεηζθέξνπλ ζηελ θαηαζηξνθή ηνπ ηζηνχ θαη ηελ επέθηαζε ηεο κφιπλζεο. Ο ρξπζίδσλ ζηαθπιφθνθθνο εθθξίλεη επίζεο ηνμίλεο νη νπνίεο είλαη ππεχζπλεο γηα ιχζε θπηηάξσλ ηνπ μεληζηή (ηνμίλεο α-δ) θαη γεληθά γηα ηα ζπκπηψκαηα ηεο κφιπλζεο, φπσο επηδεξκνιπηηθέο ηνμίλεο (ζχλδξνκν ηρζχσζεο), εληεξνηνμίλεο (δειεηεξίαζε) θαη ε ηνμίλε ηνπ ζπλδξφκνπ ηνμηθνχ ζνθ. Οη δχν ηειεπηαίεο θαηεγνξίεο ζεσξνχληαη ππεξαληηγφλα, δηφηη κπνξνχλ κε κε εηδηθφ ηξφπν λα ελεξγνπνηήζνπλ κέρξη θαη ην 1/5 ησλ Σ-θπηηάξσλ ηνπ νξγαληζκνχ θαη λα πξνθαιέζνπλ ηελ παξαγσγή κεγάισλ πνζνηήησλ θπηηαξνθηλψλ απφ απηά. (56-58) Παξαδνζηαθά ε αληηκεηψπηζε ηνπ ρξπζίδνληα ζηαθπιφθνθθνπ έρεη γίλεη κε ηε ρξήζε αληηβηνηηθψλ. Η πεληθηιιίλε ρξεζηκνπνηήζεθε επξέσο γηα ηε ζεξαπεία κνιχλζεσλ γηα 10 ρξφληα πξηλ ηελ αλάπηπμε αλζεθηηθψλ ζε απηή ζηειερψλ. Η αλζεθηηθφηεηα ζην επφκελν αληηβηνηηθφ, ηε κεζηθηιιίλε, αλαπηχρζεθε κφιηο έλα ρξφλν κεηά ηε ρξήζε ηνπ. Ο αλζεθηηθφο ζε κεζηθηιιίλε ρξπζίδσλ ζηαθπιφθνθθνο (methicillin-resistant S. aureus MRSA) είλαη ζπλήζσο αλζεθηηθφο ζε πνιιαπιά αληηβηνηηθά. Παξφιν πνπ ηα θξνχζκαηα ηα κφιπλζεο κε ην βαθηήξην ζρεηίδνληαλ παιηφηεξα κε ρψξνπο ηαηξηθήο πεξίζαιςεο, παλδεκίεο ηνπ MRSA έρνπλ ζπκβεί θαη εθηφο ησλ ρψξσλ απηψλ. ήκεξα έλα αληηβηνηηθφ πνπ ρξεζηκνπνηείηαη ζε θξίζηκεο πεξηπηψζεηο είλαη ε βαλθνκπθίλε, αιιά ιφγσ ησλ ελδείμεσλ αλάπηπμεο αλζεθηηθφηεηαο ζε απηή, ελαιιαθηηθέο κέζνδνη ζεξαπείαο αλαδεηψληαη πνπ λα κελ πξνθαινχλ ηελ επηινγή θαη εμάπισζε αλζεθηηθψλ ζηειερψλ. (59, 60) Μεραληζκνί δηαθπγήο ηνπ ρξπζίδνληα ζηαθπιόθνθθνπ από ην ζπκπιήξσκα Ο ρξπζίδσλ ζηαθπιφθνθθνο δηαζέηεη κηα πιεζψξα κνξίσλ πνπ ην βνεζνχλ λα απνθεχγεη ηελ ελεξγνπνίεζε, ηνλ πνιιαπιαζηαζκφ ηεο απφθξηζεο θαη ηηο θιεγκνλψδεηο δξάζεηο ηνπ ζπκπιεξψκαηνο. Ήδε έγηλε αλαθνξά ζε ινηκνγφλνπο παξάγνληεο νη νπνίνη εκπνδίδνπλ ηελ νςσλνπνίεζε κε αληηζψκαηα θαη επνκέλσο ηελ ελεξγνπνίεζε ηεο θιαζζηθήο νδνχ, ελψ επίζεο ην θαηά Gram ζεηηθφ πεξίβιεκα ηνπ βαθηεξίνπ ην θαζηζηά αλζεθηηθφ ζηε ιχζε απφ ην MAC. Γχν αθφκε πξσηεΐλεο πνπ επίζεο πξνζδέλνληαη ζε IgG θαη παξεκβαίλνπλ ζηελ ελεξγνπνίεζε ηεο θιαζζηθήο νδνχ είλαη νη εμήο: staphylococcal superantigen-like protein 10 SSL10 θαη Staphylococcal binder of immunoglobulins Sbi. Σν Sbi βξέζεθε αξγφηεξα φηη πξνζδέλεη επίζεο θαη FH θαη C3b θαη ε ιεηηνπξγία ηνπ πξνηάζεθε φηη είλαη ε ελεξγνπνίεζε ηεο ελαιιαθηηθήο νδνχ ζηελ πγξή θάζε (ην νπνίν πηζαλψο ζεκαίλεη θαηαλάισζε ηνπ C3 ζε ζεκείν άιιν απφ ηελ επηθάλεηα ηνπ βαθηεξίνπ) θαη πηζαλψο ε ξχζκηζε ηεο ελεξγνπνίεζεο κέζσ ηνπ FH. Η ζηαθπινθηλάζε (SAK) επηζηξαηεχεη θαη ελεξγνπνηεί ην πιαζκηλνγφλν ζηελ επηθάλεηα ηνπ 35

36 βαθηεξίνπ, ην νπνίν έπεηηα απνηθνδνκεί ην IgG θαη C3b, αλαζηξέθνληαο ηελ νςσλνπνίεζε. Ο παξάγνληαο ζπζζσκάησζεο Α (Clumping factor A ClfA) ελεξγνπνηεί ην FI γηα λα απνηθνδνκήζεη ην C3b. Σέινο, ν επηθαλεηαθφο παξάγνληαο Η πνπ ξπζκίδεηαη απφ ζίδεξν (Ironregulated surface determinant protein H IsdH) θαίλεηαη λα ζπλεηζθέξεη επίζεο ζηελ απνηθνδφκεζε ηνπ C3b. Δπηπιένλ ν ρξπζίδσλ ζηαθπιφθνθθνο παξάγεη άιιεο πξσηεΐλεο νη νπνίεο παξεκπνδίδνπλ ηνλ πνιιαπιαζηαζκφ ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο. Απφ απηέο ν αλαζηνιέαο ηνπ ζπκπιεξψκαηνο ηνπ ζηαθπιφθνθθνπ (Staphylococcal Complement INhibitor (SCIN)) ζα ζπδεηεζεί πην εθηεηακέλα παξαθάησ. Η εμσθπηηάξηα πξσηεΐλε πνπ πξνζδέλεη ηλσδνγφλν (Extracellular fibrinogen binding protein Efb) πξνζδέλεη κε ηελ θαξβνμπηειηθή ηεο επηθξάηεηα ηελ επηθξάηεηα TED (ή C3d) ηνπ C3b θαη αλαζηέιιεη ηε ιεηηνπξγία ησλ θνλβεξηαζψλ πνπ ην πεξηέρνπλ (C3 θνλβεξηάζε ηεο ελαιιαθηηθήο νδνχ θαη C5 θνλβεξηάζεο φισλ ησλ νδψλ. Παξφκνηα είλαη ε ιεηηνπξγία ηεο νκφινγεο ζην Efb πξσηεΐλεο (Efb homologous protein Ehp). ζνλ αθνξά ηα κεηέπεηηα ζηάδηα ηεο ελεξγνπνίεζεο, ν ρξπζίδσλ ζηαθπιφθνθθνο δηαζέηεη επίζεο πξσηεΐλεο πνπ παξεκβαίλνπλ θαη ζε απηά. Γηα παξάδεηγκα ην SSL7 εκπνδίδεη ηε δηάζπαζε ηνπ C5 ζε C5a θαη C5b. Σν SSL5 εκπνδίδεη ηελ ελεξγνπνίεζε ησλ ππνδνρέσλ πνπ ζπλδένληαη κε πξσηεΐλε G (GPCRs) απφ ρεκεηνθίλεο, ζπκπεξηιακβαλνκέλνπ ηνπ C5aR. Οκνίσο ην CHIPS πνπ αλαθέξζεθε παξαπάλσ αλαζηέιιεη ηελ ελεξγνπνίεζε ηνπ C5aR. (61-64) Ο παξαθάησ πίλαθαο ζπλνςίδεη ηα πξναλαθεξζέληα. 36

37 Πίλαθαο 1: Πξσηεΐλεο ηνπ ρξπζίδνληα ζηαθπιφθνθθνπ πνπ παξεκβαίλνπλ ζηηο θπζηνινγηθέο δξάζεηο ηνπ ζπκπιεξψκαηνο. Πξσηεΐλε ηνπ ρξπζίδνληα ζηαθπιφθνθθνπ Πξνζδέηεο Λεηηνπξγίεο πνπ ζρεηίδνληαη κε ηε δξάζε ηνπ ζπκπιεξψκαηνο SpA IgG Αλαζηνιή ελεξγνπνίεζεο θιαζζηθήο νδνχ θαη νςσλνπνίεζεο-θαγνθπηηάξσζεο Sbi IgG, ζχκπινθν C3-FH Αλαζηνιή ελεξγνπνίεζεο θιαζζηθήο νδνχ θαη νςσλνπνίεζεο-θαγνθπηηάξσζεο, θαηαλάισζε ηνπ C3 SSL10 IgG, ππνδνρέαο 4 ηεο ρεκεηνθίλεο CXC (CXCR4) ζην κεζνθπηηάξην ρψξν Αλαζηνιή ελεξγνπνίεζεο θιαζζηθήο νδνχ θαη νςσλνπνίεζεο-θαγνθπηηάξσζεο SAK πιαζκηλνγφλν Δλεξγνπνηεί ην πιαζκηλνγφλν, ην νπνίν πέπηεη C3b θαη IgG θαη αλαζηξέθεη ηελ νςσλνπνίεζε Efb Ιλσδνγφλν, C3, θνλβεξηάζεο πνπ πεξηέρνπλ C3b Αιιαγή δηακφξθσζεο ηνπ C3 πνπ δελ επηηξέπεη θπζηνινγηθή ελεξγνπνίεζε, αλαζηνιή ελεξγνπνίεζεο ηνπ C3 θαη C5 Ehp C3, θνλβεξηάζεο πνπ πεξηέρνπλ C3b Αιιαγή δηακφξθσζεο ηνπ C3 πνπ δελ επηηξέπεη θπζηνινγηθή ελεξγνπνίεζε, αλαζηνιή ελεξγνπνίεζεο C3 θαη C5 SCINs C3b, θνλβεξηάζεο ηνπ C3 ηαζεξνπνίεζε ηεο θνλβεξηάζεο ζε κε ελεξγφ δηακφξθσζε, αλαζηνιή ελεξγνπνίεζεο ηνπ C3 θαη C5 ClfA FI, ηλσδνγφλν Απνηθνδφκεζε ηνπ C3b, αλαζηνιή νςσλνπνίεζεοθαγνθπηηάξσζεο IsdH Γελ είλαη γλσζηφ Απνηθνδφκεζε ηνπ C3b, αλαζηνιή νςσλνπνίεζεοθαγνθπηηάξσζεο SSL7 IgA, C5 Αλαζηνιή ηεο ελεξγνπνίεζεο ηνπ C5 SSL5 CHIPS C5aR, πξνζδέηεο 1 ηεο P-ζειεθηίλεο (PSGL-1) C5aR, ππνδνρέαο θνξκπι-πεπηηδίσλ (FPR1) Δκπνδίδεη ηελ ζεκαηνδφηεζε ηνπ C5aR Δκπνδίδεη ηελ ζεκαηνδφηεζε ηνπ C5aR Γίλεηαη θαηαλνεηφ φηη ν ρξπζίδσλ ζηαθπιφθνθθνο παξάγεη έλα πινχζην ξεπεξηφξην πξσηετλψλ, νη πεξηζζφηεξεο απφ ηηο νπνίεο έρνπλ πνιιαπινχο πξνζδέηεο θαη πεξίπινθε ιεηηνπξγία. Σν ξεπεξηφξην είλαη πιενλάδνλ, εθφζνλ νη ιεηηνπξγίεο είλαη αιιειεπηθαιππηφκελεο. Δδψ αλαθέξζεθαλ κφλν πξσηεΐλεο νη νπνίεο παξεκβαίλνπλ ζηε δξάζε ηνπ ζπκπιεξψκαηνο άκεζα, αιιά ην βαθηήξην απηφ παξάγεη πξσηεΐλεο πνπ αλαζηέιινπλ άιιεο δξάζεηο ηνπ αλνζνπνηεηηθνχ ζπζηήκαηνο πνπ επεξεάδνπλ ην ζπκπιήξσκα έκκεζα (φπσο γηα παξάδεηγκα ηελ ζπγθέληξσζε ησλ νπδεηεξνθίισλ ζην ζεκείν ηεο κφιπλζεο). Σν ηειηθφ απνηέιεζκα είλαη φηη 37

38 έρεη ηελ ηθαλφηεηα λα αλαζηέιιεη ηηο πνιιαπιέο ιεηηνπξγίεο ηνπ ζπκπιεξψκαηνο: ηελ ελεξγνπνίεζε, ηνλ πνιιαζηαζκφ, ηελ νςσλνπνίεζε κέζσ C3b θαη IgG, ηε ιχζε κέζσ MAC, ηε θιεγκνλψδε απφθξηζε πνπ κεζνιαβνχλ νη αλαθπιαηνμίλεο C3a θαη C5a θαη ηελ θαγνθπηηάξσζε. SCIN Σν SCIN πεξηγξάθεθε γηα πξψηε θνξά ην 2005 σο κηα εθθξηλφκελε πξσηεΐλε κεγέζνπο 9.8 kda ε νπνία αλαζηέιιεη ην ζπκπιήξσκα κε κνλαδηθφ ηξφπν: ζηαζεξνπνηεί ηηο θνλβεξηάζεο ζε κηα αλελεξγφ δηακφξθσζε πνπ δελ επηηξέπεη ηελ θαηάιπζε ηεο δηάζπαζεο ηνπ C3. Σν γεγνλφο απηφ ζπλεπάγεηαη πεξηνξηζκφ ηεο νςσλνπνίεζεο κε C3b θαη επνκέλσο θαγνθπηηάξσζεο θαη ζαλάησζεο ηνπ βαθηεξίνπ απφ ηα νπδεηεξφθηια. Έλα ηδηαίηεξν ραξαθηεξηζηηθφ ηνπ SCIN είλαη φηη είλαη εηδηθφ γηα ηνλ άλζξσπν: δελ αλαζηέιιεη ην ζπκπιήξσκα ηνπ πνληηθνχ, νχηε αξθεηψλ νηθφζηησλ νξγαληζκψλ θαη ην γνλίδην πνπ ην θσδηθνπνηεί έρεη βξεζεί κφλν ζε ζηειέρε πνπ έρνπλ απνκνλσζεί απφ αλζξψπνπο. Δίλαη ζεκαληηθφ λα αλαθεξζεί φηη πγηή άηνκα θαη άηνκα πνπ αληηκεησπίδνπλ επαλαιακβαλφκελεο κνιχλζεηο απφ ρξπζίδνληα ζηαθπιφθνθθν έρνπλ παξφκνηα επίπεδα αληηζσκάησλ έλαληη ηνπ SCIN ζηνλ νξφ ηνπο. Σν SCIN φκσο θαηαθέξλεη λα αλαζηείιεη ην ζπκπιήξσκα ζε δνθηκαζίεο in vitro, ην νπνίν ζεκαίλεη φηη ηα αληηζψκαηα κάιινλ δελ εμνπδεηεξψλνπλ ηε δξάζε ηνπ. Σέινο, πξνηάζεθε φηη ιεηηνπξγεί απνθιεηζηηθά ζηελ επηθάλεηα θαη φηη πξνζδέλεηαη ζηηο ζπλαξκνινγεκέλεο θνλβεξηάζεο θαη ησλ ηξηψλ νδψλ ηνπ ζπκπιεξψκαηνο (θαη ηηο αλαζηέιιεη) θαη φρη ζηα επηκέξνπο ζπζηαηηθά ηνπο. (65) Αξγφηεξα βξέζεθε φηη ην γνλίδην πνπ θσδηθνπνηεί ην SCIN αλήθεη ζε κηα νκάδα γνληδίσλ πνπ παξεκβαίλνπλ ζηελ αλνζηαθή απφθξηζε θαηά ηνπ κηθξνβίνπ. Η νκάδα απηή πεξηιακβάλεη ηξεηο άιιεο πξσηεΐλεο, ηηο CHIPS, SAK θαη εληεξνηνμίλε Α (SEA) θαη βξίζθεηαη ζην ζπληεξεκέλν 3 άθξν κηαο θαηεγνξίαο βαθηεξηνθάγσλ, γεγνλφο ην νπνίν δίλεη ηε δπλαηφηεηα γηα κεηαθνξά ηνπο απφ ην έλα ζηέιερνο ζην άιιν. (66) Δπηπιένλ, ην SCIN (θαη ην CHIPS) εθθξάδεηαη ζηελ αξρηθή (εθζεηηθή) θάζε ηνπ πνιιαπιαζηαζκνχ ηνπ βαθηεξίνπ θαη ππνηέζεθε φηη απηφ ζπκβαίλεη επεηδή ην βνεζά λα θαηαπνιεκήζεη ηελ αξρηθή αλνζηαθή απφθξηζε. (67) Σν 2007 ιχζεθε ε δνκή ηνπ SCIN κε θξπζηαιινγξαθία θαη βξέζεθε φηη πεξηιακβάλεη ηξεηο α- έιηθεο πνπ είλαη πεξηειηγκέλεο ζε κνξθή ζρνηληνχ. (68) Σν κνηίβν απηφ είλαη φκνην κε ηηο δνκέο αξθεηψλ άιισλ πξσηετλψλ (ή επηθξαηεηψλ ηνπο) πνπ παξεκβαίλνπλ ζηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο θαη αλαθέξζεθαλ παξαπάλσ: ε θαξβνμπηειηθή επηθξάηεηα ηνπ Efb, ην Ehp, ε επηθξάηεηα IV ηνπ Sbi θαη ην κνηίβν Β ηνπ SpA. πγθεθξηκέλα, ην SCIN έρεη ηελ ίδηα ηνπνινγία ειίθσλ κε ην SpA, αιιά δηαθνξεηηθή απφ απηή πνπ είλαη θνηλή γηα ηηο ππφινηπεο ηξεηο 38

39 πξσηεΐλεο. (69) Δπηπξφζζεηα, κε ζάξσζε ησλ δηαζέζηκσλ γνληδησκάησλ ηνπ βαθηεξίνπ πνπ ήηαλ δηαζέζηκα ζηε βάζε δεδνκέλσλ, βξέζεθαλ ηξεηο πξσηεΐλεο νκφινγεο ηνπ SCIN: SCIN-B (ηαπηφηεηα: 46%), SCIN-C (48%) θαη SCIN-D (γλσζηφ θαη σο ORF-D, 33%) (68). Γηα απηφ ην ιφγν ζήκεξα ην SCIN απνθαιείηαη θαη SCIN-A. Απηέο αλήθνπλ ζε κηα λέα νκάδα γνληδίσλ πνπ παξεκβαίλνπλ ζηελ αλνζηαθή απφθξηζε θαηά ηνπ κηθξνβίνπ, δηαθνξεηηθή απφ απηήλ ζηελ νπνία αλήθεη ην SCIN. (70) Οη λέεο απηέο πξσηεΐλεο έρνπλ παξφκνην κέγεζνο θαη (πξνβιεπφκελε) δεπηεξνγελή δηακφξθσζε κε ην αξρηθφ κφξην. κσο κφλν ην SCIN-B θαη C βξέζεθε φηη έρεη παξφκνηα ιεηηνπξγία κε ην SCIN, αθνχ αλαζηέιινπλ ηελ ελεξγνπνίεζε θαη ησλ ηξηψλ νδψλ (ζηαζεξνπνηψληαο ηηο θνλβεξηάζεο ζε αλελεξγφ δηακφξθσζε) θαζψο θαη ηε θαγνθπηηάξσζε ηνπ βαθηεξίνπ. Σν SCIN-D είλαη αλελεξγφ. (68, 70) Σα ηξία ελεξγά SCINs θαίλεηαη φηη ζπλαγσλίδνληαη γηα παξφκνην ζεκείν πξφζδεζεο πάλσ ζηελ θνλβεξηάζε C3bBb θαη φηη πξνδέλνληαη ζε απηή κε παξφκνηα ζπγγέλεηα. Σέινο, κε ηε κειέηε ρεηκεξηθψλ κνξίσλ ζηα νπνία αιιεινπρίεο ηνπ SCIN αληηθαηαζηάζεθαλ κε αιιεινπρίεο ηνπ SCIN-D, βξέζεθε φηη ε πεξηνρή πνπ είλαη απαξαίηεηε γηα ηε ιεηηνπξγία ηνπ πξψηνπ είλαη ηα ακηλνμέα (Δηθφλα 10). (68) Δηθόλα 10: H δνκή ηνπ SCIN. Σν κφξην απηφ απνηειείηαη απφ ηξεηο α-έιηθεο νη νπνίεο αξηζκνχληαη α1-α3 απφ ην ακηλνηειηθφ (Ν) εψο ην θαξβνμπηειηθφ άθξν (C). Η αιιεινπρία L 31 -G 48 ε νπνία δείρλεηαη κε sticks βξέζεθε κε πεηξάκαηα νκφινγεο αληηθαηάζηαζεο φηη είλαη θξίζηκε γηα ηελ ιεηηνπξγία ηεο πξσηεΐλεο σο αλαζηνιέαο ηνπ ζπκπιεξψκαηνο. Η δηαπίζησζε φηη ν SCIN πξνζδέλεηαη κφλν ζε ζπλαξκνινγεκέλεο θνλβεξηάζεο θαη φρη ζηα επηκέξνπο ζπζηαηηθά ηνπο ήξζε ζε αληίζεζε κε ηνλ ηξφπν δξάζεο άιισλ αλαζηνιέσλ ηνπ ζπκπιεξψκαηνο νη νπνίνη πξνζδέλνπλ κεκνλσκέλα ζπζηαηηθά. Γηα ην ιφγν απηφ, έλαο απφ ηνπο ζηφρνπο ηεο παξνχζαο δηαηξηβήο ήηαλ ε κειέηε ηεο αιιειεπίδξαζεο ηνπ SCIN κε ην C3b, αθνχ απηφ είλαη ζπλήζσο ν ζηφρνο ησλ ξπζκηζηψλ θαη αλαζηνιέσλ. Η δηεξεχλεζε ηνπ κεραληζκνχ δξάζεο ηνπ SCIN κπνξεί λα ξίμεη θσο ζε δχν θαηεπζχλζεηο: ηνλ ζρεδηαζκφ 39

40 θαιχηεξσλ θαξκάθσλ έλαληη ηνπ ρξπζίδνληα ζηαθπιφθνθθνπ, αιιά θαη ηελ αλάπηπμε ζεξαπεηψλ γηα αζζέλεηεο ζηηο νπνίεο εκπιέθεηαη ε αλεμέιεγθηε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο. Παξάιιεια, ε ζηαζεξνπνίεζε ηεο δνκήο ηνπ C3bBb ζήκαηλε φηη ην SCIN κπνξεί λα ρξεζηκνπνηεζεί γηα ηελ επίιπζε ηεο δνκήο ηνπ ζπκπιφθνπ. Compstatin - Έλαο πεπηηδηθόο αλαζηνιέαο ησλ θνλβεξηαζώλ ηνπ C3 ε αληίζεζε κε ην SCIN, ην νπνίν είλαη πξντφλ ελφο παζνγφλνπ κηθξννξγαληζκνχ, ε compstatin είλαη ζπλζεηηθφ πεπηίδην, ην νπνίν επίζεο δηαζέηεη ηελ ηθαλφηεηα λα αλαζηέιιεη ηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο (Δηθφλα 11). Σν πεπηίδην απηφ πνπ αλαθαιχθζεθε πξηλ απφ 15 ρξφληα βξίζθεηαη ζε θιηληθέο δνθηκέο γηα ηελ ζεξαπεία ηεο ειηθηαθήο εθθχιηζεο ηεο σρξάο θειίδαο θαη είλαη έλα απφ ιίγα θάξκαθα ππφ αλάπηπμε ή ζηελ αγνξά πνπ ζηνρεχνπλ ην ζπκπιήξσκα. Παξαθάησ ζα γίλεη κηα ζχληνκε αλαδξνκή ζηελ πνξεία αλάπηπμεο απηνχ ηνπ αλαζηνιέα (γηα πεξηζζφηεξεο ιεπηνκέξεηεο, βι. αλαζθφπεζε (71)) θαη ζα ζπδεηεζνχλ νη ζηφρνη γηα ηε βειηίσζή ηνπ. Δμέιημε θαη ζεκαζία Η compstatin αλαθαιχθζεθε κέζσ ηεο ζάξσζε βηιηνζήθεο πεπηηδίσλ πνπ εθηίζεληαη ζηελ επηθάλεηα θάγσλ. Η κεζνδνινγία απηή ζπλίζηαηαη ζε επαλαιακβαλφκελνπο θχθινπο επηινγήο: αθηλεηνπνίεζε ηεο πξσηεΐλεο ζηφρνπ (C3b ζε απηή ηελ πεξίπησζε) ζε ζηεξεφ ππφζηξσκα (ι.ρ. πηάην ELISA), επηινγή ησλ θάγσλ ηεο βηβιηνζήθεο πνπ πξνζδέλνληαη ζην ζηφρν, έθινπζε θαη πνιιαπιαζηαζκφ κέζσ κφιπλζεο βαθηεξίσλ. Έπεηηα γίλεηαη επηινγή κνλψλ θιψλσλ (θαγηθψλ πιαθψλ) θαη ε αιιεινχρηζή ηνπο, ε νπνία αλαδεηθλχεη ηελ αιιεινπρία ηνπ πεπηηδίνπ πνπ εθηίζεην ζηελ επηθάλεηα. Απηφ ηέινο ζπληίζεηαη θαη ππφθεηηαη ζε ιεηηνπξγηθέο κειέηεο. άξσζε κε C3b έδσζε έλα πεπηίδην 27 ακηλνμέσλ ην νπνίν κπνξνχζε λα πξνζδέζεη C3, C3b θαη C3c αιιά φρη C3d. Σν πεπηίδην απηφ είρε ηελ ηδηφηεηα λα αλαζηείιεη ηελ ελεξγνπνίεζε ηεο θιαζζηθήο θαη ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο θαη βξέζεθε φηη απηφ ζπκβαίλεη ιφγσ ηεο πξφζδεζεο ζην C3 θαη ηεο αλαζηνιήο ηεο πέςεο απηνχ απφ ηηο θνλβεξηάζεο. Βξέζεθε φηη ην πξψην κηζφ ηκήκα (13 πξψηα ακηλνμέα I[CVVQDWGHHRC]T, φπνπ νη αγγχιεο δειψλνπλ ην ζρεκαηηζκφ δηζνπιθηδηθνχ δεζκνχ), ην νπνίν αξγφηεξα νλνκάζηεθε compstatin, έρεη ζρεδφλ φιε ηελ ελεξγφηεηα ηνπ πιήξνπο κνξίνπ θαη φηη ν δηζνπιθηδηθφο δεζκφο κεηαμχ ησλ θαηαινίπσλ 2-12 είλαη απαξαίηεηνο γηα ηε ιεηηνπξγία ηνπ. (72) 40

41 Δηθόλα 11: Ο αλαζηνιέαο ηνπ ζπκπιεξψκαηνο compstatin ζηνρεχεη ηελ θαξδηά ηνπ ζπζηήκαηνο, ην C3. Δκπνδίδεη ηελ ελεξγνπνίεζή ηνπ θαη απφ ηηο ηξεηο νδνχο, ηνλ πνιιαπιαζηαζκφ ηεο απφθξηζεο κέζσ ηεο ελαιιαθηηθήο νδνχ θαη επνκέλσο θαη ηα κεηέπεηηα βήκαηα ελεξγνπνίεζεο θαη ηηο ιεηηνπξγίεο πνπ ηα ελεξγνπνηεκέλα κφξηα ζα κεζνιαβνχζαλ. Μηα ζεηξά απφ κειέηεο αθνινχζεζαλ νη νπνίεο αλέδεημαλ ηα ραξαθηεξηζηηθά ηεο compstatin πνπ είλαη ζεκαληηθά γηα ηε ιεηηνπξγία ηεο θαη νδήγεζαλ ζηελ βειηίσζε ηεο ζπγγέλεηάο ηεο πξνο ην C3/C3b θαη ηεο αλαζηαιηηθήο ηεο δξάζεο. Απφ ηα πξψηα βήκαηα ήηαλ ε αληηθαηάζηαζε ησλ ακηλνμέσλ έλα πξνο έλα κε ην απινχζηεξν ακηλνμχ αιαλίλε, ε νπνία αλέδεημε απηά ησλ νπνίσλ ε πιεπξηθή αιπζίδα είλαη απαξαίηεηε γηα ελεξγφηεηα (ζέζεηο 3 θαη 5-8). (73) Απαξαίηεην ζηνηρείν είλαη επίζεο ε θπθιηθή δνκή κε κήθνο δαθηπιίνπ 11 ακηλνμέσλ, ελψ ε αθεηπιίσζε ηνπ ακηλνηειηθνχ άθξνπ νδήγεζε ζε κεγαιχηεξε ζηαζεξφηεηα ζην πιάζκα θαη ζε αχμεζε ηεο ελεξγφηεηαο. (74) Δκπεηξηθέο δνθηκέο θαη ππνινγηζηηθνί ζρεδηαζκνί νδήγεζαλ ζην αληηθαηάζηαζε ησλ ακηλνμέσλ ζηε ζέζε 9 κε αιαλίλε θαη ζηε ζέζε 4 κε ηξππηνθάλε (4W9A) ην νπνίν είρε 45 θνξέο απμεκέλε ελεξγφηεηα ζε ζρέζε κε ην αξρηθφ κφξην θαη είλαη ην πην ελεξγφ αλάινγν κε θπζηθά ακηλνμέα. Πξφζζεζε κηαο κεζπινκάδαο ζηνλ άλζξαθα 1 ηεο W 4 νδήγεζε ζην 267 θνξέο πην ελεξγφ αλάινγν 4(1MeW) (ζε ζρέζε πάληα κε ην αξρηθφ κφξην). (71) Αλάιπζε αλαιφγσλ κε Ν-κεζπιίσζε ζε θάζε θαηάινηπν θαη κεηαιιάμεηο ζην 13 ν θαηάινηπν νδήγεζε ζην αλάινγν compstatin-20 πνπ είλαη 1000 θνξέο πην ελεξγφ απφ ην αξρηθφ: Ac-I[CV- 1MeW-QDW-Sar-AHRC]-NMeI-NH 2. (75) ηελ πνξεία απηψλ ησλ βειηηψζεσλ ζεκαληηθφ ξφιν έπαημε ε κειέηε ησλ θηλεηηθψλ θαη ε ζεξκνδπλακηθψλ παξακέηξσλ ηεο αιιειεπίδξαζεο ησλ αλαιφγσλ ηεο compstatin κε ην ζηφρν (C3/C3b), νη νπνίεο ήηαλ αληίζηνηρεο κε ηελ ελεξγφηεηά ηνπο σο αλαζηνιείο. Η επίιπζε ηεο δνκήο (ζε δηάιπκα) ηεο compstatin (αξρηθή αιιεινπρία 13 ακηλνμέσλ) κε ππξεληθφ καγλεηηθφ ζπληνληζκφ έδεημε ην ζρεκαηηζκφ κηαο β-ζηξνθήο ηχπνπ Ι αλάκεζα ζηα 41

42 ακηλνμέα 5-8 (73), ε νπνία φκσο κε ηελ θξπζηαιινγξάθεζε ηνπ ζπκπιφθνπ C3c compstatin 4W9A αξγφηεξα βξέζεθε φηη ζρεκαηίδεηαη αλάκεζα ζηα ακηλνμέα Απηφ ην γεγνλφο αλέδεημε ηελ αιιαγή δηακφξθσζεο ηεο compstatin κεηά ηελ πξφζδεζε ζην ζηφρν (Δηθφλα 12). Αληίζεηα ε δηακφξθσζε ηνπ C3c δελ άιιαμε ζεκαληηθά. Δπεηδή ε πξφζδεζε γίλεηαη ζε κηα ζηελή αχιαθα αλάκεζα ζηηο επηθξάηεηεο MG4 θαη MG5, ην νπνίν είλαη καθξηά απφ ην C3a (πνπ αθαηξείηαη θαηά ηελ ελεξγνπνίεζε ηνπ C3) θαη απφ ηελ πεξηνρή ζηελ νπνία κεηαθηλείηαη ην TED (θαηά ηε κεηαηξνπή απφ C3 ζε C3b), θαίλεηαη ε compstatin δελ εκπνδίδεη ζηεξηθά απηέο ηηο δηαδηθαζίεο. (76) Απηέο νη πιεξνθνξίεο ζε ζπλδπαζκφ κε ην αξρηθφ εχξεκα φηη ε compstatin δελ εκπνδίδεη ην ζρεκαηηζκφ ηεο θνλβεξηάζεο (πξφζδεζε FB ζην C3b θαη πέςε ηνπ πξψηνπ απφ FD, γηα ηνλ ζρεκαηηζκφ C3bBb) (72) θαη πξνεγνχκελε γλψζε απφ ηνλ θξχζηαιιν ηνπ C3b (29) νδήγεζαλ ζηελ πξφηαζε φηη ν κεραληζκφο δξάζεο είλαη ν εμήο: ε compstatin εκπνδίδεη ζηεξηθά ηνλ εηεξνδηκεξηζκφ ηνπ ππνζηξψκαηνο C3 κε ην C3b ηνπ ελδχκνπ C3bBb πνπ είλαη απαξαίηεηνο γηα ηελ ελδπκαηηθή πέςε ηνπ C3. (76) Δηθόλα 12: α. Γνκή ηνπ ζπκπιφθνπ C3c - Compstatin Ac-ICVWQDWGAHRCT-NH 2. Η compstatin πξνζδέλεηαη ζε κηα ζηελή αχιαθα αλάκεζα ζηηο επηθξάηεηεο MG4 θαη MG5. β. Γηακφξθσζε ηεο πξνζδεδεκέλεο ζην C3c Compstatin Ac-ICVWQDWGAHRCT-NH 2. γ. Γηακφξθσζε ηεο ειεχζεξεο Compstatin ICVVQDWGHHRCT-NH 2 ζην δηάιπκα, φπσο είρε αξρηθά βξεζεί κε ππξεληθφ καγλεηηθφ ζπληνληζκφ. Δίλαη εκθαλήο ε δηαθνξά αλάκεζα ζηηο δηακνξθψζεηο β θαη γ. Πξνζαξκνγή απφ (76). Η compstatin πξνζδέλεηαη εηδηθά ζην C3 ηνπ αλζξψπνπ θαη πξσηεπφλησλ νξγαληζκψλ αιιά φρη άιισλ ζειαζηηθψλ πνπ εμεηάζηεθαλ (πνληίθη, αξνπξαίνο, ρνίξνο θαη ηλδηθφ ρνηξίδην) (72, 77) ην νπνίν έρεη πεξηνξίζεη ηελ in vivo ρξήζε ηεο γηα κνληέια αζζελεηψλ ζηα πξσηεχνληα. Παξφια 42

43 απηά ε ιεηηνπξγία δηαθφξσλ αλαιφγσλ ηεο έρεη κειεηεζεί εθηελψο ζε κηα πνηθηιία ζπζηεκάησλ ζηα νπνία εκπιέθεηαη ην ζπκπιήξσκα, αλαδεηθλχνληαο ηελ ρξεζηκφηεηα σο πεηξακαηηθφ εξγαιείν γηα ηε κειέηε ηνπ ζπκπιεξψκαηνο θαη σο ζεξαπεπηηθφ κφξην. Σν πξψην in vitro παξάδεηγκα ήηαλ ε αλαζηνιή ηνπ ζπκπιεξψκαηνο θαη ησλ θιεγκνλσδψλ απνθξίζεσλ πνπ απηφ πξνθαιεί ζε έλα κνληέιν εμσζσκαηηθήο θπθινθνξίαο αίκαηνο κέζα ζε ζσιήλεο PVC. (78, 79) ε έλα πην πξφζθαην κνληέιν εμσζσκαηηθήο θπθινθνξίαο αίκαηνο ζε θίιηξα αηκνθάζαξζεο, ε compstatin αλέζηεηιε επίζεο ηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο θαη ησλ νπδεηεξνθίισλ θαζψο θαη ηελ παξαγσγή ηζηηθνχ παξάγνληα ζε απηά, ε νπνία εκπιέθεηαη ζηηο επηπινθέο ζξφκβσζεο ηεο αηκνθάζαξζεο. (20) Έρεη βξεζεί αθφκα φηη ε compstatin κπνξεί λα επηκεθχλεη ηελ επηβίσζε λεθξψλ ρνίξνπ εγρπφκελσλ κε αλζξψπηλν αίκα (ex vivo κνληέιν μελνκεηακφζρεπζεο) (80) θαη λα πξνζηαηέςεη παγθξεαηηθά λεζίδηα ρνίξσλ (81) θαη αλζξψπσλ (82) απφ ηελ ελαπφζεζε C3b/iC3b θαηά ηελ επψαζε ζε αλζξψπηλν πιάζκα. Δπηπιένλ, έλαο κεραληζκφο κε ηνλ νπνίν ζα κπνξνχζε θαλείο λα πξνζηαηέςεη ην κφζρεπκα απφ ηελ επίζεζε ηνπ ζπκπιεξψκαηνο, ρσξίο ηε ζπζηεκαηηθή ρνξήγεζε ηνπ αλαζηνιέα, πξνηάζεθε ηειεπηαία φηαλ επηηεχρζεθε ε ελζσκάησζε ελφο αλαιφγνπ compstatin κε εμα-ηζηηδίλε ζε ζπληεθνγφλα θπζηίδηα ιηπηδίσλ πνπ πεξηείραλ ηφληα ληθειίνπ. χληεμε απηψλ ησλ θπζηηδίσλ ζε κεκβξάλεο θαιιηεξγεκέλσλ θπηηάξσλ, αθνινπζνχκελε απφ πξφζδεζε ηεο compstatin πξνζηάηεςε ηα θχηηαξα απφ ελαπφζεζε C3b. (83) Η πξψηε ρξήζε ηεο compstatin in vivo έγηλε ζε έλα κνληέιν ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο ζε κπακπνπΐλνπο κέζσ ηεο ρνξήγεζεο πξσηακίλεο-επαξίλεο, ην νπνίν απνηειεί επηπινθή ησλ εγρεηξήζεσλ θαξδηάο. Η ρνξήγεζε ηεο compstatin αλέζηεηιε ησλ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο ρσξίο εκθαλείο παξελέξγεηεο ζε θαξδηαθφ θαη αηκαηνινγηθφ επίπεδν. (84) Η επφκελε κεγάιε επηηπρία ηεο compstatin ήηαλ ε πξφζθαηε κειέηε πνπ έδεημε ηελ πξνζηαζία κπακπνπΐλσλ απφ πνιιαπιή απψιεηα νξγάλσλ θαη ηελ βειηίσζε ηεο θιηληθήο εηθφλαο ζε έλα κνληέιν ζήςεο πνπ είρε πξνθιεζεί κε βαθηήξηα E. coli. (85) Δπίζεο, ε πξψηε θάζε θιηληθψλ δνθηκψλ ηνπ αλαιφγνπ POT-4 ηεο compstatin γηα ηελ ζεξαπεία ηεο ειηθηαθήο εθθχιηζεο ηεο σρξάο θειίδαο νινθιεξψζεθε κε επηηπρία. Σν γεγνλφο απηφ νδήγεζε ζηελ αγνξά ηεο εηαηξείαο Potentia πνπ μεθίλεζε ηηο δνθηκέο απφ ηελ Alcon θαη ηελ εηζαγσγή ζε δεχηεξε θάζε θιηληθψλ δνθηκψλ. Σαπηφρξνλα, έλα αλεμάξηεην κνληέιν ηεο ίδηαο αζζέλεηαο πνπ έγηλε ζε κηα απνηθία ελφο είδνπο πξσηεπφλησλ (Cynomolgus monkey) πνπ εκθαλίδνπλ νδίδηα ζηνπο νθζαικνχο ηνπο πνιχ λσξίο (αθφκα θαη ζε ειηθία δχν ρξφλσλ) αμηνπνηήζεθε γηα ηε κειέηε ησλ επηπηψζεσλ ηεο έλεζεο compstatin ζηνλ ακθηβιεζηξνεηδή θαη βξέζεθε φηη ηα νδίδηα εμαθαλίζηεθαλ έμη κήλεο κεηά ηελ έλεζε. (86) 43

44 Απφ ηελ παξαπάλσ αλαδξνκή γίλεηαη θαηαλνεηφ φηη ε compstatin είλαη πνιιά ππνζρφκελε γηα ηελ αληηκεηψπηζε παζνινγηψλ ζηηο νπνίεο εκπιέθεηαη ε απμεκέλε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο θαη επνκέλσο ππάξρεη κεγάιν ελδηαθέξνλ γηα ηελ πεξαηηέξσ βειηίσζε ησλ ραξαθηεξηζηηθψλ ηεο σο θάξκαθν. Η κεγαιχηεξε έκθαζε έρεη δνζεί σο ηψξα ζηελ ελεξγφηεηα, ε νπνία, φπσο πξναλαθέξζεθε, θαηνξζψζεθε λα είλαη 1000 θνξέο κεγαιχηεξε ζην ηειεπηαίν αλάινγν ηεο compstatin ζε ζρέζε κε ηελ αξρηθή αιιεινπρία θαη ζα ζπλερίζεη λα βειηηψλεηαη. Δπίζεο, ν δηζνπιθηδηθφο δεζκφο, πξνζθέξεη απμεκέλε ζηαζεξφηεηα έλαληη δηάζπαζεο ζε ζρέζε κε ην γξακκηθφ αλάινγν, (74) αιιά είλαη επαίζζεηνο ζε αλαγσγή θαη επνκέλσο ζα ήηαλ ζεηηθφ λα αληηθαηαζηαζεί κε έλαλ πην ζηαζεξφ δεζκφ (δεο επφκελε παξάγξαθν). Σα ηξνπνπνηεκέλα, κε θπζηθά ακηλνμέα πνπ έρνπλ ρξεζηκνπνηεζεί ζηα ηειεπηαία αλάινγα ηεο compstatin είλαη πηζαλφ φηη απμάλνπλ επίζεο ηε ζηαζεξφηεηα. Έλαο πηζαλφο ζηφρνο γηα ηελ δεκηνπξγία ελφο αλαζηνιέα κε θαιχηεξεο θαξκαθνθηλεηηθέο ηδηφηεηεο είλαη ε εθαξκνγή πεπηηδνκηκεηηθήο, δειαδή ε εχξεζε ελφο θζελφηεξνπ κε πεπηηδηθνχ ρεκηθνχ κνξίνπ κε ηελ ίδηα δηακφξθσζε ζην ζεκείν πξφζδεζεο θαη κηθξφηεξν κέγεζνο. Αθφκε, γηα ηελ θαζπζηέξεζε ηεο πηζαλψο γξήγνξεο απέθθξηζεο κέζσ ηεο λεθξηθήο δηήζεζεο (ιφγσ κηθξνχ κεγέζνπο), έλαο ζηφρνο είλαη ε δεκηνπξγία ελφο ρεηκεξηθνχ αλαιφγνπ, ηνπ νπνίνπ ην έλα ηκήκα λα πξνζδέλεηαη ζε κηα κεγαιχηεξε θαη άθζνλε πξσηεΐλε, φπσο ε αιβνπκίλε ηνπ νξνχ. Παξνκνίσο ζχληεμε κε άιιν κφξην πνπ λα πξνζδέλεηαη επηιεθηηθά ζε ζπγθεθξηκέλε θαηεγνξία θπηηάξσλ ζα κπνξνχζε λα θαηεπζχλεη ηελ ζεξαπεπηηθή ιεηηνπξγία ηεο compstatin ζε απηά ηα θχηηαξα. Σέινο, γηα ηε δηεπθφιπλζε ηεο έξεπλαο, ζα ήηαλ ρξήζηκε ε δεκηνπξγία αλαιφγσλ ελεξγψλ ζε κηθξά πεηξακαηφδσα, φπσο ην πνληίθη, ή αληίζηξνθα, ε δεκηνπξγία δηαγνληδηαθψλ πνληηθψλ ησλ νπνίσλ ην C3 έρεη κεηαιιαρζεί έηζη ψζηε λα πξνζδέλεη ηελ compstatin. (71) Αληηθαηάζηαζε δηζνπιθηδηθνύ δεζκνύ κε ζεηναηζεξηθό Έλα απφ ηα ραξαθηεξηζηηθά ηεο compstatin πνπ έρνπλ πεξηζψξην βειηίσζεο αθνξά ηνλ δηζνπιθηδηθφ δεζκφ, ν νπνίνο είλαη απαξαίηεηνο γηα ηε ιεηηνπξγηθφηεηά ηεο. Ο δεζκφο απηφο είλαη αλαζηξέςηκνο θαη κπνξεί λα αλαρζεί, πξνθαιψληαο ηε κεηαηξνπή ζηε γξακκηθή ηνπ πεπηηδίνπ. Αλαγσγή ηνπ δηζνπιθηδηθνχ θαη αιθπιίσζε (γηα ηελ απνθπγή ηεο νμείδσζεο) ή ε αληηθαηάζηαζε ησλ θπζηετλψλ κε αιαλίλεο είρε σο απνηέιεζκα ηελ απψιεηα ηεο ελεξγφηεηαο θαη ηεο ζπγγέλεηαο ηεο compstatin πξνο ην C3. (72) Δπίζεο, ε θπθιηθή, ζπκπαγήο δνκή πξνζηαηεχεη ην πεπηίδην απφ απνηθνδφκεζε ζε αλζξψπηλν αίκα, αθνχ ην θπθιηθφ πεπηίδην δίλεη ιηγφηεξα πξντφληα δηάζπαζεο θαη έρεη κεγαιχηεξν ρξφλν εκηδσήο ζε ζρέζε κε ην γξακκηθφ. (74) Γηα απηφ ην ιφγν έλαο απφ ηνπο ζηφρνπο γηα ηελ βειηίσζε ηεο compstatin ήηαλ ε αληηθαηάζηαζε ηνπ δηζνπιθηδηθνχ απφ άιιν δεζκφ, ν νπνίνο λα κε δηαζπάηαη. Αλάκεζα ζηηο 44

45 πηζαλέο ιχζεηο πνπ έρνπλ ρξεζηκνπνηεζεί γηα άιια ζεξαπεπηηθά πεπηίδηα (γέθπξα θαξβα-, ιαθηακ-, δηζειελίνπ θαη ζεηναηζέξα), ν ζεηναηζέξαο επηιέρηεθε εδψ θαη ηα αλάινγα ηεο compstatin 4W9A θαη CP20 πνπ παξάρζεθαλ κειεηήζεθαλ ζηελ παξνχζα δηαηξηβή. Ο ζεηναηζέξαο είλαη ε ιεηηνπξγηθή νκάδα C-S-C, φπνπ C: άλζξαθαο θαη S: ζείν. Αξθεηά ζεξαπεπηηθά πεπηίδηα έρνπλ παξαρζεί ζε θπθιηθή κνξθή κε ηε ρξήζε ζεηαηζεξηθνχ δεζκνχ, φπσο ε βαδνπξεζζίλε, ε νμπηνθίλε (87), πξνζδέηεο αληη-θαξδηνιηπηδηθψλ αληηζσκάησλ (88) θαη αληαγσληζηέο ηνπ VCAM/VLA-4 (89). Η αληηθαηάζηαζε ηνπ δηζνπιθηδηθνχ δεζκνχ κε ζεηναηζέξα θαηά ηε ζχλζεζε ελφο πεπηηδίνπ κπνξεί λα γίλεη κε ηε δεκηνπξγία κηαο γέθπξαο θπζηαζεηνλίλεο. πσο θαίλεηαη παξαθάησ ε κφλε δηαθνξά αλάκεζα ζηελ θπζηίλε (δηκεξέο θπζηετλψλ ζπλδεδεκέλσλ κε δηζνπιθηδηθφ δεζκφ, Δηθφλα 13α) θαη ζηελ θπζηαζεηνλίλε (κπνξεί λα ζεσξεζεί εηεξνδηκεξέο αιαλίλεο θαη νκνθπζηεΐλεο, Δηθφλα 13β) είλαη ε αληηθαηάζηαζε ελφο αηφκνπ -S- κε ηελ νκάδα -CH2-. Με κηα κηθξή δνκηθή δηαθνξά επνκέλσο παίξλνπκε έλα δεζκφ ν νπνίνο δε κπνξεί λα αλαρζεί. Δπεηδή ν ζεηαηζέξαο κπνξεί φκσο λα νμεηδσζεί, κειεηήζεθε επίζεο εδψ ην απνηέιεζκα ηεο νμείδσζεο ελφο αλαιφγνπ πνπ πεξηέρεη ζεηναηζέξα ζηελ ελεξγφηεηα ηεο compstatin θαη ζπγθξίζεθε κε ην απνηέιεζκα ηεο αλαγσγήο ηνπ αλαιφγνπ κε δηζνπιθηδηθφ δεζκφ. Τπάξρνπλ δχν πηζαλφηεηεο σο πξνο ηελ ηνπνζέηεζε ηεο νκνθπζηεΐλεο: ζηε ζέζε 2 θαη 12. Γηα ηελ δηεξεχλεζε ηεο επίδξαζεο θαζεκηάο απφ απηέο ηηο πηζαλφηεηεο ζηελ ελεξγφηεηα ηνπ κνξίνπ, δεκηνπξγήζεθαλ δχν αληίζηνηρα αλάινγα (2 θαη 3, Δηθφλα 13γ) ηεο Compstatin 4W9A (κάξηπξαο 1). Δπίζεο εμεηάζηεθε ε επίδξαζε ηεο αληηθαηάζηαζεο ηνπ δηζνπιθηδηθνχ κε ζεηναηζέξα ζηελ πεξίπησζε ηεο πιένλ ελεξγνχο Compstatin-20 (κάξηπξαο 4), κε ηε δεκηνπξγία ηνπ αληίζηνηρνπ αλαιφγνπ 5. Σν ηειεπηαίν πεξηέρεη ηελ νκνθπζηεΐλε ζηε ζέζε

46 Δηθόλα 13: χγθξηζε ηνπ δηζνπιθηθνχ δεζκνχ ηεο θπζηίλεο, α θαη ηνπ ζεηαηζεξηθνχ ηεο θπζηαζεηνλίλεο, β (Hcy: νκνθπζηεΐλε). γ. Λίζηα ησλ αλαιφγσλ ηεο compstatin πνπ κειεηήζεθαλ. Οη κάξηπξεο 1 θαη 4 πεξηέρνπλ δηζνπιθηδηθφ δεζκφ. Σα αλάινγα 2 θαη 3 αληηπξνζσπεχνπλ ηηο δχν πηζαλφηεηεο σο πξνο ηελ ηνπνζέηεζε ηνπ ζείνπ: πην θνληά ζην Ν-ηειηθφ ή ην C-ηειηθφ άθξν ηνπ πεπηηδίνπ. Σν αλάινγν 5 πεξηέρεη ην ζείν πην θνληά ζην Ν-ηειηθφ άθξν. δ. Γεληθή ζρεκαηηθή αλαπαξάζηαζε ησλ αλαιφγσλ ηεο compstatin θαη ησλ κεηαβιεηψλ ακηλνμέσλ θαη ρεκηθψλ νκάδσλ ηεο γέθπξαο πνπ ζπγθξαηεί ην κφξην ζηελ θπθιηθή κνξθή. Ζ ηερληθή ηνπ ζπληνληζκνύ επηθαλεηαθώλ πιαζκνλίσλ (Surface Plasmon Resonance SPR). Η κέζνδνο ηνπ ζπληνληζκνχ ησλ επηθαλεηαθψλ πιαζκνλίσλ (SPR) είλαη πνιχ ζεκαληηθή γηα ηε κειέηε αιιειεπηδξάζεσλ αλάκεζα ζε πξσηεΐλεο, πξσηεΐλεο θαη πεπηίδηα θαη άιια καθξνκφξηα. Δπεηδή έρεη ρξεζηκνπνηεζεί εθηελψο ζην παξειζφλ γηα ηε κειέηε αιιειεπηδξάζεσλ κεηαμχ πξσηετλψλ ηνπ ζπκπιεξψκαηνο θαη ρξεζηκνπνηήζεθε επίζεο γηα ηηο αλάγθεο ηεο παξνχζαο δηαηξηβήο, ηα βαζηθά ραξαθηεξηζηηθά ηεο πεξηγξάθνληαη εδψ: Σν SPR κπνξεί λα δψζεη πιεξνθνξίεο γηα ηε ζπγγέλεηα αιιά θαη ηηο θηλεηηθέο παξακέηξνπο κηαο αιιειεπίδξαζεο. Απαηηνχληαη κφλν κηθξέο πνζφηεηεο πξσηετλψλ, νη νπνίεο δελ ρξεηάδεηαη λα ζεκαλζνχλ κε θζνξνθφξα ή αιια κφξηα. Η ηππηθή δηάηαμε πνπ ρξεζηκνπνηείηαη γηα ην SPR πεξηιακβάλεη έλα ηζηπ κε γηα γπάιηλε επηθάλεηα πάλσ ζηελ νπνία ππάξρεη κηα ιεπηή επίζηξσζε ρξπζνχ. Κάησ απφ ηε γπάιηλε επηθάλεηα ππάξρεη έλα πξίζκα, ελψ πάλσ ζηε ρξπζή ππάξρεη ζε νξηζκέλα ηζηπ κηα ζηξψζε αιπζίδσλ θαξβνμπκέζπιν-δεμηξάλεο, ε νπνία ρξεζηκεχεη γηα ηελ αθηλεηνπνίεζε ηεο πξσηεΐλεο-ζηφρνπ κε δηάθνξεο κεζφδνπο. Η δεχηεξε, αλαιπφκελε πξσηεΐλε ελχεηαη θαη ξέεη πάλσ απφ ην ζηφρν. Φσο απφ κηα πεγή πεξλά δηακέζνπ 46

47 ηνπ πξίζκαηνο θαη δηαζιάηαη κέζα απφ ην ηζηπ. Αλ αιιειεπηδξάζνπλ νη δχν πξσηεΐλεο, δειαδή ε αλαιπφκελε βξεζεί θνληά ζηε ρξπζή επηθάλεηα, ηφηε ν δείθηεο δηάζιαζεο αιιάδεη θαη απηφ κεηαθξάδεηαη ηειηθά ζε αχμεζε ησλ ιεγφκελσλ «κνλάδσλ ζπληνληζκνχ» (resonance units RU) απφ ηελ αξρηθή ηηκή, κε 1RU = 1pg/mm 2. Καηά ηελ έλεζε ηεο αλαιπφκελεο πξσηεΐλεο, ην ζήκα ηνπ SPR θαηαγξάθεηαη ζε πξαγκαηηθφ ρξφλν, θαη αληηζηνηρεί ζε ζπγθεθξηκέλν ιφγν κνξίσλ πνπ ζπλδένληαη θαη απνζπλδένληαη, κέρξη λα επέιζεη ηζνξξνπία (ζηαζεξή θάζε) θαη έπεηηα, κεηά ην ηέινο ηεο έλεζεο, κφλν δηάζηαζε. Οη ζηαζεξέο ηνπ ξπζκνχ πξφζδεζεο θαη δηάζηαζεο (k on θαη k off αληηζηνίρσο) κπνξνχλ έπεηηα λα ππνινγηζηνχλ κε ηελ πξνζσκνίσζε ζε καζεκαηηθέο εμηζψζεηο πνπ πεξηγξάθνπλ κνληέια πξφζδεζεο. Η ζπγγέλεηα ηεο αιιειεπίδξαζεο (ζηαζεξά δηάζηαζεο θαηά ηελ ηζνξξνπία - K D ) κπνξεί λα ππνινγηζηεί είηε απφ ηνλ ηχπν K D = k off / k on είηε κε πξνζσκνίσζε ηνπ γξαθήκαηνο ησλ ζπγθεληξψζεσλ πξνο ην ζήκα ηεο ζηαζεξήο θάζεο. (90) 47

48 Β. θνπφο 48

49 Δίλαη θαηαλνεηφ φηη ην ζπκπιήξσκα απνηειεί έλαλ πνιχ ζεκαληηθφ κεραληζκφ άκπλαο έλαληη ησλ παζνγφλσλ κηθξννξγαληζκψλ θαη δηαηήξεζεο ηεο νκνηνζηαζίαο ηνπ νξγαληζκνχ. Η ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο φκσο πξέπεη πάληα λα δηαηεξείηαη ππφ έιεγρν κέζσ κηαο πιεζψξαο κεραληζκψλ ξχζκηζεο, γηα λα απνηξέπεηαη ε επίζεζε θαηά ηνπ μεληζηή. Αλ ε ηζνξξνπία αλάκεζα ζηελ ελεξγνπνίεζε θαη ζηε ξχζκηζε δηαηαξαρζεί, ηφηε νδεγνχκαζηε ζε παζνινγηθέο θαηαζηάζεηο. Παξαδείγκαηα ηέηνησλ παζνινγηθψλ θαηαζηάζεσλ ζηηο νπνίεο έρεη δεηρζεί ε εκπινθή ηνπ ζπκπιεξψκαηνο θαη ε δπλαηφηεηα γηα ζεξαπεπηηθή παξέκβαζε απνηεινχλ ε ζήςε, ε ειηθηαθή εθθχιηζε ηεο σρξάο θειίδαο, ην ζχλδξνκν ARDS, νη επηπινθέο ζξφκβσζεο θαηά ην ζχλδξνκν αληηθσζθνιηπηδίσλ θαη θαηά ηελ αηκνθάζαξζε θ.ά. ηνλ αληίπνδα, πνιινί παζνγφλνη κηθξννξγαληζκνί, φπσο ν ρξπζίδσλ ζηαθπιφθνθθνο, δηαθεχγνπλ απφ ηελ επίζεζε ηνπ ζπκπιεξψκαηνο κε ηελ παξαγσγή αλαζηνιέσλ, φπσο γηα παξάδεηγκα ην SCIN. Ο ζηφρνο ηεο παξνχζαο δηαηξηβήο ήηαλ ε εκβάζπλζε ησλ γλψζεψλ καο πάλσ ζηνπο κεραληζκνχο κε ηνπο νπνίνπο ελεξγνπνηείηαη θαη ξπζκίδεηαη ην θεληξηθφ ελδχκν ηνπ ζπκπιεξψκαηνο, C3bBb, θαζψο θαη ε αλάπηπμε θαη βειηίσζε αλαζηνιέσλ ηνπ ελδχκνπ απηνχ, φπσο ην θαξκαθεπηηθφ κφξην compstatin, γηα κειινληηθή ζεξαπεπηηθή ρξήζε ζε παζνινγηθέο θαηαζηάζεηο φπσο νη παξαπάλσ. πγθεθξηκέλα, νη επηκέξνπο ζηφρνη ήηαλ νη εμήο: Η αλαγλψξηζε κνξίσλ-ζηφρσλ γηα ηε ζεξαπεπηηθή αλαζηνιή ηνπ θεληξηθνχ ελδχκνπ ηνπ ζπκπιεξψκαηνο C3bBb. Δλψ είρε πξνηαζεί ζην παξειζφλ φηη γηα ην ζρεκαηηζκφ ηνπ ελδχκνπ απαηηείηαη ε αξρηθή πξφζδεζε γίλεηαη κέζσ ηνπ Ba ηκήκαηνο ηνπ FB ζην C3b, δελ ππήξρε άκεζε απφδεημε θαη θηλεηηθή αλάιπζε απηήο ηεο αιιειεπίδξαζεο νχηε ήηαλ γλσζηή ε ζπλεηζθνξά ηνπ Bb ζηελ πξφζδεζε. Δπεηδή νη γλψζεηο απηέο είλαη απαξαίηεηεο γηα ην ζρεδηαζκφ αλαζηνιέσλ απηήο ηεο αιιειεπίδξαζεο εδψ πξαγκαηνπνηήζεθε ε εμεξεχλεζε ησλ θηλεηηθψλ παξακέηξσλ ηεο αιιειεπίδξαζεο ηνπ C3b θαη ηνπ FB (θαη ηνπ ηκήκαηφο ηνπ, Ba) θαηά ην ζρεκαηηζκφ ηεο πξνθνλβεξηάζεο C3bB. Η θαηαλφεζε ηνπ ηξφπνπ δξάζεο ηνπ ζηαθπινθνθθηθνχ αλαζηνιέα ηνπ ζπκπιεξψκαηνο SCIN, ε νπνία κπνξεί λα βνεζήζεη ζε δχν θαηεπζχλζεηο: ηε κειινληηθή θαιχηεξε αληηκεηψπηζε ησλ ινηκψμεσλ απφ απηφ ην βαθηήξην θαη ηελ πηζαλή ρξήζε ηνπ SCIN σο κνληέιν γηα ην ζρεδηαζκφ ελφο ζεξαπεπηηθνχ αλαζηνιέα ηνπ ζπκπιεξψκαηνο. Ωο ηψξα ήηαλ γλσζηφ φηη ν κεραληζκφο αλαζηνιήο ηνπ SCIN ζπλίζηαηαη ζηελ παγίδεπζε ηεο θνλβεξηάζεο C3bBb ζε αλελεξγφ κνξθή θαη είρε πξνηαζεί φηη ην SCIN πξνζδέλεηαη κφλν ζε απηφ ην ζχκπινθν θαη φρη ζε κεκνλσκέλα ζπζηαηηθά ηνπ. Aπηφ ζεσξήζεθε απίζαλν, αθνχ ε πιεηνλφηεηα ησλ ξπζκηζηψλ θαη 49

50 αλαζηνιέσλ πξνζδέλνληαη ζε κεκνλσκέλα ζπζηαηηθά ηεο θνλβεξηάζεο θαη εηδηθά ζην C3b. Γηα απηφ ην ιφγν, δηεξεπλήζεθε εδψ ν κεραληζκφο αιιειεπίδξαζεο ηνπ SCIN κε ην C3b κφλν ηνπ θαη βξέζεθε ην ζεκείν πξφζδεζήο ηνπο κέζσ ηεο επίιπζεο ηεο θξπζηαιιηθήο δνκήο ηνπ ζπκπιφθνπ C3b-SCIN. Η ιεπηνκεξήο θαηαλφεζε ηνπ κεραληζκνχ ιεηηνπξγίαο ηεο θνλβεξηάζεο C3bBb γηα ηε δηεπθφιπλζε ηνπ κειινληηθνχ ζρεδηαζκνχ αλαζηνιέσλ ηνπ ζπκπιεξψκαηνο γηα ζεξαπεπηηθή ρξήζε. Απηφ επηηεχρζεθε κέζα απφ έλα ζχλνιν δνκηθψλ αλαιχζεσλ πνπ πξαγκαηνπνίεζαλ νη ζπλεξγάηεο καο, αιιά θαη βηνρεκηθψλ θαη βηνθπζηθψλ αλαιχζεσλ απφ ηε δηθηά καο πιεπξά: Αξρηθά, έγηλε ρξήζε ηεο ηδηφηεηαο ηνπ SCIN λα ζηαζεξνπνηεί ηελ, θαηά ηα άιια, αζηαζή θνλβεξηάζε C3bBb, γηα ηελ θξπζηάιισζε ηνπ ζπκπιφθνπ απηνχ θαη ηε κειέηε ηεο δνκήο ηνπ. Παξάιιεια, έηζη επηβεβαηψζεθε απηή ε ηδηφηεηα ηνπ SCIN θαη επεθηάζεθε ε γλψζε ηεο αιιειεπίδξαζεο κε ην C3bBb ζε αηνκηθφ επίπεδν. Έπεηηα, πξαγκαηνπνηήζεθε ε κειέηε ηνπ ζρεκαηηζκνχ θαη ηεο ελεξγνπνίεζεο ηεο θνλβεξηάζεο θαηά ηελ αιιειεπίδξαζε ηνπ C3b κε ην FB θαη απηνχ κε ην FD, κέζσ ηεο ιχζεο ηεο θξπζηαιιηθήο δνκήο ησλ πξν-θνλβεξηαζψλ C3bB θαη C3bBD. Σαπηφρξνλα, έγηλε βηνρεκηθή κειέηε κεηαιιαγκάησλ ηνπ FD θαη FB ζε ακηλνμέα πνπ βξέζεθε φηη ήηαλ θξίζηκα γηα ηελ πξφζδεζε θαη ηε ιεηηνπξγία απηψλ ησλ πξσηετλψλ, κε ζθνπφ λα επηβεβαησζνχλ θαη λα εκπινπηηζηνχλ ηα απνηειέζκαηα απφ ηελ αλάιπζε ηεο δνκήο ησλ ζπκπιφθσλ. Σέινο, ε βειηίσζε ηεο ρεκηθήο ζηαζεξφηεηαο ηνπ πνιιά ππνζρφκελνπ θαξκαθεπηηθνχ αλαζηνιέα ηνπ ζπκπιεξψκαηνο, compstatin, ν νπνίνο βξίζθεηαη ζε θιηληθέο δνθηκέο γηα ηε ζεξαπεία ηεο ειηθηαθήο εθθχιηζεο ηεο σρξάο θειίδαο. Η βειηίσζε απηή έγηλε κέζσ ηεο αληηθαηάζηαζεο ηνπ επαίζζεηνπ ζε αλαγσγή (δηάζπαζε) δηζνπιθηδηθνχ δεζκνχ, πνπ ζπγθξαηεί ην κφξην ζηελ ελεξγφ θπθιηθή κνξθή, κε έλαλ ζηαζεξφ ζεηναηζεξηθφ δεζκφ πνπ δε δηαζπάηαη. Σα λέα αλάινγα ηεο compstatin κειεηήζεθαλ θαη ραξαθηεξίζηεθε ε αλαζηαιηηθή ηνπο δξάζε θαη ε ζπγγέλεηά ηνπο πξνο ην C3b, ελψ επίζεο απνδείρηεθε ην πιενλέθηεκά ηνπο ζε ζχγθξηζε κε ηα κεηξηθά κφξηα. πσο ζα ζπδεηεζεί αξγφηεξα, ζην κέιινλ κπνξεί ηα αλάινγα απηά λα απνδεηρηνχλ ρξήζηκα ζε πεξηπηψζεηο φπνπ ε «αλαγσγηθή δπλαηφηεηα» ηνπ αίκαηνο είλαη απμεκέλε, φπσο ζηε ζήςε ή ζε αηκνιπηηθέο επηπινθέο θαη αζζέλεηεο, φπσο ε αηκνθάζαξζε θαη ε παξνμπζκηθή λπρηεξηλή αηκνζθαηξηλνπξία αληίζηνηρα. 50

51 Γ. Μέζνδνη θαη πιηθά 51

52 Πξσηεΐλεο Αλαζπλδπαζκέλε έθθξαζε ηνπ Ba ηκήκαηνο ηνπ FB. Kισλνπνίεζε Γηα ηελ θισλνπνίεζε ηνπ Ba ζηνλ πιαζκηδηθφ θνξέα pqe-30 ηεο QIAGEN ζρεδηάζηεθαλ νη αθφινπζνη εθθηλεηέο: Πξφζζηνο εθθηλεηήο: 5 TTA(GGATCC)ACTCCATGGTCTTTGGCCCGG 3 Αλάζηξνθνο εθθηλεηήο: 5 TTA(GTCGAC)[CTA]CCGCTTCTGTTGTTCCCCTGG 3, φπνπ ζε παξέλζεζε εγθιείεηαη ε αιιεινπρία πέρεο ησλ πεξηνξηζηηθψλ ελδχκσλ BamHI θαη SalI γηα ηνλ πξφζζην θαη αλάζηξνθν εθθηλεηή αληίζηνηρα θαη ζε αγθχιεο ην θσδηθφλην STOP ηεξκαηηζκνχ ηεο κεηάθξαζεο. Ο ζρεδηαζκφο απηφο έγηλε γηα λα επηηξέςεη ηελ έθθξαζε κηαο νπξάο έμη ηζηηδίλσλ ζην ακηλνηειηθφ άθξν ηεο πξσηεΐλεο. Ωο εθκαγείν ρξεζηκνπνηήζεθε έλαο θιψλνο cdna ηνπ FB πνπ παξείρε ην εξγαζηήξην ην Dr. Piet Gros. Μεηά ηελ αιπζηδσηή αληίδξαζε πνιπκεξάζεο (PCR), ρξεζηκνπνηψληαο απηφ ην εθκαγείν, ην πξντφλ ηεο PCR ελψζεθε κε ηνλ θνξέα θισλνπνίεζεο pgem - T Easy (Promega) ελδπκαηηθά. Αθνινχζεζε κεηαζρεκαηηζκφο βαθηεξίσλ TOP10 (Invitrogen), επηινγή ιεπθψλ θιψλσλ θαη αλίρλεπζε θιψλσλ ζεηηθψλ γηα ην έλζεκα κέζσ PCR θαη αιιεινχρηζεο. Ο θιψλνο πνπ είρε ηε ζσζηή αιιεινπρία ρξεζηκνπνηήζεθε γηα ηελ θισλνπνίεζε ζην θνξέα έθθξαζεο pqe-30: Σν απνκνλσκέλν πιαζκίδην θαη ν θνξέαο pqe-30 ππέζηεζαλ πέςε κε ηα ίδηα πεξηνξηζηηθά έλδπκα. Μεηά απφ ειεθηξνθφξεζε ζε πεθηή αγαξφδεο, ηα θαηάιιεια ηκήκαηα θαζαξίζηεθαλ απφ απηή θαη ελψζεθαλ κεηαμχ ηνπο ελδπκαηηθά, πξηλ απφ ην κεηαζρεκαηηζκφ ζε TOP10. Αλίρλεπζε ζεηηθψλ θιψλσλ πξαγκαηνπνηήζεθε θαη πάιη θαη ην πιαζκίδην κε ηε ζσζηή αιιεινπρία κεηαζρεκαηίζηεθε ζε βαθηήξηα έθθξαζεο Μ15. Έθθξαζε-Καζαξηζκφο Βαθηεξηαθή θαιιηέξγεηα πξαγκαηνπνηήζεθε θαη επαγσγή ηεο έθθξαζεο κε isopropyl β-d-1- thiogalactopyranoside (IPTG), αθνινπζνχκελε απφ πιχζηκν θαη δηάζπαζε ησλ θπηηάξσλ θαη απνκφλσζε ηεο πξσηεΐλεο απφ ηα έγθιεηζηα κε ηε ρξήζε ρξσκαηνγξαθίαο ζπγγελείαο ζε ζηήιε ληθειίνπ (Ni-NTA) ζε απνδηαηαθηηθέο ζπλζήθεο, ζχκθσλα κε ηηο νδεγίεο ηεο QIAGEN. Μεηά απφ αλαδίπισζε ηεο πξσηεΐλεο θαηά ηε δηαπίδπζε ππφ ηελ παξνπζία γινπηαζεηφλεο (ζπλδπαζκφο αλεγκέλεο θαη νμεηδσκέλεο κνξθήο), αθνινχζεζε πεξαηηέξσ θαζαξηζκφο κε ρξσκαηνγξαθία αληαιιαγήο αληφλησλ ζε ζηήιε Mono Q (GE Healthcare). 52

53 Πξνεηνηκαζία ηνπ C3b γηα ηηο κειέηεο πξόζδεζεο θαη θξπζηάιισζεο κε ην SCIN Απνκφλσζε θαη θαζαξηζκφο ηνπ C3 απφ αλζξψπηλν πιάζκα: Η κέζνδνο γηα ηελ απνκφλσζε ηνπ C3 απφ αλζξψπηλν πιάζκα είλαη κηα πξνζαξκνγή ηεο κεζφδνπ θαζαξηζκνχ ζε έλα βήκα, απφ κηθξφ φγθν νξνχ, κε ηε ζηήιε ρξσκαηνγξαθίαο αληαιιαγήο αληφλησλ Mono Q (91): Μηα ζηήιε κε πιηθφ αληαιιαγήο αληφλησλ Source 15S (GE Healthcare), φγθνπ πεξίπνπ 380 ml εηνηκάζηεθε γηα θαζαξηζκφ απφ έλα κέηξην φγθν πιάζκαηνο (~100 ml). ια ηα βήκαηα έγηλαλ ζηνπο 4 o C. Μεηά ηελ πξφζζεζε αλαζηνιέσλ πξσηεαζψλ (ηειηθέο ζπγθεληξψζεηο: 10 mm ethylenediaminetetraacetic acid (EDTA), 10 mm Benzamidine- HCl, 0.01% NaN 3 θαη 10 mm phenylmethanesulfonylfluoride - PMSF) ζην πιάζκα, αθνινχζεζε θαζίδεζε ησλ πξσηετλψλ κε ηελ αξγή πξφζζεζε δηαιχκαηνο 60% polyethylene glycol (PEG) κνξηαθνχ βάξνπο Da θαη ζπλερή αλάδεπζε, κέρξη ηειηθήο ζπγθέληξσζεο 5% w/v. Έπεηηα απφ αλάδεπζε γηα επηπιένλ ιεπηά, αθνινχζεζε θπγνθέληξεζε (8000 rpm, 30min). Σν ππεξθείκελν κεηαθέξζεθε ζε λέν δνρείν γηα επαλάιεςε ηεο θαζίδεζεο κε PEG (κέρξη ηειηθήο ζπγθέληξσζεο 15% w/v απηή ηε θνξά). Σν ίδεκα ηεο δεχηεξεο απηήο θπγνθέληξεζεο επαλαδηαιπηνπνηήζεθε ζην δηάιπκα εμηζζνξφπεζεο ηεο ζηήιεο (Α: 3 mm KH 2 PO 4, 50 mm NaCl, ph 7,4) θαη αθνινχζεζε ν θαζαξηζκφο κε ηε ρξήζε ηεο ζηήιεο Source 15S. Σν πξφγξακκα έθινπζεο είρε σο εμήο: απφ 0 55 % δηαιχκαηνο Β (3 mm KH 2 PO 4, 240 mm NaCl, ph 7,4) ζε 5 φγθνπο ζηήιεο θαη απφ % δηαιχκαηνο Β ζε 15 φγθνπο ζηήιεο. Σα θιάζκαηα πνπ πεξηείραλ C3 ζπγθεληξψζεθαλ, ππέζηεζαλ δηαπίδπζε ζε 5 mm 2-(Nmorpholino)ethanesulfonic acid (MES), ph 6,0, γηα ηελ θαζίδεζε ηεο πξσηεΐλεο θαη ην ίδεκα πιχζεθε ζην ίδην δηάιπκα δχν θνξέο. Πξνεηνηκαζία ηνπ C3b απφ ην C3: Σν C3b εηνηκάζηεθε κε ηε κέζνδν πνπ έρεη πεξηγξαθεί (92) κε κηθξέο αιιαγέο. πγθεθξηκέλα, ην πιηθφ activated thiol sepharose (ATS, GE Healthcare) μεπιχζεθε πξψηα κε λεξφ δηακέζνπ γπάιηλνπ θίιηξνπ (1 gr ζθφλεο δίλεη 4 ml φηαλ βξέρεηαη θαη 1 ml βξεγκέλνπ πιηθνχ είλαη αξθεηφ γηα θαζαξηζκφ 6 mg C3b) θαη κεηά κεηαθέξζεθε ζε πιαζηηθή θνιψλα. Σν C3 (πνπ ήηαλ ζε δηάιπκα MES) θπγνθεληξήζεθε, επαλαδηαιπηνπνηήζεθε ζε 10 mm θσζθνξηθφ λάηξην, ph 7,5, 150 mm NaCl (PBS) κε 10 mm EDTA (φγθνο έσο θαη 2 θνξέο ηνλ φγθν ηεο ζηήιεο) θαη πξνζηέζεθε ζηε ζηήιε. Έπεηηα πξνζηέζεθε ηξπςίλε (0,1% w/w ζε ζρέζε κε ην C3) γηα ηελ πεξηνξηζκέλε πέςε ηνπ C3 θαη ηελ πξνζθφιιεζε ζηηο ελεξγέο νκάδεο ζείνπ ηνπ ATS. Μεηά απφ επψαζε γηα 15 ιεπηά κε αλάδεπζε, πξνζηέζεθε ν αλαζηνιέαο ηεο ηξπςίλεο soybean trypsin 53

54 inhibitor (SBTI, 0,5% w/w ζε ζρέζε κε ην C3, δειαδή 5 θνξέο πεξίζζεηα ζε ζρέζε κε ηελ ηξπςίλε) θαη ε αλάδεπζε ζπλερίζηεθε γηα 2 αθφκα ψξεο. Ακέζσο κεηά, ε ζηήιε μεπιχζεθε εθηελψο κε PBS πξηλ απφ ηελ έθινπζε ηνπ C3b κε δηάιπκα 10mM L-θπζηεΐλεο, ph 7,0. Σέινο, αθνινχζεζε δηαπίδπζε ηνπ C3b ζε PBS, αιθπιίσζε κε ηελ επψαζε κε 100 mm iodoacetamide γηα 30 ιεπηά ζηνλ πάγν θαη μαλά δηαπίδπζε ζε PBS. Λνηπέο πξσηεΐλεο Οη ππφινηπεο πξσηεΐλεο πνπ ρξεζηκνπνηήζεθαλ γηα ηηο αλάγθεο ηεο παξνχζαο δηαηξηβήο παξάρζεθαλ απφ ζπλεξγάηεο θαη ζπλαδέιθνπο θαη νη δηαδηθαζίεο πεξηγξάθνληαη ζηα αληίζηνηρα άξζξα κνπ. Αθαίξεζε ηνπ FD από αλζξώπηλν πιάζκα 23,5 gr ζηεγλνχ πιηθνχ Biorex 70 (Bio-Rad) δπγίζηεθαλ, γηα λα δψζνπλ πεξίπνπ 40 ml φηαλ βξαρνχλ ζχκθσλα κε ηηο νδεγίεο ηνπ θαηαζθεπαζηή θαη ηνπνζεηήζεθαλ ζε δνρείν δέζεσο. Γηα ηελ εμηζνξξφπεζε ηνπ πιηθνχ 200 ml ξπζκηζηηθνχ δηαιχκαηνο veronal (3,2 mm βαξβηηνπξηθφ νμχ, 1,8 mm βαξβηηνπξηθφ λάηξην, ph 7.4, 75 mm NaCl (VBS)) πξνζηέζεθαλ ζην δνρείν δέζεσο θαη, κεηά απφ αλάκημε, απηφ αθέζεθε λα θαζηδάλεη ζηνπο 4 ν C. Σν ππεξθείκελν δηάιπκα αθαηξέζεθε θαη λέν πξνζηέζεθε θαη αλακίρζεθε κε ην πιηθφ γηα ηελ επαλάιεςε ηεο δηαδηθαζίαο δχν αθφκα θνξέο. Έπεηηα ην πιηθφ αλακίρζεθε κε ιίγν απφ ην δηάιπκα γηα λα γίλεη δπλαηή ε κεηαθνξά ζε γπάιηλε θνιψλα ηεο Bio-Rad, γηα ηε δεκηνπξγία ηεο ζηήιεο ρξσκαηνγξαθίαο πνπ είρε δηαζηάζεηο 2 Υ 20 cm. Αλζξψπηλν πιάζκα είρε ζπιιερζεί απφ πγηή δφηε ππφ ηελ παξνπζία ηεο αληηπεθηηθήο νπζίαο EDTA ε νπνία αλαζηέιιεη επίζεο ηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο.σν ππφινηπν ξπζκηζηηθφ δηάιπκα αθέζεθε λα ηξέμεη έμσ απφ ηε ζηήιε θαη ακέζσο πξνζηέζεθε κε πξνζνρή ην πιάζκα ρσξίο λα δηαηαξαρζεί ην πιηθφ ηεο ζηήιεο. Η ζπιινγή θιαζκάησλ έγηλε κε βάζε ηε ρξσκαηνκεηξηθή δνθηκαζία, φπνπ ιίγα κηθξφιηηξα απφ ην θιάζκα αλακηγλχνληαη κε ην δηάιπκα Protein assay ηεο Bio-Rad αξαησκέλν 1:5 ζε λεξφ θαη αιιαγή ηνπ ρξψκαηνο απφ θαθέ ζε κπιε ζεκαίλεη παξνπζία πξσηεΐλεο. ηαλ ην πιάζκα εηζήιζε πιήξσο ζηε ζηήιε, λέν δηάιπκα VBS πξνζδέζεθε γηα ην μέπιπκά ηεο απφ ηηο πξσηεΐλεο. Πεξίπνπ 25 ml ησλ θιαζκάησλ ήηαλ θηηξηλσπά θαη είραλ πςειφηεξε ζπγθέληξσζε πξσηετλψλ, ελψ πεξίπνπ 15 ml πξηλ θαη κεηά απφ ηα θηηξηλσπά ήηαλ πην αξαησκέλα. Σα ηειεπηαία ζπγθεληξψζεθαλ ζε 1 ml κε θπγνθέληξεζε ζε θσληθφ ζσιήλα δηακέζνπ θίιηξνπ κε φξην κάδαο 10 kda θαη πξνζηέζεθαλ ζηα 25 ml ηνπ πην ζπγθεληξσκέλνπ δείγκαηνο. Γηαπίδπζε αθνινχζεζε ζε VBS ρξεζηκνπνηψληαο εκηδηαπεξαηή κεκβξάλε κε φξην κάδαο 3,5 kda. Η δηαπίδπζε έγηλε γηα πεξίπνπ 16 ψξεο ζηνπο 4 ν C. (93) Γηα 54

55 ηελ πξνεηνηκαζία ζεηηθνχ κάξηπξα κηα κηθξή πνζφηεηα ηνπ αξρηθνχ πιάζκαηνο πνπ δελ πέξαζε κέζα απφ ηε ζηήιε ππέζηε δηαπίδπζε κε ηνλ ίδην ηξφπν. Βηνρεκηθά πεηξάκαηα Γνθηκαζίεο αλαζύζηαζεο ηεο ιεηηνπξγηθόηεηαο ηεο ελαιιαθηηθήο νδνύ ζε αλζξώπηλν πιάζκα από ην νπνίν έρεη αθαηξεζεί ν FD Γνθηκαζία ηύπνπ ELISA ελαπόζεζεο ηνπ C3b Δπηβεβαίσζε ηεο απψιεηαο ελεξγφηεηαο ηεο ελαιιαθηηθήο νδνχ γηα ην πιάζκα πνπ πέξαζε απφ ηε ζηήιε Biorex 70 (ειεχζεξν απφ FD): Δπίζηξσζε ηνπ πηάηνπ ELISA κε 40 κg/ml ιηπνπνιπζαθραξίηε (LPS) ζε 10mM θσζθνξηθνχ λαηξίνπ, ph 7.4, 150 mm NaCl (PBS) ηεο S. typhosa έγηλε γηα 2 ψξεο ζε ζεξκνθξαζία δσκαηίνπ ή γηα 16 ψξεο ζηνπο 4 o C (50 κl αλά πεγαδάθη). (Σα ππφινηπα βήκαηα έγηλαλ ζε ζεξκνθξαζία δσκαηίνπ.) Έπεηηα απφ πιχζηκν κε PBS κε 0,05% απνξξππαληηθνχ Tween 20 (PBST) (200 κl αλά πεγαδάθη) δχν θνξέο, δηάιπκα αιβνπκίλεο νξνχ βνδηνχ (bovine serum albumin BSA) 1% ζε PBS επσάζηεθε γηα κία ψξα (200 κl αλά πεγαδάθη). Μεηά απφ δχν πιπζίκαηα, πξνζηέζεθαλ ηα δηαθνξεηηθά δείγκαηα πιάζκαηνο (ειεχζεξν απφ FD, ζεηηθφο κάξηπξαο θαη ειεχζεξν απφ FD κε ηελ πξνζζήθε αλαζπλδπαζκέλνπ FD αγξίνπ ηχπνπ) θαη έγηλε δηαδνρηθή αξαίσζε 1:1 κέζα ζε VBS κε 5 mm MgCl 2 θαη 5 mm ethylene glycol tetraacetic acid (VBS-MgEGTA) μεθηλψληαο απφ 1:2,5 (50 κl αλά πεγαδάθη). Ωο αξλεηηθφο κάξηπξαο ιεηηνχξγεζαλ νξηζκέλα πεγαδάθηα φπνπ δελ πξνζηέζεθε θαζφινπ πιάζκα. Ο ζπλδπαζκφο ηφλησλ Mg 2+ θαη EGTA, επηηξέπεη ηελ ελεξγνπνίεζε ηεο ελαιιαθηηθήο νδνχ γηα ηελ ελαπφζεζε ηνπ C3b ζην πηάην, αιιά φρη ηεο θιαζζηθήο. Η θιαζζηθή νδφο ρξεηάδεηαη θαη ηφληα Ca 2+, ηα νπνία εδψ παγηδεχνληαη απφ ην EGTA. Σν FD πξνζηέζεθε ζηε θπζηνινγηθή ζπγθέληξσζε ζηελ νπνία ππάξρεη ζην πιάζκα (80 nm) γηα ηε ζπγθεθξηκέλε αξρηθή αξαίσζε (80 : 2,5 = 32 nm). Μεηά απφ επψαζε κίαο ψξαο θαη δχν πιπζίκαηα, αθνινχζεζε επψαζε 30 ιεπηψλ κε πνιπθισληθφ αληίζσκα έλαληη ηνπ αλζξψπηλνπ C3, ην νπνίν είλαη πξνζδεδεκέλν κε ππεξνμεηδάζε (horseradish peroxidase HRP) απφ ηελ MP Biomedicals, LLC. Η αξαίσζε ηνπ αληηζψκαηνο ήηαλ 1:1000 ζην δηάιπκα ηνπ BSA (50 κl αλά πεγαδάθη). Σξία πιπζίκαηα αθνινχζεζαλ θαη εκθάληζε ηνπ απνηειέζκαηνο κέζσ ηνπ ππνζηξψκαηνο ηεο ππεξνμεηδάζεο 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS). πγθεθξηκέλα, 10 ml δηαιχκαηνο 0,1Μ θηηξηθνχ λαηξίνπ κε ph 4,3 αλακίρζεθαλ κε 5 mg ABTS θαη 10κl 30% H 2 O 2 κφιηο πξηλ ηε ρξήζε θαη 50 κl πξνζηέζεθαλ αλά πεγαδάθη. Μέηξεζε ηεο απνξξφθεζεο ζηα 405nm αθνινχζεζε θαη αλάιπζε ησλ απνηειεζκάησλ κε ηε 55

56 ρξήζε Excell. Μηα ζρεκαηηθή αλαπαξάζηαζε ηεο δνθηκαζίαο απηήο θαίλεηαη παξαθάησ (βι. ρήκα 1). Γνθηκαζία αλαζχζηαζεο ηεο ιεηηνπξγηθφηεηαο ηεο ελαιιαθηηθήο νδνχ: Η δνθηκαζία απηή έγηλε φπσο ε παξαπάλσ κε ηε δηαθνξά φηη, ζην βήκα πνπ πξνζηίζεηαη ην πιάζκα, έγηλε αξρηθά δηαδνρηθή αξαίσζε FD αγξίνπ ηχπνπ θαη δηαθφξσλ κεηαιιαγκάησλ, μεθηλψληαο απφ ζπγθέληξσζε πνπ δίλεη ηειηθή ζπγθέληξσζε ηέζζεξηο θνξέο ηε θπζηνινγηθή ηνπ πιάζκαηνο. Έπεηηα πξνζηέζεθε παληνχ ίζνο φγθνο πιάζκαηνο αξαησκέλνπ 1:5 γηα ηειηθή αξαίσζε 1:10 (60 κl ζπλνιηθά αλά πεγαδάθη). Ωο αξλεηηθφο κάξηπξαο ιεηηνχξγεζαλ νξηζκέλα πεγαδάθηα φπνπ δελ πξνζηέζεθε θαζφινπ πιάζκα, θαζψο θαη πεγαδάθηα φπνπ πξνζηέζεθε ην πιάζκα ζε ηειηθή αξαίσζε 1:10, ρσξίο FD (ππφινηπε ελεξγνπνίεζε). ρήκα 1: Αλαπαξάζηαζε ηεο δνθηκαζίαο ελεξγνπνίεζεο ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο ζε πηάην ELISA (LPS: ιηπνπνιπζαθραξίηεο, BSA: αιβνπκίλε νξνχ βνδηνχ: HRP: ππεξνμεηδάζε ηεο ξαπαλίδαο). Αηκνιπηηθή δνθηκαζία Πξνεηνηκαζία εξπζξνθπηηάξσλ: Πνζφηεηα αίκαηνο θνπλειηνχ (απφ ηελ Cocalico Biologicals, Inc, ζπιιεγκέλν ππφ ηελ παξνπζία EDTA) θπγνθεληξήζεθε γηα ηελ θαζίδεζε ησλ εξπζξνθπηηάξσλ ηα νπνία πιχζεθαλ κε πεξίζζεηα δηαιχκαηνο GVB-MgEGTA (3,2 mm βαξβηηνπξηθφ νμχ, 1,8 mm βαξβηηνπξηθφ λάηξην, ph 7.4, 140 mm NaCl, 0.1% δειαηίλε, 2,5 mm MgCl 2 θαη 2,5 mm EGTA) κέρξη ην ππεξθείκελν ηεο θπγνθέληξεζεο λα είλαη δηάθαλν. (Κφθθηλν ρξψκα δειψλεη ηελ ιχζε ησλ εξπζξνθπηηάξσλ.) Έπεηηα ν φγθνο ηνπ ελαησξήκαηνο πξνζαξκφζηεθε έηζη ψζηε αξαίσζε 1:30 απηνχ ζε λεξφ λα δίλεη απνξξφθεζε ίζε κε 1 ζηα 405nm, ην νπνίν αληηζηνηρεί ζε 10 9 θχηηαξα αλά ml. Δχξεζε ηνπ φγθνπ ηνπ πιάζκαηνο πνπ πξνθαιεί 50% αηκφιπζε: 56

57 ε πηάην ELISA κε θσληθφ πάην αλακίρζεθαλ: 10κl ελαησξήκαηνο εξπζξνθπηηάξσλ θνπλειηνχ, αλζξψπηλν πιάζκα (ζεηηθφο κάξηπξαο θαη πιάζκα ειεχζεξν απφ FD ζην νπνίν πξνζηέζεθε αλαζπλδπαζκέλν FD αγξίνπ ηχπνπ ζε θπζηνινγηθή ζπγθέληξσζε) φγθνπ πνπ θπκάλζεθε απφ 0-10κl θαη GVB-MgEGTA κέρξη ηειηθφ φγθν 100κl. Σν πεγαδάθη κε κεδεληθφ φγθν πιάζκαηνο απνηέιεζε ηνλ αξλεηηθφ κάξηπξα ηεο δνθηκαζίαο, ελψ ν ζεηηθφο κάξηπξαο ήηαλ έλα πεγαδάθη κε 10 κl ελαησξήκαηνο εξπζξνθπηηάξσλ θαη 90 κl λεξνχ. Σν ηειεπηαίν ζπλεπάγεηαη 100% νζκσηηθή ιχζε ησλ εξπζξνθπηηάξσλ. Δπψαζε αθνινχζεζε γηα 30 ιεπηά ζηνπο 37 o C, κεηά απφ ηελ νπνία ε αληίδξαζε ζηακάηεζε κε ηελ πξνζζήθε 200κl GVB-EDTA (3,2 mm βαξβηηνπξηθφ νμχ, 1,8 mm βαξβηηνπξηθφ λάηξην, ph 7.4, 140 mm NaCl, 0.1% δειαηίλε, 20 mm EDTA) αλά πεγαδάθη. Φπγνθέληξεζε αθνινχζεζε γηα ηελ θαζίδεζε ησλ εξπζξνθπηηάξσλ πνπ δελ έρνπλ ζπάζεη θαη έπεηηα, κέξνο ηνπ ππεξθεηκέλνπ κεηαθέξζεθε ζε λέν πηάην ELISA κε επίπεδν πάην γηα ηε κέηξεζε ηεο απνξξφθεζεο ζηα 405 nm. Αλάιπζε ηνπ απνηειέζκαηνο θαηέδεημε ηνλ φγθν ηνπ πιάζκαηνο πνπ πξνθαιεί 50% αηκφιπζε. Αηκνιπηηθή δνθηκαζία αλαζχζηαζεο ηεο ιεηηνπξγηθφηεηαο ηεο ελαιιαθηηθήο νδνχ: Γηαδνρηθή αξαίσζε FD αγξίνπ ηχπνπ θαη κεηαιιαγκάησλ έγηλε ζε φγθν 50κl GVB-MgEGTA αλά πεγαδάθη ζε πηάην ELISA κε θσληθφ πάην. Αθνινχζεζε πξνζζήθε 50κl ελαησξήκαηνο εξπζξνθπηηάξσλ (10κl) αλακεκηγκέλσλ κε ηελ πνζφηεηα πιάζκαηνο (ειεχζεξνπ απφ FD) πνπ πξνζδηνξίζηεθε παξαπάλσ, αξαησκέλσλ ζε GVB-MgEGTA. Η αξρηθή ζπγθέληξσζε ησλ FD αληηζηνηρεί ζε ηέζζεξηο θνξέο ηε θπζηνινγηθή γηα ηε ζπγθεθξηκέλε πνζφηεηα πιάζκαηνο. Η επψαζε θαη ηα ινηπά βήκαηα αθνινχζεζαλ φπσο παξαπάλσ. Γνθηκαζία ηύπνπ ELISA ελαπόζεζεο ηνπ C3b, ε νπνία μεθηλά κέζσ ηεο θιαζζηθήο νδνύ. Η κέζνδνο απηή έρεη πεξηγξαθεί πξνεγνπκέλσο (94) θαη ρξεζηκνπνηήζεθε εδψ κε κηθξέο ηξνπνπνηήζεηο (ρήκα 2): Αιβνπκίλε ηνπ ιεπθνχ κέξνπο απγψλ θνηφπνπινπ (ovalbumin OVA) ζε πνζνζηφ 1% ζε PBS ρξεζηκνπνηήζεθε γηα ηελ επίζηξσζε ηνπ πηάηνπ (50κl αλά πεγαδάθη) γηα 2 ψξεο ζε ζεξκνθξαζία δσκαηίνπ ή γηα 16 ψξεο ζηνπο 4 o C. (Σα ππφινηπα βήκαηα έγηλαλ ζε ζεξκνθξαζία δσκαηίνπ.) Μεηά απφ δχν πιπζίκαηα κε 200κl PBST αλά πεγαδάθη, πξνζηέζεθε δηάιπκα αιβνπκίλεο νξνχ βνδηνχ (bovine serum albumin BSA) 1% ζε PBS θαη επσάζηεθε γηα κία ψξα (200 κl αλά πεγαδάθη). Έπεηηα πξνζηέζεθε πνιπθισληθφο αληη-νξφο θνπλειηνχ θαηά ηεο OVA αξαησκέλνο 1:1000 ζην δηάιπκα ηνπ BSA (50κl αλά πεγαδάθη) θαη έγηλε επψαζε γηα 30 ιεπηά, θαηά ηελ νπνία ζρεκαηίδεηαη ζχκπινθν αληηγφλνπαληηζψκαηνο ην νπνίν ελεξγνπνηεί ηελ θιαζζηθή νδφ. Γχν πιπζίκαηα αθνινχζεζαλ μαλά. Σα 57

58 αλάινγα ηεο compstatin (πνπ είραλ δηαιπηνπνηεζεί ζε λεξφ θαη ην ph ηνπο είρε ξπζκηζηεί θνληά ζην 7,0-7,4) πξνζηέζεθαλ θαη έγηλε δηαδνρηθή αξαίσζε ζε λεξφ (30κl αλά πεγαδάθη). Ακέζσο κεηά, ίζνο φγθνο πιάζκαηνο πγηνχο δφηε (πνπ έρεη ζπιιερζεί κε ην αληηπεθηηθφ lepirudin, ην νπνίν δελ αλαζηέιιεη ην ζπκπιήξσκα) αξαησκέλνπ 1:40 ζε 2Υ VBS ++ (6,4 mm βαξβηηνπξηθφ νμχ, 3,6 mm βαξβηηνπξηθφ λάηξην, ph 7.4, 150 mm NaCl, 1 mm MgCl 2 θαη 0.9 mm CaCl 2 ) πξνζηέζεθε θαη αλαθαηεχζεθε (ηειηθή αξαίσζε: 1:80). Ωο αξλεηηθφο κάξηπξαο ιεηηνχξγεζαλ πεγαδάθηα φπνπ πξνζηέζεθε κφλν ην δηάιπκα, ελψ σο ζεηηθφο πεγαδάθηα φπνπ πξνζηέζεθε πιάζκα αιιά φρη compstatin (100% ελεξγνπνίεζε). Δπψαζε 15 ιεπηψλ έγηλε γηα λα επηηξέςεη ηελ ελεξγνπνίεζε θαη ηνλ πνιιαπιαζηαζκφ ηνπ ζπκπιεξψκαηνο. Μεηά απφ δχν πιπζίκαηα, ε αλίρλεπζε ηνπ C3b πνπ είρε ελαπνηεζεί έγηλε κε ην αληίζσκα έλαληη ηνπ αλζξψπηλνπ C3 HRP θαη ηελ εκθάληζε κε ην ππφζηξσκα ABTS φπσο θαη παξαπάλσ. Σα απνηειέζκαηα εθθξάζηεθαλ σο έλα δηάγξακκα ησλ ζπγθεληξψζεσλ έλαληη ηνπ πνζνζηνχ αλαζηνιήο θαη πξνζνκνηψζεθαλ ζε κηα ζηγκνεηδή θακπχιε κηαο ινγηζηηθήο εμίζσζεο δφζεο-απφθξηζεο κε ηε ρξήζε ηνπ Origin. ρήκα 2: Αλαπαξάζηαζε ηεο δνθηκαζίαο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο μεθηλψληαο απφ ηελ θιαζζηθή νδφ ζε πηάην ELISA (OVA: αιβνπκίλε απγνχ θνηνπνχινπ, BSA: αιβνπκίλε νξνχ βνδηνχ: HRP: ππεξνμεηδάζε ηεο ξαπαλίδαο). Μειέηεο πξσηετληθώλ αιιειεπηδξάζεσλ κε SPR Γεληθά Οη ζπζθεπέο SPR πνπ ρξεζηκνπνηήζεθαλ ήηαλ νη: Biacore 2000 θαη Biacore 3000 ηεο GE Healthcare θαη ην ProteOn XPR36 ηεο Bio-Rad. ηελ πεξίπησζε ηνπ Biacore, ζρεκαηίδνληαη ηέζζεξηο παξάιιεινη δηάδξνκνη νη νπνίνη κπνξεί λα ηξέρνπλ θαηά ζεηξά (1-4) ή ζε δπλδπαζκνχο ησλ δχν, σο εμήο: 1-2 θαη 3-4 (αιιά φρη 1-3, 2-4, θηι) ή ν θαζέλαο μερσξηζηά (1 ή 2 ή 3 ή 4). (ρήκα 3α) Ο έλαο δηάδξνκνο ρξεζηκνπνηείηαη σο αλαθνξά θαη νη ππφινηπνη ηξεηο κπνξεί λα ρξεζηκνπνηεζνχλ γηα κειέηε αιιειεπηδξάζεσλ. Αληίζεηα ζην ProteOn XPR36, 58

59 ππάξρνπλ έμη θάζεηνη δηάδξνκνη θαη έμη νξηδφληηνη, νη νπνίνη ζπλαληψληαη ζε 36 δηαθνξεηηθά ζεκεία. Η ξνή κπνξεί λα γίλεηαη ζε θάζε ζπγθεθξηκέλε ζηηγκή είηε ζηελ θάζεηε είηε ζηελ νξηδφληηα θαηεχζπλζε παξάιιεια ζηνπο έμη δηαδξφκνπο (ζε αληίζεζε κε ηελ θαηά ζεηξά ξνή ηνπ Biacore) θαη θαηά ζχκβαζε ε θάζεηε ρξεζηκνπνηείηαη γηα ηελ επίζηξσζε ησλ πξσηετλψλπξνζδεηψλ, ελψ ε νξηδφληηα γηα ηε ξνή ησλ αλαιπφκελσλ πξσηετλψλ. Απηφ πξνζθέξεη ηε δπλαηφηεηα γηα κειέηε πεξηζζφηεξσλ αιιειεπηδξάζεσλ, κέρξη θαη 36. Παξάιιεια, δελ είλαη αλαγθαίν λα εμαηξεζεί έλαο δηάδξνκνο σο αλαθνξά, εθφζνλ, ηα ζεκεία αλάκεζα απφ ηα ζεκεία ζπλάληεζεο ησλ θαζέησλ θαη νξηδνληίσλ δηαδξφκσλ κπνξνχλ λα ρξεζηκνπνηεζνχλ γηα απηφ ην ζθνπφ. (ρήκα 3β) ρήκα 3: Αλαπαξάζηαζε ησλ δηαδξφκσλ ξνήο ηνπ Biacore (α, θαη ηνπ ProteOn XPR36 (β, Η ζεξκνθξαζία γηα φιεο ηηο κειέηεο πξσηετληθψλ αιιειεπίδξαζεσλ κε SPR ήηαλ 25 o C. Σα δηαιχκαηα ξνήο πνπ ρξεζηκνπνηήζεθαλ ήηαλ: HBS-Mg (10 mm HEPES, ph 7,4, 150 mm NaCl κε 1 mm MgCl 2, 0,005% Tween-20) ή HBS-EP (Biacore: 10 mm HEPES, ph 7,4, 150 mm NaCl κε 1 mm EDTA, 0,005% Tween-20) ή PBS-P (10 mm θσζθνξηθφ λάηξην, 150 mm NaCl κε 0,005% Tween-20). Γηα αλαγέλλεζε ηεο επηθάλεηαο ρξεζηκνπνηήζεθαλ ηα δηαιχκαηα: 2Μ NaCl, 1M NaCl, 0,2 M sodium carbonate, ph 9,0. Η έλεζε ησλ δηαιπκάησλ απηψλ γηλφηαλ γηα 30 δεπηεξφιεπηα κε απμεκέλν ξπζκφ ξνήο 20 κl/min θαη άλσ. Πξνεηνηκαζία επηθάλεηαο κε C3b: Γηα ηελ εηδηθή θαη πξνζαλαηνιηζκέλε πξνζθφιιεζε ηνπ C3b ζην ηζηπ κε θπζηνινγηθή θαηεχζπλζε ρξεζηκνπνηήζεθε C3b ην νπνίν είρε βηνηηλπιησζεί ζην ζεηνεζηεξηθφ δεζκφ. Απηφ πξνζδέζεθε ζε ηζηπ κε επηθάλεηα ζηξεπηαδίλεο φπσο ην SA (GE Healthcare) ή ζε ηζηπ κε επηθάλεηα λνπηξαβηδίλεο (neutravidin - NLC ηεο Bio-Rad). Η πνιχ πςειή ζπγγέλεηα ηεο βηνηίλεο κε ηε ζηξεπηαβηδίλε / λνπηξαβηδίλε νδεγεί ζηε δεκηνπξγία κηαο πνιχ ζηαζεξήο επηθάλεηαο C3b. Σν CAPture (GE Healthcare) είλαη έλα ηξίην είδνο ηζηπ, ζην νπνίν πξνζηίζεηαη ζηξεπηαβηδίλε 59

60 ζχκθσλα κε ηηο νδεγίεο ηνπ θαηαζθεπαζηή θαη είλαη θαηαζθεπαζκέλν έηζη ψζηε λα είλαη δπλαηφ λα ρξεζηκνπνηεζεί μαλά θαη μαλά γηα ηελ επίζηξσζε κηαο βηνηηλπιησκέλεο πξσηεΐλεο: Σν ηζηπ έρεη κηα επηθάλεηα επηζηξσκέλε κε λνπθιετθά νμέα θαη ε αληίζηνηρε ζηξεπηαβηδίλε είλαη ζπλδεδεκέλε κε ην ζπκπιεξσκαηηθφ λνπθιετθφ νμχ. Οπφηε, φηαλ ελχεηαη ε ζηξεπηαβηδίλε, απηή πξνζθνιιάηαη ζηαζεξά ζηελ επηθάλεηα κέζσ ηεο δεκηνπξγίαο δηπιήο έιηθαο ησλ λνπθιετθψλ νμέσλ θαη έπεηηα είλαη δπλαηή ε επίζηξσζε κε ηε βηνηηλπιησκέλε πξσηεΐλε. Μεηά ηε ρξήζε ηεο επηθάλεηαο, κπνξεί θαλείο λα αθαηξέζεη ηειείσο φιεο ηηο πξσηεΐλεο απφ ην ηζηπ κε έλεζε ελφο ζπλδπαζκνχ απνδηαηαθηηθψλ νπζηψλ (6 Μ guanidine-hcl θαη 250 mm NaOH), αθήλνληαο κφλν ηελ επηθάλεηα ησλ λνπθιετθψλ νμέσλ. Ωο επηθάλεηα αλαθνξάο ζηελ πεξίπησζε ηνπ CAPture ηζηπ ρξεζηκνπνηείηαη έλαο δηάδξνκνο επηζηξσκέλνο κε ζηξεπηαβηδίλε αιιά φρη πξσηεΐλεπξνζδέηε. Μειέηε απεπζείαο πξόζδεζεο ηνπ FB (ηνπ πιάζκαηνο) θαη ηνπ αλαζπλδπαζκέλνπ ηκήκαηνο Ba ζην C3b Γηα ηε κειέηε απηή ρξεζηκνπνηήζεθε ην Biacore 2000 θαη ε C3b επηθάλεηα δεκηνπξγήζεθε πάλσ ζε ηζηπ επηζηξσκέλν κε ζηξεπηαβηδίλε (ρήκα 4). Σα δηαιχκαηα πνπ ρξεζηκνπνηήζεθαλ ήηαλ ηα HBS-Mg θαη HBS-EP θαη ν ξπζκφο ξνήο 30κl/min. ηελ πεξίπησζε ηνπ FB, ελέζεηο 3 ιεπηψλ πξαγκαηνπνηήζεθαλ ζε εχξνο ζπγθεληξψζεσλ nm γηα ην δηάιπκα HBS-Mg θαη 625 nm 20 µm γηα ην δηάιπκα HBS-EP. Η δηάζηαζε επηηξάπεθε γηα 5 ιεπηά πξηλ απφ ηελ αλαγέλλεζε κε 0,2 sodium carbonate, ph 9,0 θαη 2 M NaCl. ηελ πεξίπησζε ηνπ ηκήκαηνο Ba, ελέζεηο 1 ιεπηνχ πξαγκαηνπνηήζεθαλ ζε εχξνο ζπγθεληξψζεσλ nm, ελψ ε δηάζηαζε επηηξάπεθε γηα 2 ιεπηά πξηλ απφ ηελ αλαγέλλεζε κε 1 M NaCl. Σα ζήκαηα ππέζηεζαλ επεμεξγαζία κε ηε ρξήζε ηνπ Scrubber (BioLogic) γηα ηελ αθαίξεζε ζεκάησλ απφ ηελ επηθάλεηα αλαθνξάο θαη ελέζεσλ δηαιχκαηνο, ελψ ε θηλεηηθή αλάιπζε έγηλε κε ην πξφγξακκα CLAMP. ρήκα 4: Αλαπαξάζηαζε ηεο δνθηκαζίαο SPR ηεο πξφζδεζεο ηνπ FB ή ηνπ Ba φηαλ απηά ελχνληαη θαη ξένπλ πάλσ απφ επηθάλεηα κε αθηλεηνπνηεκέλν C3b. 60

61 Μειέηε απεπζείαο πξόζδεζεο ηνπ αλαζπλδπαζκέλνπ FB ζην C3b κε SPR θαη θηλεηηθή αλάιπζε κνλνύ θύθινπ Γηα ηε κειέηε απηή ρξεζηκνπνηήζεθε ην Biacore 3000 θαη ε C3b επηθάλεηα δεκηνπξγήζεθε πάλσ ζε ηζηπ SA (ρήκα 4). Με δηάιπκα ην HBS-Mg θαη ξπζκφ ξνήο 30 κl αλά ιεπηφ, πξαγκαηνπνηήζεθε θηλεηηθή αλάιπζε κνλνχ θχθινπ, φπνπ νη 5 απμαλφκελεο ζπγθεληξψζεηο ηνπ FB ελχνληαλ ε κία κεηά απφ ηελ άιιε γηα δηάξθεηα δχν ιεπηψλ, ρσξίο αλακνλή κεηά απφ θάζε έλεζε γηα ηελ επηζηξνθή ηνπ ζήκαηνο ζηε βάζε. Γχν θχθινη πξαγκαηνπνηήζεθαλ κε αξαίσζε 1:1 θαη εχξνο ζπγθεληξψζεσλ 2-31 nm θαη nm, κεηά απφ ην ηέινο ησλ νπνίσλ αλαγέλλεζε έγηλε κε 0,2 M sodium carbonate, ph 9,0. Σα ζήκαηα απφ ηελ επηθάλεηα αλαθνξάο θαη ελφο θχθινπ κε ελέζεηο κφλν δηαιχκαηνο αθαηξέζεθαλ απφ ηα πεηξακαηηθά ζήκαηα θαη θηλεηηθή αλάιπζε αθνινχζεζε κε ην πξφγξακκα BIAevaluation (v4, GE Healthcare). πγθεθξηκέλα, ρξεζηκνπνηήζεθε κηα κέζνδνο πξνζνκνίσζεο γηα θηλεηηθή αλάιπζε κνλνχ θχθινπ, ε νπνία πξνζαξκφζηεθε ζε κνληέιν αιιαγήο δηακφξθσζεο απφ έλα αξρηθφ κνληέιν πξφζδεζεο 1:1, ην νπνίν παξείρε ε GE Healthcare, γηα ηελ εμαγσγή ησλ ζηαζεξψλ πξφζδεζεο θαη δηάζηαζεο θαη ηεο ζπγγέλεηαο (k on, k off θαη K D αληνηζηνίρσο). Μειέηε πξόζδεζεο ηνπ FD* ζην FB όηαλ απηό είλαη πξνζδεδεκέλν ζε C3b Γηα ηε κειέηε απηή ρξεζηκνπνηήζεθε ην ProteOn XPR36 θαη ε C3b επηθάλεηα δεκηνπξγήζεθε πάλσ ζε ηζηπ NLC (ρήκα 5). Σν δηάιπκα πνπ ρξεζηκνπνηήζεθε ήηαλ ην HBS-Mg θαη ν ξπζκφο ξνήο ήηαλ 25 κl αλά ιεπηφ. Αξρηθά ελέζεθε ζε φινπο ηνπο δηαδξφκνπο ην κεηάιιαγκα ηνπ FB κε απμεκέλε ελεξγφηεηα (D254G N260D) ζε ζπγθέληξσζε 500 nm γηα 1 ιεπηφ γηα ην ζρεκαηηζκφ ελφο ζηαζεξνχ ζπκπιφθνπ πξν-θνλβεξηάζεο C3bB. Έπεηηα ελέζεθε κηα ζεηξά πέληε ζπγθεληξψζεσλ αλελεξγνχ κεηαιιάγκαηνο FD (S183A, ζπκβνιίδεηαη κε *) κε δηαδνρηθή αξαίσζε 1:4 ( nm). Σν έθην δείγκα πνπ ελέζεθε ήηαλ κφλν δηάιπκα (αξλεηηθφο κάξηπξαο) θαη ρξεζηκνπνηήζεθε γηα ηελ αθαίξεζε ηνπ ζήκαηφο ηνπ απφ ηα ζήκαηα ησλ ππφινηπσλ δεηγκάησλ, αθαηξψληαο έηζη ηελ πηψζε ηνπ ζήκαηνο απφ ηελ αξγή απνζχλδεζε ηνπ FB. Πεξαηηέξσ επεμεξγαζία ησλ ζεκάησλ αθνινχζεζε θαη αθαίξεζε ζεκάησλ απφ ηα ζεκεία αλαθνξάο. Η θηλεηηθή αλάιπζε έγηλε κε ην πξφγξακκα ProteOn Manager (v2, Bio-Rad) κε πξνζνκνίσζε ζην κνληέιν εηερογένειας ηοσ προζδέηη. 61

62 ρήκα 5: Αλαπαξάζηαζε ηεο δνθηκαζίαο SPR ηεο πξφζδεζεο ηνπ FD* ζην FB D254G N260D πνπ έρεη πξψηα πξνζδεζεί ζην C3b. Μειέηε δεκηνπξγίαο ηεο θνλβεξηάζεο C3bBb Γηα ηε κειέηε απηή ρξεζηκνπνηήζεθε ην Biacore 3000, αιιά θαη ην ProteOn XPR36 θαη ε C3b επηθάλεηα δεκηνπξγήζεθε πάλσ ζε ηζηπ SA ή NLC αληίζηνηρα (ρήκα 6). Γηάιπκα ήηαλ ην HBS- Mg θαη ν ξπζκφο ξνήο 10 κl αλά ιεπηφ. Σν FB αγξίνπ ηχπνπ (100 nm) αλακίρζεθε κε ηα δηάθνξα κεηαιιάγκαηα ηνπ FD (100 nm) θαη ηα κίγκαηα απηά ελέζεθαλ γηα 3 ιεπηά. Η θπζηνινγηθή απνδέζκεπζε ηεο θνλβεξηάζεο επηηξάπεθε γηα 3 ιεπηά πξηλ απφ ηελ αλαγέλλεζε ηεο επηθάλεηαο κε ελέζεηο FH (200 nm ζε HBS-EP), γηα επηηάρπλζε ηεο απνδέζκεπζεο ηνπ Bb απφ ην C3b θαη 2M NaCl, γηα ηελ απνδέζκεπζε ηνπ FH απφ ην C3b. Ωο κάξηπξεο ελέζεθαλ επίζεο κφλα ηνπο ην FB θαη ην FD αγξίνπ ηχπνπ (100 nm), ελψ ζε επίπεδν ζρεκαηηζκνχ ηεο θνλβεξηάζεο, ν ζεηηθφο κάξηπξαο ήηαλ ην ελεξγφ κεηάιιαγκα R115C ηνπ FD θαη ν αξλεηηθφο ην αλελεξγφ κεηάιιαγκα FD* S183A. Σα ζήκαηα ππέζηεζαλ επεμεξγαζία κε ηε ρξήζε ηνπ Scrubber (v2.0c, BioLogic Pty, Australia), γηα ηελ αθαίξεζε ζεκάησλ απφ ηελ επηθάλεηα αλαθνξάο θαη ελέζεσλ δηαιχκαηνο. ρήκα 6: Αλαπαξάζηαζε ηεο δνθηκαζίαο SPR ηεο δεκηνπξγίαο ηεο θνλβεξηάζεο C3bBb πάλσ ζε ηζηπ. Έλα κίγκα FB αγξίνπ ηχπνπ θαη δηαθφξσλ κεηαιιαγκάησλ FD ελχεηαη πάλσ απφ επηθάλεηα C3b. Σν FD πξνζδέλεηαη ζην 62

63 FB ην νπνίν πξνζδέλεηαη ζην C3b. ηαλ ην κεηάιιαγκα FD είλαη ελεξγφ, ηφηε θφβεη κεηά ηελ Arg 234 νδεγψληαο ζηελ απνκάθξπλζε ηνπ Ba θαη ην ζρεκαηηζκφ ηεο θνλβεξηάζεο C3bBb. ηνπ FB Μειέηε ελεξγνπνίεζεο ηεο πξν-θνλβεξηάζεο C3bB από ην FD Γηα ηε κειέηε απηή ρξεζηκνπνηήζεθε ην Biacore 3000, ην ηζηπ CAPture θαη ην δηάιπκα HBS- Mg. ε θάζε θχθιν γηλφηαλ επίζηξσζε κε ζηξεπηαβηδίλε θαη έπεηηα κε C3b. Έπεηηα, ζε ξπζκφ ξνήο 10 κl αλά ιεπηφ ελπφηαλ ην κεηάιιαγκα ηνπ FB κε απμεκέλε ελεξγφηεηα (D254G N260D) ζε ζπγθέληξσζε 500 nm γηα 3 ιεπηά. Η θπζηνινγηθή απνδέζκεπζε ηεο πξν-θνλβεξηάζεο επηηξάπεθε γηα ζχληνκν ρξνληθφ δηάζηεκα, κεηά απφ ην νπνίν ελέζεθε έλα απφ ηα κεηαιιάγκαηα ηνπ FD ζε ζπγθέληξσζε 100 nm γηα 2 ιεπηά (ρήκα 7). Η ελεξγνπνίεζε ηεο πξν-θνλβεξηάζεο κέζσ ηεο πέςεο ηνπ FB θαη ηεο απνκάθξπλζεο ηνπ Ba γηλφηαλ νξαηή κέζσ ηεο πηψζεο ηνπ ζήκαηνο. Έλεζε ηνπ FD αγξίνπ ηχπνπ κεηά απφ ην εμεηαδφκελν κεηάιιαγκα επηβεβαίσλε ζε θάζε θχθιν ηελ δπλαηφηεηα γηα ελεξγνπνίεζε ηεο πξν-θνβεξηάζεο. Λφγσ ηεο πνιχ αξγήο απνδέζκεπζεο ηνπ Bb απφ ην C3b (πάλσ απφ 60 ιεπηά) θαη γηα ηελ επηηάρπλζε ηεο πεηξακαηηθήο δηαδηθαζίαο, ζην ηέινο ηνπ θχθινπ γηλφηαλ αλαγέλλεζε ηνπ ηζηπ ζχκθσλα κε ηηο νδεγίεο ηνπ θαηαζθεπαζηή (δεο παξαπάλσ). Έηζη ην ηζηπ ήηαλ έηνηκν μαλά γηα επίζηξσζε κε ζηξεπηαβηδίλε θαη C3b ζηνλ επφκελν θχθιν. Η επεμεξγαζία ησλ ζεκάησλ θαη ν ζεηηθφο θαη αξλεηηθφο κάξηπξαο είλαη ίδηα κε ηελ πξνεγνχκελε κειέηε. ρήκα 7: Αλαπαξάζηαζε ηεο δνθηκαζίαο SPR ηεο ελεξγνπνίεζεο ηεο πξν-θνλβεξηάζεο C3bB πάλσ ζε ηζηπ. Σν FB D254G N260D ελχεηαη πάλσ απφ επηθάλεηα C3b θαη πξνζδέλεηαη ζηαζεξά ζε απηφ (C3bB). Έπεηηα έλα κεηάιιαγκα FD ελχεηαη θαη πξνζδέλεηαη ζην FB. ηαλ ην κεηάιιαγκα FD είλαη ελεξγφ, ηφηε θφβεη κεηά ηελ Arg234 ηνπ FB νδεγψληαο ζηελ απνκάθξπλζε ηνπ Ba θαη ην ζρεκαηηζκφ ηεο ελεξγνχο θνλβεξηάζεο C3bBb. Μειέηε αιιειεπίδξαζεο αλαιόγσλ ηεο compstatin κε ην C3b Γηα ηηο κειέηεο απηέο ρξεζηκνπνηήζεθε ην Biacore Σξεηο C3b επηθάλεηεο κε ππθλφηεηεο ~3000, 4000 θαη 5000 RU δεκηνπξγήζεθαλ πάλσ ζε ηζηπ SA (ρήκα 8). Σν δηάιπκα πνπ ρξεζηκνπνηήζεθε ήηαλ ην PBS-P θαη ν ξπζκφο ξνήο ήηαλ 30 κl αλά ιεπηφ. 63

64 Καηάηαμε αλαιφγσλ Γηα κηα πξψηε θαηάηαμε ησλ αλαιφγσλ 1-5 πξαγκαηνπνηήζεθε ζεηξά ελέζεψλ ηνπο ζε ζπγθέληξσζε 1 κm γηα 2 ιεπηά. Η επεμεξγαζία ησλ δεδνκέλσλ έγηλε κε ηε ρξήζε ηνπ Scrubber γηα ηελ αθαίξεζε ζεκάησλ απφ ηελ επηθάλεηα αλαθνξάο θαη ελέζεσλ δηαιχκαηνο. Δχξεζε θηλεηηθψλ παξακέηξσλ Η κέζνδνο θηλεηηθήο αλάιπζεο κνλνχ θχθινπ ρξεζηκνπνηήζεθε εδψ φπσο θαη ζηελ πεξίπησζε ηεο αιιειεπίδξαζεο FB-C3b. Γηα ηα πεπηίδηα 1-3 πξαγκαηνπνηήζεθαλ ελέζεηο δχν νκάδσλ ζπγθεληξψζεσλ (δηαδνρηθήο αξαίσζεο 1:2): 0,46-37 θαη nm θαη ε απνδέζκεπζε επηηξάπεθε γηα 10 ιεπηά, ελψ γηα ηα πεπηίδηα 4 θαη 5 πξαγκαηνπνηήζεθε κφλν ε πξψηε νκάδα (0,46-37 nm) θαη απνδέζκεπζε 15 ιεπηψλ. Δπίζεο, γηα ηε ζχγθξηζε ησλ πεπηηδίσλ 4 θαη 5 κε ηα αληίζηνηρα αλεγκέλα-αιθπιησκέλα θαη νμεηδσκέλα παξάγσγά ηνπο ρξεζηκνπνηήζεθε ε νκάδα ζπγθεληξψζεσλ nm θαη απνδέζκεπζε 15 ιεπηψλ. Η επεμεξγαζία ησλ δεδνκέλσλ έγηλε αξρηθά κε ην Scrubber γηα ηελ αθαίξεζε ζεκάησλ απφ ηελ επηθάλεηα αλαθνξάο θαη ελέζεσλ δηαιχκαηνο θαη έπεηηα, ε αλάιπζε έγηλε κε ην BIAevaluation γηα ηελ πξνζνκνίσζε ζε κνληέιν κνλνχ θχθινπ γηα πξφζδεζε 1:1 θαη ηελ εμαγσγή ησλ ζηαζεξψλ πξφζδεζεο θαη δηάζηαζεο θαη ηεο ζπγγέλεηαο (k on, k off θαη K D αληνηζηνίρσο). ρήκα 8: Αλαπαξάζηαζε ηεο δνθηκαζίαο SPR ηεο πξφζδεζεο ηεο compstatin ζην αθηλεηνπνηεκέλν C3b. Δπηπηώζεηο έθζεζεο αλαιόγσλ ηεο compstatin ζε αλαγσγηθνύο θαη νμεηδσηηθνύο παξάγνληεο Αλαγσγή: Σα πεπηίδηα 4 θαη 5 εηνηκάζηεθαλ ζε ζπγθέληξσζε 50κM ζην δηάιπκα Α. Tris(2- carboxyethyl)-phosphine (TCEP-HCl) δηαιπηνπνηήζεθε ζε λεξφ θαη πξνζηέζεθε ζηα πεπηίδηα γηα ηειηθή ζπγθέληξσζε 500 θνξέο πάλσ απφ απηή ησλ πεπηηδίσλ. Αλάκεημε θαη επψαζε αθνινχζεζε γηα 90 ιεπηά ζε ζεξκνθξαζία δσκαηίνπ. Γείγκα 1κl αθαηξέζεθε πξηλ θαη θαη κεηά ην TCEP-HCl γηα αλάιπζε κε θαζκαηνζθνπία κάδαο (ΜΑLDI, δεο παξαθάησ). 64

65 Παξαγσγή αλεγκέλνπ θαη αιθπιησκέλνπ πεπηηδίνπ 4: Σν πεπηίδην 4 ζηελ κε θαζαξηζκέλε, αλεγκέλε κνξθή ηνπ δηαιπηνπνηήζεθε ζε έλα ζπλδπαζκφ 100 mm ammonium bicarbonate, ph 7,8 κε 50% δηάιπκα Β (γηα αχμεζε ηεο δηαιπηφηεηαο) ππφ ηελ παξνπζία TCEP-HCl ζε 10 θνξέο κνξηαθή πεξίζζεηα. Σν TCEP-HCl πξνζηέζεθε δηφηη είρε παξαηεξεζεί φηη ην αλεγκέλν πεπηίδην 4 ηείλεη λα θπθινπνηείηαη ηπραία κε ην ζρεκαηηζκφ δηζνπιθηδηθνχ ζε βαζηθφ ph. Έπεηηα πξνζηέζεθε iodoacetamide ζε 20 θνξέο κνξηαθή πεξίζζεηα (αληηζηνηρψληαο ζε 10 θνξέο γηα θαζεκία απφ ηηο δχν θπζηεΐλεο) γηα ηελ αιθπιίσζε. Απηή ειέγζεθε κε θαζκαηνζθνπία κάδαο (ΜΑLDI, δεο παξαθάησ) δεηγκάησλ 1κl πξηλ θαη κεηά ηελ πξφζζεζε ηνπ iodoacetamide. Σν πεπηίδην έπεηηα θαζαξίζηεθε κε πγξή ρξσκαηνγξαθία πςειήο απφδνζεο αληίζηξνθεο θάζεο (Reverse Phase - High Performance Liquid Chromatography RP-HPLC) ζε ζηήιε Vydac C18 ρξεζηκνπνηψληαο ηα δηαιχκαηα Α (0,1% trifluoracetic acid (TFA) ζε λεξφ) θαη Β (0,1% TFA ζε acetonitrile). Ομείδσζε: Σα πεπηίδηα 4 θαη 5 εηνηκάζηεθαλ ζε ζπγθέληξσζε 20 κm ζε λεξφ θαη ην ph απμήζεθε ψζηε λα είλαη βαζηθφ (~8) κε δηάιπκα ΝΗ 4 ΟΗ. Τπεξνμείδην ηνπ πδξνγφλνπ (Η 2 Ο 2 ) πξνζηέζεθε ζε ηειηθφ πνζνζηφ 0,4% θαη ε νμείδσζε ηνπ ζείνπ ηνπ ζεηνεζηεξηθνχ δεζκνχ παξαθνινπζήζεθε (φπσο θαη ε αλαγσγή παξαπάλσ) θαηά ηελ επψαζε ζε ζεξκνθξαζία δσκαηίνπ. ηαλ ε αληίδξαζε νινθιεξψζεθε κεηά απφ θάπνηεο ψξεο, ηα δείγκαηα ησλ πεπηηδίσλ παγψζεθαλ θαη αθνινχζεζε ιπνθηιίσζή ηνπο γηα ηελ αθαίξεζε ηνπ ΝΗ 4 ΟΗ θαη ηνπ Η 2 Ο 2. Σα ζηεγλά δείγκαηα δηαιπηνπνηήζεθαλ έπεηηα ζε λεξφ γηα ηε ρξήζε ηνπο ζηηο ιεηηνπξγηθέο κειέηεο φπσο πεξηγξάθεθε παξαπάλσ. Υαξαθηεξηζκόο πεπηηδίσλ Μέηξεζε κάδαο κε MALDI: 1κl ηνπ δείγκαηνο αλακηγλχρζεθε κε 1κl δηαιχκαηνο Α-cyano-4-hydroxycinnamic acid (CHCA) απφ ηελ Waters (MassPREP MALDI Matrix, CHCA), πνπ είρε εηνηκαζηεί ζχκθσλα κε ηηο νδεγίεο ηνπ θαηαζθεπαζηή. 1κl απφ ην κείγκα ηνπνζεηήζεθε ζε θαζαξή ζέζε ζην θαηάιιειν κεηαιιηθφ πηάην θαη αθνχ ζηέγλσζε, ε αλίρλεπζε κε θαζκαηνζθνπία κάδαο έγηλε ζην θαζκαηφκεηξν MALDI Micro MX ηεο Waters. Αλάιπζε κάδαο θαη θαζαξφηεηαο κε αλαιπηηθή ρξσκαηνγξαθία θαη electrospray ionization (ESI): 65

66 Σα δείγκαηα αλαιχζεθαλ κε UPLC (φπνπ U = Ultra) αθνινζνχκελν απφ ESI ζην SYNAPT HDMS ηεο Waters κε δηαιχκαηα Α θαη Β, φπνπ αληί γηα TFA ρξεζηκνπνηήζεθε formic acid (FA). 66

67 Γ. Απνηειέζκαηα 67

68 Πξνηεηνηκαζία πξσηετλώλ Πξνηεηνηκαζία ηνπ C3b Γηα ηε κειέηε πξφζδεζεο ηνπ ζηαθπινθνθθηθνχ αλαζηνιέα ηνπ ζπκπιεξψκαηνο SCIN ζην C3b, ε πξνεηνηκαζία C3b πςειήο θαζαξφηεηαο ήηαλ απαξαίηεηε. Αξρηθά πξαγκαηνπνηήζεθε απνκφλσζε ηνπ C3 κέζσ ηεο θιαζκαηνπνίεζεο αλζξψπηλνπ πιάζκαηνο κε ηε ρξήζε PEG θαη ελφο βήκαηνο θαζαξηζκνχ ζε ζχζηεκα FPLC κε ηε ζηήιε αληαιιαγήο αληφλησλ Source 15Q. (Δηθφλα 14). πσο θαίλεηαη, ην C3 πνπ απνκνλψζεθε κε απηή ηε κέζνδν είλαη αξθεηά θαζαξφ, ελψ θάπνηεο πξνζκείμεηο αθαηξέζεθαλ επηπιένλ κε ηελ θαζίδεζε ζε δηάιπκα MES κε ph 6,0 ίζν κε ην pi ηνπ C3. Έπεηηα, απηφ ππέζηε πεξηνξηζκέλε πέςε κε ηξπςίλε γηα ηελ απνκάθξπλζε ηνπ C3a. Η πέςε έγηλε παξνπζία εηδηθήο ζεθαξφδεο κε νκάδεο ζεηφιεο, γηα ηελ αθηλεηνπνίεζε ηνπ λεν-ζρεκαηηζκέλνπ C3b ζε απηήλ κέζσ δηζνπιθηδηθνχ δεζκνχ πνπ ζρεκαηίδεηαη απφ ηηο ζεηφιεο απηέο θαη ηελ θπζηεΐλε ηνπ απειεπζεξσκέλνπ ζεηνεζηεξηθνχ. Σν πιχζηκν ηεο ζεθαξφδεο απνκάθξπλε πξνζκείμεηο πνπ δελ πξνζδέζεθαλ ζε απηή. Μεηά ηελ έθινπζε C3b πςειήο θαζαξφηεηαο, αθνινχζεζε αιθπιίσζε ηνπ ζεηνεζηεξηθνχ γηα ηελ απνθπγή ζρεκαηηζκνχ δηκεξψλ. Δηθόλα 14: Αληηπξνζσπεπηηθφ απνηέιεζκα ηεο δηαδηθαζίαο απνκφλσζεο ηνπ C3 θαη κεηαηξνπήο ηνπ ζε C3b. Απφ αξηζηεξά: Αληνληναληαιιαθηηθή ρξσκαηνγξαθία γηα ηελ απνκφλσζε ηνπ C3 απφ αλζξψπηλν πιάζκα θιαζκαηνπνηεκέλν κε PEG θαη αλάιπζε κε SDS-PAGE. Μπιε γξακκή: απνξξφθεζε ππεξηψδνπο θσηφο, θαθέ γξακκε: αγσγηκφηεηα εθινπφκελνπ δηαιχκαηνο, πξάζηλε γξακκή: πνζνζηφ δηαιχκαηνο έθινπζεο, AU: κνλάδα απνξξφθεζεο ππεξηψδνπο θσηφο. ηελ δεμηά πιεπξά ε αλάιπζε κε SDS-PAGE ζπγθξίλεη ηελ θηλεηηθφηεηα ηνπ C3 κε ην C3b πνπ έρεη δεκηνπξγεζεί κε πεξηνξηζκέλε ηξπςηλνπνίεζε παξνπζίᾳ ζεθαξφδεο ATS, έρεη εθινπζηεί απφ 68

69 απηή θαη ππνζηεί δηαπίδπζε ζε PBS. Δίλαη εκθαλήο ε δηαθνξά θηλεηηθφηεηαο ηεο αιπζίδαο α ηνπ C3 απφ ηελ α ηνπ C3b, απφ ηελ νπνία ιείπεη ην ζξαχζκα C3a. Πξνεηνηκαζία ηνπ Ba Σν Ba ζξαχζκα ηνπ FB παξάρζεθε κε ζηφρν ηε κειέηε ηεο απεπζείαο πξφζδεζήο ηνπ ζην C3b. Γηα δηεπθφιπλζε ηνπ θαζαξηζκνχ ηεο αλαζπλδπαζκέλεο πξσηεΐλεο επηιέρηεθε ην ζχζηεκα έθθξαζεο pqe30-m15 ηεο QIAGEN πνπ επέηξεςε ηελ εηζαγσγή νπξάο έμη ηζηηδίλσλ ζην ακηλνηειηθφ άθξν. Η πξσηεΐλε απνκνλψζεθε απφ ηα έγθιεηζηα ηεο βαθηεξηαθήο θαιιηέξγεηαο κέζσ ηεο ρξσκαηνγξαθίαο ζπγγελείαο ζε ζηήιε ληθειίνπ, ην νπνίν έρεη ζπγγέλεηα πξνο ηελ νπξά έμη ηζηηδίλσλ. Οη πξσηεΐλεο ρσξίο απηή ηελ νπξά πέξαζαλ απφ ηε ζηήιε ρσξίο λα πξνζδεζνχλ, ελψ ην Ba πξνζδέζεθε θαη έπεηηα εθινχζηεθε κε ηε κείσζε ηνπ ph. πσο, θαίλεηαη ζηελ Δηθφλα 15, ην Ba ήηαλ ε θχξηα πξσηεΐλε ηνπ εθινπφκελνπ δείγκαηνο. Μεηά ηελ αλαδίπισζε ηεο πξσηεΐλεο, έλα αθφκα βήκα θαζαξηζκνχ ζην FPLC πξαγκαηνπνηήζεθε ζε ζηήιε αληαιιαγήο αληφλησλ Mono Q. Δηθόλα 15: Αληηπξνζσπεπηηθφ απνηέιεζκα ηεο δηαδηθαζίαο απνκφλσζεο ηνπ αλαζπλδπαζκέλνπ ζξαχζκαηνο Ba. α. Αλάιπζε κε SDS-PAGE ρξσκαηνγξαθίαο ζπγγελείαο ζε ζηήιε ληθειίνπ ησλ δηαιπηνπνηεκέλσλ εγθιείζησλ βαθηεξηαθήο θαιιηέξγεηαο φπνπ επάρζεθε ε έθθξαζε ηνπ Ba. Η ρξσκαηνγξαθία έγηλε ππφ απνδηαηαθηηθέο ζπλζήθεο (8 Μ νπξία). Σν Ba εθινχζηεθε απφ ηε ζηήιε ζε φια ηα ph πνπ δνθηκάζηεθαλ. β. Αληνληναληαιιαθηηθή ρξσκαηνγξαθία γηα ηνλ πεξαηηέξσ θαζαξηζκφ ηνπ Ba θαη αλάιπζε κε SDS-PAGE. Μπιε γξακκή: απνξξφθεζε ππεξηψδνπο θσηφο, θαθέ γξακκε: αγσγηκφηεηα εθινπφκελνπ δηαιχκαηνο, πξάζηλε γξακκή: πνζνζηφ δηαιχκαηνο έθινπζεο, AU: κνλάδα απνξξφθεζεο ππεξηψδνπο θσηφο. 69

70 Αιιειεπίδξαζε ηνπ FB θαη ηνπ ζξαύζκαηνο Ba κε ην C3b. πσο πξναλαθέξζεθε, ππήξραλ ελδείμεηο φηη ην Ba πξνζδέλεηαη ζην C3b θαη κάιηζηα φηη πηζαλψο απηή ε αιιειεπίδξαζε είλαη ην πξψην βήκα ζην ζρεκαηηζκφ ηεο πξν-θνλβεξηάζεο C3bB, αθνινπζνχκελν απφ ηελ αιιειεπίδξαζε ηνπ Bb κε ην C3b. Ωζηφζν δελ ππήξρε σο ηψξα θηλεηηθή αλάιπζε πνπ λα απνδεηθλχεη θαη λα πεξηγξάθεη ηα βήκαηα απηά. Γηα ην ιφγν απηφ αλαιχζεθε ε πξφζδεζε ηνπ ηκήκαηνο Ba θαη νιφθιεξνπ ηνπ FB ζην C3b κε SPR. Δπεηδή είλαη γλσζηφ φηη ε πξφζδεζε ηνπ FB ζην C3b είλαη εμαξηψκελε απφ ηφληα Mg 2+ θαη φηη ην ζεκείν πξφζδεζεο ησλ ηφλησλ βξίζθεηαη ζην ιεγφκελν ζεκείν MIDAS ηνπ Bb, ε αλάιπζε ηεο πξφζδεζεο έγηλε ζε δχν δηαθνξεηηθά δηαιχκαηα: Έλα πνπ πεξηείρε Mg 2+ θαη έλα πνπ πεξηείρε ηε ρειηθή έλσζε EDTA πνπ πξνζδέλεη ηα ηφληα, εκπνδίδνληάο ηα λα πξνζδεζνχλ ζην Bb. Παξνπζίᾳ Mg 2+, ν FB πξνζδέλεηαη θαη δηίζηαηαη απφ ην C3b ζε δχν θάζεηο: κηα γξήγνξε θαη κηα αξγή. Σα ζήκαηα κπνξνχλ λα πξνζνκνησζνχλ θαιά ζην κνληέιν αλλαγής διαμόρθωζης θαη ηεο εηερογένειας ηης επιθάνειας, αιιά φρη ζην κνληέιν απλής αλληλεπίδραζης δύο μορίων. (Δηθφλα 16δ θαη ζη) Αληίζεηα, ην Ba αιιειεπηδξά κε ην C3b κε κηα γξήγνξε πξφζδεζε θαη δηάζηαζε. Η πξνζσκνίσζε ησλ δεδνκέλσλ κπνξεί λα γίλεη ζην κνληέιν απλής αλληλεπίδραζης δύο μορίων, ην νπνίν ππνζέηεη έλα ζεκείν πξφζδεζεο θαη θηλεηηθή πξφζδεζεο 1:1 θαηά Langmuir. Η μερσξηζηή πξνζσκνίσζε ηεο ζηαζεξήο θάζεο ζην κνληέιν πξφζδεζεο 1:1 θαηαδεηθλχεη ηελ εηδηθφηεηα ηεο πξφζδεζεο κε ζπγγέλεηα K D = 12κM (Δηθφλα 16α θαη γ). Καηά ηελ αληηθαηάζηαζε ηνπ Mg 2+ απφ EDTA, ην πξφηππν πξφζδεζεο ηνπ Ba παξακέλεη φκνην (κε ζπγγέλεηα K D = 13κM, Δηθφλα 16β). Σν πξφηππν ηνπ FB φκσο αιιάδεη δξακαηηθά πξνο απηφ ηεο απλής αλληλεπίδραζης δύο μορίων κε γξήγνξε πξφζδεζε θαη δηάζηαζε (Δηθφλα 16ε). Γίλεηαη δειαδή φκνην ηνπ Ba. Σα ζπκπεξάζκαηα απηήο ηεο αλάιπζεο είλαη ηα εμήο: Η πξφζδεζε ηνπ Ba ζην C3b είλαη αλεμάξηεηε απφ ηελ παξνπζία ηφλησλ Mg 2+. Η πξψηε, γξήγνξε θάζε πξφζδεζεο ηνπ FB ζην C3b είλαη επίζεο αλεμάξηεηε απφ ηελ παξνπζία ηφλησλ Mg 2+ θαη κπνξεί λα απνδνζεί ζε απηή ηελ αξρηθή επαθή ηνπ ηκήκαηνο Ba ζην C3b. Η δεχηεξε, αξγή θάζε ιακβάλεη ρψξα κφλν θαηά ηελ παξνπζία ηφλησλ Mg 2+ θαη κπνξεί λα απνδνζεί ζηελ πξφζδεζε ηνπ ηκήκαηνο Bb. Μπνξεί επνκέλσο θαλείο λα ππνζέζεη φηη, ζε θπζηνινγηθέο ζπλζήθεο, φηαλ ην Ba έρεη αθαηξεζεί κε πέςε απφ ηνλ FD, ε θνλβεξηάζε C3bBb ηειηθά δηίζηαηαη κε αλαζηξέςηκα ιφγσ ηνπ φηη ην Bb δε κπνξεί λα μαλαπξνζδεζεί ζην C3b, ιφγσ ηεο ρακειήο ζηαζεξάο ηνπ ξπζκνχ πξφζδεζεο. (95) 70

71 Αλαιπόκελε πξσηεΐλε (Γηάιπκα) Κηλεηηθφ κνληέιν k on1 (M -1 s -1 ) k off1 (s -1 ) K D1 (µm) k on2 (M -1 s -1 ) k off2 (s -1 ) K D2 (µm) Ba (1 mm MgCl 2 ) Απιή αιιειεπίδξαζε δχν κνξίσλ Ba (3 mm EDTA) Απιή αιιειεπίδξαζε δχν κνξίσλ FB (1 mm MgCl 2 ) Απιή αιιειεπίδξαζε δχν κνξίσλ α Δηεξνγέλεηα επηθαλείαο Αιιαγή δηακφξθσζεο ( ) ( ) (0.6) β Harris et al. γ (8.5) δ β FB (3 mm EDTA) Απιή αιιειεπίδξαζε δχν κνξίσλ ε α Σα δεδνκέλα δελ κπνξνχλ λα πξνζνκνησζνχλ ζε απηφ ην κνληέιν (πξάζηλεο γξακκέο ζην έλζεην ζη ηεο εηθφλαο). Οη ηηκέο δίλνληαη γηα πιεξνθνξηαθνχο ιφγνπο, ρσξίο λα αληηπξνζσπεχνπλ ηελ πξαγκαηηθφηεηα. β Η κνλάδα γηα ην k on2 είλαη s -1 ζηελ πεξίπησζε ηνπ κνληέινπ αιιαγήο δηακφξθσζεο (ν ξπζκφο κεηαηξνπήο είλαη αλεμάξηεηνο ηεο κνξηαθήο ζπγθέληξσζεο). 71

72 γ Οη ζηαζεξέο ησλ ξπζκψλ πξφζδεζεο θαη δηάζηαζεο πνπ έρνπλ δεκνζηεπηεί ζην παξειζφλ ζχκθσλα κε ην κνληέιν αιιαγήο δηακφξθσζεο. (96) δ ηε δεκνζίεπζε ηνπ Harris et al. δελ αλαθέξζεθε ηηκή γηα ην K D (96), αιιά ππνινγίζηεθε εδψ σο K D = k off/k on. ε Γηα ηνλ αθξηβέζηεξν ππνινγηζκφ ησλ θηλεηηθψλ παξακέηξσλ ηεο πξφζδεζεο απνπζίᾳ καγλεζίνπ, ν FB ελέζεθε ζε πςειφηεξεο ζπγθεληξψζεηο (625 nm - 20 µm). Ωζηφζν, ηα ζήκαηα πξφζδεζεο θαη πάιη δελ θαιχπηνπλ ην απαξαίηεην εχξνο ηηκψλ θαη επνκέλσο νη ζηαζεξέο πνπ ππνινγίδνληαη είλαη ρακειήο αμηνπηζηίαο (πξνθαλείο). Δηθόλα 16: Κηλεηηθή αλάιπζε ηεο αιιειεπίδξαζεο ηνπ C3b κε ην FB θαη ην Ba: α-γ, Πξφζδεζε ηνπ ζξαχζκαηνο Ba ζε αθηλεηνπνηεκέλν C3b παξνπζίᾳ MgCl 2 (α) ή EDTA (β). Πξνζνκνίσζε ζε κνληέιν πξφζδεζεο απλής αλληλεπίδραζης δύο μορίων (καχξν: ζήκαηα SPR, θφθθηλν: πξνζνκνίσζε). γ. ρεδηάγξακκα ζηαζεξήο θάζεο (ηζνξξνπίαο) πξνο ζπγθέληξσζε (πξνηππνπνηεκέλν επί ηνηο %) ηεο πξφζδεζεο ηνπ Ba ζην C3b: θακπχιε πξνζνκνίσζεο ηεο ζην κνληέιν ενός ζημείοσ πρόζδεζης θαη γηα ηα δχν ζεη δεδνκέλσλ (α θαη β) (κε K D ίζν κε 12 θαη 13 µm ζηελ πεξίπησζε ηνπ δηαιχκαηνο κε Mg 2+ θαη EDTA αληηζηνίρσο). δ-ζη, Πξφζδεζε ηνπ FB ζην C3b παξνπζίᾳ (δ) ή απνπζίᾳ (ε) Mg 2+. ηελ πεξίπησζε ηνπ καγλεζίνπ, ηα δεδνκέλα πξνζνκνηψλνληαη ζην κνληέιν αλλαγής διαμόρθωζης κε δχν θάζεηο: γξήγνξε αιιειεπίδξαζε θαη αξγή κεηαηξνπή (δ). ηαλ ην καγλήζην αληηθαζίζηαηαη απφ ην EDTA, ε θηλεηηθή ηεο πξφζδεζεο αιιάδεη πξνο ην κνληέιν απλής αλληλεπίδραζης δύο μορίων κε ζηαζεξά δηάζηαζεο παξφκνηα κε απηή ηνπ Ba θαη ζεκαληηθά κεησκέλε πξνθαλή ζπγγέλεηα (ε θαη έλζεην). Πξέπεη λα ζεκεησζεί φηη ηα δεδνκέλα ηεο πξφζδεζεο ηνπ FB ζην δηάιπκα κε καγλήζην πξνζνκνηψζεθαλ εμίζνπ θαιά ζε έλα μονηέλο εηερογένειας ηης επιθανείας φηαλ απηφ ιακβάλεη ππφςε δχν αλεμάξηεηα ζεκεία πξφζδεζεο (ζη ξνδ θακπχιεο), ελψ δελ πξνζνκνηψζεθαλ ηθαλνπνηεηηθά ζην κνληέιν απλής αλληλεπίδραζης δύο μορίων (ζη πξάζηλεο θακπχιεο). δ, Κηλεηηθέο ζηαζεξέο γηα ην FB θαη ην Ba παξνπζίᾳ ή απνπζίᾳ καγλεζίνπ. Οη ζηαζεξέο ησλ ξπζκψλ πξφζδεζεο θαη δηάζηαζεο γηα ην κνληέιν αλλαγής διαμόρθωζης ζηελ πεξίπησζε ηνπ FB ζπκθσλνχλ κε δεδνκέλα πνπ έρνπλ δεκνζηεπζεί πξνεγνπκέλσο (96). Αιιειεπίδξαζε ηνπ SCIN κε ην C3b. Σν C3b πνπ παξάρζεθε ρξεζηκνπνηήζεθε γηα ηε κειέηε αιιειεπίδξαζεο κε ην SCIN κε ηηο ηερλνινγίεο ηεο ζεξκηδνκεηξίαο ηζφζεξκεο ηηηινδφηεζεο (ITC), ηεο ζθέδαζεο αθηίλσλ Υ κηθξήο γσλίαο (SAXS) (97) θαη ηεο θξπζηαιινγξαθίαο (98, 99). ηελ πξψηε κειέηε επηβεβαηψζεθε ε ππφζεζε φηη ην SCIN πξνζδέλεηαη ζην C3b κε κηα ζεηξά πεηξακάησλ: Με ηε ρξήζε SPR βξέζεθε φηη ην SCIN πξνζδέλεηαη ζην C3b πνπ είλαη αθηλεηνπνηεκέλν ζην ηζηπ κέζσ ηνπ ζεηνεζηεξηθνχ δεζκνχ, ελψ κε ITC βξέζεθε φηη πξφζδεζε ζπκβαίλεη θαη φηαλ θαη νη δχν πξσηεΐλεο βξίζθνληαη ζην δηάιπκα. Σν ITC έδεημε φηη ε αληίδξαζε πξφζδεζεο είλαη εμψζεξκε θαη ηα δεδνκέλα κπνξνχλ λα πξνζσκνησζνχλ αξθεηά θαιά ζε κνληέιν κίαο πεξηνρήο πξφζδεζεο κε ζπγγέλεηα 264 nm θαη ελζαιπία -7 kcal/mol. Ωζηφζν, ε πξνβιεπφκελε ζηνηρεηνκεηξία ηεο αληίδξαζεο είλαη ~0,75, απνθιίλεη απφ ηελ ζηνηρεηνκεηξία 1:1. Πεξαηηέξσ κειέηε ηεο ζηνηρεηνκεηξίαο ησλ ζπκπιφθσλ κε SAXS επηβεβαίσζε φηη απηά ππάξρνπλ ζε κηα ηζνξξνπία εηεξνδηκεξψλ θαη εηεξνηεηξακεξψλ. (97) Παξάιιεια, ε θξπζηάιισζε ηνπ ζπκπιφθνπ C3b-SCIN (αιιά θαη C3c-SCIN) πξαγκαηνπνηήζεθε κε επηηπρία θαη έδεημε ην ζρεκαηηζκφ εηεξνηεηξακεξψλ, φπνπ δχν ζχκπινθα 72

73 C3b-SCIN ζηνηρίδνληαη ην έλα απέλαληη απφ ην άιιν θαη φπνπ ην SCIN ηνπ ελφο ζπκπιφθνπ έξρεηαη ζε επαθή κε ηα C3b θαη ησλ δχν ζπκπιφθσλ. πγθεθξηκέλα, ην πξψην ζεκείν πξφζδεζεο ζρεκαηίδεηαη αλάκεζα ζηελ 2 ε α-έιηθα ηνπ SCIN θαη πεξηνρή ηνπ C3b πνπ πεξηιακβάλεη θπξίσο ηελ α-αιπζίδα θαη ζε κηθξφηεξν πνζνζηφ ηελ β-αιπζίδα (ζπγθεθξηκέλα ηηο επηθξάηεηεο MG6, MG7 θαη ηελ α ακηλνηειηθή νπξά), φπσο θαίλεηαη ζηελ Δηθφλα 17α. Σν δεχηεξν ζεκείν πξφζδεζεο ζρεκαηίδεηαη αλάκεζα ζηε 1 ε θαη 3 ε α-έιηθα ηνπ SCIN θαη πεξηνρή ηεο α-αιπζίδαο ηνπ απέλαληη κνξίνπ C3b (MG7 θαη MG8). Σα ζεκεία πξφζδεζεο ησλ C3b κνξίσλ πάλσ ζην SCIN πεξηιακβάλνπλ θπξίσο ηε δεχηεξε έιηθα γηα ην πξψην C3b θαη ηκήκαηα ηεο πξψηεο θαη ηξίηεο έιηθαο γηα ην δεχηεξν C3b. Σα ζεκεία απηά δελ ζπκπίπηνπλ κε ηα L 31 -G 48 πνπ είραλ πξνεγνπκέλσο πξνβιεθζεί φηη είλαη απαξαίηεηα γηα ηελ αλαζηαιηηθή δξάζε ηνπ SCIN, εθηφο απφ ηα ακηλνμέα Τ 40 θαη R 42 (Δηθφλα 17β). Η θπζηνινγηθή ζεκαζία ηνπ δεχηεξνπ ζεκείνπ πξφζδεζεο θαη ηνπ ζρεκαηηζκνχ εηεξνηεηξακεξψλ δελ είλαη γλσζηή. Μηα ππφζεζε είλαη φηη απηφ έρεη σο απνηέιεζκα ηελ θάιπςε ηνπ ζεκείνπ πξφζδεζεο ηνπ C3b απφ ηνπο ππνδνρείο CR1 θαη CRIg θαη ηελ αλαζηνιή ηεο θαγνθπηηάξσζεο. Η ππφζεζε απηή φκσο ζα πξέπεη λα δηεξεπλεζεί πεξαηηέξσ. Δηθόλα 17: α. Γνκή ηνπ ζπκπιφθνπ C3b-SCIN. Γηα ιφγνπο απινχζηεπζεο, δείρλεηαη κφλν ην έλα δηκεξέο αληί γηα ην εηεξνηεηξακεξέο. Οη επηθξάηεηεο ηνπ 1 νπ απηνχ κνξίνπ C3b κε ηηο νπνίεο αιιειεπηδξά ην SCIN δείρλνληαη κε δηαθνξεηηθφ ρξψκα απφ ην ππφινηπν κφξην. β. Οη πιεπξηθέο αιπζίδεο ησλ ακηλνμέσλ ηνπ SCIN πνπ αιιειεπηδξνχλ κε ην 1 ν C3b θαίλνληαη κε πξάζηλν θαη απηέο πνπ αιιειεπηδξνχλ κε ην 2 ν δείρλνληαη κε κνβ. 73

74 Γνκή ηεο θνλβεξηάζε C3bBb ζε ζύκπινθν κε ην SCIN θαη κεραληζκόο αλαζηνιήο ηνπ ζπκπιεξώκαηνο. Η ηδηφηεηα ηνπ SCIN λα ζηαζεξνπνηεί ηελ θνλβεξηάζε C3bBb ζε κηα αλελεξγφ δηακφξθσζε ρξεζηκνπνηήζεθε γηα ηελ θξπζηάιισζε ηνπ ζπκπιφθνπ θαη ηελ επίιπζε ηεο δνκήο ηνπ. Η αζχκκεηξε κνλάδα ηνπ θξπζηάιινπ πεξηιάκβαλε δχν δηκεξή ηνπ ζπκπιφθνπ C3bBb-SCIN. Σα δηκεξή ζρεκαηίδνληαη απφ ηα δχν πξνζδεδεκέλα C3b κφξηα, πνπ γεθπξψλνληαη κε ηα δχν SCIN κφξηα κε ηνλ ίδην ηξφπν πνπ πεξηγξάθεθε παξαπάλσ γηα ηε δνκή ηνπ δηκεξνχο ζπκπιφθνπ C3b-SCIN. Σα δχν Bb κφξηα βξίζθνληαη ζε ζπκκεηξηθέο ζέζεηο ζην εμσηεξηθφ ηνπ δηκεξνχο C3b- C3b. Σν Bb πξνζδέλεηαη κέζσ ηεο επηθξάηεηαο VWA ζηελ θαξβνμπηειηθή επηθξάηεηα C345C ηνπ C3b, ελψ ε θαηαιπηηθή επηθξάηεηα SP είλαη απνκαθξπζκέλε θαη δελ έξρεηαη ζε επαθή κε ην C3b. Αμίδεη λα ζεκεησζεί φηη ην C345C ζπκκεηέρεη ζηελ ρειηθή δηακφξθσζε ηεο πεξηνρήο MIDAS ηνπ VWA πνπ εγθνιπψλεη ην ηφλ Mg 2+. Δπίζεο ην SCIN πξνζδέλεηαη ζην Bb, θπξίσο ζηελ επηθξάηεηα VWA θαη ζηελ επηθάλεηα αλάκεζα ζηηο επηθξάηεηεο VWA θαη SP, αιιά δελ κπινθάξεη άκεζα ηελ θαηαιπηηθή πεξηνρή ηεο επηθξάηεηα SP, δειαδή δελ εκπνδίδεη ζηεξηθά ηελ θαηαιπηηθή ηεο δξάζε (Δηθφλα 18). 74

75 Δηθόλα 18: α. Γνκή ηνπ ζπκπιφθνπ (C3bBb-SCIN) 2 πνπ απνηειείηαη απφ δχν αληίγξαθα θαζεκηάο πξσηεΐλεο. Σα δχν εηεξνηξηκεξή γεθπξψλνληαη κέζσ ησλ δχν κνξίσλ SCIN. Οη θφθθηλεο ζθαίξεο ζηα Bb είλαη ε θαηαιπηηθή ηξηάδα. β. Πεξηνρέο πξφζδεζεο ηνπ SCIN κε ηα κφξηα C3b θαη Bb ηνπ δηθνχ ηνπ θαη ηνπ ζπκκεηξηθνχ εηεξνηξηκεξνχο. Σα ακηλνμέα πνπ δεκηνπξγνχλ επαθέο είλαη ππνγξακκηζκέλα. γ. χγθξηζε ησλ πξνβιεπφκελσλ πεξηνρψλ πξφζδεζεο αλάκεζα ζην C3b-FB κε ηελ πεξηνρή πξφζδεζεο πνπ θαίλεηαη απφ ηελ παξνχζα θξπζηαιιηθή δνκή. Με θαθέ θαίλνληαη νη πεξηνρέο πνπ είραλ επηπιένλ (καδί κε ηηο ραθί) δεηρηεί φηη ζπκκεηέρνπλ ζηελ πξφζδεζε ηνπ C3b απφ ηε κειέηε ηξπςηλνπνίεζεο. (Γεο θαη Δηθφλα 7 ηεο δνκήο ηνπ FB). ηελ αξηζηεξή πιεπξά, νη πεξηνρέο φπνπ ε επηθάλεηα ηνπ C3b θαη ηνπ FB δηαθφπηεηαη είλαη νη πεξηνρέο πξφζδεζεο ζην SCIN θαη C3b ηνπ ζπκκεηξηθνχ ζπκπιφθνπ. Γεληθά νη δνκέο ησλ επηκέξνπο ζπζηαηηθψλ ηνπ ζπκπιφθνπ είλαη φκνηεο κε ηηο πξνεγνπκέλσο δεκνζηεπκέλεο δνκέο ησλ ειεχζεξσλ πξσηετλψλ. Δπίζεο ηα ζεκεία πξφζδεζεο ηνπ SCIN κε ηo C3b θαη Bb πεξηιακβάλνπλ ην ηκήκα ηεο αιιεινπρίαο ακηλνμέσλ πνπ είρε βξεζεί φηη είλαη ζεκαληηθφ γηα ηε ιεηηνπξγία ηνπ, φπσο αλαθέξζεθε ζηελ εηζαγσγή θαη γεληθά ζπκθσλνχλ κε ηα ζεκεία πξφζδεζήο ηνπ πνπ βξέζεθαλ απφ ηε δνκή ηνπ ζπκπιφθνπ C3b-SCIN (Δηθφλα 18β). Η πεξηνρή πξφζδεζεο ηνπ C3b ζην Bb ζπκθσλεί, ελψ ε πεξηνρή πξφζδεζεο ηνπ Bb πάλσ ζην C3b δε ζπκθσλεί κε ηηο αληίζηνηρεο πνπ είραλ πξνβιεθζεί απφ λσξίηεξεο βηνρεκηθέο κειέηεο (Δηθφλα 18γ). Ο δηκεξηζκφο ηνπ ζπκπιφθνπ απνδείρηεθε φηη δελ είλαη απαξαίηεηνο γηα ηελ αλαζηνιή ηνπ ζπκπιεξψκαηνο απφ ην SCIN, αθνχ βξέζεθε φηη κεηαιιάγκαηα ησλ νπνίσλ ιείπεη ε αιιεινπρία πξφζδεζεο ζην δεχηεξν C3b ζρεκαηίδνπλ κνλνκεξή ζχκπινθα αλελεξγνχο θνλβεξηάζεο. ηελ πξνζπάζεηα λα βξεζεί ν κεραληζκφο αλαζηνιήο απφ ην SCIN έγηλε πξνζνκνίσζε ηεο πξφζδεζεο ηνπ ππνζηξψκαηνο C3 ζηελ κία θνλβεξηάζε C3bBb κέζσ εηεξνδηκεξηζκνχ (C3-C3b) ζηα ζεκεία πνπ δηκεξίδνληαη ηα C3b κφξηα. Απηή έδεημε φηη ε θαηαιπηηθή πεξηνρή ηεο επηθξάηεηαο SP θαηεπζχλεηαη πξνο ηνλ πεπηηδηθφ δεζκφ ηνπ ππνζηξψκαηνο (C3) πνπ πξέπεη λα θνπεί, αιιά βξίζθεηαη πνιχ καθξηά (30 Å) απφ απηφλ θαη δε ζα κπνξνχζε λα πξαγκαηνπνηήζεη ηελ πέςε. Πξνηείλεηαη φηη, θαηά ηελ απνπζία ηνπ αλαζηνιέα SCIN, ε απφζηαζε απηή ησλ 30 Å κπνξεί λα θαιπθζεί κέζσ ηεο κεηαθίλεζεο ηεο επηθξάηεηαο C345C απφ ηελ νπνία «θξέκεηαη» ην Bb (ε C345C είλαη απφ ηηο επηθξάηεηεο πνπ έρνπλ δπλαηφηεηα κεηαθίλεζεο, αθνχ ζπλδένληαη κε έλαλ ειαζηηθφ ζχλδεζκν κε ην ππφινηπν κφξην), ψζηε λα θέξνπλ ηελ θαηαιπηηθή επηθξάηεηα SP πην θνληά ζην ππφζηξσκα. Ο κεραληζκφο αλαζηνιήο ηνπ SCIN δειαδή πηζαλψο έγθεηηαη ζην φηη ζηαζεξνπνηεί ηελ επηθξάηεηα C345C θαη εκπνδίδεη απηή ηελ απαξαίηεηε θίλεζή ηεο. Δλαιιαθηηθά, επεηδή ε πξνζνκνίσζε έγηλε κε βάζε ηα ζεκεία δηκεξηζκνχ ησλ κνξίσλ C3b, απηφο ν δηκεξηζκφο κπνξεί λα αληηπξνζσπεχεη ηε θάζε απειεπζέξσζεο ηνπ πξντφληνο κεηά ηελ πέςε θαη φρη ηε θάζε πξφζδεζεο ηνπ ππνζηξψκαηνο. Αλ ν εηεξνδηκεξηζκφο C3-C3b πεξηιακβάλεη ηελ επαθή αλάκεζα ζε πεξηζζφηεξεο επηθξάηεηεο 75

76 MG, θαιχπηνληαο έηζη ηελ απφζηαζε αλάκεζα ζην ππφζηξσκα θαη ην έλδπκν, ηφηε κπνξεί ν κεραληζκφο αλαζηνιήο λα είλαη φηη ην SCIN εκπνδίδεη ηε δεκηνπξγία απηψλ ησλ πην ζηελψλ επαθψλ. Γελ είλαη γλσζηφ πνηνο απφ ηνπο δχν κεραληζκνχο ηζρχεη ή αλ ηζρχνπλ θαη νη δχν. Δηθόλα 19: Πξνζνκνίσζε ηεο πξφζδεζεο ηνπ ππνζηξψκαηνο C3 ζηελ θνλβεξηάζε C3bBb, φπσο απηή πξνθχπηεη απφ ηε δνκή ηνπ ζπκπιφθνπ C3bBb-SCIN, αλαδεηθλχεη ηε βάζε ηνπ πξνηεηλφκελνπ κεραληζκνχ αλαζηνιήο ηεο θνλβεξηάζεο απφ ην SCIN. Η θαηαιπηηθή ηξηάδα ηνπ Bb είλαη πνιχ καθξηά (~30 Å) απφ ην δεζκφ ηνπ C3 πνπ πξέπεη λα δηαζπαζηεί γηα ηελ απειεπζέξσζε ηνπ C3a θαη επνκέλσο ε ελδπκαηηθή αληίδξαζε δελ είλαη εθηθηή. Γνκή θαη κεραληζκόο ελεξγνπνίεζεο ηνπ ζπκπιόθνπ ηεο πξνθνλβεξηάζεο C3bB θαη ηνπ ζπκπιόθνπ ηεο κε ην FD (C3bBD). Δλψ ηα παξαπάλσ απνηειέζκαηα έδεημαλ ηε δνκή θαη ηνπο κεραληζκνχο ιεηηνπξγίαο θαη απην-ξχζκηζεο ηεο θνλβεξηάζεο C3bBb, δελ έδεημαλ ην ηξφπν κε ηνλ νπνίν ζρεκαηίδεηαη θαη ελεξγνπνηείηαη αξρηθά ε πξν-θνλβεξηάζε. Με ζθνπφ ηε δηεξεχλεζε απηψλ ησλ θξίζηκσλ βεκάησλ, πξαγκαηνπνηήζεθε ε θξπζηάιισζε ησλ ζπκπιφθσλ C3bB θαη C3bBD*, θαζψο θαη ε βηνρεκηθή αλάιπζε κηαο ζεηξάο κεηαιιαγκάησλ, ε νπνία επηβεβαίσζε ηα απνηέιεζκαηα απφ ηελ θξπζηαιιηθή δνκή. Σν D* είλαη έλα θαηαιπηηθά αλελεξγφ κεηάιιαγκα ηεο θαηαιπηηθήο ζεξίλεο ηνπ FD, S183A, ην νπνίν δε κπνξεί λα πέςεη ην FB. Δπίζεο, ν FB πνπ ρξεζηκνπνηήζεθε ήηαλ ην δηπιφ κεηάιιαγκα D254G N260G πνπ φπσο πξναλαθέξζεθε είρε βξεζεί φηη ζρεκαηίδεη πνιχ πην ζηαζεξέο θνλβεξηάζεο. Ο ιφγνο γηα απηφ είλαη ε πνιχ απμεκέλε ζπγγέλεηα πξνο ην C3b, φπσο δείρλεηαη παξαθάησ. Αθφκα, ην ζχκπινθν C3bB θξπζηαιιψζεθε παξνπζία ληθειίνπ αληί γηα καγλήζην, πνπ επίζεο απμάλεη ηε ζηαζεξφηεηα θαη ελεξγφηεηα ηεο θνλβεξηάζεο, θξαηψληαο ηνλ FB ζηελ αλνηρηή ηνπ δηακφξθσζε. Σν ηξηπιφ ζχκπινθν C3bBD* θξπζηαιιψζεθε παξνπζίᾳ ηφλησλ καγλεζίνπ. Παξάιιεια, βξέζεθε ε δνκή ηνπ ειεχζεξνπ FD* θαη ηνπ κεηαιιάγκαηνο FD 76

77 R202A. Η ηειεπηαία κεηάιιαμε πξνθαιεί ηελ κεηαηφπηζε ηνπ απην-αλαζηαιηηθνχ βξφγρνπ ηεο πνιππεπηηδηθήο αιπζίδαο ηνπ FD θαη ηελ επαγσγή ηεο ελεξγνχο δηακφξθσζεο ηεο θαηαιπηηθήο ηξηάδαο, γεγνλφο πνπ απμάλεη ηελ πέςε πεπηηδίσλ, αιιά κεηψλεη ηελ πέςε ηνπ FB, πηζαλψο επεηδή ην R202 είλαη ζεκαληηθφ γηα ηελ εηδηθφηεηα ηεο αιιειεπίδξαζεο. Γνκή ηεο πξν-θνλβεξηάζεο Η δνκή ηνπ C3b θαη ζηα δχν ζχκπινθα, C3bB θαη C3bBD (Δηθφλα 20α), είλαη πνιχ φκνηα κε απηή ηνπ ειεχζεξνπ C3b: ν ππξήλαο ηνπ κνξίνπ παξακέλεη ζηαζεξφο, ελψ νη πεξηθεξεηαθέο επηθξάηεηεο TED θαη C345C εκθαλίδνπλ θάπνηα πεξηζηξνθή, ην νπνίν είλαη αλακελφκελν, αθνχ έρεη πεξηγξαθεί πξνεγνπκέλσο φηη νη επηθξάηεηεο απηέο έρνπλ δπλαηφηεηα κεηαθίλεζεο. Ο FB ησλ ζπκπιφθσλ βξίζθεηαη ζε αλνηρηή δηακφξθσζε, δειαδή, ζε αληίζεζε κε ηηο δνκέο ηνπ ειεχζεξνπ FB, ηνπ FB ηνπ ζπκπιφθνπ CVFB (100) ή ηνπ Bb ηνπ C3bBb-SCIN, ε γσλία αλάκεζα ζηηο επηθξάηεηεο VWA θαη SP είλαη κεγάιε. Απηφ ζπλεπάγεηαη ηε κεηαθίλεζε ηνπ SP πξνο ηα θάησ θαη ηε δεκηνπξγία επηπιένλ επαθψλ αλάκεζα ζε απηφ θαη ηηο επηθξάηεηεο CUB θαη MG2 ηνπ C3b. Δπίζεο, ε αιιαγή δηακφξθσζεο εθζέηεη ην πξνεγνπκέλσο θξπκκέλν θαηάινηπν R234 κεηά ην νπνίν γίλεηαη ε πέςε απφ ηνλ FD. Η πξφζδεζε ηνπ VWA γίλεηαη κέζσ ηνπ C345C, φπσο θαη ζην ζχκπινθν C3bBb-SCIN. Σν Ba πνπ είλαη ηνπνζεηεκέλν αλάκεζα ζην VWA θαη ην C3b πξνζδέλεηαη ζην ηειεπηαίν κε φια ηα SCRs ηνπ, αιιά θπξίσο κε ηα SCR2-3. Η επαθή ηνπο κε ην C3b γίλεηαη κέζσ ησλ επηθξαηεηψλ MG2, MG6, MG7, CUB θαη ην ακηλνηειηθφ άθξν ηεο α αιπζίδαο (Δηθφλα 20β). ην ζχκπινθν C3bBD, ν FD* πξνζδέλεηαη κφλν ζην FB θαη φρη ζην C3b. Η πξφζδεζε γίλεηαη ζηελ επηθάλεηα αλάκεζα ζην VWA θαη ην SP ηνπ FB κέζσ κηαο πεξηνρήο ηνπ FD* δηαθνξεηηθήο απφ ην θαηαιπηηθφ θέληξν, φπσο είρε πξνβιεθζεί (δεο εηζαγσγή, Δηθφλα 20γ θαη Δηθφλα 21β). Η πεξηνρή απηή έρεη αθξηβψο ίδηα δηακφξθσζε ζην FD* ηνπ ζπκπιφθνπ, ζηα δχν ειεχζεξα FD (FD* θαη FD R202A, νη δνκέο δε δείρλνληαη εδψ), θαζψο θαη ζηηο πξνεγνπκέλσο δεκνζηεπκέλεο δνκέο ειεχζεξνπ FD, επνκέλσο ε ελεξγνπνίεζε ηνπ FD δε γίλεηαη κέζσ αιιαγήο δηακφξθσζεο απηήο ηεο πεξηνρήο. Αληίζεηα, ν ιεγφκελνο απηναλαζηαιηηθφο βξφγρνο ηνπ FD κεηαηνπίδεηαη απφ ηε ζέζε ηνπ ζηελ πεξίπησζε ηνπ ζπκπιφθνπ C3bBD* θαη ηνπ ειεχζεξνπ FD R202A (αιιά φρη ζην ειεχζεξν FD*), νδεγψληαο ζηελ ελεξγφ δηακφξθσζε ηεο θαηαιπηηθήο ηξηάδαο. Γπζηπρψο, δελ ππάξρεη ειεθηξνληθή ππθλφηεηα γηα ην βξφγρν ηνπ FB πνπ πεξηιακβάλεη ην ζεκείν πέςεο απφ ηνλ FD, επνκέλσο δελ ππάξρεη απφδεημε γηα ηνλ ηξφπν ηνπνζέηεζεο απηνχ κέζα ζην θαηαιπηηθφ θέληξν ηνπ FD. (101) 77

78 Δηθόλα 20: Η δνκή ησλ ζπκπιφθσλ πξν-θνλβεξηάζεο ηεο ελαιιαθηηθήο νδνχ. α. Γνκή ηνπ ζπκπιφθνπ C3bB (αξηζηεξά) θαη C3bBD* (δεμηά). β. Γείρλνληαη νη επηθάλεηεο πξφζδεζεο ηνπ FB πάλσ ζην C3b (πάλσ) θαη ηνπ C3b πάλσ ζην FB (θάησ) κε ηα αληίζηνηρα ρξψκαηα ησλ επηθξαηεηψλ πνπ ζπκκεηέρνπλ ζηελ πξφζδεζε. γ. ε αλαινγία κε ην β, δείρλνληαη νη επηθάλεηεο πξφζδεζεο ηνπ FD πάλσ ζην FB (αξηζηεξά) θαη ηνπ FB πάλσ ζην FD (δεμηά). δ. Γηάγξακκα πνπ δείρλεη ηηο επηθξάηεηεο ησλ ζπζηαηηθψλ ηεο θνλβεξηάζεο θαη ηνλ ρξσκαηηζκφ πνπ αληηζηνηρεί ζηηο απεηθνληδφκελεο δνκέο. Πξνζαξκνγή απφ (101). Η πεξηνρή πξφζδεζεο ηνπ FB πάλσ ζην C3b δελ ζπκθσλεί πιήξσο κε απηή πνπ είρε πξνβιεθζεί απφ ηηο βηνρεκηθέο κειέηεο παιηφηεξα (D 730 -L 768, δεο Eηθφλα α, θίηξηλν). πγθεθξηκέλα ελψ ζην ζχκπινθν C3bBb-SCIN ην Bb δελ έξρεηαη θαζφινπ ζε επαθή κε ηε ζπγθεθξηκέλε πεξηνρή ηνπ C3b, ζηα ζχκπινθα ηεο πξν-θνλβεξηάζεο ην Ba δεκηνπξγεί θάπνηεο επαθέο ζην κέζν ηεο πεξηνρήο απηήο. Αιιά φπσο πεξηγξάθεθε ζηελ πξνεγνχκελε παξάγξαθν θαη Δηθφλα 21, νη πεξηνρέο πξφζδεζεο ηνπ FB πάλσ ζην C3b είλαη εθηεηακέλεο θαη πεξηιακβάλνπλ πνιιέο άιιεο επηθξάηεηεο. Πην επηηπρήο ήηαλ ε πξφβιεςε ηεο πεξηνρήο πξφζδεζεο ηνπ C3b πάλσ ζην FB φζνλ αθνξά ην VWA (D 251 -T 262 θαη D 364 -P 373, Δηθφλα 21α, ραθί), ελψ φζνλ αθνξά ην Ba, ηα ηκήκαηα S 127 -I 132 θαη P 146 -V 152 (Δηθφλα 21α, θφθθηλν) παξακέλνπλ θαηά θχξην ιφγν θξπκκέλα ζην εζσηεξηθφ ηνπ κνξίνπ φπσο θαη ζηε δνκή ηνπ ειεχζεξνπ FB θαη δε ζπκκεηέρνπλ ζεκαληηθά ζηελ πξφζδεζε ζην C3b. ηελ πεξίπησζε ηνπ FD δε, νη βηνρεκηθέο κειέηεο είραλ δείμεη ακηλνμέα θαη βξφγρνπο ηεο πνιππεπηηδηθήο αιπζίδαο πνπ 78

79 είλαη ζεκαληηθά γηα ηελ ελεξγφηεηα θαη είραλ πξνηείλεη φηη ε πξφζδεζε κε ην FB γίλεηαη ζε κηα πεξηνρή έμσ απφ ην θαηαιπηηθφ θέληξν, αιιά δελ είραλ βξεη πνηα είλαη ε πεξηνρή απηή. Απηφ έγηλε γηα πξψηε θνξά εδψ. Με ιίγα ιφγηα δειαδή, ε θξπζηάιισζε ησλ ζπκπιφθσλ ηεο θνλβεξηάζεο θαη πξν-θνλβεξηάζεο ηεο ελαιιαθηηθήο νδνχ έδεημε γηα πξψηε θνξά κε ζηγνπξηά ηηο πεξηνρέο αιιειεπίδξαζεο κεηαμχ ησλ ζπζηαηηθψλ ηεο, ξίρλνληαο θσο ζην κεραληζκφ δξάζεο θαη ξχζκηζήο ηεο θαη αλνίγνληαο ην δξφκν γηα ηνλ ζρεδηαζκφ αλαζηνιέσλ. Δηθόλα 21: α. χγθξηζε ησλ πεξηνρψλ πξφζδεζεο ηνπ C3b θαη FB πνπ είραλ πξνβιεθζεί απφ βηνρεκηθέο κειέηεο κε ηηο απηέο πνπ θαίλνληαη απφ ηελ θξπζηαιιηθή δνκή. Με θαθέ θαίλνληαη νη πεξηνρέο πνπ είραλ επηπιένλ (καδί κε ηηο ραθί) δεηρηεί φηη ζπκκεηέρνπλ ζηελ πξφζδεζε ηνπ C3b απφ ηε κειέηε ηξπςηλνπνίεζεο (δεο εηθφλα 7 ηεο δνκήο ηνπ FB θαη ηνπ C3bBb-SCIN). β. Πεξηνρή πξφζδεζεο ηνπ FB πάλσ ζην FD θαη άιια ζεκαληηθά δνκηθά ζηνηρεία (δεο θαη εηθφλα 8 ηεο δνκήο ηνπ FD). Γείρλνληαη ηα ακηλνμέα ζηα νπνία έρνπλ γίλεη κεηαιιάμεηο, φπσο γηα ην ζεηηθφ κάξηπξα, R115C πνπ βξίζθεηαη έμσ απφ ηελ πεξηνρή πξφζδεζεο, νη κεηαιιάμεηο ηεο πεξηνρήο πξφζδεζεο, R157A, V203D θαη H133A, ε κεηάιιαμε ηνπ αλελεξγνχο FD*, S183A θαη ηέινο ε κεηάιιαμε ζηνλ απην-αλαζηαιηηθφ βξφγρν, R202A. Βηνθπζηθέο θαη βηνρεκηθέο κειέηεο πνπ ζηεξίδνπλ ηα απνηειέζκαηα ηεο θξπζηαιιηθήο δνκήο Σν δηπιό κεηάιιαγκα FB D254G N260D πξνζδέλεηαη ζην C3b κε πνιύ κεγαιύηεξε ζπγγέλεηα θαη απινπνηεκέλν θηλεηηθό πξνθίι ζε ζύγθξηζε κε ην FB ηνπ πιάζκαηνο. 79

80 Γηα ηελ θξπζηάιισζε ησλ ζπκπιφθσλ C3bB θαη C3bBD ρξεζηκνπνηήζεθε ην δηπιφ κεηάιιαγκα FB D254G N260D (θέξδνπο ιεηηνπξγίαο), ην νπνίν φπσο εηπψζεθε ζηελ εηζαγσγή, ζρεκαηίδεη πην ζηαζεξέο θνλβεξηάζεο. Η ζχγθξηζε ηνπ πξνθίι πξφζδεζεο ζην C3b κε απηφ ηνπ FB ηνπ πιάζκαηνο κε SPR παξνπζίᾳ Mg 2+ θαηέδεημε ην κεραληζκφ πνπ επζχλεηαη γηα απηή ηε ζηαζεξφηεηα: Έλα αξρηθφ πείξακα θαηάηαμεο έδεημε φηη ν FB D254G N260D εκθαλίδεη πνιχ πην ηζρπξή πξφζδεζε θαη πνιχ αξγή δηάζηαζε απφ ην C3b ζε ζρέζε κε ηνλ FB ηνπ πιάζκαηνο. Λφγσ απηήο ηεο πνιχ αξγήο δηάζηαζεο, επηιέρζεθε ε κέζνδνο ηεο θηλεηηθήο αλάιπζεο κνλνχ θχθινπ γηα ην ραξαθηεξηζκφ ηνλ αιιειεπηδξάζεσλ, φπσο εμεγείηαη ζην ηκήκα Μέζνδνη θαη Τιηθά. Σν απνηέιεζκα επηβεβαίσζε ηελ πνιχ πην ηζρπξή πξφζδεζε ηνπ δηπινχ κεηαιιάγκαηνο ζην C3b ζε ζρέζε κε ην FB ηνπ πιάζκαηνο, αθνχ ην ζήκα ηνπ πξψηνπ ήηαλ πνιχ πην δπλαηφ απφ ην δεχηεξν γηα ηελ ίδηα νκάδα ζπγθεληξψζεσλ. Γηα ηελ εμαγσγή θηλεηηθψλ παξακέηξσλ γηα ην FB ηνπ πιάζκαηνο, ελέζεθε κηα δεχηεξε νκάδα πςειφηεξσλ ζπγθεληξψζεσλ ε νπνία είρε επίζεο ρακειφηεξν ζήκα πξφζδεζεο απφ ηε κία νκάδα ζπγθεληξψζεσλ ηνπ δηπινχ κεηαιιάγκαηνο (Δηθφλα 22α). Δπηπιένλ, επεηδή ην δηπιφ κεηάιιαγκα δηίζηαηαη απφ ην C3b κε πνιχ πην αξγφ ξπζκφ, ε πξν-θνλβεξηάζε έρεη πνιχ κεγαιχηεξν ρξφλν εκηδσήο φπσο ζα θαλεί ζηελ επφκελε παξάγξαθν. Μηα άιιε ζεκαληηθή δηαθνξά αλάκεζα ζηα δχν FB αθνξά ην πξνθίι ηεο αιιειεπίδξαζεο. Δλψ ην FB ηνπ πιάζκαηνο θαίλεηαη εδψ λα πξνζδέλεηαη ζε δχν βήκαηα, έλα γξήγνξν θαη έλα αξγφ, ην δηπιφ κεηάιιαγκα δελ αθνινπζεί ην ίδην πξνθίι. πγθεθξηκέλα, ε πξνζνκνίσζε ησλ ζεκάησλ ζην κνληέιν πξφζδεζεο 1:1 είλαη πνιχ πεηζηηθή γηα ην δηπιφ κεηάιιαγκα (Δηθφλα 22β θαη 22δ), αιιά παξεθθιίλεη πνιχ ζηελ πεξίπησζε ηνπ κνξίνπ ηνπ πιάζκαηνο. Σν ηειεπηαίν κπνξεί λα πξνζνκνησζεί θαιχηεξα ζην κνληέιν αλλαγής διαμόρθωζης (Δηθφλα 22γ θαη 22δ), γεγνλφο ην νπνίν ζπκθσλεί κε ηα απνηειέζκαηα πνπ πεξηγξάθεθαλ παξαπάλσ γηα ηελ αιιειεπίδξαζε ηνπ FB κε ην C3b κε ηε ζπλήζε κέζνδν θηλεηηθήο αλάιπζεο (πνιιαπιψλ θχθισλ). Δπνκέλσο, θαίλεηαη φηη νη κεηαιιάμεηο D254G θαη N260D πξνζδίδνπλ ζην FB ηελ ηδηφηεηα λα πξνζδέλεηαη ζην C3b ζε έλα βήκα. Δίλαη δειαδή πηζαλφ φηη ην δηπιφ κεηάιιαγκα βξίζθεηαη ήδε ζηελ ελεξγφ δηακφξθσζε θαη δε ρξεηάδεηαη λα αιιάμεη δηακφξθσζε κεηά ηελ πξφζδεζε ζην C3b. 80

81 δ Αλαιπόκελε πξσηεΐλε Κηλεηηθφ κνληέιν k on1 (M -1 s -1 ) k off1 (s -1 ) K D1 (nm) k on2 (M -1 s -1 ) k off2 (s -1 ) K D2 (mm) FB D254G N260D 1:1 2, ,0004 0, FB πιάζκαηνο Αιιαγή δηακφξθσζεο 2, , , , Δηθόλα 22: Κηλεηηθή αλάιπζε κνλνχ θχθινπ ηεο πξφζδεζεο ηνπ FB ζην C3b. α. χγθξηζε δχν νκάδσλ ζπγθεληξψζεσλ ηνπ FB απφ αλζξψπηλν πιάζκα κε κία ηνπ κεηαιιάγκαηνο «θέξδνπο ιεηηνπξγίαο» D254G N260D. Έλζεην: ζχγθξηζε ηεο ίδηαο νκάδαο ζπγθεληξψζεσλ γηα ηηο δχν πξσηεΐλεο. β. Πξνζνκνίσζε ηνπ ζήκαηνο πξφζδεζεο ηνπ κεηαιιάγκαηνο FB D254G N260D ζην C3b (καχξν) ζην κνληέιν 1:1 (θφθθηλν). γ. Πξνζνκνίσζε ηνπ ζήκαηνο πξφζδεζεο ηνπ FB ηνπ πιάζκαηνο ζην C3b (καχξν) ζην κνληέιν αιιαγήο δηακφξθσζεο (θφθθηλν). δ. Κηλεηηθέο παξάκεηξνη πνπ πξνέθπςαλ απφ ηηο παξαπάλσ πξνζνκνηψζεηο. Γηα ην FB ηνπ πιάζκαηνο, νη παξάκεηξνη πξνέξρνληαη απφ ηελ πξνζνκνίσζε κφλν ηεο πςειφηεξεο νκάδαο ζπγθεληξψζεσλ. 81

82 Σν FD* πξνζδέλεηαη κε ην FB κε πςειή ζπγγέλεηα, κόλν όηαλ ην ηειεπηαίν είλαη πξνζδεδεκέλν ζην C3b. Απφ ηελ θξπζηαιιηθή δνκή ηεο πξνθνλβεξηάζεο θαίλεηαη φηη ν FD δελ έξρεηαη ζε επαθή κε ην C3b, ην νπνίν επηβεβαηψζεθε κέζσ SPR: Ο FD αγξίνπ ηχπνπ δελ δίλεη ζήκα πξφζδεζεο, ελψ ν FB αγξίνπ ηχπνπ πξνζδέλεηαη κε ην ζπλεζηζκέλν πξνθίι. Έλεζε ηνπ κίγκαηνο ησλ δχν πξσηετλψλ νδεγεί ζε πςειφηεξν ζήκα απφ απηφ ηνπ FB κε δηαθνξεηηθφ πξνθίι, ραξαθηεξηζηηθφ ηνπ ζρεκαηηζκνχ ηεο θνλβεξηάζεο (Δηθφλα 23α). Καηά ηε θάζε πξφζδεζεο, ην ζήκα είλαη έλα κηθηφ ζήκα: αληηπξνζσπεχεη ηελ πξφζδεζε ηνπ FB ζην C3b θαη ηνπ FD ζην FB, θαζψο θαη ηελ πέςε θαη απνκάθξπλζε ηνπ Ba. Καηά ηε θάζε δηάζηαζεο, ην Bb απνκαθξχλεηαη απφ ην C3b. Γηα λα βξεζεί ε ζπγγέλεηα ηνπ FD πξνο ην FB, ρξεζηκνπνηήζεθε ην αλελεξγφ κεηάιιαγκα FD* νχησο ψζηε ην αληρλεπφκελν ζήκα λα αληηζηνηρεί κφλν ζηελ πξφζδεζε θαη φρη ζηελ πέςε θαη απνκάθξπλζε ηνπ ηκήκαηνο Ba. Πξψηα επηηξάπεθε ε πξφζδεζε ηνπ FB ζην C3b. Υξεζηκνπνηήζεθε ην δηπιφ κεηάιιαγκα D254G N260D ψζηε ην ζχκπινθν λα παξακείλεη ζηαζεξφ γηα ρξνληθφ δηάζηεκα αξθεηφ γηα λα επηηξέςεη ηελ έλεζε ηνπ FD*. Έπεηηα ελέζεθαλ ηαπηφρξνλα (ζε παξάιιεινπο δηαδξφκνπο) 5 δηαδνρηθέο ζπγθεληξψζεηο ηνπ FD*, θαζψο θαη δηάιπκα, ην ζήκα ηνπ νπνίνπ αθαηξέζεθε απφ ηα ζήκαηα ηνπ FD* γηα λα δηνξζσζεί ε θιίζε ηεο θακπχιεο πνπ πξνθαιείηαη απφ ηελ αξγή δηάζηαζε ηνπ FB D254G N260D. Σα ζήκαηα πξνζνκνηψζεθαλ κέηξηα ζην κνληέιν πξφζδεζεο 1:1 θαη θαιχηεξα ζην κνληέιν εηερογένειας ηοσ προζδέηη. Η θαηλνκεληθή ζπγγέλεηα θπκαίλεηαη ζηα ιίγα nm (Δηθφλα 23β θαη 23γ). k a1 k d1 K D1 Μνληέιν (10 6 M -1 s -1 ) (10-2 s -1 ) (nm) (10 6 M -1 s -1 ) (10-2 s -1 ) (nm) 1: Δηεξνγέλεηα k a2 k d2 K D2 ρ 2 82

83 ηνπ πξνζδέηε (2 γεγνλφηα πξφζδεζεο) Δηθόλα 23: Μειέηεο αιιειεπίδξαζεο ηνπ FD κε ην FB. α. Σν FB, FD θαη ν ζπλδπαζκφο ηνπο ελέζεθαλ πάλσ απφ επηθάλεηα C3b. β. Γηαδνρηθέο αξαηψζεηο ηνπ FD* πάλσ απφ πξνζρεκαηηζκέλν ζχκπινθν C3bB D254G N260D. Σν έλζεην δείρλεη ηε ζπλνιηθή δνθηκαζία, φπνπ ε ίδηα ζπγθέληξσζε FB D254G N260D ελέζεθε πάλσ απφ φιεο ηηο επηθάλεηεο κε C3b θαη έπεηηα ελέζεθαλ νη δηαδνρηθέο αξαηψζεηο FD*. Σα επεμεξγαζκέλα ζήκαηα ζην β (καχξεο θακπχιεο) πξνζνκνηψλνληαη ηθαλνπνηεηηθά ζην πην πεξίπινθν κνληέιν ηεο εηερογένειας ηοσ προζδέηη πνπ αληηζηνηρεί ζε δχν γεγνλφηα πξφζδεζεο (θφθθηλεο θακπχιεο), αιιά φρη ηφζν θαιά ζην κνληέιν πξφζδεζεο 1:1 (πξάζηλεο θακπχιεο). Ο πίλαθαο γ δείρλεη ηηο πξνθαλείο ηηκέο ησλ ξπζκψλ πξφζδεζεο θαη δηάζηαζεο θαζψο θαη ηεο ζπγγέλεηα φπσο πξνθχπηεη απφ ηα δχν κνληέια. Μεηαιιάγκαηα ηνπ FD ησλ ζεκείσλ πξόζδεζεο ζην FB δελ ζρεκαηίδνπλ ηελ θνλβεξηάζε. Η θξπζηαιιηθή δνκή ηεο πξνθνλβεξηάζεο ζε ζχκπινθν κε ην FD* αλέδεημε ηελ πεξηνρή πξφζδεζήο ηνπ κε ην FB, ε νπνία βξίζθεηαη εθηφο ηνπ θαηαιπηηθνχ θέληξνπ ηνπ πξψηνπ, θαζψο θαη ηε ζεκαζία κεηαηφπηζεο ηνπ απην-αλαζηαιηηθνχ βξφγρνπ γηα ηελ επαγσγή ηεο ελεξγνχο κνξθήο ηνπ FD. Γηα ηελ επηβεβαίσζε απηψλ ησλ απνηειεζκάησλ, παξάρζεθαλ δηάθνξα κεηαιιάγκαηα ηνπ FD ζηα ακηλνμέα πνπ ζχκθσλα κε ηελ θξπζηαιιηθή δνκή εκπιέθνληαη ζηελ πξφζδεζε ζην FB. Έπεηηα, εμεηάζηεθε κε δχν δηαθνξεηηθέο δνθηκαζίεο SPR ε ηθαλφηεηα απηψλ ησλ κεηαιιαγκάησλ γηα δεκηνπξγία ηεο θνλβεξηάζεο, θαζψο θαη ελεξγνπνίεζεο ηεο ζπλαξκνινγεκέλεο πξν-θνλβεξηάζεο (κέζσ ηεο πξφζδεζεο θαη πέςεο ηνπ FB φηαλ απηφ είλαη πξνζδεδεκέλν ζην C3b). ηελ πξψηε δνθηκαζία, ηα κεηαιιάγκαηα αλακίρζεθαλ κε ην FB ζε ηζνκνξηαθή ζπγθέληξσζε θαη ελέζεθαλ πάλσ απφ επηθάλεηα κε C3b. Δθηφο απφ ην κφξην αγξίνπ ηχπνπ θαη ην ζεηηθφ κάξηπξα R115C (ε κεηάιιαμε απηή ηνπνζεηείηαη ζηελ επηθάλεηα ηνπ κνξίνπ αιιά εθηφο ηνπ ζεκείνπ πξφζδεζεο ζην FB) πνπ ζπκπεξηθέξζεθαλ φκνηα, ηα ππφινηπα κεηαιιάγκαηα ηνπ ζεκείνπ πξφζδεζεο (R157A θαη H133A) απέηπραλ λα ζρεκαηίζνπλ θνλβεξηάζε. (Δηθφλα 24α) Σν ζήκα ηνπ κίγκαηφο ηνπο κε ην FB έκνηαδε κε απηφ ηνπ FB κφλν ηνπ, φπσο έγηλε θαη κε ηνλ θαηαιπηηθά αλελεξγφ, αξλεηηθφ κάξηπξα S183A. Σν κεηάιιαγκα ζην ακηλνμχ πνπ πξνθαιεί κεηαηφπηζε ηνπ αλαζηαιηηθνχ βξφγρνπ (R202A) είρε κεησκέλε ηθαλφηεηα ζρεκαηηζκνχ θνλβεξηάζεο ζε ζρέζε κε ην κφξην αγξίνπ ηχπνπ (Δηθφλα 24β). Απηφ ζπκθσλεί κε ηηο πξνβιέςεηο γηα ηε ζεκαζία ηνπ ακηλνμένο απηνχ σο ζεκείν αιιειεπίδξαζεο κε ην FB πνπ επεξεάδεη ηελ εηδηθφηεηα πξφζδεζεο. 83

84 ηε δεχηεξε δνθηκαζία ζρεκαηίζηεθε αξρηθά ε πξν-θνλβεξηάζε, κε έλεζε ηνπ δηπινχ κεηαιιάγκαηνο FB πάλσ απφ ην C3b θαη, κεηά απφ κηα έλεζε δηαιχκαηνο, πξαγκαηνπνηήζεθε έλεζε ησλ δηαθφξσλ κεηαιιαγκάησλ FD. Σν κφξην αγξίνπ ηχπνπ θαη ν ζεηηθφο κάξηπξαο R115C πξνθάιεζαλ ηελ ίδηα πηψζε ηνπ ζήκαηνο ιφγσ ηεο πέςεο θαη απνκάθξπλζεο ηνπ ηκήκαηνο Ba απφ ην FB. Μάιηζηα απηή ε πηψζε αληηζηνηρεί πεξίπνπ ζην έλα ηξίην ηνπ ζήκαηνο ηνπ FB, ην νπνίν ζπκθσλεί κε ην φηη ε κάδα ηνπ Ba είλαη ην έλα ηξίην απηήο ηνπ FB. Μηα ηειηθή έλεζε FD αγξίνπ ηχπνπ επηβεβαίσλε πάληα ηελ επαηζζεζία ηνπ FB ζηελ πέςε. Σα κεηαιιάγκαηα ηεο πεξηνρήο πξφζδεζεο (R157A, H133A θαη V203D) θαη ν αξλεηηθφο κάξηπξαο δελ πξνθάιεζαλ θακηά αιιαγή ζην ζήκα, δείρλνληαο φηη δελ πξνζδέλνληαη νχηε πέπηνπλ ην FB, αληηζηνίρσο, ππφ απηέο ηηο ζπλζήθεο (Δηθφλα 24γ). Δηθόλα 24: α-β, Γνθηκαζία SPR ζρεκαηηζκνχ ηεο θνλβεξηάζεο πνπ γίλεηαη κε ξνή κίγκαηνο FB θαη FD πάλσ απφ επηθάλεηα κε C3b. α, Γνθηκαζία ζην Biacore 3000 κεηαιιαγκάησλ FD ηνπ ζεκείνπ πξφζδεζεο θαη ελφο κεηαιιάγκαηνο ηεο επηθαλείαο ηνπ FD (R115C) σο ζεηηθνχ κάξηπξα. β, Γνθηκαζία ζην ProteOn XPR36 ηνπ κεηαιιάγκαηνο R202A. γ, Γνθηκαζία SPR ελεξγνπνίεζεο ηεο πξν-θνλβεξηάζεο C3bB D254G N260D απφ ηα δηάθνξα κεηαιιάγκαηα ηνπ ζεκείνπ πξφζδεζεο ηνπ FB πάλσ ζην FD. 84

85 Μεηαιιάγκαηα ηνπ FD ησλ ζεκείσλ πξόζδεζεο ζην FB δελ κπνξνύλ αλαζπζηήζνπλ ηε ιεηηνπξγηθόηεηα ηεο ελαιιαθηηθήο νδνύ ζε πιάζκα από ην νπνίν έρεη αθαηξεζεί ν FD. Γηα ηελ επηβεβαίσζε ησλ παξαπάλσ απνηειεζκάησλ ζε πην ιεηηνπξγηθφ επίπεδν εμεηάζηεθε ε δπλαηφηεηα ησλ δηαθφξσλ κεηαιιαγκάησλ ηνπ FD λα ζπκκεηάζρνπλ ζηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο κέζσ ηεο ελαιιαθηηθήο νδνχ. Γηα ην ζθνπφ απηφ εηνηκάζηεθε αξρηθά πιάζκα ειεχζεξν απφ FD, ην νπνίν δελ είρε ηε δπλαηφηεηα γηα ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο. Απηφ επηβεβαηψζεθε κε κία δνθηκαζία ηχπνπ ELISA φπνπ εμεηάζηεθε ε ελαπφζεζε C3b ιφγσ ηεο ελεξγνπνίεζεο ηεο ελαιιαθηηθήο νδνχ απφ ιηπνπνιπζαθραξίηεο. ηελ πεξίπησζε ηνπ πιάζκαηνο πνπ είλαη ειεχζεξν απφ FD δελ ππήξμε ελαπφζεζε ηνπ C3b, ε νπνία φκσο έιαβε ρψξα ζηελ πεξίπησζε ηεο πξνζζήθεο θπζηνινγηθήο ζπγθέληξσζεο FD αγξίνπ ηχπνπ ζην πιάζκα πνπ ήηαλ ειεχζεξν απφ FD (αλαζχζηαζε) ή ηεο ρξήζεο άζηθηνπ πιάζκαηνο (Δηθφλα 25α). Με ηελ ίδηα δνθηκαζία έγηλε ε ζχγθξηζε ησλ δηαθφξσλ FD θαη παξαηεξήζεθε φηη ηα κεηαιιάγκαηα ηνπ ζεκείνπ πξφζδεζεο ζην FB θαη ην θαηαιπηηθά αλελεξγφ κεηάιιαγκα δελ αλαζπζηήλνπλ ηελ ελεξγφηεηα ηνπ πιάζκαηνο, ελψ νη ζεηηθνί κάξηπξεο (κφξην αγξίνπ ηχπνπ θαη κεηάιιαγκα R115C) αλαζπζηήλνπλ ηελ ελεξγφηεηα ζε ζπγθξίζηκα επίπεδα (Δηθφλα 25β). Δπίζεο ρξεζηκνπνηήζεθε κηα αηκνιπηηθή δνθηκαζία φπνπ έλα ελαηψξεκα εξπζξνθπηηάξσλ θνπλειηνχ αλακίρζεθε κε δηάθνξνπο φγθνπο πιάζκαηνο θαη κεηά απφ επψαζε κεηξήζεθε ην θφθθηλν ρξψκα πνπ πξνέθπςε απφ ηε ιχζε ηνπο. Ο φγθνο πιάζκαηνο πνπ έδσζε 50% ιχζεο ήηαλ απηφο πνπ ρξεζηκνπνηήζεθε έπεηηα γηα ηε δνθηκαζία κε πιάζκα ρσξίο FD θαη ηελ πξνζζήθε ησλ δηαθφξσλ κεηαιιαγκάησλ FD ζε απηφ. ε ζπκθσλία κε ηα παξαπάλσ, ηα κεηαιιάγκαηα ηνπ ζεκείνπ πξφζδεζεο ζην FB θαη ην θαηαιπηηθά αλελεξγφ κεηάιιαγκα δελ νδήγεζαλ ζηε ιχζε ησλ εξπζξνθπηηάξσλ, ζε αληίζεζε κε ην FD αγξίνπ ηχπνπ θαη ην κεηάιιαγκα R115C, ηα νπνία πξνθάιεζαλ ζπγθξίζηκε ιχζε (Δηθφλα 25γ). 85

86 Δηθόλα 25: α. Γνθηκαζία ELISA γηα ηελ επηβεβαίσζε ηεο απψιεηαο ελεξγφηεηαο ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο φηαλ αθαηξείηαη ην FD απφ ην πιάζκα θαη ηεο αλαζχζηαζεο απηήο φηαλ πξνζηίζεηαη εμσγελέο FD. β-γ. Γνθηκαζίεο αλαζχζηαζεο ηεο ελεξγφηεηαο ηεο ελαιιαθηηθήο νδνχ ηνπ πιάζκαηνο πνπ είλαη ειεχζεξν απφ FD φηαλ πξνζηίζεληαη εμσγελψο δηάθνξα κεηαιιάγκαηα FD. β. Γνθηκαζία ELISA, γ. Αηκνιπηηθή δνθηκαζία. πκπεξαζκαηηθά, φια ηα βηνρεκηθά δεδνκέλα ζπκθσλνχλ κε ηα δνκηθά θαη θαηαδεηθλχνπλ φηη ε ελδπκαηηθή εηδηθφηεηα ηνπ FD σο πξνο ην FB θαη ε αδπλακία πέςεο κηθξφηεξσλ ζπλζεηηθψλ ππνζηξσκάησλ νθείιεηαη ζηελ απαίηεζε γηα εηδηθή πξφζδεζε ηνπ FD ζην ππφζηξσκά ηνπ κέζσ κηαο πεξηνρήο ηνπ πνπ είλαη έμσ απφ ηελ θαηαιπηηθή πεξηνρή. Δλψ ε πξφζδεζε ηνπ ππνζηξψκαηνο δελ θαίλεηαη λα πξνθαιεί αιιαγή δηακφξθσζεο ζηελ πεξηνρή απηή, πξνθαιεί ηε κεηαηφπηζε ηνπ απην-αλαζηαιηηθνχ βξφγρνπ (πνπ ζηελ ειεχζεξε κνξθή θαιχπηεη ην ελεξγφ θέληξν ηνπ ελδχκνπ), γηα λα επηηξέςεη ηελ πξφζβαζε ηνπ βξφγρνπ ηνπ FB πνπ ζα θνπεί κέζα ζην ελεξγφ θέληξν ηνπ FD. Απηφ ζπκθσλεί κε ηνλ κεραληζκφ πνπ είρε πξνβιεθζεί θαη ηνλ εκπινπηίδεη αθνχ γηα πξψηε θνξά βξέζεθαλ ηα ζεκεία πξφζδεζεο αλάκεζα ζηνλ FB θαη FD. (101) 86

87 Βειηίσζε ηεο ζηαζεξόηεηαο ηνπ αλαζηνιέα ηνπ ζπκπιεξώκαηνο compstatin. Η compstatin είλαη έλαο πνιιά ππνζρψκελνο αλαζηνιέαο ηνπ ζπκπιεξψκαηνο πνπ αλ πεξάζεη κε επηηπρία ηηο θιηληθέο δνθηκέο ζα είλαη έλα απφ ηα ιίγα δηαζέζηκα θάξκαθα πνπ ζηνρεχνπλ ην ζπκπιήξσκα. Κάζε πξνζπάζεηα βειηίσζεο ηεο ελεξγφηεηαο, ζηαζεξφηεηαο θαη θαξκαθνθηλεηηθήο ηνπ κνξίνπ είλαη επνκέλσο ζεκαληηθή. Έλα απαξαίηεην ραξαθηεξηζηηθφ γηα ηελ ελεξγφηεηα ηεο compstatin είλαη ε παξνπζία ηνπ δηζνπιθηδηθνχ δεζκνχ πνπ ζπγθξαηεί ην κφξην ζε θπθιηθή κνξθή. Οη δηζνπιθηδηθνί δεζκνί πξσηετλψλ θαη πεπηηδίσλ φκσο κπνξεί λα αλαρζνχλ (λα δηαζπαζηνχλ) θάησ απφ αλαγσγηθέο ζπλζήθεο. Δδψ εμεηάζηεθε ε ελεξγφηεηα ελφο αλαιφγνπ ζην νπνίν αληηθαηαζηάζεθε ν δηζνπιθηδηθφο δεζκφο κε ηνλ πην ζηαζεξφ ζεηναηζεξηθφ δεζκφ, ν νπνίνο δε δηαζπάηαη κε αλαγσγή θαη επνκέλσο πξνζθέξεη απμεκέλε ζηαζεξφηεηα. πγθεθξηκέλα, πξαγκαηνπνηήζεθε θηλεηηθή αλάιπζε γηα ηελ εχξεζε ηεο ζπγγέλεηαο ησλ λέσλ αλαιφγσλ πξνο ην C3b, θαζψο θαη δνθηκαζία αλαζηνιήο ηνπ ζπκπιεξψκαηνο θαη βξέζεθε φηη ηα λέα αλάινγα δηαηεξνχλ πςειή ελεξγφηεηα. Δπίζεο απνδείρηεθε ε ζηαζεξφηεηα ηνπ ζεηναηζέξα ζε ηζρπξά αλαγσγηθέο ζπλζήθεο. Αληίζεηα, φπσο πξνβιέπεηαη γηα απηφ ηνλ ηχπν δεζκνχ, βξέζεθε φηη ν ζεηναηζέξαο κπνξεί λα νμεηδσζεί ζε ηζρπξά νμεηδσηηθέο ζπλζήθεο. Ωζηφζν, βξέζεθε επίζεο φηη ε νμείδσζε δελ αθαηξεί ηειείσο ηελ ελεξγφηεηα ηνπ κνξίνπ φπσο ζπκβαίλεη θαηά ηελ αλαγσγή ηνπ αλαιφγνπ κε ην δηζνπιθηδηθφ δεζκφ. Κηλεηηθή αλάιπζε κε SPR αλαιόγσλ ηεο compstatin κε γέθπξα ζεηναηζέξα Γηα κηα πξψηε εθηίκεζε ηεο ελεξγφηεηαο ησλ λέσλ αλαιφγσλ κε SPR, απηά ελέζεθαλ πάλσ απφ αθηλεηνπνηεκέλν C3b ζηε ίδηα ζπγθέληξσζε ηνπ 1 κm. πσο θαίλεηαη ζηελ Δηθφλα 26, ην αλάινγν 2 κε ηελ νκνθπζηεΐλε ζηε ζέζε 2 πξνζδέλεηαη ζην C3b ιηγφηεξν ηζρπξά απφ φια ηα αλάινγα. Σν αλάινγν 3 πνπ πεξηέρεη ηελ νκνθπζηεΐλε ζηε ζέζε 12 θαίλεηαη εδψ λα πξνζδέλεηαη κε ηζρχ ζπγθξίζηκε κε απηή ηνπ αληίζηνηρνχ ηνπ ζεηηθνχ κάξηπξα 1. Σν αλάινγν 5 θαίλεηαη λα πξνζδέλεηαη κε ζπγθξίζηκν ξπζκφ κε ην αλάινγν 4, αιιά δηίζηαηαη αξθεηά πην γξήγνξα. (Γηα ηηο αιιεινπρίεο ησλ αλαιφγσλ, βιέπε Δηθφλα 13.) 87

88 Δηθόλα 26: Κηλεηηθή θαηάηαμε ησλ αλαιφγσλ ηεο compstatin ζε ζπγθέληξσζε 1κM. Σν απνηέιεζκα είλαη αληηπξνζσπεπηηθφ ηνπιάρηζηνλ ηξηψλ νκάδσλ δεδνκέλσλ. Γηα ηελ πνζνηηθνπνίεζε ησλ ζηαζεξψλ πξφζδεζεο θαη δηάζηαζεο πξαγκαηνπνηήζεθε θηλεηηθή αλάιπζε κνλνχ θχθινπ φπνπ πέληε απμαλφκελεο ζπγθεληξψζεηο πεπηηδίνπ ελέζεθαλ πάλσ απφ ην C3b. Ο ζπγθεθξηκέλνο ηχπνο αλάιπζεο επηιέρηεθε, γηαηί επηηξέπεη ηελ γξήγνξε αλάιπζε αιιειεπηδξάζσλ κε αξγφ ξπζκφ δηάζηαζεο, φπσο ην πεπηίδην 4. ια ηα πεπηίδηα αλαιχζεθαλ κε ηελ ίδηα κέζνδν, γηα λα είλαη άκεζα ζπγθξίζηκα ηα απνηειέζκαηα. πγθεθξηκέλα, κία νκάδα ζπγθεληξψζεσλ ήηαλ θνηλή γηα φια ηα πεπηίδηα, ε νπνία ήηαλ αξθεηή γηα ηνλ ραξαθηεξηζκφ ηνπ αλαιφγνπ 4 θαη 5. Μία επηπιένλ, πςειφηεξε νκάδα ζπγθεληξψζεσλ ρξεζηκνπνηήζεθε γηα ηα αλάινγα 1, 2 θαη 3. πσο θαίλεηαη, ηα ζήκαηα φισλ ησλ πεπηηδίσλ κπνξνχλ λα πξνζνκνησζνχλ ζην κνληέιν πξφζδεζεο 1:1. Σα πεπηίδηα ηεο νκάδαο 4W9A (1, 2, 3) εκθαλίδνπλ γξήγνξε πξφζδεζε θαη δηάζηαζε, ελψ ηα πεπηίδηα ηεο νκάδαο Compstatin 20 (4 θαη 5) εκθαλίδνπλ γξήγνξε πξφζδεζε, αιιά πην αξγή δηάζηαζε. Ο ξπζκφο πξφζδεζεο είλαη ζπγθξίζηκνο αλάκεζα ζηα αλάινγα ηεο θάζε νκάδαο, ελψ κεγαιχηεξεο δηαθνξέο παξαηεξνχληαη ζην ξπζκφ δηάζηαζεο, νη νπνίεο θαη θαζνξίδνπλ ηηο δηαθνξέο ζηε ζπγγέλεηα. πγθεθξηκέλα, ην πεπηίδην 2 δηίζηαηαη 6 θνξέο γξεγνξφηεξα θαη έρεη 6 θνξέο ρακειφηεξε ζπγγέλεηα απφ ην πεπηίδην 1. Σν αλάινγν 3 πξνζδέλεηαη κε ειαθξψο πην αξγφ ξπζκφ θαη δηίζηαηαη κε ειαθξψο πην γξήγνξν ξπζκφ δίλνληαο πεξίπνπ 1.6 θνξέο ρακειφηεξε ζπγγέλεηα ζε ζρέζε κε ην κεηξηθφ κφξην. Σν αλάινγν 5, ηέινο, πξνζδέλεηαη κε ζπγθξίζηκν ξπζκφ κε ην αληίζηνηρν κεηξηθφ κφξην 4, αιιά δηίζηαηαη 3 θνξέο πην γξήγνξα, ην νπνίν νδεγεί ζε πεξίπνπ 3.8 θνξέο κηθξφηεξε ζπγγέλεηα (Δηθφλα 27 θαη Πίλαθαο 2). 88

89 Δηθόλα 27: Κηλεηηθή αλάιπζε κνλνχ θχθινπ ησλ αλαιφγσλ ηεο compstatin. Γχν νκάδεο ζπγθεληξψζεσλ, 0,46-37 nm θαη nm εμεηάζηεθαλ γηα ηα αλάινγα 1, 2 θαη 3, αιιά κφλν ε νκάδα 0,46-37 nm εμεηάζηεθε ζηελ πεξίπησζε ησλ αλαιφγσλ 4 θαη 5. Μαχξεο θακπχιεο: πεηξακαηηθά ζήκαηα, πνξηνθαιί θακπχιεο: πξνζνκνίσζε ζην κνληέιν πξφζδεζεο 1:1. Σν απνηέιεζκα είλαη αληηπξνζσπεπηηθφ ηνπιάρηζηνλ έμη νκάδσλ δεδνκέλσλ. Σν γεγνλφο φηη ε ζηαζεξά ηνπ ξπζκνχ πξφζδεζεο είλαη παξφκνηα γηα ηα αλάινγα ηεο θάζε νκάδαο δείρλεη φηη ε αληηθαηάζηαζε ηνπ δηζνπιθηδηθνχ δεζκνχ κε ην ζεηναηζέξα δελ επεξεάδεη ηελ αξρηθή αλαγλψξηζε θαη πξφζδεζε ηεο compstatin ζην C3b. Αληίζεηα, θαίλεηαη φηη αθνχ γίλεη ε πξφζδεζε ηεο compstatin θαη επέιζεη αιιαγή ηεο δηακφξθσζήο ηεο, ηφηε ε δηαθνξεηηθή ηνπνινγία ηεο γέθπξαο ηνπ ζεηναηζέξα επεξεάδεη αξλεηηθά ηε ζηαζεξφηεηα ηνπ ζπκπιφθνπ. Απηφ εθθξάδεηαη κε ηελ αχμεζε ηεο ζηαζεξάο ηνπ ξπζκνχ δηάζηαζεο. Η αχμεζε απηή είλαη πην εκθαλήο ζηελ πεξίπησζε ηνπ αλαιφγνπ 5, ίζσο γηαηί ν αληίζηνηρφο ηνπ κάξηπξαο, πεπηίδην 4, είρε βειηηζηνπνηεζεί γηα ηελ πξφζδεζε ζην C3b. Αλαζηνιή ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξώκαηνο από ηα αλάινγα ηεο compstatin κε γέθπξα ζεηναηζέξα Γηα ηελ εμέηαζε ηεο ιεηηνπξγηθφηεηαο ησλ λέσλ αλαιφγσλ ρξεζηκνπνηήζεθε κηα δνθηκαζία ηχπνπ ELISA φπνπ ε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο ηνπ πιάζκαηνο (κέζσ ηεο θιαζζηθήο νδνχ) επάγεηαη απφ ζχκπινθα αληηγφλνπ αληηζψκαηνο, νδεγψληαο ζηελ ελαπφζεζε C3b. Η παξνπζία δηαδνρηθψλ αξαηψζεσλ ηεο compstatin νδεγεί ζε αληίζηνηρε κείσζε ηεο ελαπφζεζεο ηνπ C3b ε νπνία εθθξάδεηαη σο πνζνζηφ αλαζηνιήο ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο ζε ζχγθξηζε κε έλα κάξηπξα ρσξίο πεπηίδην (100% ελεξγνπνίεζε, δει. 0% αλαζηνιή). ε 89

90 ζπκθσλία κε ηα απνηειέζκαηα ηεο θηλεηηθήο αλάιπζεο, ην αλάινγν 2 είλαη ην ιηγφηεξν ελεξγφ, επηβεβαηψλνληαο φηη ε ηνπνζέηεζε ηεο νκνθπζηεΐλεο ζηε ζέζε 2 δελ είλαη επλντθή. Αληίζεηα, ην αλάινγν 3 είλαη κφλν 1.6 θνξέο ιηγφηεξν ελεξγφ απφ ηνλ αληίζηνηρν κάξηπξα κε δηζνπιθηδηθφ δεζκφ, ην αλάινγν 1. Παξνκνίσο, ην αλάινγν 5 είλαη κφλν 2.1 θνξέο ιηγφηεξν ελεξγφ ζε ζρέζε κε ην αλάινγν 4 (Δηθφλα 28 θαη Πίλαθαο 2). Δπνκέλσο, φπσο θαη ζε πξνεγνχκελεο κειέηεο, ε ζρεηηθή ζπγγέλεηα ησλ αλαιφγσλ κε ην C3b έξρεηαη ζε ζπκθσλία κε ηε ζρεηηθή ελεξγφηεηά ηνπο σο αλαζηνιείο ηνπο ζπκπιεξψκαηνο. Η κείσζε ηεο ελεξγφηεηαο ησλ λέσλ αλαιφγσλ δελ είλαη κεγάιε θαη απηά παξακέλνπλ ηζρπξνί αλαζηνιείο, έρνληαο ην πιενλέθηεκα ηεο απμεκέλεο ζηαζεξφηεηαο πνπ πξνζδίδεη ε γέθπξα ζεηναηζέξα. Δηθόλα 28: Γξάζε ησλ αλαιφγσλ ηεο compstatin σο αλαζηνιείο ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο απφ ζχκπινθα αληηγφλνπ αληηζψκαηνο. Σν απνηέιεζκα είλαη αληηπξνζσπεπηηθφ ηνπιάρηζηνλ πέληε πεηξακάησλ. Πίλαθαο 2: ηαζεξέο ξπζκψλ πξφζδεζεο θαη δηάζηαζεο, ζπγγέλεηεο (ζχκθσλα κε ην κνληέιν πξφζδεζεο 1:1), αλαζηαιηηθή ελεξγφηεηα θαη ζρεηηθή αλαζηαιηηθή ελεξγφηεηα (ΓIC 50) ησλ αλαιφγσλ ηεο compstatin. Πεπηίδην k a (10 5 M -1 s -1 ) α k d (10-2 s -1 ) α K D (nm) α IC 50 (nm) β ΓIC ± ± ± ± ± ± ± 59 > > ± ± ± ± ± ± ± ± ± ± ± ± α Σα απνηειέζκαηα δείρλνπλ ην κέζν φξν θαη ηελ ηππηθή απφθιηζε απφ ηνπιάρηζηνλ έμη νκάδεο δεδνκέλσλ. β Σα απνηειέζκαηα δείρλνπλ ην κέζν φξν θαη ηελ ηππηθή απφθιηζε απφ ηνπιάρηζηνλ πέληε νκάδεο δεδνκέλσλ. 90

91 Δπαηζζεζία ησλ αλαιόγσλ ηεο compstatin ζε αλαγσγή θαη νμείδσζε θαη επίδξαζε ζηε ιεηηνπξγηθόηεηά ηνπο Σα πην ελεξγά αλάινγα 4 θαη 5 επηιέρζεθαλ γηα ηελ πεξαηηέξσ κειέηε ησλ επηπηψζεσλ έθζεζεο ζε αλαγσγηθέο θαη νμεηδσηηθέο ζπλζήθεο. ηελ πξψηε πεξίπησζε ρξεζηκνπνηήζεθε ν αλαγσγηθφο παξάγνληαο TCEP θαη παξαηεξήζεθε αιιαγή κάδαο +2 ηνπ αλαιφγνπ 4 πνπ πεξηέρεη δηζνπιθηδηθφ δεζκφ, ε νπνία αληηζηνηρεί ζηελ πξνζζήθε δχν πδξνγφλσλ, δειαδή ζηελ αλαγσγή (Δηθφλα 29α). Αληίζεηα ε κάδα ηνπ αλαιφγνπ 5 παξέκεηλε ε ίδηα, απνδεηθλχνληαο ηελ αλακελφκελε ζηαζεξφηεηα ηνπ ζεηναηζέξα (Δηθφλα 29β). Δηθόλα 29: Απνηέιεζκα έθζεζεο ησλ αλαιφγσλ 4 θαη 5 ζηνλ αλαγσγηθφ παξάγνληα TCEP. 91

92 Σαπηφρξνλα, επεηδή σο γλσζηφλ ν ζεηναηζέξαο είλαη επηξξεπήο ζε νμείδσζε ζεσξήζεθε αλαγθαίν λα εμεηαζηεί απηή ηδηφηεηα, παξφιν πνπ θαηά ηε ζχλζεζε, ηνλ θαζαξηζκφ, ηηο ιεηηνπξγηθέο θαη βηνινγηθέο κειέηεο θαη ηελ απνζήθεπζε δελ παξαηεξήζεθε νμείδσζε ηνπ αλαιφγνπ 5. Η αλάιπζε απηή είλαη απαξαίηεηε γηαηί έρεη βξεζεί φηη ε νμείδσζε ηνπ ζεηναηζέξα ελφο πεπηηδίνπ κπνξεί λα επεξεάζεη ηελ ελεξγφηεηά ηνπ, φπσο ζηελ πεξίπησζε ηεο ληζίλεο φπνπ επέξρεηαη απψιεηα ελεξγφηεηαο (102) θαη ζηελ πεξίπησζε ηεο actagardine, φπνπ αληίζεηα ε νμείδσζε είλαη απαξαίηεηε γηα ηελ ελεξγφηεηα (103). ηαλ ινηπφλ ην πεπηίδην εθηέζεθε ζε ππεξνμείδην ηνπ πδξνγφλνπ ππφ βαζηθέο ζπλζήθεο, ηφηε επηηεχρζεθε ε επηιεθηηθή νμείδσζε ηνπ ζεηναηζέξα φπσο θαηαδεηθλχεηαη απφ ηελ αιιαγή κάδαο +16 πνπ αληηζηνηρεί ζηελ πξνζζήθε νμπγφλνπ (Δηθφλα 30α). Αληίζεηα, ην αλάινγν 4 δελ επεξεάζηεθε απφ απηή ηε δηαδηθαζία (Δηθφλα 30β). 92

93 Δηθόλα 30: Απνηέιεζκα έθζεζεο ησλ αλαιφγσλ 4 θαη 5 ζηνλ νμεηδσηηθφ παξάγνληα Η 2Ο 2. Δπνκέλσο, ην αλάινγν 4 είλαη επαίζζεην ζηελ αλαγσγή θαη ην αλάινγν 5 ζηελ νμείδσζε. Τπάξρεη επνκέλσο πιενλέθηεκα γηα ηελ αληηθαηάζηαζε ηνπ δηζνπιθηδηθνχ κε ην ζεηναηζέξα; Γηα λα απαληεζεί απηφ ην εξψηεκα αλαιχζεθε ε ζπγγέλεηα ησλ ηξνπνπνηεκέλσλ αλαιφγσλ πξνο ην C3b θαη ε ελεξγφηεηά ηνπο σο αλαζηνιείο ηνπ ζπκπιεξψκαηνο φπσο πεξηγξάθεθε παξαπάλσ. πγθεθξηκέλα, ην αλεγκέλν αλάινγν 4 ππέζηεη αιθπιίσζε γηα ηνλ παξεκπνδηζκφ ηεο επαλνμείδσζεο ηνπ δηζνπιθηδηθνχ κέζσ ηνπ νμπγφλνπ ηνπ αηκνζθαηξηθνχ αέξα ε νπνία παξαηεξήζεθε φηη ζπκβαίλεη γξήγνξα ζην θπζηνινγηθφ ph 7,4 πνπ ρξεζηκνπνηείηαη θαηά ηελ πεηξακαηηθή αλάιπζε. Δπίζεο, αλαιχζεθαλ δείγκαηα ησλ αλαιφγσλ 4 θαη 5 πνπ είραλ εθηεζεί ζε ππεξνμείδην ηνπ πδξνγφλνπ (ην 4 παξέκεηλε άζηθην θαη ρξεζίκεπζε σο κάξηπξαο φζνλ αθνξά ηελ έθζεζε ζηνλ νμεηδσηηθφ παξάγνληα, ελψ ην 5 είλαη νμεηδσκέλν). πσο θαίλεηαη ζηελ Δηθφλα 31, ην αλεγκέλν-αιθπιησκέλν αλάινγν 4 έρεη ράζεη ζρεδφλ νινθιεξσηηθφ ηελ ηδηφηεηα πξφζδεζεο ζην C3b θαη αλαζηνιήο ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο, ην νπνίν ζπκθσλεί κε πξνεγνχκελε γλψζε ηεο ζεκαζίαο ηεο θπθιηθήο δνκήο γηα ηε ιεηηνπξγία ηνπ κνξίνπ. Η έθζεζε αληίζεηα ηνπ ίδηνπ αλαιφγνπ ζηνλ νμεηδσηηθφ παξάγνληα ην έρεη αθήζεη ζρεδφλ αλεπεξέαζην δίλνληαο κηθξή δηαθφξα (<2 θνξέο) αλαζηαιηηθήο δξάζεο. Σν νμεηδσκέλν αλάινγν 5 πξνζδέλεηαη κε πην αξγφ ξπζκφ θαη δηίζηαηαη κε πην γξήγνξν ξπζκφ νδεγψληαο ζε 6 θνξέο ρακειφηεξε ζπγγέλεηα ζε ζρέζε κε ην άζηθην αλάινγν 5, ελψ ε αλαζηαιηηθή ηνπ δξάζε είλαη επίζεο 4 θνξέο ρακειφηεξε. Βιέπνπκε επνκέλσο φηη ε νμείδσζε ηνπ αλαιφγνπ 5 έρεη θάπνηα αξλεηηθή ζπλέπεηα ζηε ιεηηνπξγηθφηεηά ηνπ, αιιά απηφ παξακέλεη ηζρπξφο αλαζηνιέαο κε ζπγγέλεηα πξνο ην C3b κηθξφηεξε ησλ 100nM. πκπεξαζκαηηθά, ε αλεγκέλε κνξθή ηνπ αλαιφγνπ 4 είλαη αλελεξγφο, ελψ ε νμεηδσκέλε κνξθή ηνπ αλαιφγνπ 5 δηαηεξεί ζεκαληηθφ ηκήκα ηεο ηζρχνο ηεο compstatin σο αλαζηνιέαο ηνπ ζπκπιεξψκαηνο, θαηαδεηθλχνληαο ην πιενλέθηεκα ηεο επηινγήο ηνπ αλαιφγνπ 5 ζε ζπλζήθεο ζηηο νπνίεο κπνξεί λα ζπκβεί κεηαβνιηθή αλαγσγή ή νμείδσζε. 93

94 Δηθόλα 31: Δπίδξαζε ηεο αλαγσγήο / νμείδσζεο ησλ αλαιφγσλ 4 θαη 5 ζηελ ιεηηνπξγηθφηεηά ηνπο. α, θηλεηηθή αλάιπζε κνλνχ θχθινπ ηνπ αλαιφγνπ 4 θαη ηεο αλεγκέλεο κνξθήο ηνπ. β, θηλεηηθή αλάιπζε κνλνχ θχθινπ ηνπ αλαιφγνπ 5 θαη ηεο νμεηδσκέλεο κνξθήο ηνπ. Μαχξεο θακπχιεο: πεηξακαηηθά ζήκαηα, θφθθηλεο θαη πνξηνθαιί θακπχιεο: πξνζνκνίσζε ζην κνληέιν πξφζδεζεο 1:1. Γηαθεθνκκέλε θακπχιε γηα ην «αλεγκέλν 4» επηζεκαίλεη ηελ ρακειή αμηνπηζηία ηεο πξνζνκνίσζεο ιφγσ ηνπ πνιχ ρακεινχ ζήκαηνο. γ, αλαζηαιηηθή δξάζε έλαληη ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο ησλ αλαιφγσλ 4 θαη 5 θαη ηεο αλεγκέλεο θαη νμεηδσκέλεο κνξθήο ηνπο αληίζηνηρα. Σν δείγκα κε φλνκα «4 (νμείδσζε)» απνηειεί αξλεηηθφ κάξηπξα γηα ηε δηαδηθαζία νμείδσζεο, αθνχ εθηέζεθε ζην Η 2Ο 2 αιιά δελ νμεηδψζεθε. Γηα ην «αλεγκέλν 4» δελ έγηλε πξνζνκνίσζε ζηελ ζηγκνεηδή θακπχιε δφζεο-απφθξηζεο, ιφγσ ηνπ ρακεινχ θαη κε αμηφπηζηνπ πνζνζηνχ αλαζηνιήο. δ, πίλαθαο κε ηηο ζηαζεξέο ξπζκψλ πξφζδεζεο θαη δηάζηαζεο, θαζψο θαη ηηο απφιπηεο θαη ζρεηηθέο ζπγγέλεηεο πξφζδεζεο ζην C3b (ζχκθσλα κε ην κνληέιν πξφζδεζεο 1:1) ησλ ηξνπνπνηεκέλσλ αλαιφγσλ ηεο compstatin. ε, πίλαθαο πνπ δείρλεη ηελ (απφιπηε θαη ζρεηηθή σο πξνο ην κάξηπξα) αλαζηαιηηθή ελεξγφηεηα ησλ ηξνπνπνηεκέλσλ αλαιφγσλ ηεο compstatin. 94

95 Δ. πδήηεζε 95

96 Σα ηειεπηαία ρξφληα έρεη γίλεη φιν θαη πεξηζζφηεξν εκθαλέο φηη ην ζχζηεκα ηνπ ζπκπιεξψκαηνο θαηέρεη θεληξηθή ζέζε ζηελ άλνζε απφθξηζε θαη ηε δηαηήξεζε ηεο νκνηαζηαζίαο ηνπ νξγαληζκνχ θαη δηαπιέθεηαη επίζεο ζε άιιεο ιεηηνπξγίεο κε ηε ζπλνκηιία ηνπ κε άιια ζπζηήκαηα, φπσο απηφ ηεο πήμεο. ηνλ αληίπνδα, έρεη γίλεη θαηαλνεηφ φηη ζπκπιήξσκα εκπιέθεηαη ζηελ παζνγέλεζε δηαθφξσλ αζζελεηψλ. Απφ ηε κηα πιεπξά, δηάθνξνη παζνγφλνη κηθξννξγαληζκνί, φπσο ν ρξπζίδσλ ζηαθπιφθνθθνο έρνπλ αλαπηχμεη κηα πιεζψξα κεραληζκψλ, φπσο ε πξσηεΐλε SCIN, γηα λα δηαθεχγνπλ ηελ επίζεζε ηνπ ζπκπιεξψκαηνο θαη λα πξνθαινχλ επηθίλδπλεο κνιχλζεηο. Απφ ηελ άιιε, ε αλεμέιεγθηε ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο εκπιέθεηαη ζε δηάθνξεο παζνινγηθέο θαηαζηάζεηο, φπσο ην ζχλδξνκν αληηθσζθνιηπηδίσλ, ην ARDS, ε ζήςε, νη επηπινθέο ηεο αηκνθάζαξζεο, ιφγσ ηεο ελεξγνπνίεζεο απφ ηα βηνυιηθά, ε ειηθηαθή εθθχιηζε ηεο σρξάο θειίδαο, ε λπρηεξηλή παξνμπζκηθή αηκνζθαηξηλνπξία θ.ά. Με ζθνπφ ηε κειινληηθή ζεξαπεπηηθή αληηκεηψπηζε απηψλ ησλ θαηαζηάζεσλ κειεηήζεθαλ ζε απηή ηε δηαηξηβή νη κεραληζκνί ελεξγνπνίεζεο, εγγελνχο ξχζκηζεο θαη αλαζηνιήο ηνπ θεληξηθνχ ελδχκνπ ηνπ ζπκπιεξψκαηνο, ηεο θνλβεξηάζεο ηνπ C3 ηεο ελαιιαθηηθήο νδνχ, C3bBb. Η δξάζε ηνπ ελδχκνπ απηνχ είλαη θεληξηθήο ζεκαζίαο, αθνχ πηζηεχεηαη φηη επζχλεηαη γηα ην κεγαιχηεξν πνζνζηφ ηεο ελαπφζεζεο C3b γηα ηελ νςσλνπνίεζε ησλ παζνγφλσλ θαη ηελ παξαγσγή ησλ αλαθπιαηνμίλσλ C3a θαη C5a. Η αξρηθή κειέηε ηεο δνκήο ηεο θνλβεξηάζεο απηήο ζε ζχκπινθν κε ηνλ αλαζηνιέα SCIN (θαζψο θαη ηνπ ζπκπιφθνπ C3b-SCIN) αλέδεημε ηα ζηνηρεία πνπ θαζνξίδνπλ εηδηθφηεηα ησλ πξσηετληθψλ απηψλ αιιειεπηδξάζεσλ, θαζψο θαη ηνλ ηξφπν ιεηηνπξγίαο ηεο θνλβεξηάζεο. Με ηηο βηνθπζηθέο κειέηεο βξέζεθε φηη, θαηά ηελ αιιειεπίδξαζε ηνπ FB κε ην C3b, ην ηκήκα Ba πξνζδέλεηαη πξψην κε ηαρχ ξπζκφ, αθνινπζνχκελν απφ κηα αιιαγή δηακφξθσζεο θαη ηελ πξφζδεζε ηνπ Bb, ε νπνία εμαξηάηαη απφ ηελ παξνπζία Mg 2+. Μεηά ηελ πέςε θαη απφκαθξπλζε ηνπ Ba, ε θνλβεξηάζε C3bBb έρεη κηθξφ ρξφλν εκηδσήο θαη φηαλ δηαζηαζεί ζε C3b θαη Bb, ην ηειεπηαίν δε κπνξεί λα επαλαπξνζδεζεί ζην C3b ιφγσ ηνπ πνιχ ρακεινχ ξπζκνχ πξφζδεζεο πνπ έρεη. Απηφ απνηειεί έλα κεραληζκφ ξχζκηζεο πνπ ρξεζηκνπνηεί ν νξγαληζκφο, γηα λα ειέγρεη ηα επίπεδα ελεξγνπνίεζεο. Η παξαπάλσ γλψζε ζεκαίλεη φηη κπνξεί θαλείο, γηα ζεξαπεπηηθνχο ζθνπνχο, λα αλαδεηήζεη/ζρεδηάζεη έλαλ αλαζηνιέα πνπ εκπνδίδεη ηελ αξρηθή αιιειεπίδξαζε ηνπ Ba κε ην C3b, ψζηε λα πξνιάβεη επηιεθηηθά ηελ ελεξγνπνίεζε ηεο ελαιιαθηηθήο νδνχ ηνπ ζπκπιεξψκαηνο. Δπηπιένλ, ε ηδηφηεηα ηνπ ρξπζίδνληα ζηαθπιφθνθθνπ λα αλαπηχζζεη αλζεθηηθφηεηα ζηα αληηβηνηηθά επηηάζζεη ηελ αλαδήηεζε λέσλ ηξφπσλ αληηκεηψπηζεο ησλ κνιχλζεσλ πνπ 96

97 πξνθαιεί. Με ηε κειέηε ηνπ κεραληζκνχ κε ηνλ νπνίν ε ζηαθπινθνθθηθή πξσηεΐλε SCIN αλαζηέιιεη ην ζπκπιήξσκα ξίρλεηαη θσο πξνο απηή ηελ θαηεχζπλζε. Ο κεραληζκφο αλαζηνιήο απφ ηνλ SCIN είλαη κνλαδηθφο, δηφηη ζπλίζηαηαη ζηελ ζηαζεξνπνίεζε ηνπ C3bBb ζε κηα αλελεξγφ κνξθή, φπνπ ην SCIN εκπνδίδεη ηε κεηαθίλεζε ηεο θαηαιπηηθήο ππνκνλάδαο Bb πξνο ην ππφζηξσκα ή/θαη εκπνδίδεη ζηεξηθά ηελ ζσζηή πξφζδεζε ηνπ ππνζηξψκαηνο, C3. Αλάπηπμε θαξκάθσλ πνπ εκπνδίδνπλ ηελ αιιειεπίδξαζε ηνπ SCIN θαη άιισλ αλαζηνιέσλ ηνπ ζηαθπιφθνθθνπ κε ηηο πξσηεΐλεο ηνπ ζπκπιεξψκαηνο ζα κπνξνχζε λα βνεζήζεη ζηελ θαιχηεξε αληηκεηψπηζε ησλ κνιχλζεσλ. Παξάιιεια ν κεραληζκφο δξάζεο ηνπ SCIN ζα κπνξνχζε λα ρξεζηκνπνηεζεί σο κνληέιν γηα ην ζρεδηαζκφ αλαζηνιέσλ ηνπ ζπκπιεξψκαηνο. Παξφιν πνπ ην SCIN είλαη αλνζνγελέο θαη κάιηζηα φινη νη άλζξσπνη έρνπλ παξφκνηα επίπεδα αληηζσκάησλ έλαληί ηνπ (είηε είλαη πγηή, είηε εκθαλίδνπλ επαλαιακβαλφκελεο κνιχλζεηο κε ζηαθπιφθνθθν) (65), ε δξάζε ηνπ σο αλαζηνιέαο ηεο ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο ζε αλζξψπηλν πιάζκα ζε in vitro δνθηκαζίεο δελ θαίλεηαη λα εκπνδίδεηαη απφ ηα αληηζψκαηα (κε δεκνζηεπκέλε παξαηήξεζε). Δίλαη κάιηζηα πςειφηεξε απφ ηνλ ηερλεηφ αλαζηνιέα compstatin, ην νπνίν ζεκαίλεη ν SCIN φηη ζα κπνξνχζε λα ρξεζηκνπνηεζεί ζεξαπεπηηθά. Ίζσο γηα ην ζθνπφ απηφ λα είλαη απαξαίηεηε ε ηξνπνπνίεζή ηνπ γηα ηε κείσζε ηεο αλνζνγνληθφηεηάο ηνπ ή ε κίκεζε ηνπ κεραληζκνχ ηνπ απφ έλα δηαθνξεηηθφ, κε αλνζνγνληθφ κφξην. Αθφκα, κε ηελ δνκηθή θαη βηνρεκηθή κειέηε ηεο πξν-θνλβεξηάζεο C3bB θαη ηνπ ζπκπιφθνπ ηεο κε ην FD* απνδείρηεθε ν κεραληζκφο ελεξγνπνίεζήο ηεο ζε C3bBb: ε ελεξγνπνίεζε ηνπ FB απφ ην FD είλαη εμαξηψκελε απφ ηελ παξνπζία ηνπ ζπκπαξάγνληα (C3b) θαη επάγεηαη απφ ην ίδην ην FB. Απηφ πεξηνξίδεη ηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο ζηηο επηθάλεηεο ησλ παζνγφλσλ πνπ είλαη επηθαιπκκέλεο κε C3b. Πέξα απφ ην κεραληζηηθφ ελδηαθέξνλ ηεο δηαδηθαζίαο απηήο, ε απνθάιπςε ησλ ζεκείσλ αιιειεπίδξαζεο κεηαμχ ησλ ζπζηαηηθψλ ηεο θνλβεξηάζεο, ηα νπνία θαηά θχξην ιφγν ήηαλ άγλσζηα, αλνίγεη ην δξφκν γηα ην ζρεδηαζκφ λέσλ αλαζηνιέσλ πνπ λα εκπνδίδνπλ απηέο ηηο αιιειεπηδξάζεηο. Ιδηαίηεξν ελδηαθέξνλ παξνπζηάδεη ην FD. Απηφ ην έλδπκν βξίζθεηαη ζε ρακειή ζπγθέληξσζε ζην πιάζκα ( ρακειφηεξε απφ ην C3) θαη εκθαλίδεη πςειή εηδηθφηεηα έλαληη ηνπ FB. Δπνκέλσο, ελδείθλπηαη σο ζηφρνο γηα ηελ αλαζηνιή ηνπ ζπκπιεξψκαηνο. Ήηαλ κάιηζηα ην πξψην κφξην ηνπ ζπκπιεξψκαηνο ηνπ νπνίνπ βξέζεθε ε δνκή θαη γηα ην νπνίν έγηλαλ πνιιέο θξπζηαιινγξαθηθέο θαη βηνρεκηθέο κειέηεο κε ζθνπφ λα αλαγλσξίζνπλ ην ζεκείν πξφζδεζήο ηνπ ζην FB. (36) Οη πξνζπάζεηεο απηέο φκσο είραλ απνηχρεη ιφγσ ηεο ηδηαίηεξεο θχζεο ηνπ FD, ην νπνίν πξνζδέλεηαη ζην FB κέζσ ζεκείνπ εθηφο ηνπ θαηαιπηηθνχ ηνπ θέληξνπ. Με ηελ θξπζηάιισζε ηνπ ζπκπιφθνπ 97

98 C3bBD* ην ζεκείν πξφζδεζεο έγηλε γλσζηφ θαη έηζη δίλεηαη ε δπλαηφηεηα πιένλ γηα αλαζεψξεζε ησλ πξνζπαζεηψλ αλάπηπμεο εηδηθνχ αλαζηνιέα έλαληη ηνπ FD. Έλαο πνιιά ππνζρφκελνο αλαζηνιέαο ηνπ ζπκπιεξψκαηνο πνπ έρεη ήδε αλαπηχμεη ην εξγαζηήξην ηνπ θ. Λάκπξε είλαη ε compstatin, ε νπνία πξνζδέλεηαη ζην C3 θαη εκπνδίδεη ηελ ελεξγνπνίεζε φισλ ησλ νδψλ ηνπ ζπκπιεξψκαηνο. Σν πεπηίδην απηφ πέξαζε κε επηηπρία ηελ πξψηε θαη βξίζθεηαη ηψξα ζηε δεχηεξε θάζε θιηληθψλ δνθηκψλ γηα ηε ζεξαπεία ηεο ειηθηαθήο εθθχιηζεο ηεο σρξάο θειίδαο, πνπ είλαη ε θχξηα αηηία ηχθισζεο ζην δπηηθφ θφζκν. ε έλα κνληέιν απηήο ηεο αζζέλεηαο ζε πξσηεχνληα (Macaca fascicularis) ε compstatin αλέζηξεςε ην ζρεκαηηζκφ ησλ νδηδίσλ ζηνπο νθζαικνχο ησλ δψσλ. (86) ην κέιινλ, ε compstatin πηζαλφλ λα ρξεζηκεχζεη σο πεηξακαηηθφ εξγαιείν γηα ηελ αλαγλψξηζε ηεο ζπκβνιήο ηνπ ζπκπιεξψκαηνο ζε πνιιέο πεξηζζφηεξεο αζζέλεηεο, θαζψο θαη σο ζεξαπεπηηθή παξέκβαζε γηα απηέο. ηα πιαίζηα κηαο γεληθφηεξεο πξνζπάζεηαο γηα πεξαηηέξσ βειηίσζε απηνχ ηνπ αλαζηνιέα παξάρζεθαλ λέα, πην ζηαζεξά αλάινγά ηνπ. ηα αλάινγα απηά, ε θπθινπνίεζε ηνπ κνξίνπ, πνπ είλαη απαξαίηεηε γηα ηε ιεηηνπξγία ηνπ θαη ηελ πξνζηαζία ηνπ απφ απνηθνδφκεζε, γίλεηαη κέζσ ελφο ζεηναηζεξηθνχ δεζκνχ. Ο δεζκφο απηφο, ζε αληίζεζε κε ηνλ αξρηθφ δηζνπιθηδηθφ, δελ δηαζπάηαη κε αλαγσγή. Παξφιν πνπ ηα λέα αλάινγα έραζαλ κηθξφ κέξνο ηεο ελεξγφηεηάο, παξέκεηλαλ ηζρπξνί αλαζηνιείο ηνπ ζπκπιεξψκαηνο (κάιηζηα ην αλάινγν 5 έρεη ζπγθξίζηκε ελεξγφηεηα κε ην αλάινγν 4(1MeW) πνπ βξίζθεηαη ζε θιηληθέο δνθηκέο) θαη εκθαλίδνπλ ην πιενλέθηεκα ηεο απμεκέλεο ζηαζεξφηεηαο. Δλψ ε αλαγσγή ηνπ δηζνπιθηδηθνχ δεζκνχ ηνπ κεηξηθνχ κνξίνπ θαηαζηξέθεη πιήξσο ηελ ελεξγφηεηά ηνπ, ε αληίζεηε κεηαβνιηθή δξαζηεξηφηεηα, ε νμείδσζε, πνπ κπνξεί λα ζπκβεί ζην ζεηναηζέξα, κεηψλεη, αιιά δελ θαηαζηξέθεη ηελ ελεξγφηεηα ηνπ λένπ αλαιφγνπ. Γίλεηαη θαηαλνεηφ ινηπφλ φηη ηα αλάινγα κε ην ζεηαηζέξα πηζαλφλ λα είλαη πην ζηαζεξά θαηά ην κεηαβνιηζκφ ηνπ θαξκάθνπ θαη επνκέλσο λα έρνπλ θαιχηεξεο θαξκαθνθηλεηηθέο ηδηφηεηεο. Απηφ κπνξεί λα απνδεηρζεί αθφκα πην ζεκαληηθφ ζε πεξηπηψζεηο φπνπ ε compstatin πξέπεη λα παξακείλεη γηα κεγάιν ρξνληθφ δηάζηεκα ζηνλ νξγαληζκφ ή ζε αζζέλεηεο φπνπ ε αλαγσγηθή δπλαηφηεηα ηνπ πιάζκαηνο είλαη απμεκέλε. Γηα παξάδεηγκα, απφ ηελ επηθνηλσλία καο κε ηελ εηαηξεία πνπ νινθιήξσζε ηελ πξψηε θάζε θιηληθψλ δνθηκψλ (Potentia), θαζψο θαη απφ ηελ έξεπλα ζην κνληέιν ησλ πξσηεπφλησλ μέξνπκε φηη, φηαλ ε compstatin ελχεηαη ζην κάηη, θαζηδάλεη θαη δεκηνπξγεί κία πεθηή ε νπνία είλαη ζηαζεξή θαη παξακέλεη ζην κάηη γηα θαηξφ, απειεπζεξψλνληαο ζηγά-ζηγά ηε δηαιπηή κνξθή ηνπ θαξκάθνπ πξνζθέξνληαο κηα θπζηθή κνξθή «αληιίαο αξγήο απειεπζέξσζεο». Γελ είλαη γλσζηφ φκσο αλ θαηά ηε δηάξθεηα απηήο ηεο παξακνλήο ην πεπηίδην ζα παξακείλεη ζηαζεξφ ή αλ ζα αλαρζεί. Δπηπιένλ, ε compstatin έρεη 98

99 δείμεη δπλαηφηεηα γηα ζεξαπεπηηθή παξέκβαζε ζε έλα κνληέιν ζήςεο ζε κπακπνπΐλνπο, φπνπ βξέζεθε φηη πξνζηαηεχεη ηα φξγαλα ησλ δψσλ απφ πνιιαπιή αλεπάξθεηα. (85) Έρεη φκσο επίζεο βξεζεί φηη θαηά ηε ζήςε ε πνζφηεηα ηνπ αλαγσγηθνχ παξάγνληα thioredoxin δηπιαζηάδεηαη ζην αίκα, (104) ην νπνίν κπνξεί λα ζέζεη ζε θίλδπλν ηελ αθεξαηφηεηα ηεο δνκήο θαη ηεο ιεηηνπξγίαο ηεο compstatin. Παξνκνίσο, ε compstatin ζα κπνξνχζε λα ρξεζηκνπνηεζεί ζεξαπεπηηθά ζε αζζέλεηεο φπνπ ζπκβαίλεη αηκφιπζε, φπσο ε παξνμπζκηθή λπρηεξηλή αηκνζθαηξηλνπξία (23) θαη θαηά ηελ αηκνθάζαξζε (σο επηπινθή) (20). Καηά ηελ αηκφιπζε φκσο, ε αλεγκέλε κνξθή ηεο γινπηαζεηφλεο ησλ εξπζξνθπηηάξσλ (1 3 mm) απειεπζεξψλεηαη ζην πιάζκα, απμάλνληαο ηελ θαηά πνιχ ρακειφηεξε ζπγθέληξσζή ηεο ζην πιάζκα (2 4 κm). (105, 106) ε απηέο ηηο ζπλζήθεο, ε κεηαβνιηθή ζηαζεξφηεηα πνπ πξνζθέξνπλ ηα λέα αλάινγα ηεο compstatin ζα κπνξνχζε λα απνδεηρζεί πνιχ ρξήζηκε. 99

100 Σ. πκπεξάζκαηα 100

101 Η παξνχζα εξγαζία αλέιπζε ηε δνκή θαη ιεηηνπξγία ηνπ θεληξηθνχ ελδχκνπ ηεο ελαιιαθηηθήο νδνχ ελεξγνπνίεζεο ηνπ ζπκπιεξψκαηνο. Έηζη έγηλαλ γλσζηά ηα ζεκεία θαη ν κεραληζκφο αιιειεπίδξαζεο αλάκεζα ζηηο πξσηεΐλεο πνπ ηελ δεκηνπξγνχλ: C3b, FB θαη FD. Αλάκεζα ζηηο ζεκαληηθέο πιεξνθνξίεο πνπ πήξακε απν ηηο αλαιχζεηο απηέο ήηαλ: α) ε απφδεημε φηη ην πξψην βήκα γηα ην ζρεκαηηζκφ ηεο θνλβεξηάζεο είλαη ε αιιειεπίδξαζε ηνπ ηκήκαηνο Ba ηνπ FB κε ην C3b θαη β) ε εχξεζε γηα πξψηε θνξά ηεο πεξηνρήο πξφζδεζεο ηνπ FD πάλσ ζην FB πνπ είλαη πξνζδεδεκέλν ζην C3b. Οη γλψζεηο απηέο καο θέξλνπλ πην θνληά ζηελ αλάπηπμε αλαζηνιέσλ απηψλ ησλ αιιειεπηδξάζεσλ πνπ ζα κπνξνχζαλ λα ρξεζηκνπνηεζνχλ ζεξαπεπηηθά γηα λα ζηακαηήζνπλ ηελ ελεξγνπνίεζε ηνπ ζπκπιεξψκαηνο ζε αζζέλεηεο ζηηο νπνίεο έρεη δεηρζεί φηη απηφ εκπιέθεηαη, φπσο ην ζχλδξνκν αληηθσζθνιηπηδίσλ, ην ζχλδξνκν νμείαο αλαπλεπζηηθήο δπζρέξεηαο θ.ά. ηα πιαίζηα απηά επίζεο αλαιχζεθε δνκηθά ν κεραληζκφο δξάζεο ηνπ βαθηεξηαθνχ αλαζηνιέα ηνπ ζπκπιεξψκαηνο SCIN θαη βξέζεθε φηη απηφο δξα κέζσ ηεο ζηεξηθήο παξεκπφδηζεο ηεο πξνζέγγηζεο ηνπ ππνζηξψκαηνο C3 ζηελ θνλβεξηάζε. Ο αλαζηνιέαο απηφο κπνξεί ζην κέιινλ λα ρξεζηκεχζεη σο εθκαγείν γηα ην ζρεδηαζκφ ζεξαπεπηηθψλ κνξίσλ. Σέινο, βειηηψζεθε ε ρεκηθή ζηαζεξφηεηα ηνπ πνιιά ππνζρφκελνπ ζπλζεηηθνχ αλαζηνιέα compstatin ν νπνίνο βξίζθεηαη θαζ νδφλ πξνο ηελ θιηληθή ρξήζε. Απηφ έγηλε κέζσ ηεο αληηθαηάζηαζεο ηνπ δηζνπιθηδηθνχ δεζκνχ κε κηα γέθπξα ζεηναηζέξα ε νπνία πξνζδίδεη ζην κφξην κεηαβνιηθή ζηαζεξφηεηα έλαληη ηεο αλαγσγήο θαη πξνζηαηεχεη ηελ ελεξγφηεηά ηνπ. Σν λέν αλάινγν κπνξεί λα βξεη εθαξκνγή ζε πεξηπηψζεηο φπνπ ε δνκηθή αθεξαηφηεηα ηνπ κεηξηθνχ κνξίνπ ζα απεηινχληαλ ιφγσ απμεκέλεο δπλαηφηεηαο αλαγσγήο, φπσο θαηά ηε ζήςε ή θαηά ηελ αηκφιπζε. Η απμεκέλε ζηαζεξφηεηά ηνπ πηζαλφλ λα ζεκαίλεη φηη ζα παξακείλεη ζην ζψκα θαη ζα αζθεί ηε ζεξαπεπηηθή ηνπ ελεξγφηεηα γηα κεγαιχηεξν ρξνληθφ δηάζηεκα, θαηά ζπλέπεηα νδεγψληαο ζε ιηγφηεξεο δφζεηο ηνπ θαξκάθνπ. 101

102 ΒΗΒΛΗΟΓΡΑΦΗΚΔ ΠΑΡΑΠΟΜΠΔ 1. D.Male, J.Brostoff, D.B.Roth, and I.Roitt. "Complement." In Immunology, pp W.E.Paul. "Complement." In Fundamental Immunology, pp C.A.J.Janeway, P.Travers, M.Walport, and et al. "The complement system and innate immunity." In Immunobiology: The immune system in health and disease, New York: Garland Science, C.Gaboriaud, N.M.Thielens, L.A.Gregory, V.Rossi, J.C.Fontecilla-Camps, and G.J.Arlaud. "Structure and activation of the C1 complex of complement: unraveling the puzzle." Trends Immunol 25, no. 7(2004): R.Wallis, D.A.Mitchell, R.Schmid, W.J.Schwaeble, and A.H.Keeble. "Paths reunited: Initiation of the classical and lectin pathways of complement activation." Immunobiology 215, no. 1(2010): D.Spitzer, L.M.Mitchell, J.P.Atkinson, and D.E.Hourcade. "Properdin can initiate complement activation by binding specific target surfaces and providing a platform for de novo convertase assembly." J Immunol 179, no. 4(August 2007): D.T.Fearon and K.F.Austen. "Properdin: binding to C3b and stabilization of the C3bdependent C3 convertase." J Exp Med 142, no. 4(1975): M.Harboe and T.E.Mollnes. "The alternative complement pathway revisited." J Cell Mol Med 12, no. 4(2008): D.Ricklin, G.Hajishengallis, K.Yang, and J.D.Lambris. "Complement: a key system for immune surveillance and homeostasis." Nat Immunol 11, no. 9(2010): M.M.Markiewski, B.Nilsson, K.N.Ekdahl, T.E.Mollnes, and J.D.Lambris. "Complement and coagulation: strangers or partners in crime?" Trends Immunol 28, no. 4(2007): M.Huber-Lang, J.V.Sarma, F.S.Zetoune, D.Rittirsch, T.A.Neff, S.R.McGuire, J.D.Lambris, R.L.Warner, M.A.Flierl, L.M.Hoesel, F.Gebhard, J.G.Younger, S.M.Drouin, R.A.Wetsel, and P.A.Ward. "Generation of C5a in the absence of C3: a new complement activation pathway." Nat Med 12, no. 6(2006): J.P.Atkinson and M.M.Frank. "Bypassing complement: evolutionary lessons and future implications." J Clin Invest 116, no. 5(2006): B.Selander, U.Martensson, A.Weintraub, E.Holmstrom, M.Matsushita, S.Thiel, J.C.Jensenius, L.Truedsson, and A.G.Sjoholm. "Mannan-binding lectin activates C3 and the alternative complement pathway without involvement of C2." J Clin Invest 116, no. 5(May 2006):

103 14. C.E.Bamberg, C.R.Mackay, H.Lee, D.Zahra, J.Jackson, Y.S.Lim, P.L.Whitfeld, S.Craig, E.Corsini, B.Lu, C.Gerard, and N.P.Gerard. "The C5a receptor (C5aR) C5L2 is a modulator of C5aR-mediated signal transduction." J Biol Chem 285, no. 10(2010): A.M.Scola, K.O.Johswich, B.P.Morgan, A.Klos, and P.N.Monk. "The human complement fragment receptor, C5L2, is a recycling decoy receptor." Mol Immunol 46, no. 6(March 2009): D.Rittirsch, M.A.Flierl, B.A.Nadeau, D.E.Day, M.Huber-Lang, C.R.Mackay, F.S.Zetoune, N.P.Gerard, K.Cianflone, J.Kohl, C.Gerard, J.V.Sarma, and P.A.Ward. "Functional roles for C5a receptors in sepsis." Nat Med 14, no. 5(May 2008): A.Klos, A.J.Tenner, K.O.Johswich, R.R.Ager, E.S.Reis, and J.Kohl. "The role of the anaphylatoxins in health and disease." Mol Immunol 46, no. 14(2009): K.Ritis, M.Doumas, D.Mastellos, A.Micheli, S.Giaglis, P.Magotti, S.Rafail, G.Kartalis, P.Sideras, and J.D.Lambris. "A novel C5a receptor-tissue factor cross-talk in neutrophils links innate immunity to coagulation pathways." J.Immunology 177, no. 7(2006): K.Kambas, M.M.Markiewski, I.A.Pneumatikos, S.S.Rafail, V.Theodorou, D.Konstantonis, I.Kourtzelis, M.N.Doumas, P.Magotti, R.A.DeAngelis, J.D.Lambris, and K.D.Ritis. "C5a and TNF-alpha up-regulate the expression of tissue factor in intra-alveolar neutrophils of patients with the acute respiratory distress syndrome 1." J.Immunology 180, no. 11(June 2008): I.Kourtzelis, M.M.Markiewski, M.Doumas, S.Rafail, K.Kambas, I.Mitroulis, S.Panagoutsos, P.Passadakis, V.Vargemezis, P.Magotti, H.Qu, T.E.Mollnes, K.Ritis, and J.D.Lambris. "Complement anaphylatoxin C5a contributes to hemodialysisassociated thrombosis." Blood prepublished online April 27, 2010; DOI /blood V.M.Holers. "The spectrum of complement alternative pathway-mediated diseases." Immunol Rev 223,(2008): J.D.Lambris, D.Ricklin, and B.V.Geisbrecht. "Complement evasion by human pathogens." Nat Rev Microbiol 6, no. 2(2008): D.Ricklin and J.D.Lambris. "Complement-targeted therapeutics." Nat.Biotechnol. 25, no. 11(2007): A.Sahu, D.Morikis, and J.D.Lambris. "Complement inhibitors targeting C3, C4, and C5." In Therapeutic interventions in the complement system, eds., J.D.Lambris and V.M.Holers, pp. In press. New Jersey: Humana Press Inc., A.Sahu and J.D.Lambris. "Complement inhibitors: a resurgent concept in antiinflammatory therapeutics." Immunopharmacology 49, no. 1-2(August 2000): E.Wagner and M.M.Frank. "Therapeutic potential of complement modulation." Nat Rev Drug Discov 9, no. 1(January 2010):

104 27. Z.Fishelson and H.J.Müller-Eberhard. "Residual hemolytic and proteolytic activity expressed by Bb after decay-dissociation of C3b,Bb." J.Immunology 132,(1984): B.J.C.Janssen, E.G.Huizinga, H.C.A.Raaijmakers, A.Roos, M.R.Daha, K.Ekdahl- Nilsson, B.Nilsson, and P.Gros. "Structures of Complement Component C3 Provide Insights Into the Function and Evolution of Immunity." Nature 437,(2005): B.J.Janssen, A.Christodoulidou, A.McCarthy, J.D.Lambris, and P.Gros. "Structure of C3b reveals conformational changes that underlie complement activity." Nature 444, no. 7116(2006): A.A.Bhattacharya, M.L.Lupher, Jr., D.E.Staunton, and R.C.Liddington. "Crystal structure of the A domain from complement factor B reveals an integrin-like open conformation." Structure. 12, no. 3(March 2004): H.Jing, Y.Xu, M.Carson, D.Moore, K.J.Macon, J.E.Volanakis, and S.V.Narayana. "New structural motifs on the chymotrypsin fold and their potential roles in complement factor B." EMBO J 19, no. 2(January 2000): Z.Fishelson and H.J.Müller-Eberhard. "C3 convertase of human complement: enhanced formation and stability of the enzyme generated with nickel instead of magnesium." J.Immunology 129,(1982): K.Ponnuraj, Y.Xu, K.Macon, D.Moore, J.E.Volanakis, and S.V.Narayana. "Structural analysis of engineered Bb fragment of complement factor B: insights into the activation mechanism of the alternative pathway C3-convertase." Mol.Cell 14, no. 1(April 2004): F.J.Milder, L.Gomes, A.Schouten, B.J.Janssen, E.G.Huizinga, R.A.Romijn, W.Hemrika, A.Roos, M.R.Daha, and P.Gros. "Factor B structure provides insights into activation of the central protease of the complement system." Nat Struct Mol Biol 14, no. 3(March 2007): S.V.Narayana, M.Carson, O.el Kabbani, J.M.Kilpatrick, D.Moore, X.Chen, C.E.Bugg, J.E.Volanakis, and L.J.Delucas. "Structure of human factor D. A complement system protein at 2.0 A resolution." J.Mol.Biol. 235, no. 2(January 1994): Y.Xu, S.V.Narayana, and J.E.Volanakis. "Structural biology of the alternative pathway convertase." Immunol Rev 180,(April 2001): J.M.Higgins, H.Wiedemann, R.Timpl, and K.B.Reid. "Characterization of mutant forms of recombinant human properdin lacking single thrombospondin type I repeats. Identification of modules important for function." J Immunol 155, no. 12(December 1995): Z.Sun, K.B.Reid, and S.J.Perkins. "The dimeric and trimeric solution structures of the multidomain complement protein properdin by X-ray scattering, analytical ultracentrifugation and constrained modelling." J Mol Biol 343, no. 5(November 2004):

105 39. J.D.Becherer, J.Alsenz, I.Esparza, C.E.Hack, and J.D.Lambris. "A segment spanning residues of the complement C3 sequence contains a neoantigenic site and accommodates the binding of CR1, factor H, and factor B." Biochemistry 31,(1992): Z.Fishelson. "Complement-C3 - A Molecular Mosaic of Binding Sites." Molecular Immunology 28,(1991): A.Taniguchi-Sidle and D.E.Isenman. "Interactions of human complement component C3 with factor B and with complement receptors type 1 (CR1, CD35) and type 3 (CR3, CD11b/CD18) involve an acidic sequence at the N-terminus of C3 alpha'-chain 35." J Immunol 153, no. 11(1994): J.D.Lambris, Z.Lao, T.J.Oglesby, J.P.Atkinson, C.E.Hack, and J.D.Becherer. "Dissection of CR1, factor H, membrane cofactor protein, and factor B binding and functional sites in the third complement component." J Immunol 156, no. 12(1996): A.Ueda, J.F.Kearney, K.H.Roux, and J.E.Volanakis. "Probing functional sites on complement protein B with monoclonal antibodies. Evidence for C3b-binding sites on Ba." J.Immunology 138,(1987): E.L.G.Pryzdial and D.E.Isenman. "Alternative complement pathway activation fragment Ba binds to C3b." J.Biol.Chem. 262,(1987): D.E.Hourcade, L.M.Wagner, and T.J.Oglesby. "Analysis of the short consensus repeats of human complement factor B by site-directed mutagenesis." J Biol Chem 270, no. 34(August 1995): D.S.Tuckwell, Y.Xu, P.Newham, M.J.Humphries, and J.E.Volanakis. "Surface loops adjacent to the cation-binding site of the complement factor B von Willebrand factor type A module determine C3b binding specificity." Biochemistry 36, no. 22(June 1997): D.E.Hourcade, L.M.Mitchell, and T.J.Oglesby. "Mutations of the type A domain of complement factor B that promote high-affinity C3b-binding." J Immunol 162, no. 5(March 1999): J.Hinshelwood, D.I.Spencer, Y.J.Edwards, and S.J.Perkins. "Identification of the C3b binding site in a recombinant vwf-a domain of complement factor B by surfaceenhanced laser desorption-ionisation affinity mass spectrometry and homology modelling: implications for the activity of factor B." J Mol Biol 294, no. 2(November 1999): C.A.Smith, C.W.Vogel, and H.J.Müller-Eberhard. "MHC Class III products: an electron microscopic study of the C3 convertases of human complement." Journal of Experimental Medicine 159,(1984): J.D.Lambris and H.J.Müller-Eberhard. "Isolation and characterization of a 33,000-dalton fragment of complement factor B with catalytic and C3b binding activity." J.Biol.Chem. 259,(1984):

106 51. E.Torreira, A.Tortajada, T.Montes, C.S.Rodriguez de, and O.Llorca. "3D structure of the C3bB complex provides insights into the activation and regulation of the complement alternative pathway convertase." Proc Natl Acad Sci U S A 106, no. 3(January 2009): E.Torreira, A.Tortajada, T.Montes, C.S.Rodriguez de, and O.Llorca. "Coexistence of closed and open conformations of complement factor B in the alternative pathway C3bB(Mg2+) proconvertase." J Immunol 183, no. 11(December 2009): C.M.Kam, B.J.McRae, J.W.Harper, M.A.Niemann, and J.E.Volanakis. "Human complement proteins D, C2, and B. Active site mapping with peptide thioester substrates." J.Biol.Chem. 262,(1987): C.M.Kam, T.J.Oglesby, M.K.Pangburn, J.E.Volanakis, and J.C.Powers. "Substituted isocoumarins as inhibitors of complement serine proteases." J.Immunology 149,(1992): S.Kim, S.V.Narayana, and J.E.Volanakis. "Catalytic role of a surface loop of the complement serine protease factor D." J.Immunology 154, no. 11(June 1995): E.A.Morell and D.M.Balkin. "Methicillin-resistant Staphylococcus aureus: a pervasive pathogen highlights the need for new antimicrobial development." Yale J Biol Med 83, no. 4(December 2010): T.Foster. "Staphylococcus BTI - Medical Microbiology." no. Chapter T.Ferry, T.Perpoint, F.Vandenesch, and J.Etienne. "Virulence determinants in Staphylococcus aureus and their involvement in clinical syndromes." Curr.Infect Dis Rep. 7, no. 6(November 2005): Todar K. "Staphylococcus aureus and Staphylococcal Disease." In Todar's online textbook of bacteriology, T.Foster. "Staphylococcus." In Medical Microbiology, ed., Baron S., Galveston (TX): The University of Texas Medical Branch at Galveston, J.D.Lambris, D.Ricklin, and B.V.Geisbrecht. "Complement evasion by human pathogens." Nat.Rev.Microbiol. 6, no. 2(2008): B.V.Geisbrecht. "Staphylococcal Complement Inhibitors: Biological Functions, Recognition of Complement Components, and Potential Therapeutic Implications." Adv.Exp.Med.Biol. 632,(2008): T.J.Foster. "Colonization and infection of the human host by staphylococci: adhesion, survival and immune evasion." Vet.Dermatol 20, no. 5-6(October 2009): D.Serruto, R.Rappuoli, M.Scarselli, P.Gros, and J.A.Van Strijp. "Molecular mechanisms of complement evasion: learning from staphylococci and meningococci." Nat Rev Microbiol 8, no. 6(2010):

107 65. S.H.Rooijakkers, M.Ruyken, A.Roos, M.R.Daha, J.S.Presanis, R.B.Sim, W.J.van Wamel, K.P.van Kessel, and J.A.Van Strijp. "Immune evasion by a staphylococcal complement inhibitor that acts on C3 convertases." Nat Immunol 6, no. 9(2005): W.J.van Wamel, S.H.Rooijakkers, M.Ruyken, K.P.van Kessel, and J.A.Van Strijp. "The innate immune modulators staphylococcal complement inhibitor and chemotaxis inhibitory protein of Staphylococcus aureus are located on beta-hemolysin-converting bacteriophages." J Bacteriol 188, no. 4(2006): S.H.Rooijakkers, M.Ruyken, J.van Roon, K.P.van Kessel, J.A.Van Strijp, and W.J.van Wamel. "Early expression of SCIN and CHIPS drives instant immune evasion by Staphylococcus aureus." Cell Microbiol 8, no. 8(2006): S.H.Rooijakkers, F.J.Milder, B.W.Bardoel, M.Ruyken, J.A.Van Strijp, and P.Gros. "Staphylococcal complement inhibitor: structure and active sites." J Immunol 179, no. 5(2007): A.Upadhyay, J.D.Burman, E.A.Clark, E.Leung, D.E.Isenman, J.M.van den Elsen, and S.Bagby. "Structure-function analysis of the C3 binding region of Staphylococcus aureus immune subversion protein Sbi." J Biol Chem 283, no. 32(August 2008): I.Jongerius, J.Kohl, M.K.Pandey, M.Ruyken, K.P.van Kessel, J.A.Van Strijp, and S.H.Rooijakkers. "Staphylococcal complement evasion by various convertase-blocking molecules." J Exp Med 204, no. 10(2007): D.Ricklin and J.D.Lambris. "Compstatin: a complement inhibitor on its way to clinical application." Adv Exp Med Biol 632,(2008): A.Sahu, B.K.Kay, and J.D.Lambris. "Inhibition of human complement by a C3-binding peptide isolated from a phage-displayed random peptide library." J.Immunology 157, no. 2(1996): D.Morikis, N.Assa-Munt, A.Sahu, and J.D.Lambris. "Solution structure of compstatin, a potent complement inhibitor." Protein Science 7,(1998): A.Sahu, A.M.Soulika, D.Morikis, L.Spruce, W.T.Moore, and J.D.Lambris. "Binding kinetics, structure-activity relationship, and biotransformation of the complement inhibitor compstatin." J.Immunology 165, no. 5(2000): H.Qu, P.Magotti, D.Ricklin, E.L.Wu, I.Kourtzelis, Y.Q.Wu, Y.N.Kaznessis, and J.D.Lambris. "Novel analogues of the therapeutic complement inhibitor compstatin with significantly improved affinity and potency." Mol Immunol 48, no. 4(January 2011): B.J.Janssen, E.F.Halff, J.D.Lambris, and P.Gros. "Structure of compstatin in complex with complement component C3c reveals a new mechanism of complement inhibition." J.Biol.Chem. 282, no. 40(2007): A.Sahu, D.Morikis, and J.D.Lambris. "Compstatin, a peptide inhibitor of complement, exhibits species-specific binding to complement component C3." Molecular Immunology 39, no. 10(2003):

108 78. B.Nilsson, R.Larsson, J.Hong, G.Elgue, K.N.Ekdahl, A.Sahu, and J.D.Lambris. "Compstatin inhibits complement and cellular activation in whole blood in two models of extracorporeal circulation." Blood 92, no. 5(1998): K.T.Lappegard, G.Bergseth, J.Riesenfeld, A.Pharo, P.Magotti, J.D.Lambris, and T.E.Mollnes. "The artificial surface-induced whole blood inflammatory reaction revealed by increases in a series of chemokines and growth factors is largely complement dependent." J.Biomed.Mater.Res.A(2007). 80. A.E.Fiane, T.E.Mollnes, V.Videm, T.Hovig, K.Hogasen, O.J.Mellbye, L.Spruce, W.T.Moore, A.Sahu, and J.D.Lambris. "Compstatin, a peptide inhibitor of C3, prolongs survival of ex vivo perfused pig xenografts." Xenotransplantation 6, no. 1(1999): M.Goto, J.Tjernberg, D.Dufrane, G.Elgue, D.Brandhorst, K.N.Ekdahl, H.Brandhorst, L.Wennberg, Y.Kurokawa, S.Satomi, J.D.Lambris, P.Gianello, O.Korsgren, and B.Nilsson. "Dissecting the instant blood-mediated inflammatory reaction in islet xenotransplantation." Xenotransplantation 15, no. 4(July 2008): J.Tjernberg, K.N.Ekdahl, J.D.Lambris, O.Korsgren, and B.Nilsson. "Acute antibodymediated complement activation mediates lysis of pancreatic islets cells and may cause tissue loss in clinical islet transplantation." Transplantation 85, no. 8(April 2008): L.Goga, G.Perez-Abadia, S.B.Pushpakumar, D.Cramer, J.Yan, N.Todnem, G.Anderson, C.Soni, J.Barker, and C.Maldonado. "Cell membrane modification for rapid display of bifunctional peptides: a novel approach to reduce complement activation." Open.Cardiovasc.Med J 4,(2010): A.M.Soulika, M.M.Khan, T.Hattori, F.W.Bowen, B.A.Richardson, C.E.Hack, A.Sahu, L.H.Edmunds, Jr., and J.D.Lambris. "Inhibition of heparin/protamine complex-induced complement activation by Compstatin in baboons." Clin.Immunol. 96, no. 3(2000): R.Silasi-Mansat, H.Zhu, N.I.Popescu, G.Peer, G.Sfyroera, P.Magotti, L.Ivanciu, C.Lupu, T.E.Mollnes, F.B.Taylor, G.Kinasewitz, J.D.Lambris, and F.Lupu. "Complement inhibition decreases the procoagulant response and confers organ protection in a baboon model of Escherichia coli sepsis." Blood 116, no. 6(August 2010): Z.L.Chi, T.Yoshida, J.D.Lambris, and T.Iwata. "Suppression of drusen formation by compstatin, a peptide inhibitor of complement C3 activation, on cynomolgus monkey with early-onset macular degeneration." Adv Exp Med Biol 703,(2010): J.P.Mayer, J.R.Heil, J.Zhang, and M.C.Munson. "An alternative solid-phase approach to C1-oxytocin." Tetrahedron Letters 36, no. 41(October 1995): D.S.Jones, C.A.Gamino, M.E.Randow, E.J.Victoria, L.Yu, and S.M.Coutts. "Synthesis of a cyclic-thioether peptide which binds anti-cardiolipin antibodies." Tetrahedron Letters 39, no. 34(August 1998): N.Fotouhi, P.Joshi, J.W.Tilley, K.Rowan, V.Schwinge, and B.Wolitzky. "Cyclic thioether peptide mimetics as VCAM-VLA-4 antagonists." Bioorg.Med Chem Lett 10, no. 11(June 2000):

109 90. D.Ricklin and J.D.Lambris. "Exploring the complement interaction network using surface plasmon resonance." Adv.Exp.Med.Biol. 598,(2007): M.Basta and C.H.Hammer. "A Rapid FPLC Method for Purification of the Third Component of Human and Guinea Pig Complement." J.Immunol.Methods 142,(1991): J.D.Lambris and G.D.Ross. "Assay of membrane complement receptors (CR1 and CR2) with C3b- and C3d-coated fluorescent microspheres." J.Immunology 128,(1982): P.H.Lesavre and H.J.Muller-Eberhard. "Mechanism of action of factor D of the alternative complement pathway." J Exp Med 148, no. 6(December 1978): B.Mallik, M.Katragadda, L.A.Spruce, C.Carafides, C.G.Tsokos, D.Morikis, and J.D.Lambris. "Design and NMR characterization of active analogues of compstatin containing non-natural amino acids." J.Med.Chem. 48, no. 1(2005): S.H.Rooijakkers, J.Wu, M.Ruyken, R.van Domselaar, K.L.Planken, A.Tzekou, D.Ricklin, J.D.Lambris, B.J.Janssen, J.A.Van Strijp, and P.Gros. "Structural and functional implications of the alternative complement pathway C3 convertase stabilized by a staphylococcal inhibitor." Nat Immunol 10, no. 7(2009): C.L.Harris, R.J.Abbott, R.A.Smith, B.P.Morgan, and S.M.Lea. "Molecular dissection of interactions between components of the alternative pathway of complement and decay accelerating factor (CD55)." J.Biol.Chem. 280, no. 4(2005): D.Ricklin, A.Tzekou, B.L.Garcia, M.Hammel, W.J.McWhorter, G.Sfyroera, Y.Q.Wu, V.M.Holers, A.P.Herbert, P.N.Barlow, B.V.Geisbrecht, and J.D.Lambris. "A molecular insight into complement evasion by the staphylococcal complement inhibitor protein family." J Immunol 183, no. 4(2009): B.L.Garcia, A.Tzekou, K.X.Ramyar, W.J.McWhorter, D.Ricklin, J.D.Lambris, and B.V.Geisbrecht. "Crystallization of human complement component C3b in the presence of a staphylococcal complement-inhibitor protein (SCIN)." Acta Crystallogr Sect F Struct Biol Cryst Commun 65, no. Pt 5(2009): B.L.Garcia, K.X.Ramyar, A.Tzekou, D.Ricklin, W.J.McWhorter, J.D.Lambris, and B.V.Geisbrecht. "Molecular basis for complement recognition and inhibition determined by crystallographic studies of the staphylococcal complement inhibitor (SCIN) bound to C3c and C3b." J Mol Biol 402, no. 1(2010): B.J.Janssen, L.Gomes, R.I.Koning, D.I.Svergun, A.J.Koster, D.C.Fritzinger, C.W.Vogel, and P.Gros. "Insights into complement convertase formation based on the structure of the factor B-cobra venom factor complex." The EMBO Journal 28, no. 16(2009): F.Forneris, D.Ricklin, J.Wu, A.Tzekou, R.S.Wallace, J.D.Lambris, and P.Gros. "Structures of C3b in complex with factors B and D give insight into complement convertase formation." Science 330, no. 6012(December 2010):

110 102. S.Wilson-Stanford, A.Kalli, K.Hakansson, J.Kastrantas, R.S.Orugunty, and L.Smith. "Oxidation of lanthionines renders the lantibiotic nisin inactive." Appl.Environ.Microbiol 75, no. 5(March 2009): S.Boakes, J.Cortes, A.N.Appleyard, B.A.Rudd, and M.J.Dawson. "Organization of the genes encoding the biosynthesis of actagardine and engineering of a variant generation system." Mol Microbiol 72, no. 5(June 2009): S.K.Leaver, N.S.MacCallum, V.Pingle, M.B.Hacking, G.J.Quinlan, T.W.Evans, and A.Burke-Gaffney. "Increased plasma thioredoxin levels in patients with sepsis: positive association with macrophage migration inhibitory factor." Intensive Care Med 36, no. 2(February 2010): V.Serru, B.Baudin, F.Ziegler, J.P.David, M.J.Cals, M.Vaubourdolle, and N.Mario. "Quantification of reduced and oxidized glutathione in whole blood samples by capillary electrophoresis." Clin Chem 47, no. 7(2001): D.Giustarini, I.le-Donne, R.Colombo, A.Milzani, and R.Rossi. "Interference of plasmatic reduced glutathione and hemolysis on glutathione disulfide levels in human blood." Free Radic.Res 38, no. 10(October 2004):

111 ΠΡΟΩΠΗΚΑ ΣΟΗΥΔΗΑ Βηνγξαθηθό ζεκείσκα ηεο Απνζηνιίαο Σδέθνπ Σόπνο γέλλεζεο: Άγηνο Θεφδσξνο Καξδίηζαο Ζκεξνκελία γέλλεζεο: 18 Ινπλίνπ 1983 Οηθνγελεηαθή θαηάζηαζε: Άγακε Γηεύζπλζε: 409 Perry street, Ridley park, Pennsylvania 19078, USA Σειέθσλα: , Γηεύζπλζε ειεθηξνληθήο αιιεινγξαθίαο: ΠΟΤΓΔ ΚΑΗ ΔΡΔΤΝΖΣΗΚΖ ΔΜΠΔΗΡΗΑ Ννέκβξηνο 2006 ζήκεξα: Δθπφλεζε δηδαθηνξηθήο δηαηξηβήο ζην εξγαζηήξην ηνπ θαζεγεηή Ισάλλε Λάκπξε, ζην Σκήκα Παζνινγίαο θαη Δξγαζηεξηαθήο Ιαηξηθήο ηνπ Παλεπηζηεκίνπ ηεο Πελλζπιβάληα ησλ ΗΠΑ, ζε ζπλεξγαζία κε ην Σκήκα Ιαηξηθήο ηνπ Γπκνθξηηείνπ Παλεπηζηεκίνπ Θξάθεο. Θέκα: «Μεραληζκνί ξύζκηζεο ηεο ελαιιαθηηθήο νδνύ ηνπ ζπκπιεξώκαηνο θαη βειηίσζε ηεο ζηαζεξόηεηαο ηνπ ζεξαπεπηηθνύ αλαζηνιέα ηνπ ζπκπιεξώκαηνο, Compstatin». Δπηβιέπσλ: Καζεγεηήο Κσλζηαληίλνο Ρίηεο. Ννέκβξηνο 2005 Ννέκβξηνο 2006: Έξεπλα: Αλαδήηεζε αλαζηνιέσλ έλαληη ηνπ ζπκπιεξψκαηνο, ζην εξγαζηήξην ηνπ θαζεγεηή Ισάλλε Λάκπξε, ζην Σκήκα Παζνινγίαο θαη Δξγαζηεξηαθήο Ιαηξηθήο ηνπ Παλεπηζηεκίνπ ηεο Πελλζπιβάληα ησλ ΗΠΑ : Γεκνθξίηεην Παλεπηζηήκην Θξάθεο, Σκήκα Μνξηαθήο Βηνινγίαο θαη Γελεηηθήο, Βαθμός Πτστίοσ: 8,56 (Άριστα) Μάξηηνο 2005 Αχγνπζηνο 2005: Δθπφλεζε δηπισκαηηθήο εξγαζίαο ζην εξγαζηήξην ηνπ θαζεγεηή Ισάλλε Λάκπξε, ζην Σκήκα Παζνινγίαο θαη Δξγαζηεξηαθήο Ιαηξηθήο ηνπ Παλεπηζηεκίνπ ηεο Πελλζπιβάληα ησλ ΗΠΑ. Θέκα: «Αλαζπλδπαζκέλε έθθξαζε θαη θαζαξηζκόο εμσθπηηάξησλ πξσηετλώλ ηνπ ηνύ Vaccinia θαη θαζνξηζκόο ηεο αληηγνληθόηεηάο ηνπο έλαληη ηεο άλνζεο ζθαηξίλεο θαηά ηνπ ηνπ Vaccinia (VIG)». Δπηβιέπσλ: Καζεγεηήο Ισάλλεο Λάκπξεο. Βαθμός: 10 (Άριστα) : 1 ν Δληαίν Λύθεην Καξδίηζαο, Βαθμός πτστίοσ: 19,5 (Άριστα) ΒΡΑΒΔΗΑ ΤΠΟΣΡΟΦΗΔ Βξαβείν επίδνζεο απφ ην Ίδξπκα Κνηλσληθψλ Τπνηξνθηψλ γηα ην αθαδεκατθφ έηνο Τπνηξνθία εηζαγσγήο ζε Αλψηαην Δθπαηδεπηηθφ Ίδξπκα απφ ην Ίδξπκα Κνηλσληθψλ Τπνηξνθηψλ γηα ην έηνο ΓΛΩΔ ΓΝΩΔΗ ΤΠΟΛΟΓΗΣΩΝ Διιεληθά (κεηξηθή) Αγγιηθά (πνιχ θαιή Πηπρίν Proficiency ηνπ Παλεπηζηεκίνπ ηνπ Cambridge θαη ηνπ Michigan) Πεξηβάιινλ Windows, πξνγξάκκαηα Word, Excel, PowerPoint Πξφγξακκα κνξηαθήο απεηθφλεζεο (PyMol) 111

112 Αλαδήηεζε βηβιηνγξαθίαο θαη βάζεσλ δεδνκέλσλ (NCBI, PDB θ.ά.) Πξνγξάκκαηα αλάιπζεο αιιεινπρηψλ (BLAST, Clustal) ΣΡΔΥΟΝΣΑ ΔΡΔΤΝΖΣΗΚΑ ΔΝΓΗΑΦΔΡΟΝΣΑ Αλάιπζε θαη βειηίσζε ησλ θαξκαθνθηλεηηθψλ ηδηνηήησλ ηνπ αλαζηνιέα ηνπ ζπκπιεξψκαηνο Compstatin. Μειέηε ησλ κεραληζκψλ ξχζκηζεο ηνπ ζπκπιεξψκαηνο. Μειέηε ησλ αλαζηνιέσλ ηνπ ζπκπιεξψκαηνο πνπ παξάγεη ν Υξπζίδσλ ηαθπιφθνθθνο. ΔΠΗΣΖΜΟΝΗΚΔ ΓΖΜΟΗΔΤΔΗ (* Γείρλεη ηζφηηκε ζπκβνιή) C. Carmona-Fontaine, E. Theveneau, A. Tzekou, M. Tada, M. Woods, K. Page, M. Parsons, J.D. Lambris, R. Mayor, Complement fragment C3a controls mutual cell attraction during collective cell migration. Dev Cell, accepted for publication. P.J.Knerr*, A.Tzekou*, D.Ricklin, H.Qu, H.Chen, W.A.van der Donk, and J.D.Lambris. "Synthesis and activity of thioether-containing analogues of the complement inhibitor compstatin." ACS Chem Biol 6, no. 7(July 2011): Y.Q.Wu, H.Qu, G.Sfyroera, A.Tzekou, B.K.Kay, B.Nilsson, E.K.Nilsson, D.Ricklin, and J.D.Lambris. "Protection of nonself surfaces from complement attack by factor H-binding peptides: implications for therapeutic medicine." J Immunol 186, no. 7(April 2011): F.Forneris, D.Ricklin, J.Wu, A.Tzekou, R.S.Wallace, J.D.Lambris, and P.Gros. "Structures of C3b in complex with factors B and D give insight into complement convertase formation." Science 330, no. 6012(December 2010): S.Liang, J.L.Krauss, H.Domon, M.L.McIntosh, K.B.Hosur, H.Qu, F.Li, A.Tzekou, J.D.Lambris, and G.Hajishengallis. "The C5a receptor impairs IL-12-dependent clearance of Porphyromonas gingivalis and is required for induction of periodontal bone loss." J Immunol 186, no. 2(January 2011): H.Chen, D.Ricklin, M.Hammel, B.L.Garcia, W.J.McWhorter, G.Sfyroera, Y.Q.Wu, A.Tzekou, S.Li, B.V.Geisbrecht, V.L.Woods, Jr., and J.D.Lambris. "Allosteric inhibition of complement function by a staphylococcal immune evasion protein." Proc Natl Acad Sci U S A 107, no. 41(2010): B.L.Garcia, K.X.Ramyar, A.Tzekou, D.Ricklin, W.J.McWhorter, J.D.Lambris, and B.V.Geisbrecht. "Molecular basis for complement recognition and inhibition determined by crystallographic studies of the staphylococcal complement inhibitor (SCIN) bound to C3c and C3b." J Mol Biol 402, no. 1(2010): D.Ricklin, A.Tzekou, B.L.Garcia, M.Hammel, W.J.McWhorter, G.Sfyroera, Y.Q.Wu, V.M.Holers, A.P.Herbert, P.N.Barlow, B.V.Geisbrecht, and J.D.Lambris. "A molecular insight into complement evasion by the staphylococcal complement inhibitor protein family." J Immunol 183, no. 4(2009): S.H.Rooijakkers, J.Wu, M.Ruyken, R.van Domselaar, K.L.Planken, A.Tzekou, D.Ricklin, J.D.Lambris, B.J.Janssen, J.A.Van Strijp, and P.Gros. "Structural and functional implications of the alternative complement pathway C3 convertase stabilized by a staphylococcal inhibitor." Nat Immunol 10, no. 7(2009): B.L.Garcia, A.Tzekou, K.X.Ramyar, W.J.McWhorter, D.Ricklin, J.D.Lambris, and B.V.Geisbrecht. "Crystallization of human complement component C3b in the presence of a staphylococcal complementinhibitor protein (SCIN)." Acta Crystallogr Sect F Struct Biol Cryst Commun 65, no. Pt 5(2009):

113 ΔΠΗΣΖΜΟΝΗΚΔ ΑΝΑΚΟΗΝΩΔΗ Δ ΤΝΔΓΡΗΑ F. Zipfel, N. Lauer, D. Ricklin, S. Heinen, H.M. Dahse, A. Tzekou, and J.D. Lambris, The new chimeric alternative complement inhibitor COMP_CFH15-20 protects surfaces from complement-mediated damage. Molecular Immunology, 48 no. 14, (2011) SI: N. Lauer, D. Ricklin, S. Heinen, H.M. Dahse, A. Tzekou, J.D. Lambris, and P.F. Zipfel, Use of the C- terminal surface attachment region of factor H to target compstatin to self surfaces and to sites of immunstress. 5th International Complement Therapeutics Conference, Rhodes, Greece, Jul K. Del Rio-Tsonis, T. Haynes, A. Tzekou, A.L. Madrigal, N.P. Echeverri, P. Tsonis, and J.D. Lambris, The role of complement in retina regeneration. 283 Regenerative Medicine I: IPS and Isolated Stem Cells, J. Wu, D. Ricklin, G. Sfyroera, A. Tzekou, J.D. Lambris, and P. Gros, Structures of C3b in complex with regulator provide insights into complement regulation and immune evasion by orthopoxviruses. 5th International Complement Therapeutics Conference, Rhodes, Greece, Jul D. Ricklin, H. Chen, M. Hammel, B.L. Garcia, W.J. McWhorter, G. Sfyroera, Y.Q. Wu,, A. Tzekou, S.Li, B.V. Geisbrecht, V.L. Woods, and J.D. Lambris, Allosteric inhibition of complement function by the Staphylococcal immune evasion protein Efb. Molecular Immunology, 47 no. 13, (2010) SI: B.L. Garcia, A. Tzekou, D. Ricklin, K.X. Ramyar, W.J. McWhorter, B.V. Geisbrecht, and J.D. Lambris, Molecular basis for complement recognition and inhibition by staphylococcal complement inhibitors. Molecular Immunology, 47 no. 13, (2010) SI: J. Wu, D. Ricklin, G. Sfyroera, A. Tzekou, J.P. Atkinson, J.D. Lambris, and P. Gros, Characterization of the interactions between C3b and complement regulators. Molecular Immunology, 47 no. 13, (2010) SI: F. Forneris, J. Wu, R.S. Wallace, A. Tzekou, D. Ricklin, J.D. Lambris, and P. Gros, Crystal structure of C3bB in complex with factor D. Molecular Immunology, 47 no. 13, (2010) SI: D. Ricklin, H. Chen, M. Hammel, A. Tzekou, B.L. Garcia, W.J. McWhorter, G. Sfyroera, Y.Q. Wu, V.L. Woods, B.V. Geisbrecht, and J.D. Lambris, Learning from little bugs - what bacterial immune evasion molecules teach us about the dynamics and function of complement. 7th International Conference on Innate Immunity, Rhodes, Greece, Jul B.L. Garcia, A. Tzekou, D. Ricklin, K.X. Ramyar, W.J. McWhorter, J.D. Lambris, and B.V. Geisbrecht, New insight into the structure/function relationships of the Staphylococcal Complement Inhibitor (SCIN) protein family. 7th International Conference on Innate Immunity, Rhodes, Greece, Jul B.L. Garcia, A. Tzekou, D. Ricklin, K.X. Ramyar, W.J. McWhorter, J.D. Lambris, and B.V. Geisbrecht, Structural insights into the mechanism of the Staphylococcal Complement Inhibitor (SCIN). 7th International Conference on Innate Immunity, Jul D. Ricklin, J. Wu, S.H.M. Rooijakkers, Y.Q. Wu, A. Tzekou, B.L. Garcia, M. Hammel, W.J. McWorther, G. Sfyroera, H. Chen, B.J.C. Janssen, J.A.G. van Strijp, P. Gros, B.V. Geisbrecht, and J.D. Lambris, A biophysical look beneath the SCIN of immune evasion by Staphylococcus aureus. Current Trends in Microcalorimetry and Biacore Symposium 2009, Baltimore, MD, Oct D.Ricklin, S.K. Ricklin-Lichtsteiner, G. Sfyroera, H. Chen, A. Tzekou, P. Magotti, Y.Q. Wu, B.L. Garcia, W.J. McWorther, N.Haspel, L.E. Kavraki, B.V. Geisbrecht, and J.D. Lambris, Novel insights into target 113

114 specificities and molecular mechanisms for two potent complement evasion proteins from Staphylococcus aureus. Molecular Immunology, 45 no. 16, (2008) SI: C. Carmona-Fontaine, E. Theveneau, A. Tzekou, J.D. Lambris, and R. Mayor, A novel role of C3 as a regulator of neural crest migration during embryo development. Molecular Immunology, 45 no. 16, (2008) SI: Y.Q. Wu, A. Tzekou, P. Magotti, G. Sfyroera, H. Qu, D. Ricklin, B.K. Kay, and J.D. Lambris, Identification of complement-targeting peptides using phage-display libraries. Molecular Immunology, 45 no. 16, (2008) SI: I. Kourtzelis, S. Rafail, I. Mitroulis, S. Panagoutsos, K. Kampas, A. Tzekou, M. Doumas, G. Kartalis, V. Vargemezis, P. Passadakis, J.D. Lambris, and K. Ritis, Hemodialysis biomaterials induce the expression of procoagulant tissue factor through neutrophils-complement cross-talk. 15 th Hellenic Congress of Nephrology, Athens, Greece, J.D. Lambris, G. Sfyroera, M. Schuster, H. Chen, A. Tzekou, K. Papp, M. Winters, and V.L. Woods, Studies on the solvent accessibility of native C3 and its fragments, as analyzed by HDX-MS. Molecular Immunology, 44 no. 1-3, (2007) SI: I. Kourtzelis, K. Kampas, A. Tzekou, S. Rafail, S. Panagoutsos, P. Passadakis, T. Paraskevopoulou, S. Petanidis, I. Mitroulis, M. Doumas, J.D. Lambris, and K. Ritis, A complement dependent Tissue Factor (TF) expression is triggered by hemodialysis biomaterials., 29 th Scientific Congress of Hellenic Society for Biological Sciences, Kavala, Greece, ΠΡΟΚΔΚΛΖΜΔΝΖ ΟΜΗΛΖΣΡΗΑ ProteOn User Group Meeting, Baltimore, USA, October 2010: Complement inhibitor Compstatin as an example of using SPR in academic drug development. 114

115 Λίζηα επηζηεκνληθώλ δεκνζηεύζεσλ 115

116 1 (Έρεη γίλεη δεθηό γηα δεκνζίεπζε) 116

117 2 117

118 118

119 119

120 120

121 121

122 122

123 123

124 124

125 3 125

126 4 126

127 5 127

128 6 128

129 7 129

130 8 130

131

132 132

ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP

ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP ηότοι εργαζηηρίοσ ην πιαίζην ηνπ ζπγθεθξηκέλνπ εξγαζηεξίνπ ζα παξνπζηαζηνύλ βαζηθέο ιεηηνπξγίεο ησλ Windows XP πνπ ζρεηίδνληαη

Διαβάστε περισσότερα

Βάσεις Δεδομέμωμ. Εξγαζηήξην V. Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016

Βάσεις Δεδομέμωμ. Εξγαζηήξην V. Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016 Βάσεις Δεδομέμωμ Εξγαζηήξην V Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016 2 Σκοπός του 5 ου εργαστηρίου Σθνπόο απηνύ ηνπ εξγαζηεξίνπ είλαη: ε κειέηε ζύλζεησλ εξσηεκάησλ ζύλδεζεο ζε δύν ή πεξηζζόηεξεο ζρέζεηο ε κειέηε

Διαβάστε περισσότερα

«Μειέηεο ζηε ρσξηθή θαη ρξνληθή έθθξαζε ηνπ γνληδίνπ C3 θαη ηνπ ζπκπιόθνπ MAC ηνπ ζπζηήκαηνο ηνπ ζπκπιεξώκαηνο ζηελ όξληζα (Gallus gallus)»

«Μειέηεο ζηε ρσξηθή θαη ρξνληθή έθθξαζε ηνπ γνληδίνπ C3 θαη ηνπ ζπκπιόθνπ MAC ηνπ ζπζηήκαηνο ηνπ ζπκπιεξώκαηνο ζηελ όξληζα (Gallus gallus)» ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΥΟΛΖ ΔΠΗΣΖΜΩΝ ΤΓΔΗΑ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Πξόγξακκα Μεηαπηπρηαθώλ πνπδώλ Δθαξκνγέο ζηηο Βαζηθέο Ηαηξηθέο Δπηζηήκεο «Μνξηαθή Βηνινγία θαη Κπηηαξνγελεηηθή» ΓΗΠΛΩΜΑΣΗΚΖ ΔΡΓΑΗΑ «Μειέηεο ζηε ρσξηθή

Διαβάστε περισσότερα

H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ

H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ Φξεζηκόηεηα καζεκαηηθώλ Αξρή θαηακέηξεζεο Όζα έδσζαλ νη Έιιελεο... Τξίγσλνη αξηζκνί Τεηξάγσλνη αξηζκνί Δπηκήθεηο αξηζκνί Πξώηνη αξηζκνί Αξηζκνί κε μερσξηζηέο ηδηόηεηεο Γίδπκνη πξώηνη

Διαβάστε περισσότερα

ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ

ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ 1.Απηόο πνπ ζα αλαγλσξηζηεί απνπζηάδεη γηα πνιύ θαηξό. 2.Δπηζηξέθεη κε πιαζηή ηαπηόηεηα ή κεηακνξθσκέλνο. 3.Απνκνλώλνληαη ηα δύν πξόζσπα 4.Άξζε κεηακόξθσζεο 5.Απνθάιπςε 6.Ακθηβνιίεο-απνδεηθηηθά

Διαβάστε περισσότερα

Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training. Dipl.Biol.cand.med. Stylianos Kalaitzis

Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training. Dipl.Biol.cand.med. Stylianos Kalaitzis Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training Dipl.Biol.cand.med. Stylianos Kalaitzis Stylianos Kalaitzis Μνλνϋβξηδηζκνο 1 Γπν γνλείο, εηεξόδπγνη γηα ηνλ αιθηζκό θάλνπλ παηδηά. Πνία ε πηζαλόηεηα

Διαβάστε περισσότερα

Η απνξξόθεζε ηνπ νξαηνύ θσηόο γίλεηαη κέζσ ρξσζηηθώλ νπζηώλ πνπ νλνκάδνληαη τλωροθύλλες.

Η απνξξόθεζε ηνπ νξαηνύ θσηόο γίλεηαη κέζσ ρξσζηηθώλ νπζηώλ πνπ νλνκάδνληαη τλωροθύλλες. ΦΩΣΟΤΝΘΔΗ Δλαιιαθηηθή δηεξγαζία παξαγσγήο ελέξγεηαο Υξεζηκνπνηείηαη από ηνπο νλνκαδόκελνπο θσηνζπλζεηηθνύο νξγαληζκνύο Οπζηαζηηθά ε αληίζηξνθε δηεξγαζία ηεο αλαπλνήο πλίζηαηαη ζηελ δέζκεπζε ειηαθήο ελέξγεηαο

Διαβάστε περισσότερα

Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ. Καξθηά 3 θηιά πεξίπνπ κε κήθνο ηξηπιάζην από ην πάρνο ηνπ μύινπ θπξί κεγάιν θαη ππνκνλή

Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ. Καξθηά 3 θηιά πεξίπνπ κε κήθνο ηξηπιάζην από ην πάρνο ηνπ μύινπ θπξί κεγάιν θαη ππνκνλή Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΙΩΝ ΠΡΩΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ ΔΝΟΣΗΣΑ 10 ε : ΜΗΥΑΝΙΚΗ ΜΔΡΟ Β ΠΙΔΗ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Καξέθια θαθίξε Όξγαλα Τιηθά Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ.

Διαβάστε περισσότερα

ΑΝΤΗΛΙΑΚΑ. Η Μηκή ζθέθηεθε έλαλ ηξόπν, γηα λα ζπγθξίλεη κεξηθά δηαθνξεηηθά αληειηαθά πξντόληα. Απηή θαη ν Νηίλνο ζπλέιεμαλ ηα αθόινπζα πιηθά:

ΑΝΤΗΛΙΑΚΑ. Η Μηκή ζθέθηεθε έλαλ ηξόπν, γηα λα ζπγθξίλεη κεξηθά δηαθνξεηηθά αληειηαθά πξντόληα. Απηή θαη ν Νηίλνο ζπλέιεμαλ ηα αθόινπζα πιηθά: ΑΝΤΗΛΙΑΚΑ Η Μηκή θαη ν Νηίλνο αλαξσηήζεθαλ πνην αληειηαθό πξντόλ παξέρεη ηελ θαιύηεξε πξνζηαζία ζην δέξκα ηνπο. Τα αληειηαθά πξντόληα έρνπλ έλα δείθηε αληειηαθήο πξνζηαζίαο (SPF), ν νπνίνο δείρλεη πόζν

Διαβάστε περισσότερα

Α. Εηζαγσγή ηεο έλλνηαο ηεο ηξηγσλνκεηξηθήο εμίζσζεο κε αξρηθό παξάδεηγκα ηελ εκx = 2

Α. Εηζαγσγή ηεο έλλνηαο ηεο ηξηγσλνκεηξηθήο εμίζσζεο κε αξρηθό παξάδεηγκα ηελ εκx = 2 ΣΡΙΓΩΝΟΜΔΣΡΙΚΔ EΞΙΩΔΙ Πνηα παξαδείγκαηα εμηζώζεσλ ή θαη πξνβιεκάησλ πηζηεύεηαη όηη είλαη θαηάιιεια γηα ηελ επίιπζε ηνπο θαηά ηελ δηάξθεηα ηεο δηδαθηηθήο δηαδηθαζίαο κέζα ζηελ ηάμε; 1 ε ΓΙΓΑΚΣΙΚΗ ΩΡΑ Α.

Διαβάστε περισσότερα

Κεθάλαιο 1. Ενόηηηα 2 Πλάνο Μάρκεηινγκ. Εξγαιεία Μάξθεηηλγθ. Dr. Andrea Grimm Dr. Astin Malschinger

Κεθάλαιο 1. Ενόηηηα 2 Πλάνο Μάρκεηινγκ. Εξγαιεία Μάξθεηηλγθ. Dr. Andrea Grimm Dr. Astin Malschinger Κεθάλαιο 1 Ενόηηηα 2 Πλάνο Μάρκεηινγκ Εξγαιεία Μάξθεηηλγθ Dr. Andrea Grimm Dr. Astin Malschinger ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ 2 ΠΛΑΝΟ ΜΑΡΚΕΤΙΝΓΚ Κεθάιαην 1: Εξγαιεία Μάξθεηηλγθ Σπγγξαθείο: Δξ. Andrea Grimm, Δξ.

Διαβάστε περισσότερα

Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 2011-12

Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 2011-12 Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 11-12 Project 6: Ταμίδη κε ηε Μεραλή ηνπ Φξόλνπ Υπεύζπλνη Καζεγεηέο: Ε. Μπηιαλάθε Φ. Αλησλάηνο Δρώηηζη 3: Πνηα από ηα παξαθάησ ΜΜΕ ηεξαξρείηε από πιεπξάο ζεκαζίαο;

Διαβάστε περισσότερα

Σύνθεζη ηαλανηώζεων. Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο:

Σύνθεζη ηαλανηώζεων. Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο: Σύνθεζη ηαλανηώζεων Α. Σύλζεζε δύν α.α.η ηεο ίδιας ζστνόηηηας Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο: Η απνκάθξπλζε

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου έλαξμεο 09.30 ιήμεο 09.45 Σην παξαθάησ ζρήκα θαίλεηαη ηκήκα ελόο πνιενδνκηθνύ ζρεδίνπ κηαο πόιεο. Οη ζθηαζκέλεο

Διαβάστε περισσότερα

ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ

ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ Κιηληθή ηαμηλόκεζε ηνπ βαζκνύ ηεξεδνληθήο βιάβεο ηωλ νπώλ θαη ζρηζκώλ καζεηηθώλ επηθαλεηώλ θαηά ICDAS 1 νο Βαζκόο

Διαβάστε περισσότερα

Φιεγκνλψδεηο ππξνδνηεηέο ζε θιηληθά κνληέια Μειέηε ηνπ ξπζκηζηηθνχ ξφινπ ηεο αλαθπιαηνμίλεο C5a

Φιεγκνλψδεηο ππξνδνηεηέο ζε θιηληθά κνληέια Μειέηε ηνπ ξπζκηζηηθνχ ξφινπ ηεο αλαθπιαηνμίλεο C5a Φιεγκνλψδεηο ππξνδνηεηέο ζε θιηληθά κνληέια Μειέηε ηνπ ξπζκηζηηθνχ ξφινπ ηεο αλαθπιαηνμίλεο C5a Inflammatory mediators in clinical models Σhe regulatory role of C5a anaphylatoxin ΓΗΓΑΚΣΟΡΗΚΖ ΓΗΑΣΡΗΒΖ ΗΩΑΝΝΖ

Διαβάστε περισσότερα

Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots)

Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots) Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots) 1.1 Σςνοπτική Πεπιγπαυή Hot Spots Σα ζεκεία αζύξκαηεο πξόζβαζεο πνπ επηιέρζεθαλ αλαθέξνληαη ζηνλ επόκελν πίλαθα θαη παξνπζηάδνληαη αλαιπηηθά ζηηο επόκελεο παξαγξάθνπο.

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου ΠΡΟΒΛΗΜΑ Σε έλα ηνπξλνπά βόιετ δήισζαλ ζπκκεηνρή νκάδεο Γπκλαζίσλ ηεο Κύπξνπ.

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ ΜΑΘΗΜΑ : ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_1382/153 1. Καη όηαλ έγηλε ε ππνρώξεζε αξγά ην απόγεπκα, επεηδή θνβήζεθαλ νη νιηγαξρηθνί κήπσο νη δεκνθξαηηθνί, αθνύ θάλνπλ επίζεζε, θαηαιάβνπλ

Διαβάστε περισσότερα

Γιπθόδε + Ομπγόλν Δηνμείδην ηνπ άλζξαθα + Νεξό + Ελέξγεηα

Γιπθόδε + Ομπγόλν Δηνμείδην ηνπ άλζξαθα + Νεξό + Ελέξγεηα 4. ΑΝΑΠΝΟΗ Η δηάζπαζε ηεο γιπθόδεο γίλεηαη κέζα ζηα θύηηαξα, νλνκάδεηαη θπηηαξηθή αλαπλνή θαη εμαζθαιίδεη ηελ ελέξγεηα πνπ είλαη απαξαίηεηε ζην θύηηαξν. Η δηάζπαζε γίλεηαη κε ηελ παξνπζία νμπγόλνπ θαη

Διαβάστε περισσότερα

Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα!

Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα! Cpyright 2013 Λόγος & Επικοινωνία // All rights Reserved Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα! Αυηό ηο παιχνίδι έχει ζηόχους: 1. ηελ εθγύκλαζε ηεο αθνπζηηθήο κλήκεο ησλ παηδηώλ 2. ηελ εμάζθεζε ζηελ

Διαβάστε περισσότερα

ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΛΘΤΑΗΚΘΔΗΡ Τ.

ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΛΘΤΑΗΚΘΔΗΡ Τ. ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΟΑIΤΜΘΔΘ ΡΕ ΛΕΓΑΚΞ ΓΗΟΕΔΞ 11V11 ΗΚΘΙΘΑ 6-10 ΤΠΞΜΩΜ ΛΕΘΞΜΕΙΗΛΑΑ ΞΣ ΟΑΘΤΜΘΔΘΞΣ ΡΕ ΛΕΓΑΚΞ ΓΗΟΕΔΞ ΓΘΑ ΟΑΘΙΕΡ ΗΚΘΙΘΑΡ 6-10 ΕΩΜ Η ΔΘΑΔΠΞΛΗ ΑΟΞ Η ΛΘΑ ΕΡΘΑ ΡΗΜ ΑΚΚΗ ΕΘΜΑΘ ΛΕΓΑΚΗ

Διαβάστε περισσότερα

Δπηιέγνληαο ην «Πξνεπηινγή» θάζε θνξά πνπ ζα ζπλδέεζηε ζηελ εθαξκνγή ζα βξίζθεζηε ζηε λέα ρξήζε.

Δπηιέγνληαο ην «Πξνεπηινγή» θάζε θνξά πνπ ζα ζπλδέεζηε ζηελ εθαξκνγή ζα βξίζθεζηε ζηε λέα ρξήζε. ΑΝΟΙΓΜΑ ΝΔΑ ΥΡΗΗ 1. Γεκηνπξγείηε ηε λέα ρξήζε από ηελ επηινγή «Παξάκεηξνη/Παξάκεηξνη Δηαηξίαο/Γηαρείξηζε Δηαηξηώλ». Πιεθηξνινγείηε ηνλ θσδηθό ηεο εηαηξίαο ζαο θαη παηάηε Enter. Σηελ έλδεημε «Υξήζεηο» παηάηε

Διαβάστε περισσότερα

ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ ΥΟΛΗ ΓΔΩΣΔΥΝΙΚΩΝ ΔΠΙΣΗΜΩΝ ΚΑΙ ΓΙΑΥΔΙΡΙΗ ΠΔΡΙΒΑΛΟΝΣΟ. Πτυχιακή διατριβή ΟΛΟΚΛΗΡΩΜΔΝΗ ΑΠΟΡΡΤΠΑΝΗ ΚΑΤΑΔΡΙΩΝ ΠΛΟΙΩΝ

ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ ΥΟΛΗ ΓΔΩΣΔΥΝΙΚΩΝ ΔΠΙΣΗΜΩΝ ΚΑΙ ΓΙΑΥΔΙΡΙΗ ΠΔΡΙΒΑΛΟΝΣΟ. Πτυχιακή διατριβή ΟΛΟΚΛΗΡΩΜΔΝΗ ΑΠΟΡΡΤΠΑΝΗ ΚΑΤΑΔΡΙΩΝ ΠΛΟΙΩΝ ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ ΥΟΛΗ ΓΔΩΣΔΥΝΙΚΩΝ ΔΠΙΣΗΜΩΝ ΚΑΙ ΓΙΑΥΔΙΡΙΗ ΠΔΡΙΒΑΛΟΝΣΟ Πτυχιακή διατριβή ΟΛΟΚΛΗΡΩΜΔΝΗ ΑΠΟΡΡΤΠΑΝΗ ΚΑΤΑΔΡΙΩΝ ΠΛΟΙΩΝ Αργσρώ Ιωάννοσ Λεμεσός 2012 ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ

Διαβάστε περισσότερα

Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική ΑΔ

Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική ΑΔ Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική Δίζηε μησανικόρ διοίκηζηρ μεγάληρ καηαζκεςαζηικήρ εηαιπείαρ και καλείζηε να ςλοποιήζεηε ηο έπγο πος πεπιγπάθεηαι από ηον Πίνακα 1. Κωδ.

Διαβάστε περισσότερα

Δξγαιεία Καηαζθεπέο 1 Σάμε Σ Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ. ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Φαθόο κε ζσιήλα.

Δξγαιεία Καηαζθεπέο 1 Σάμε Σ Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ. ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Φαθόο κε ζσιήλα. Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Φαθόο κε ζσιήλα Γηαθξάγκαηα Δξγαιεία Καηαζθεπέο 2 Η θαηαζθεπή πεξηγξάθεηαη ζηελ αληίζηνηρε ελόηεηα

Διαβάστε περισσότερα

ΤΠΟΓΟΥΔΑ Σ-ΛΔΜΦΟΚΤΣΣΑΡΟΤ

ΤΠΟΓΟΥΔΑ Σ-ΛΔΜΦΟΚΤΣΣΑΡΟΤ ΤΠΟΓΟΥΔΑ Σ-ΛΔΜΦΟΚΤΣΣΑΡΟΤ 6 Τα Τ-ιεκθνθύηηαξα παίδνπλ ζεκαληηθό ξόιν ζηελ αλνζηαθή απάληεζε έλαληη ηωλ πξωηεϊληθώλ αληηγόλωλ. Από ηε ζηηγκή πνπ όινη νη παζνγόλνη κηθξννξγαληζκνί πεξηέρνπλ πξωηεΐλεο, ηα

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ 1. ρεδίαζε πλδπαζηηθνύ Κπθιώκαηνο Έλα ζπλδπαζηηθό θύθισκα (Κ) έρεη ηξεηο εηζόδνπο A, B θαη C θαη κία έμνδν Y Y=A B+AC Να θαηαζθεπάζεηε ην ράξηε Karnaugh. B 0

Διαβάστε περισσότερα

Μονοψϊνιο. Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ.

Μονοψϊνιο. Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ. Μονοψϊνιο Ολιγοψώνιο Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ. Οπιακή αξία Δπηπξόζζεηα νθέιε από ηελ ρξήζε/θαηαλάισζε κηαο επηπξόζζεηε

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου έλαξμεο 09.30 ιήμεο 09.45 Σην παξαθάησ ζρήκα θαίλεηαη ηκήκα ελόο πνιενδνκηθνύ ζρεδίνπ κηαο πόιεο. Οη ζθηαζκέλεο

Διαβάστε περισσότερα

TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΠΡΟΑΡΜΟΓΗ: ΒΑΛΚΑΝΙΩΣΗ ΔΗΜ. ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 TOOLBOOK ΜΑΘΗΜΑ 2

TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΠΡΟΑΡΜΟΓΗ: ΒΑΛΚΑΝΙΩΣΗ ΔΗΜ. ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 TOOLBOOK ΜΑΘΗΜΑ 2 TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 Δημιουργία σελίδων και βιβλίων Έλα θαηλνύξην βηβιίν πεξηέρεη κία άδεηα ζειίδα κε έλα άδεην background. Δελ κπνξνύκε λα μερσξίζνπκε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ

ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ ΘΔΜΑ Α Α1. α. Σ β. Σ γ. Λ δ. Λ ε. Λ ζη. Σ Α2. Γ Α3. 1. γ 2. ε 3. δ 4. α Β1. ΘΔΜΑ Β Οη ηειηθνί ππνινγηζηέο παίξλνπλ απνθάζεηο δξνκνιόγεζεο κόλν γηα ηα δηθά ηνπο απηνδύλακα

Διαβάστε περισσότερα

Οδηγίες τρήζης για λειηοσργία μεηαθοράς καναλιών ζε υηθιακό δέκηη OST-7060 HD

Οδηγίες τρήζης για λειηοσργία μεηαθοράς καναλιών ζε υηθιακό δέκηη OST-7060 HD Οδηγίες τρήζης για λειηοσργία μεηαθοράς καναλιών ζε υηθιακό δέκηη OST-7060 HD Γηα ηε δηεπθόιπλζή ζαο θαηά ην switch-off ηεο πεξηνρήο ηεο Πεινπνλλήζνπ έρνπκε πξνζζέζεη ζηνπο ςεθηαθνύο καο δέθηεο κία λέα,

Διαβάστε περισσότερα

Α Ο Κ Η Α Μ Α Ζ Η Η Ρ Η ( S E A R C H )

Α Ο Κ Η Α Μ Α Ζ Η Η Ρ Η ( S E A R C H ) Ξ G O O G L E S C H O L A R Α Ο Ξ Ε Κ Ε Θ Λ Θ Α Λ Η Τ Α Μ Η Α Μ Α Ζ Η Η Ρ Η Ρ Οξαγκαηνπνηώληαο αλαδήηεζε ζην GoogleScholar (http://scholar.google.com/) ν ρξήζηεο κπνξεί λα εληνπίζεη πιηθό αθαδεκαϊθνύ θαη

Διαβάστε περισσότερα

iii. iv. γηα ηελ νπνία ηζρύνπλ: f (1) 2 θαη

iii. iv. γηα ηελ νπνία ηζρύνπλ: f (1) 2 θαη ΔΠΑΝΑΛΗΠΣΙΚΑ ΘΔΜΑΣΑ ΣΟ ΓΙΑΦΟΡΙΚΟ ΛΟΓΙΜΟ Μάρτιος 0 ΘΔΜΑ Να ππνινγίζεηε ηα όξηα: i ii lim 0 0 lim iii iv lim e 0 lim e 0 ΘΔΜΑ Γίλεηαη ε άξηηα ζπλάξηεζε '( ) ( ) γηα θάζε 0 * : R R γηα ηελ νπνία ηζρύνπλ:

Διαβάστε περισσότερα

ΔΕΟ 13. Ποσοτικές Μέθοδοι. θαη λα ππνινγίζεηε ην θόζηνο γηα 10000 παξαγόκελα πξντόληα. Να ζρεδηαζηεί γηα εύξνο πξντόλησλ έσο 30000.

ΔΕΟ 13. Ποσοτικές Μέθοδοι. θαη λα ππνινγίζεηε ην θόζηνο γηα 10000 παξαγόκελα πξντόληα. Να ζρεδηαζηεί γηα εύξνο πξντόλησλ έσο 30000. ΔΕΟ 13 Ποσοτικές Μέθοδοι Σσνάρηηζη Κόζηοσς C(), μέζο κόζηος C()/. Παράδειγμα 1 Μηα εηαηξεία δαπαλά γηα θάζε πξντόλ Α πνπ παξάγεη 0.0 λ.κ. Τα πάγηα έμνδα ηεο εηαηξείαο είλαη 800 λ.κ. Ζεηείηαη 1) Να πεξηγξάςεηε

Διαβάστε περισσότερα

ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ

ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ Σν ζύγρξνλν πξόηππν αληηκεηώπηζεο ηεο ηεξεδόλαο ελειίθσλ δελ εζηηάδεηαη κόλν ζηελ απνθαηάζηαζε ησλ ηεξεδνληθώλ βιαβώλ πνπ έρνπλ εθδεισζεί, αιιά έρεη

Διαβάστε περισσότερα

ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43

ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43 ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43 Κα ακαθένεηε 5 εονςπασθέξ πώνεξ θαη κα βνείηε ημ είδμξ ημο μνοθημύ ημοξ πιμύημο. Πμημη πανάγμκηεξ επηηνέπμοκ ηεκ θαηαζθεοή μεγάιςκ ηεπκηθώκ ένγςκ; Ε ελόνολε (ελαγςγή

Διαβάστε περισσότερα

Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15

Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15 Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15 Εηζαγσγή Οη ηερληθέο ζπληήξεζεο ηξνθίκσλ έρνπλ ζθνπό : α) λα παξεκπνδίζνπλ αλεπηζύκεηεο κεηαβνιέο ζηα ραξαθηεξηζηηθά (γεύζε - ρξώκα -

Διαβάστε περισσότερα

γηα ηνλ Άξε Κσλζηαληηλίδε

γηα ηνλ Άξε Κσλζηαληηλίδε γηα ηνλ Άξε Κσλζηαληηλίδε γηα «ην θνηλό θαη ην θύξην» (Γ.νισκόο) γηα λα ρηίδω πάληα κε ηνλ ίδηνλε ηξόπν, κε ηηο ίδηεο θαηαζθεπαζηηθέο θαη πιαζηηθέο πξννπηηθέο, κε ηελ ίδηαλε πάληνηε πίζηε θαη αγάπε.. Α.Κ.

Διαβάστε περισσότερα

ΛΙΜΝΗ ΤΣΑΝΤ. Σρήκα 1. Σρήκα 2

ΛΙΜΝΗ ΤΣΑΝΤ. Σρήκα 1. Σρήκα 2 ΛΙΜΝΗ ΤΣΑΝΤ Τν Σρήκα 1 δείρλεη ηελ αιιαγή ηεο ζηάζκεο ηεο Λίκλεο Τζαλη, ζηε Σαράξα ηεο Βόξεηαο Αθξηθήο. Η Λίκλε Τζαλη εμαθαλίζηεθε ηειείσο γύξσ ζην 20.000 π.χ., θαηά ηε δηάξθεηα ηεο ηειεπηαίαο επνρήο ησλ

Διαβάστε περισσότερα

Μορθές Κακόβοσλοσ Κώδικα (Malicious Code)

Μορθές Κακόβοσλοσ Κώδικα (Malicious Code) Μορθές Κακόβοσλοσ Κώδικα (Malicious Code) Page 1 Υποπλοίαρτος Ν. Πεηράκος ΠΝ Αηδένηα Γνύξεηνη Ίππνη (Trojan Horses) Ινί (Viruses) Worms Root-kit Page 2 Γνύξεηνο Ίππνο (Trojan Horse) Οξηζκόο: Πξόγξακκα

Διαβάστε περισσότερα

ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ

ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ Εδώ ζα ππνινγίζνπκε ην κεηαζρεκαηηζκό Fourier κεξηθώλ αθόκα ζεκάησλ, πξνζπαζώληαο λα μεθηλήζνπκε από ην κεηαζρεκαηηζκό Fourier γλσζηώλ ζεκάησλ

Διαβάστε περισσότερα

ΔΦΑΡΜΟΜΔΝΑ ΜΑΘΗΜΑΣΙΚΑ ΣΗ ΧΗΜΔΙΑ Ι ΘΔΜΑΣΑ Α επηέκβξηνο 2009. 1. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(x,y) =

ΔΦΑΡΜΟΜΔΝΑ ΜΑΘΗΜΑΣΙΚΑ ΣΗ ΧΗΜΔΙΑ Ι ΘΔΜΑΣΑ Α επηέκβξηνο 2009. 1. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(x,y) = ΘΔΜΑΣΑ Α επηέκβξηνο 9. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(,y) = y.. Να ππνινγηζηνύλ ηα νινθιεξώκαηα: a) ln b) a) 3cos b) e sin 4. Να ππνινγηζηεί ην νινθιήξσκα: S ( y) 3

Διαβάστε περισσότερα

ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ

ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ ΠΑΡΑΔΕΙΓΜΑΣΑ Ο πολσμεριζμός Πολσμεριζμός είναι η τημική ανηίδραζη καηά ηην οποία πολλά μόρια ίδιων ή διαθορεηικών οργανικών ενώζεων, ποσ ονομάζονηαι μονομερή, ενώνονηαι και ζτημαηίζοσν

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΤΝΔΥΗΕΟΜΔΝΖ ΔΚΠΑΗΓΔΤΖ ΔΣΟΤ 2010-2011

ΠΡΟΓΡΑΜΜΑ ΤΝΔΥΗΕΟΜΔΝΖ ΔΚΠΑΗΓΔΤΖ ΔΣΟΤ 2010-2011 ΠΡΟΓΡΑΜΜΑ ΤΝΔΥΗΕΟΜΔΝΖ ΔΚΠΑΗΓΔΤΖ ΔΣΟΤ 2010-2011 Σα καζήκαηα γίλνληαη ζην γξαθείν ησλ ηαηξώλ ηνπ Tκήκαηνο θάζε Πέκπηε 12:00 14:00, ρξεζηκνπνηώληαο ηα θαηάιιεια νπηηθναθνπζηηθά κέζα, εθηόο Ηνπιίνπ θαη Απγνύζηνπ.

Διαβάστε περισσότερα

Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π

Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π Α ο υ ι ς ε κ ς ξ μ ι κ ή ρ ύ μ θ ε ρ η 6 Τ ξ μ έ α π ΘΘΘ, X ώ ο ξ π κ α ι Δ π ι κ ξ ι μ χ μ ί α Η έ μ α : Διδάρκξμςεπ: Τξ εύοξπ ςξσ ξοίξσ Ιεοαμεικόπ

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_1379/50 1. Όηαλ ινηπόλ ήξζαλ [νη πξέζβεηο ζηελ Αζήλα], αθνύ ζπλέιαβαλ νη Αζελαίνη θαη ηνπο πξέζβεηο σο ππνθηλεηέο ζηάζεο θαη όζνπο έπεηζαλ [νη πξέζβεηο], ηνπο ζπγθέληξσζαλ γηα αζθάιεηα ζηελ Αίγηλα.

Διαβάστε περισσότερα

Δξγαιεία Καηαζθεπέο 1 Σάμε Δ Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ. ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Ογθνκεηξηθό δνρείν

Δξγαιεία Καηαζθεπέο 1 Σάμε Δ Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ. ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Ογθνκεηξηθό δνρείν Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Ογθνκεηξηθό δνρείν Καηαζθεπάδνπκε έλα νγθνκεηξηθό δνρείν από πιαζηηθό κπνπθάιη λεξνύ

Διαβάστε περισσότερα

Πως να δημιουργήσετε ένα Cross-Over καλώδιο

Πως να δημιουργήσετε ένα Cross-Over καλώδιο Πως να δημιουργήσετε ένα Cross-Over καλώδιο Τν crossover καλώδιο ρξεζηκνπνηείηαη γηα λα ζπλδεζνύλ δπν ππνινγηζηέο κεηαμύ ηνπο θαη αλ θηηάμνπλ έλα κηθξό ηνπηθό δίθηπν(lan). Έλα LAN κπνξεί λα είλαη ηόζν

Διαβάστε περισσότερα

ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ

ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ 1) Υξηζηνπγελληάηηθα ειαηάθηα θάξηα ή θαδξάθη θάξηα ή θαδξάθη Τιηθά πνπ ζα ρξεηαζηνύκε: Υαξηί θάλζνλ καύξν γηα ην θόλην, πξάζηλν γηα ηα ειαηάθηα, θόθθηλν γηα ηα αζηεξάθηα Απιό

Διαβάστε περισσότερα

ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KARNAUGH

ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KARNAUGH ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KRNUGH Γηα λα θάλνπκε απινπνίεζε κηαο ινγηθήο ζπλάξηεζεο κε πίλαθα (ή ράξηε) Karnaugh αθνινπζνύκε ηα παξαθάησ βήκαηα:. Η ινγηθή ζπλάξηεζε ζα πξέπεη λα είλαη ζε πιήξε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 εως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΑΙΟΛΙΚΑ ΠΑΡΚΑ. Δρώτηση 1

ΑΙΟΛΙΚΑ ΠΑΡΚΑ. Δρώτηση 1 ΑΙΟΛΙΚΑ ΠΑΡΚΑ Πνιινί άλζξσπνη πηζηεύνπλ όηη ν άλεκνο ζα έπξεπε λα αληηθαηαζηήζεη ην πεηξέιαην θαη ην θάξβνπλν σο πεγή ελέξγεηαο γηα ηελ παξαγσγή ειεθηξηζκνύ. Οη θαηαζθεπέο πνπ θαίλνληαη ζηελ εηθόλα είλαη

Διαβάστε περισσότερα

Γηαγλσζηηθή θαη Θεξαπεπηηθή Πξνζέγγηζε ηνπ «Μεγάθνινπ»

Γηαγλσζηηθή θαη Θεξαπεπηηθή Πξνζέγγηζε ηνπ «Μεγάθνινπ» Γηαγλσζηηθή θαη Θεξαπεπηηθή Πξνζέγγηζε ηνπ «Μεγάθνινπ» Κσλζηαληίλνο Μηκίδεο Γαζηξεληεξνιόγνο Δπίθνπξνο Καζεγεηήο Παζνινγίαο Γεκνθξίηεην Παλεπηζηήκην Θξάθεο Οξηζκόο Ο όξνο κεγάθνιν αλαθέξεηαη ζηε δηάκεηξν

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ιήμεο 11.00 Κάπνηνο άξρηζε λα δηαβάδεη έλα βηβιίν ηελ 1 ε Δεθεκβξίνπ. Κάζε κέξα δηάβαδε ηνλ ίδην αξηζκό ζειίδσλ

Διαβάστε περισσότερα

Η/Υ A ΤΑΞΕΩΣ ΑΕ 2010-2011. Συστήματα Αρίθμησης. Υποπλοίαρχος Ν. Πετράκος ΠΝ

Η/Υ A ΤΑΞΕΩΣ ΑΕ 2010-2011. Συστήματα Αρίθμησης. Υποπλοίαρχος Ν. Πετράκος ΠΝ Συστήματα Αρίθμησης Υποπλοίαρχος Ν. Πετράκος ΠΝ 1 Ειζαγωγή Τν bit είλαη ε πην βαζηθή κνλάδα κέηξεζεο. Είλαη κία θαηάζηαζε on ή off ζε έλα ςεθηαθό θύθισκα. Άιιεο θνξέο είλαη κία θαηάζηαζε high ή low voltage

Διαβάστε περισσότερα

ΣΟ ΤΣΖΜΑ ΔΛΑΣΖΡΗΟ - ΩΜΑ

ΣΟ ΤΣΖΜΑ ΔΛΑΣΖΡΗΟ - ΩΜΑ ΣΟ ΤΣΖΜΑ ΔΛΑΣΖΡΗΟ - ΩΜΑ Σε όια ηα πξνβιήκαηα πνπ ζα αληηκεηωπίζνπκε, ην ειαηήξην ζα είλαη αβαξέο θαη ζα ηθαλνπνηεί ην λόκν ηνπ Hooke (ηδαληθό ειαηήξην), δειαδή ε δύλακε πνπ αζθεί έλα ηδαληθό ειαηήξην έρεη

Διαβάστε περισσότερα

Τάπηα με ππάζo, bacon και θέηα by Madame Ginger

Τάπηα με ππάζo, bacon και θέηα by Madame Ginger Τάπηα με ππάζo, bacon και θέηα by Madame Ginger 1 θύιιν ζθνιηάηαο 2 πξάζα 150 γξ. bacon 150 γξ. θέηα ΓΧΓΧΝΗ 100 γξ. γξαβηέξα ΓΧΓΧΝΗ 1 θ.ζ. ειαηόιαδν Κόβνπκε ηα πξάζα ζε ιεπηέο ξνδέιεο. Κόβνπκε ην bacon

Διαβάστε περισσότερα

Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com Ώρες διδασκαλίας: 16:00 19:15 μμ

Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com Ώρες διδασκαλίας: 16:00 19:15 μμ ΠΑΙΓΑΓΩΓΙΚΟ ΙΝΣΙΣΟΤΣΟ ΚΤΠΡΟΤ Πξόγξακκα Δπηκόξθσζεο Τπνςεθίσλ Καζεγεηώλ Σερλνινγίαο Γελάξεο 2011 ΗΛΔΚΣΡΟΝΙΚΑ Ι (Ύιε Γπκλαζίνπ) Διδάσκων: Σαββίδης Σάββας Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com

Διαβάστε περισσότερα

Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ )

Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ ) Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ ) Τν πξόβιεκα - Γηαξξνή λεξνύ Αθόκε θαη κηα κηθξή δηαξξνή λεξνύ κπνξεί λα πξνθαιέζεη θαηαζηξνθή αλ δελ αληρλεπζεί εγθαίξσο Δηαξξνή κπνξεί λα πξνέιζεη

Διαβάστε περισσότερα

ΘΕΜΑ: ΚΟΠΖ ΠΗΣΑ ΠΑΔΠΠΔ - ΔΔΓΑ

ΘΕΜΑ: ΚΟΠΖ ΠΗΣΑ ΠΑΔΠΠΔ - ΔΔΓΑ ΘΕΜΑ: ΚΟΠΖ ΠΗΣΑ ΠΑΔΠΠΔ - ΔΔΓΑ Μεγάιε επηηπρία ζεκείωζε ε θνηλή εθδήιωζε γηα ηελ θνπή πίηαο γηα ην 2009, ηνπ Παλειιήληνπ πλδέζκνπ Δπηρεηξήζεωλ Πξνζηαζίαο Πεξηβάιινληνο (ΠΑΔΠΠΔ) θαη ηεο Διιεληθήο Δηαηξίαο

Διαβάστε περισσότερα

Hellas online Προεπιλεγμένες ρσθμίσεις για FritzBox Fon WLAN 7140 (Annex B) 30.04.67 FritzBox Fon WLAN 7140 - Annex B (30.04.67)

Hellas online Προεπιλεγμένες ρσθμίσεις για FritzBox Fon WLAN 7140 (Annex B) 30.04.67 FritzBox Fon WLAN 7140 - Annex B (30.04.67) Hellas online Προεπιλεγμένες ρσθμίσεις για FritzBox Fon WLAN 7140 (Annex B) 30.04.67 FritzBox Fon WLAN 7140 - Annex B (30.04.67) Γηα λα επαλαθέξεηε ην FritzBox Fon WLAN 7140 ζηηο πξνεπηιεγκέλεο ηνπ ξπζκίζεηο

Διαβάστε περισσότερα

ΔΛΔΓΥΟ ΔΜΒΟΛΙΑΣΙΚΗ ΚΑΛΤΦΗ Δ ΠΑΙΓΙΑ ΠΡΟΥΟΛΙΚΗ ΚΑΙ ΥΟΛΙΚΗ ΗΛΙΚΙΑ ΣΟΤ ΝΟΜΟΤ ΚΔΡΚΤΡΑ

ΔΛΔΓΥΟ ΔΜΒΟΛΙΑΣΙΚΗ ΚΑΛΤΦΗ Δ ΠΑΙΓΙΑ ΠΡΟΥΟΛΙΚΗ ΚΑΙ ΥΟΛΙΚΗ ΗΛΙΚΙΑ ΣΟΤ ΝΟΜΟΤ ΚΔΡΚΤΡΑ ΔΛΔΓΥΟ ΔΜΒΟΛΙΑΣΙΚΗ ΚΑΛΤΦΗ Δ ΠΑΙΓΙΑ ΠΡΟΥΟΛΙΚΗ ΚΑΙ ΥΟΛΙΚΗ ΗΛΙΚΙΑ ΣΟΤ ΝΟΜΟΤ ΚΔΡΚΤΡΑ 24 ο ΠΑΝΔΛΛΗΝΙΟ ΤΝΔΓΡΙΟ ΔΛΛΗΝΙΚΗ ΔΣΑΙΡΔΙΑ ΚΟΙΝΧΝΙΚΗ ΠΑΙΓΙΑΣΡΙΚΗ ΚΑΙ ΠΡΟΑΓΧΓΗ ΣΗ ΤΓΔΙΑ ΠΙΝΟΤΛΑ ΔΤΡΤΓΙΚΗ ΒΑΡΚΑΡΗ ΠΟΛΤΚΡΙΣΗ

Διαβάστε περισσότερα

Σ Δ Υ Ν Ι Κ Η Δ Κ Θ Δ Η Π Ρ Ο Μ Η Θ Δ Ι Α Ο Ι Κ Ο Γ Ο Μ Ι Κ Ω Ν Τ Λ Ι Κ Ω Ν Γ Η Μ Ο Τ Β Ο Λ Β Η

Σ Δ Υ Ν Ι Κ Η Δ Κ Θ Δ Η Π Ρ Ο Μ Η Θ Δ Ι Α Ο Ι Κ Ο Γ Ο Μ Ι Κ Ω Ν Τ Λ Ι Κ Ω Ν Γ Η Μ Ο Τ Β Ο Λ Β Η Σ Δ Υ Ν Ι Κ Η Δ Κ Θ Δ Η Π Ρ Ο Μ Η Θ Δ Ι Α Ο Ι Κ Ο Γ Ο Μ Ι Κ Ω Ν Τ Λ Ι Κ Ω Ν Γ Η Μ Ο Τ Β Ο Λ Β Η ΠΔΡΙΔΥΟΜΔΝΑ 1. Τερληθή Έθζεζε 2. Δλδεηθηηθφο Πξνυπνινγηζκφο 3. Έληππν νηθνλνκηθήο πξνζθνξάο ΘΔΜΑ : Πξνκήζεηα

Διαβάστε περισσότερα

ΔΡΓΑΙΑ ΣΡΙΣΟΤ ΣΡΙΜΗΝΟΤ ΣΗΝ ΟΓΤΔΙΑ

ΔΡΓΑΙΑ ΣΡΙΣΟΤ ΣΡΙΜΗΝΟΤ ΣΗΝ ΟΓΤΔΙΑ ΔΡΓΑΙΑ ΣΡΙΣΟΤ ΣΡΙΜΗΝΟΤ ΣΗΝ ΟΓΤΔΙΑ Α.Να γξάςεηε ηα ηππηθά ζηάδηα ηεο αλαγλώξηζεο ζηελ Οδύζζεηα. Το θέμα της αναγνώρισης είναι συχνό, ιδιαίτερα στις τελευταίες ραψωδίες του έπους, δηλαδή από τότε που ο Οδυσσέας

Διαβάστε περισσότερα

ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ

ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ 1 ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ ΝΟΗΠΚΝΠ 2 Τν πεηξέιαην, πνπ κεξηθέο θνξέο ζηελ θαζεκεξηλή γιώζζα απνθαιείηαη θαη μαύπορ σπςσόρ ή τσάι τος Ρέξαρ, είλαη

Διαβάστε περισσότερα

Διαηιμήζεις για Αιολικά Πάρκα. Κώδικες 28, 78 και 84

Διαηιμήζεις για Αιολικά Πάρκα. Κώδικες 28, 78 και 84 Διαηιμήζεις για Αιολικά Πάρκα Κώδικες 28, 78 και 84 Διαηιμήζεις για Αιολικά Πάρκα Οη Διαηιμήζεις για Αιολικά Πάρκα εθαξκόδνληαη γηα ηελ απνξξνθνύκελε ελέξγεηα από Αηνιηθά Πάξθα πνπ είλαη ζπλδεδεκέλα ζην

Διαβάστε περισσότερα

Πνηα λνκίδεηο όηη ζα είλαη ε ζπλνιηθή αληίζηαζε κηαο ζπλδεζκνινγίαο δύν αληηζηαηώλ ζπλδεδεκέλεο ζε ζεηξά; Γηαηί;...

Πνηα λνκίδεηο όηη ζα είλαη ε ζπλνιηθή αληίζηαζε κηαο ζπλδεζκνινγίαο δύν αληηζηαηώλ ζπλδεδεκέλεο ζε ζεηξά; Γηαηί;... ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ: Ιζοδύναμη ανηίζηαζη ζύνδεζηρ ανηιζηαηών Η δηδαζθαιία ηεο ηζνδύλακεο αληίζηαζεο γηα ζύλδεζε αληηζηαηώλ ζε ζεηξά θαη παξάιιεια ππάξρεη ζην Αλαιπηηθό Πξόγξακκα Σπνπδώλ ζηα καζήκαηα Φπζηθήο

Διαβάστε περισσότερα

Γενεηική Καρδιαγγειακών Παθήζεων

Γενεηική Καρδιαγγειακών Παθήζεων Γενεηική Καρδιαγγειακών Παθήζεων Νίκορ Ππωτονοτάπιορ, MD, FESC, Νάξορ Η γελεηηθή ησλ θαξδηαγγεηαθώλ παζήζεσλ έρεη εμειηρζεί νπζηαζηηθά θαηά ηα ηειεπηαία είθνζη ρξόληα. Σε απηό ην ρξνληθό δηάζηεκα εμειίρζεθε

Διαβάστε περισσότερα

ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ

ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ Α ΛΤΚΕΙΟΤ ΓΕΝΙΚΗ ΠΑΙΔΕΙΑ Σχολικό έτος: 2011-2012 Καθηγήτριες: Κεφαλληνού Λουκία- Καλλία Αθηνά ΙΙ. ΟΙ ΑΧΑΙΟΙ ΕΛΛΗΝΕΣ ΑΠΟ ΣΟΤ ΠΡΟΙΣΟΡΙΚΟΤ ΥΡΟΝΟΤ ΕΩ ΚΑΙ ΣΟ Μ. ΑΛΕΞΑΝΔΡΟ 1. ΕΛΛΗΝΙΚΗ

Διαβάστε περισσότερα

1. Οδηγίερ εγκαηάζηαζηρ και σπήζηρ έξςπνυν καπηών και τηθιακών πιζηοποιηηικών με σπήζη ηος λογιζμικού Μοzilla Thunderbird

1. Οδηγίερ εγκαηάζηαζηρ και σπήζηρ έξςπνυν καπηών και τηθιακών πιζηοποιηηικών με σπήζη ηος λογιζμικού Μοzilla Thunderbird 1. Οδηγίερ εγκαηάζηαζηρ και σπήζηρ έξςπνυν καπηών και τηθιακών πιζηοποιηηικών με σπήζη ηος λογιζμικού Μοzilla Thunderbird 1.1 Εγκαηάζηαζη ηυν οδηγών ηηρ έξςπνηρ κάπηαρ ζηο λογιζμικό Mozilla Thunderbird

Διαβάστε περισσότερα

ΔΝΓΔΙΚΤΙΚΔΣ ΛΥΣΔΙΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΔΥΘΥΝΣΗΣ Γ ΛΥΚΔΙΟΥ ΓΔΥΤΔΡΑ 27 ΜΑΪΟΥ 2013

ΔΝΓΔΙΚΤΙΚΔΣ ΛΥΣΔΙΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΔΥΘΥΝΣΗΣ Γ ΛΥΚΔΙΟΥ ΓΔΥΤΔΡΑ 27 ΜΑΪΟΥ 2013 ΔΝΓΔΙΚΤΙΚΔΣ ΛΥΣΔΙΣ ΣΤΑ ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΔΥΘΥΝΣΗΣ Γ ΛΥΚΔΙΟΥ ΓΔΥΤΔΡΑ 7 ΜΑΪΟΥ 13 ΘΔΜΑ Α : (Α1) Σρνιηθό βηβιίν ζειίδα 33-335 (Α) Σρνιηθό βηβιίν ζειίδα 6 (Α3) Σρνιηθό βηβιίν ζειίδα (Α) α) Λάζνο β) Σωζηό γ) Σωζηό

Διαβάστε περισσότερα

ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ

ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ α. Η ΕΚΚΛΗΙΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ β. ΣΟ ΠΝΕΤΜΑΣΙΚΟ ΜΑ ΚΕΝΣΡΟ γ. Η ΠΑΝΟΡΑΜΙΚΗ ΘΕΗ ΣΟΤ ΥΩΡΙΟΤ ΜΑ α. Η ΕΚΚΛΗΙΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ. Η Εθθιεζία ηνπ ρσξηνύ καο, ε Αγία Άλλα, είλαη θηηζκέλε πξηλ πνιιά

Διαβάστε περισσότερα