ΕΛΕΓΧΟΣ ΠΟΛΛΑΠΛΩΝ ΥΠΟΘΕΣΕΩΝ ΣΕ ΜΙΚΡΟΣΥΣΤΟΙΧΙΕΣ DNA

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΕΛΕΓΧΟΣ ΠΟΛΛΑΠΛΩΝ ΥΠΟΘΕΣΕΩΝ ΣΕ ΜΙΚΡΟΣΥΣΤΟΙΧΙΕΣ DNA"

Transcript

1 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΕΙΡΑΙΩΣ ΤΜΗΜΑ ΣΤΑΤΙΣΤΙΚΗΣ ΚΑΙ ΑΣΦΑΛΙΣΤΙΚΗΣ ΕΠΙΣΤΗΜΗΣ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΣΤΗΝ ΕΦΑΡΜΟΣΜΕΝΗ ΣΤΑΤΙΣΤΙΚΗ ΕΛΕΓΧΟΣ ΠΟΛΛΑΠΛΩΝ ΥΠΟΘΕΣΕΩΝ ΣΕ ΜΙΚΡΟΣΥΣΤΟΙΧΙΕΣ DNA Μαργαρίτα-Αργεντίνα Ν. Παπακωνσταντίνου Διπλωματική Εργασία που υποβλήθηκε στο Τμήμα Στατιστικής και Ασφαλιστικής Επιστήμης του Πανεπιστημίου Πειραιώς ως μέρος των απαιτήσεων για την απόκτηση του Μεταπτυχιακού Διπλώματος Ειδίκευσης στην Εφαρμοσμένη Στατιστική Πειραιάς Ιούνιος 27

2

3 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΕΙΡΑΙΩΣ ΤΜΗΜΑ ΣΤΑΤΙΣΤΙΚΗΣ ΚΑΙ ΑΣΦΑΛΙΣΤΙΚΗΣ ΕΠΙΣΤΗΜΗΣ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΣΤΗΝ ΕΦΑΡΜΟΣΜΕΝΗ ΣΤΑΤΙΣΤΙΚΗ ΕΛΕΓΧΟΣ ΠΟΛΛΑΠΛΩΝ ΥΠΟΘΕΣΕΩΝ ΣΕ ΜΙΚΡΟΣΥΣΤΟΙΧΙΕΣ DNA Μαργαρίτα-Αργεντίνα Ν. Παπακωνσταντίνου Διπλωματική Εργασία που υποβλήθηκε στο Τμήμα Στατιστικής και Ασφαλιστικής Επιστήμης του Πανεπιστημίου Πειραιώς ως μέρος των απαιτήσεων για την απόκτηση του Μεταπτυχιακού Διπλώματος Ειδίκευσης στην Εφαρμοσμένη Στατιστική Πειραιάς Ιούνιος 27

4 Η παρούσα Διπλωματική Εργασία εγκρίθηκε ομόφωνα από την Τριμελή Εξεταστική Επιτροπή που ορίσθηκε από τη ΓΣΕΣ του Τμήματος Στατιστικής και Ασφαλιστικής Επιστήμης του Πανεπιστημίου Πειραιώς στην υπ αριθμ... συνεδρίασή του σύμφωνα με τον Εσωτερικό Κανονισμό Λειτουργίας του Προγράμματος Μεταπτυχιακών Σπουδών στην Εφαρμοσμένη Στατιστική Τα μέλη της Επιτροπής ήταν: - Ηλιόπουλος Γεώργιος (Επιβλέπων) - Κατέρη Μαρία - Καφφές Δημήτριος Η έγκριση της Διπλωματική Εργασίας από το Τμήμα Στατιστικής και Ασφαλιστικής Επιστήμης του Πανεπιστημίου Πειραιώς δεν υποδηλώνει αποδοχή των γνωμών του συγγραφέα. v

5 UNIVERSITY OF PIRAEUS DEPARTMENT OF STATISTICS AND INSURANCE SCIENCE POSTGRADUATE PROGRAM IN APPLIED STATISTICS MULTIPLE HYPOTHESIS TESTING IN MICROARRAY EXPERIMENTS By Margarta-Argentna Papakonstantnou MSc Dssertaton subtted to the Departent of Statstcs and Insurance Scence of the Unversty of Praeus n partal fulflent of the requreents for the degree of Master of Scence n Appled Statstcs Praeus, Greece June 27 v

6 v

7 v Στην οικογένειά μου

8 v

9 Ευχαριστίες Θα ήθελα να ευχαριστήσω τον επιβλέποντα καθηγητή μου κο Γεώργιο Ηλιόπουλο για την πολύτιμη βοήθειά του και την συνεργασία μας καθώς επίσης και τα μέλη της τριμελούς επιτροπής κα Μαρία Κατέρη και κο Δημήτριο Καφφέ. Επίσης, θα ήθελα να ευχαριστήσω την διδάκτορα Χαρά Δημοπούλου για τη βοήθειά της στη συγγραφή της ενότητας που αφορούσε στην επιστήμη της βιολογίας και της τεχνολογίας των μικροσυστοιχιών, καθώς επίσης και τον Κωνσταντίνο Παπακωνσταντίνου για τη βοήθειά του ως προς την παροχή των κατάλληλων υπολογιστικών προγραμμάτων. Τέλος, θα ήθελα να ευχαριστήσω την οικογένειά μου, την Φραντζέσκα Παπά και την Αθηνά Παλιεράκη για την συμπαράστασή τους καθ όλη την διάρκεια συγγραφής της διπλωματικής εργασίας. x

10 x

11 Περίληψη Οι μικροσυστοιχίες DNA αποτελούν τμήμα ενός καινούργιου και πολλά υποσχόμενου τομέα βιοτεχνολογίας ο οποίος μας επιτρέπει να παρατηρήσουμε ταυτοχρόνως χιλιάδες γονίδια και να καθορίσουμε ποια από αυτά είναι διαφορετικά εκφρασμένα σε ένα συγκεκριμένο τύπο κυττάρου. Το βιολογικό ερώτημα της διαφορετικής έκφρασης μπορεί να καθοριστεί εκ νέου σαν ένα πρόβλημα πολλαπλού ελέγχου υποθέσεων: του ταυτόχρονου ελέγχου, για κάθε γονίδιο, της μηδενικής υπόθεσης της μη ύπαρξης σχέσης μεταξύ των επιπέδων έκφρασης και ορισμένων αποκρίσεων ή συμμεταβλητών. Σκοπός της παρούσας εργασίας είναι η διερεύνηση και η παρουσίαση διαφορετικών προσεγγίσεων του ελέγχου πολλαπλών υποθέσεων μέσα στο πλαίσιο των πειραμάτων μικροσυστοιχιών DNA και η παρουσίαση αλγορίθμων για την εφαρμογή της np και axt προσαρμογής με σκοπό τον έλεγχο της faly wse πιθανότητας σφάλματος, όπως επίσης και ενός bootstrap αλγορίθμου για τον προσδιορισμό των ακατέργαστων τιμών-p. Οι στατιστικές μέθοδοι εφαρμόστηκαν σε δύο πραγματικά σύνολα, από ασθενείς με λευχαιμία και από ασθενείς με καρκίνο του μαστού. Η ανάλυση πραγματοποιήθηκε χρησιμοποιώντας το Matheatca και το πρόγραμμα R. x

12 x

13 Abstract DNA croarrays are part of a new and prosng class of botechnologe that allows us to look at thousands of genes at once and deterne whch are expressed n a partcular cell type. The bologcal queston of dfferental expresson can be restated as a proble n ultple hypothess testng: the sultaneous test for each gene of the null hypothess of no assocaton between the expresson levels and soe responses or covarates. The purpose of the present study s to nvestgate and present dfferent approaches to ultple hypothess testng n the context of DNA croarray experents and ntroduce algorths for pleentng the np and axt adjustent to control the faly wse error rate as well as a bootstrap algorth for the deternaton of the raw p-values. These statstcal ethods were appled on two real data sets, fro leukea patents and patent wth breast cancer. The analyss was carred out usng the Matheatca and the R- package. x

14 xv

15 ΠΕΡΙΕΧΟΜΕΝΑ Κατάλογος Πινάκων xv Κατάλογος Σχημάτων xvx Εισαγωγή xx Κεφάλαιο. DNA.2 RNA 3.2. Αγγελιοφόρο RNA- RNA Μεταφορικό RNA- trna Ριβοσωμικό RNA- rrna Συμπληρωματικό DNA- cdna 5.3 Έκφραση Γονιδίων 6.4 Υβριδοποίηση νουκλεϊκού οξέος 7.5 Τεχνολογία Μικροσυστοιχιών 7.6 Δεδομένα Κεφάλαιο 2 2. Πολλαπλοί Έλεγχοι Υποθέσεων Πιθανότητες Σφαλμάτων Τύπου Ι Σύγκριση των πιθανοτήτων των σφαλμάτων τύπου I Ισχυρή και Ασθενής Ρύθμιση Προσαρμοσμένες και μη τιμές-p, τιμές-q Διαδικασίες Πολλαπλού Ελέγχου Ρύθμιση της Faly Wse Error Rate α Μέθοδοι Sngle-step β Μέθοδοι Step-down γ Μέθοδοι Step-up 27 xv

16 2.2.2 Ρύθμιση της False Dscovery Rate Ρύθμιση της Postve False Dscovery Rate Ρύθμιση της FDR για πολλαπλά εξαρτημένα τεστ 4 Κεφάλαιο 3 3. Επαναδειγματοληψία με μεταθέσεις για τον έλεγχο της FWER Ακατέργαστες τιμές-p Step-down axt προσαρμοσμένες τιμές-p Step-down np προσαρμοσμένες τιμές-p Τιμές-q Επαναδειγματοληψία με τη μέθοδο Bootstrap Ανάλυση Δεδομένων Matheatca Πρόγραμμα R - Πακέτο ulttest Πρόγραμμα R - Πακέτο affylgui 83 Παράρτημα 93 Βιβλιογραφία 97 xv

17 ΚΑΤAΛΟΓΟΣ ΠΙΝAΚΩΝ 2. Το πρόβλημα του ταυτόχρονου ελέγχου των μηδενικών 7 υποθέσων Πίνακες Αποτελεσμάτων 7, 76, 8, 88 xv

18 xv

19 ΚΑΤΑΛΟΓΟΣ ΣΧΗΜΑΤΩΝ. Ειδικό ταίριασμα των βάσεων 2.2 Μοντέλο της διπλής έλικας του DNA 2.3 Σύνθεση του RNA 4.4 Η έλικα του RNA και οι αλληλουχίες των βάσεων στο RNA (κωδίκια) 5.5 Ένα γονίδιο σε σχέση με τη διπλοελικομένη δομή του DNA και ενός χρωμοσώματος Αριθμός των υποθέσεων που απορρίπτονται για διάφορες τιμές του σφάλματος τύπου Ι (μέθοδος step-down np) Διατεταγμένες προσαρμοσμένες τιμές-p ως προς τον αριθμό των υποθέσεων που απορρίπτονται (μέθοδος step-down np) Προσαρμοσμένες τιμές-p ως προς τις τιμές του στατιστικού (μέθοδος step-down np) Τιμές των προσαρμοσμένων τιμών-p για τα 29 γονίδια (μέθοδος step-down np) Αριθμός των υποθέσεων που απορρίπτονται για διάφορες τιμές του σφάλματος τύπου (μέθοδος step-down axt) Διατεταγμένες προσαρμοσμένες τιμές-p ως προς τον αριθμό των υποθέσεων που απορρίπτονται (μέθοδος step-down axt) Προσαρμοσμένες τιμές-p ως προς τις τιμές του στατιστικού (μέθοδος step-down axt) Τιμές των προσαρμοσμένων τιμών-p για τα 29 γονίδια (μέθοδος step-down axt) Διάγραμμα συχνοτήτων Θηκογράμματα που αντιστοιχούν στα 8 δείγματα καρκίνου του μαστού Θηκογράμματα μετά την κανονικοποίηση των δεδομένων Διάγραμμα διασποράς Q-Q Plot xx

20 xx

21 ΕΙΣΑΓΩΓΗ Η παρούσα διπλωματική εργασία με θέμα Έλεγχος Πολλαπλών Υποθέσεων σε Μικροσυστοιχίες DNA αποτελείται από τρία κεφάλαια. Στο πρώτο κεφάλαιο προσφέρονται στον αναγνώστη κάποιες βασικές γνώσεις από τη Βιολογία, όπως το τι είναι το DNA και το RNA, ποιος είναι ο τρόπος έκφρασης της γενετικής πληροφορίας που είναι αποθηκευμένη στο DNA, τι σημαίνει ο όρος έκφραση των γονιδίων. Επίσης, δίνεται μία περιγραφή της τεχνολογίας των μικροσυστοιχιών, τονίζεται η σημασίας της, και παρατίθενται τα κύρια είδη αυτής. Τέλος παρουσιάζονται τα δύο σύνολα δεδομένων που χρησιμοποιήθηκαν για την εφαρμογή των στατιστικών μεθόδων. Στο δεύτερο κεφάλαιο παρουσιάζεται το πρόβλημα του ελέγχου πολλαπλών υποθέσεων. Ορίζονται οι πιθανότητες σφαλμάτων τύπου Ι, οι προσαρμοσμένες τιμές-p και δίνονται οι διαδικασίες για τη ρύθμιση της FWER και της FDR για πολλαπλά ανεξάρτητα αλλά και εξαρτημένα τεστ. Στο τρίτο κεφάλαιο παρουσιάζονται διάφοροι αλγόριθμοι για την παραγωγή των προσαρμοσμένων και μη τιμών-p. Στους αλγορίθμους αυτούς η επαναδειγματοληψία γίνεται είτε με μεταθέσεις είτε με τη μέθοδο bootstrap. Τέλος πραγματοποιείται η ανάλυση των δεδομένων μέσω του Matheatca, της συνάρτησης MTP του προγράμματος R και του πακέτου ulttest του Boconductor και του πακέτου affylgui μέσω του προγράμματος R. xx

22 xx

23 ΚΕΦΑΛΑΙΟ. DNA Το DNA (δεοξυριβονουκλεϊκό οξύ) είναι ένα μεγαλομόριο πολυδεοξυριβονουκλεοτιδίων, καθένα από τα οποία αποτελείται από ένα μεγάλο αριθμό μονομερών μονάδων, των δεοξυριβονουκλεοτιδίων. Τα δεοξυριβονουκλεοτίδια με τη σειρά τους αποτελούνται από μία αζωτούχο βάση, τύπου πουρίνης ή πυριμιδίνης, ένα σάκχαρο, τη β-d-2 δεοξυριβόζη και ένα φωσφορικό οξύ. Περιέχει τέσσερα είδη αζωτούχων βάσεων: τις αδενίνη (Α) και γουανίνη (G) οι οποίες είναι τύπου πουρίνης και τις θυμίνη (Τ) και κυτοσύνη (C) οι οποίες είναι τύπου πυριμιδίνης. Τα δεοξυριβονουκλεοτίδια με τη σχετική αλληλουχία τους είναι οι φορείς της γενετικής πληροφορίας υπό τη μορφή γενετικού κώδικα. Ο σκελετός του DNA, υπό μορφή αλυσίδας, αποτελείται από δεοξυριβόζες συνδεδεμένες με φωσφορικές ομάδες. Το ένα άκρο έχει μία ομάδα 5 -OH και το άλλο άκρο του μία 3 -OH ομάδα. Ειδικότερα η 3 -OH (υδροξυλομάδα) του σακχάρου ενός δεοξυριβονουκλεοτιδίου ενώνεται με τη 5 - OH (υδροξυλομάδα) του επόμενου σακχάρου με φωσφοδιεστερική γέφυρα. Κάθε δεοξυριβονουκλεοτίδιο του DNA έχει πολικότητα. Έχει επικρατήσει η σειρά των βάσεων να γράφεται με κατεύθυνση 5 ->3. Δύο μονόκλωνες αλυσίδες DNA συγκρατούνται από δεσμούς υδρογόνου που αναπτύσσονται μεταξύ των βάσεων σύμφωνα με τον παρακάτω κανόνα: η γουανίνη ζευγαρώνει πάντα με την κυτοσίνη και η αδενίνη πάντα με την θυμίνη (σχήμα.). Οι δύο αλυσίδες με συμπληρωματικές αλληλουχίες βάσεων και αντίθετη πολικότητα, περιελίσσονται η μία γύρω από την άλλη και δημιουργούν τη γνωστή έλικα του DNA (σχήμα.2). Την τρισδιάστατη δομή του DNA που περιγράψαμε παραπάνω συμπέραναν οι Jaes Watson και Francs Crck το 953. Ανέλυσαν φωτογραφίες περίθλασης ακτίνων X από ίνες DNA που είχαν πάρει η Rosalnd Frankln και ο Maurce Wlkns και πρότειναν ένα δομικό - -

24 μοντέλο που αποδείχτηκε αληθινό. Το επίτευγμα αυτό είναι από τα πιο σημαντικά στην ιστορία της βιολογίας διότι οδήγησε στην κατανόηση της λειτουργίας των γονιδίων σε μοριακό επίπεδο. Σχήμα.. Ειδικό ταίριασμα των βάσεων. Τα ζεύγη G-C είναι πιο σταθερά από τα A-T γιατί οι βάσεις συγκρατούνται με τρεις δεσμούς υδρογόνου και όχι με δύο. Σχήμα.2. Μοντέλο της διπλής έλικας του DNA

25 Η έκφραση της γενετικής πληροφορίας που είναι αποθηκευμένη στο μόριο του DNA γίνεται σε δύο στάδια: α) τη μεταγραφή (transcrpton), κατά την οποία τα εκμαγεία DNA δίνουν την πληροφορία για να συντεθούν τα αγγελιοφόρα RNA (RNA) τα οποία είναι ενδιάμεσα μόρια που μεταφέρουν την πληροφορία για τη σύνθεση των πρωτεϊνών. Επίσης, άλλες μορφές κυτταρικού RNA που συμμετέχουν στο μηχανισμό αυτόν είναι το μεταφορικό RNA (trna) και το ριβοσωμικό RNA (rrna). β) την μετάφραση (translaton), κατά την οποία οι πρωτεΐνες συντίθενται σύμφωνα με πληροφορίες που παρέχονται από τα εκμαγεία RNA. Μεταγραφή Μετάφραση DNA RNA Πρωτεΐνη.2 RNA Το RNA (ριβονουκλεϊκό οξύ) είναι ένα πολυμερές χωρίς διακλαδώσεις που αποτελείται από νουκλεοτίδια ενωμένα με 3-5 φωσφοδιεστερικούς δεσμούς. Ξεχωρίζει βιοχημικά από το DNA σε δύο σημεία. Το σάκχαρο στο RNA, όπως φαίνεται και από το όνομά του, είναι η ριβόζη αντί της δεοξυριβόζης και η ουρακίλη αντικαθιστά τη θυμίνη ως συμπληρωματική της αδενίνης. Μία από τις κύριες λειτουργίες του RNA είναι να αντιγράφει τη γενετική πληροφορία και στη συνέχεια να τη μεταφράζει σε πρωτεΐνες. Δομικά, το RNA δε διακρίνεται από το DNA, εκτός από την κρίσιμη παρουσία της υδροξυλικής ομάδας που είναι προσαρτημένη στο δακτύλιο της πεντόζης στη θέση 2 (το DNA έχει ένα άτομο υδρογόνου). Αυτή η υδροξυλική ομάδα κάνει το RNA λιγότερο σταθερό - 3 -

26 από το DNA διότι καθιστά την υδρόλυση του φωσφορικού κορμού των σακχάρων πιο εύκολη. Για τη σύνθεση του RNA συνήθως γίνεται κατάλυση από ένα ένζυμο, την RNA πολυμεράση, το οποίο χρησιμοποιεί το DNA σαν εκμαγείο. Το εκμαγείο DNA περιέχει περιοχές που λέγονται προαγωγείς και δεσμεύουν την RNA πολυμεράση, καθορίζοντας το σημείο που αρχίζει η μεταγραφή. Η διπλή έλικα του DNA ξετυλίγεται με τη βοήθεια της ελικάσης (σχήμα.3). Το ένζυμο προχωρεί κατά μήκος του προτύπου κλώνου με την κατεύθυνση 3 ->5, συνθέτοντας ένα συμπληρωματικό μόριο RNA. Η ακολουθία του DNA υπαγορεύει πότε θα λάβει χώρα η περάτωση της σύνθεσης του RNA. Σχήμα.3. Σύνθεση του RNA..2. Αγγελιοφόρο RNA- RNA Το RNA είναι το RNA που μεταφέρει την πληροφορία από το DNA στις ριβοσωμικές θέσεις της σύνθεσης της πρωτεΐνης σε ένα κύτταρο. Για κάθε γονίδιο ή ομάδα γονιδίων που χρειάζεται να εκφραστεί, παράγεται και ένα RNA. Μόλις παράγεται το RNA από το DNA, εξάγεται από τον πυρήνα στο κυτταρόπλασμα, όπου δεσμεύεται από τα ριβοσώματα και μεταφράζεται σε πρωτεΐνη

27 .2.2 Μεταφορικό RNA- trna Το trna περιέχει μία θέση δέσμευσης αμινοξέος και μία θέση αναγνώρισης του εκμαγείου. Κάθε μόριο trna μεταφέρει ένα είδος αμινοξέων στη θέση της πρωτεϊνοσύνθεσης, το ριβόσωμα, για το σχηματισμό πεπτιδικού δεσμού όπως καθορίζεται από το εκμαγείο RNA. Η θέση αναγνώρισης του εκμαγείου στο trna είναι μία αλληλουχία τριών βάσεων που λέγεται αντικωδίκιο (antcodon) (ή αντικωδικόνιο). Το αντικωδίκιο στο trna αναγνωρίζει μία συμπληρωματική αλληλουχία τριών βάσεων στο RNA που λέγεται κωδίκιο (codon) (σχήμα.4). Ο γενετικός κώδικας είναι η σχέση μεταξύ της αλληλουχίας των βάσεων και της αλληλουχίας των αμινοξέων στις πρωτεΐνες. Σχήμα.4. Η έλικα του RNA και οι αλληλουχίες των βάσεων στο RNA (κωδίκια)..2.3 Ριβοσωμικό RNA- rrna Το rrna είναι το κύριο συστατικό των ριβοσωμάτων, αλλά ο ακριβής ρόλος του στη σύνθεση της πρωτεΐνης δεν είναι ακόμα γνωστός..2.4 Συμπληρωματικό DNA- cdna Το cdna είναι το DNA το οποίο συντίθεται από ένα ώριμο πρότυπο RNA και συνήθως παράγεται από το ένζυμο αντίστροφη μεταγραφάση. Το ένζυμο αυτό επιτρέπει σε ένα ώριμο RNA να αποδοθεί σαν cdna. Η συνύπαρξη του RNA και του cdna θεμελιώνει τη γενική αρχή ότι η πληροφορία στη μορφή του ενός τύπου ακολουθίας νουκλεϊκού οξέος - 5 -

28 μπορεί να μετατραπεί στον άλλο τύπο. Στην τεχνολογία των μικροσυστοιχιών η διαδικασία της αντίστροφης μεταγραφής χρησιμοποιείται συχνά για την ενσωμάτωση φθοριζόντων χρωματισμών στο cdna και συμπληρωματικά στα RNA αντίγραφα. RNA αντίστροφη μεταγραφή cdna.3 Έκφραση Γονιδίων Τα γονίδια είναι οι μονάδες μιας αλληλουχίας DNA που ελέγχουν τα αναγνωρίσιμα κληρονομικά χαρακτηριστικά ενός οργανισμού. Κωδικοποιούνται στο γενετικό υλικό ενός οργανισμού (συνήθως στο DNA ή στο RNA) και ελέγχουν τη φυσική ανάπτυξη και συμπεριφορά του οργανισμού. Συγκεκριμένα, το γονιδίωμα είναι το σύνολο των γονιδίων που καθορίζουν τη γενετική δομή ενός οργανισμού ή ενός κυττάρου ή διαφορετικά το γονότυπό του. Σχήμα.5. Ένα γονίδιο σε σχέση με τη διπλοελικομένη δομή του DNA και ενός χρωμοσώματος. Τα ιντρόνια (ntrons) είναι παρεμβάλλουσες ακολουθίες που περιέχονται στα ευκαρυωτικά γονίδια. Μόνο τα εξόνια (exons) κωδικοποιούν την πρωτεΐνη. Η έκφραση των γονιδίων είναι η διαδικασία με την οποία το RNA και τελικά η πρωτεΐνη συντίθενται από το εκμαγείο DNA κάθε γονιδίου. Στο πρώτο στάδιο αυτής της διαδικασίας γίνεται η μεταγραφή του DNA σε αγγελιοφόρο RNA. Στα ευκαρυωτικά RNA συνοδεύεται από το μάτισμα του RNA, κατά το οποίο τα ιντρόνια (παρεμβάλλουσες ακολουθίες) αποκόβονται από το αρχικό αντίγραφο. Το επόμενο στάδιο της έκφρασης ενός γονιδίου είναι η μετάφραση του RNA σε πρωτεΐνη και συμβαίνει στο κυτταρόπλασμα. Μεταβολές στη γονιδιακή έκφραση έχουν συσχετιστεί με διάφορες ασθένειες όπως είναι ο καρκίνος, η σκλήρυνση κατά πλάκας κ.α. Η γνώση για το ποια γονίδια είναι εκφρασμένα - 6 -

29 κάτω από ορισμένες συνθήκες, εξηγεί για τις βιολογικές διαδικασίες σε ένα κύτταρο. Η ισχύς της τεχνολογίας των μικροσυστοιχιών υπόκειται στην ικανότητά της να μετρά την έκφραση χιλιάδων γονιδίων ταυτόχρονα..4 Υβριδοποίηση νουκλεϊκού οξέος Το ειδικό ταίριασμα των βάσεων των νουκλεϊκών οξέων αποτελεί θεμέλιο για την τεχνολογία των μικροσυστοιχιών. Το ειδικό ταίριασμα ενός τεχνητού ιχνηθέτη DNA με το βιολογικό του αντίστοιχο, επιτρέπει την ακριβή αναγνώριση της μοναδικής αλληλουχίας ή γονιδίου. Εξαιτίας αυτού του ταιριάσματος, οι δύο κλώνοι του DNA μπορούν να χωριστούν και να ανασχηματιστούν πολύ γρήγορα κάτω από ορισμένες συνθήκες που διασπούν τους δεσμούς υδρογόνου μεταξύ των βάσεων αλλά και είναι αρκετά ήπιες για να απειλήσουν τους ομοιοπολικούς δεσμούς του σκελετού του DNA. Η διαδικασία του διαχωρισμού των κλώνων λέγεται αποδιάταξη ενώ του ανασχηματισμού τους επαναδιάταξη. Η υβριδοποίηση είναι η βιοχημική μέθοδος πάνω στην οποία βασίζεται η τεχνολογία των μικροσυστοιχιών DNA. Οι αλληλουχίες των νουκλεϊκών οξέων μπορούν να συγκριθούν από άποψη συμπληρωματικότητας η οποία καθορίζεται από τους κανόνες ταιριάσματος των βάσεων και η συμπληρωματικότητα μπορεί να μετρηθεί επειδή η αποδιάταξη του DNA είναι αναστρέψιμη, κάτω από κατάλληλες συνθήκες. Η ανίχνευση και αναγνώριση ενός νουκλεϊκού οξέος - DNA ή RNA - με ένα cdna ιχνηθέτη το οποίο έχει κάποια σήμανση και το οποίο είναι συμπληρωματικό του, είναι μία εφαρμογή της υβριδοποίησης του νουκλεϊκού οξέος. Οι μικροσυστοιχίες DNA χρησιμοποιούν τις αντιδράσεις υβριδοποίησης μεταξύ των μονόκλωνων φθοριζόντων νουκλεϊκών οξέων που εξετάζονται και των μονόκλωνων αλληλουχιών που ακινητοποιούνται στην επιφάνεια της μικροδιάταξης..5 Τεχνολογία Μικροσυστοιχιών Μία μικροσυστοιχία DNA είναι ένα πλακίδιο κατασκευασμένο από ειδικό γυαλί πάνω στο οποίο παρατάσσονται μοριακοί ανιχνευτές σε συγκεκριμένες θέσεις, το πλήθος των οποίων μπορεί να κυμανθεί από μερικές εκατοντάδες έως μερικές χιλιάδες. Το προς εξέταση δείγμα - 7 -

30 DNA χρωματίζεται με κατάλληλη χρωστική και μετά από ειδική επεξεργασία τοποθετείται πάνω στο πλακίδιο. Συγκεκριμένη αλληλουχία αυτού υβριδοποιείται με τους αντίστοιχους μοριακούς ανιχνευτές και στη θέση του κάθε ανιχνευτή ελευθερώνεται η χρωστική ουσία. Η ποσότητα της χρωστικής που ελευθερώνεται είναι ανάλογη της έκφρασης του αντίστοιχου γονιδίου. Στη συνέχεια, ένας οπτικός σαρωτής σαρώνει το πλακίδιο και στην έξοδό του παράγεται μία ψηφιακή εικόνα η οποία αποτελείται από ένα πλήθος κουκκίδων. Κάθε κουκκίδα αντιστοιχεί σε ένα διαφορετικό γονίδιο και η έντασή της αντιστοιχεί στο επίπεδο έκφρασής του. Η εικόνα αναλύεται με κατάλληλο λογισμικό με αποτέλεσμα την παραγωγή ενός διανύσματος, οι μεταβλητές του οποίου είναι οι μετρήσεις γονιδιακής έκφρασης των γονιδίων. Με τη συμβολή της τεχνολογίας των μικροσυστοιχιών μπορούν να δημιουργηθούν μεγάλες συλλογές με δεδομένα εκφράσεων γονιδίων. Αυτοί οι κατάλογοι καλούνται gene expresson ή transcrptonal proflng και η διαδικασία συλλογής των δεδομένων proflng. To transcrptonal proflng βασίζεται είτε σε αλληλουχίες είτε σε υβριδοποίηση. Οι προσεγγίσεις οι οποίες βασίζονται στις αλληλουχίες περιέχουν τη δημιουργία αλληλουχιών cdna και την ακολουθιακή ανάλυση της έκφρασης του γονιδίου (SAGE). Το συμπληρωματικό DNA (cdna) είναι το DNA το οποίο συντίθεται από το εκμαγείο RNA με τη βοήθεια του ενζύμου αντίστροφη μεταγραφάση. Μόρια cdna μπορούν να κλωνοποιηθούν σε φορείς οι οποίοι είναι γνωστοί ως φορείς έκφρασης. Για να έχουμε το μέγιστο της απόδοσης στην αντιγραφή, το cdna εισάγεται στο φορέα, ο οποίος εξασφαλίζει τη μετάφραση κωδικοποιώντας θέσεις δέσμευσης στα ριβοσώματα κοντά στο RNA. Οι - 8 -

31 κλώνοι cdna μπορούν να ανιχνευτούν βάσει της ικανότητάς τους να συνθέτουν ξένες πρωτεΐνες στα βακτήρια. Ένα ραδιενεργό αντίσωμα ειδικό για την πρωτεΐνη που μας ενδιαφέρει μπορεί να χρησιμοποιηθεί για να προσδιοριστούν οι αποικίες βακτηρίων που περιέχουν τον αντίστοιχο φορέα cdna. Το αντίσωμα αυτό είναι σημασμένο και η αυτοραδιογραφία αποκαλύπτει τις θέσεις των αποικιών που μας ενδιαφέρουν. Η βασική ιδέα της SAGE είναι να παραγάγει μικρές αλληλουχίες σημάνσεων cdna από μία συγκέντρωση RNA συνδυάζοντάς τις και δημιουργώντας πολλές αλληλουχίες σημάνσεων κάθε στιγμή. Οι τρεις βασικές αρχές της SAGE είναι:. Μία μικρή ακολουθία σημάνσεων με 4 ζευγών βάσεων περιέχει αρκετή πληροφορία για τη μοναδική αναγνώριση ενός αντιγράφου, αρκεί η σήμανση να προέρχεται από μία μοναδική θέση μέσα από κάθε αντίγραφο. 2. Οι ακολουθίες σημάνσεων μπορούν να ενωθούν για να σχηματίσουν μεγάλα σειριακά μόρια, τα οποία μπορούν να κλωνοποιηθούν και να σχηματίσουν μια ακολουθία. 3. Η μέτρηση του αριθμού των φορών που μία συγκεκριμένη σήμανση παρατηρείται μας δίνει το επίπεδο έκφρασης του αντίστοιχου αντιγράφου. Παρακάτω φαίνεται η σχηματική αναπαράσταση της μεθόδου SAGE

32 Οι μέθοδοι υβριδοποίησης, όπως αυτή της Southern and Northern Αποτύπωσης, χρησιμοποιούνται για να αναγνωριστούν και να μετρηθούν τα νουκλεϊκά οξέα στα βιολογικά δείγματα. Η αποτύπωση κατά Southern αποτελεί μία τεχνική για την ανίχνευση μικρών διαφορών μεταξύ συγγενών μορίων DNA. Περιοριστικά ένζυμα αναγνωρίζουν ειδικές ακολουθίες βάσεων σε διπλή έλικα DNA και διασπούν και τις δύο έλικες σε συγκεκριμένες θέσεις. Τα περιοριστικά τμήματα DNA διαχωρίζονται και εμφανίζονται με ηλεκτροφόρηση σε πηκτή (το χαρακτηριστικό αυτών των πηκτών είναι η μεγάλη διαχωριστική τους ικανότητα). Οι ζώνες ή τα σημεία ραδιενεργού DNA στην πηκτή εμφανίζονται με αυτοραδιογραφία ή διαφορετικά μία πηκτή βάφεται με βρωμιούχο αιθίδιο, που δίνει έντονο πορτοκαλί χρώμα φθορισμού όταν είναι δεσμευμένο σε DNA. Ένα συγκεκριμένο τμήμα που περιέχει ειδικές αλληλουχίες βάσεων μπορεί να προσδιοριστεί υβριδοποιώντας το με ένα σημασμένο συμπληρωματικό DNA που είναι ο μοριακός ανιχνευτής DNA. Η αυτοραδιογραφία αποκαλύπτει τη θέση των θραυσμάτων περιορισμού που έχουν αλληλουχία συμπληρωματική με αυτή του μοριακού ανιχνευτή. Παρομοίως, μόρια RNA μπορούν να διαχωριστούν με ηλεκτροφόρηση σε πηκτή και ειδικές αλληλουχίες μπορούν να προσδιοριστούν με υβριδοποίηση. Αυτή η ανάλογη τεχνική για την ανάλυση του RNA έχει ονομαστεί αποτύπωση Northern. Αρχικά αυτές οι μέθοδοι προσπαθούσαν να αναγνωρίσουν και να μετρήσουν μόνο ένα γονίδιο κάθε φορά. Στη συνέχεια, αναπτύχθηκαν πολλές τεχνικές αναπτύχθηκαν έτσι ώστε να μπορούν να αναλυθούν χιλιάδες υβριδοποιήσεις παράλληλα. Σήμερα είναι δυνατόν να παραχθούν συστοιχίες μοριακών ανιχνευτών που παριστάνουν όλα τα γονίδια ενός γονιδιώματος πάνω σε μία μόνο διαφάνεια. Υπάρχουν τρία κύρια είδη τεχνολογίας μικροσυστοιχιών: οι εναποτεθειμένες μικροσυστοιχίες cdna (spotted cdna arrays), οι εναποτεθειμένες μικροσυστοιχίες ολιγονουκλεοτιδίων (spotted olgonucleotde arrays) και οι n-stu μικροσυστοιχίες ολιγονουκλεοτιδίων (n-stu olgonucleotde arrays). Οι διαφορές τους οφείλονται στον τρόπο παραγωγής τους και στο είδος των ιχνηθετών που χρησιμοποιούν. Στα spotted cdna arrays, ολόκληροι οι κλώνοι cdna ή οι εκφρασμένες αλληλουχίες σημάνσεων είναι μηχανικά εναποτεθειμένες κουκίδες και ακινητοποιημένες στην επιφάνεια στήριξης. Οι συστοιχίες των εναποτεθειμένων κουκίδων cdna έχουν το πλεονέκτημα, σε σχέση με άλλες συστοιχίες, ότι μπορούν να στιγματιστούν και άγνωστες αλληλουχίες. Έτσι, οι μικροσυστοιχίες των spotted - -

33 cdna αποτελούν τη μόνη επιλογή για οργανισμούς για τους οποίους είναι διαθέσιμη μόνο περιορισμένη (ή και καμία) πληροφορία για την αλληλουχία του γονιδιώματος,. Τα spotted olgonucleotde arrays είναι αρκετά όμοια με τα spotted cdna arrays, με τη διαφορά ότι ως μοριακοί ανιχνευτές, χρησιμοποιούνται τα συνθετικά ολιγονουκλεοτίδια (olgos) αντί των cdna. Στην πραγματικότητα, χρησιμοποιείται η ίδια μηχανική εναπόθεση κουκίδας για την κατασκευή και των δύο μικροσυστοιχιών. Όταν η πληροφορία για την αλληλουχία είναι διαθέσιμη, οι ολιγονουκλεοτιδικοί μοριακοί ανιχνευτές των 2 ή 7 νουκλεοτιδίων μπορούν να σχεδιαστούν και να συντεθούν. Η χρήση των ολιγονουκλεοτιδικών μοριακών ανιχνευτών μάς δίνει καλύτερο έλεγχο για το ποιο μέρος του γονιδίου θα χρησιμοποιηθεί για την υβριδοποίηση. Τα n-stu olgonucleotde arrays χρησιμοποιούν ένα συνδυασμό φωτολιθογραφίας και ολιγονουκλεοτιδικής χημείας στερεάς φάσης για τη σύνθεση ολιγονουκλεοτιδικών μοριακών ανιχνευτών, περιορισμένων σε μήκος (short), κατευθείαν πάνω στη συμπαγή επιφάνεια στήριξης. Ο αριθμός των ολιγονουκλεοτιδίων (5. ιχνηθέτες 2 σε.28 c ) σε ένα chp το οποίο είναι κατασκευασμένο με αυτόν τον τρόπο, ξεπερνά σε μεγάλο βαθμό το τι μπορεί να επιτευχθεί με τη λύση της μηχανικής εναπόθεσης κουκίδας. Η εταιρεία Affyetrx Inc. επέλεξε να χρησιμοποιήσει αυτό το πλεονέκτημα για να κατασκευάσει μία συστοιχία με διάφορους ολιγονουκλεοτιδικούς μοριακούς ανιχνευτές και πρότυπα δείγματα διασταυρούμενης υβριδοποίησης για κάθε γονίδιο στόχο. Για τα n-stu olgonucleotde arrays τα υπό εξέταση δείγματα και τα πρότυπα δείγματα υβριδοποιούνται ξεχωριστά σε διαφορετικά chps. Αντιθέτως, για τα cdna arrays ή τα spotted olgonucleotde arrays, το υπό εξέταση δείγμα και το πρότυπο δείγμα με σημάνσεις από δύο διαφορετικές χρωστικές υβριδοποιούνται συνήθως ταυτόχρονα πάνω στις ίδιες συστοιχίες..6 Δεδομένα Στην παρούσα εργασία θα χρησιμοποιήσουμε δύο σύνολα δεδομένων. Το πρώτο από αυτά αναφέρεται σε 38 δείγματα δύο διαφορετικών τύπων λευχαιμίας και μετρήσεις της έκφρασης 5 γονιδίων. Προέρχονται από τη μελέτη που πραγματοποίησαν οι Golub et al. (999) με - -

34 στόχο την παρουσίαση των δυνατοτήτων της τεχνολογίας των γονιδιωμάτων να παρέχει πιο ακριβείς τρόπους με τους οποίους οι νεοπλασίες μπορούν να χαρακτηριστούν και να ταξινομηθούν και έτσι να οδηγήσουν σε μία πιο αποτελεσματική διάγνωση και θεραπεία. Η σωστή διάγνωση της νεοπλασίας είναι απαραίτητη για τον προσδιορισμό της κατάλληλης θεραπείας και οι παραδοσιακοί τρόποι αναγνώρισης και ταξινόμησης των κακοηθειών βασίζονταν σε ιστολογική και ανοσοϊστολογική βαφή των παθολογικών δειγμάτων. Τα δύο είδη λευχαιμίας είναι η οξεία λεμφωβλαστική λευχαιμία (acute lephoblastc leukea) (ALL, ομάδα ) και η οξεία μυελώδης λευχαιμία (acute yelod leukea) (AML, ομάδα 2), οι οποίες ταξινομούνται εύκολα με τη βοήθεια των παραδοσιακών παθολογικών μεθόδων. Οι Golub et al. (999) θέλησαν να αποδείξουν ότι αυτοί οι κακοήθεις όγκοι μπορούν να αναγνωριστούν και να διαχωριστούν με τη βοήθεια μετρήσεων της έκφρασης των γονιδίων σε μικροσυστοιχίες. Ένας από τους στόχους της στατιστικής ανάλυσης ήταν η αναγνώριση γονιδίων τα οποία διαφέρουν περισσότερο ανάμεσα στις δύο ομάδες. Το σύνολο μελέτης αποτέλεσαν 38 δείγματα μυελού των οστών από τα οποία 27 ήταν τύπου ALL και τύπου AML και τα οποία προήλθαν από ασθενείς με οξεία λευχαιμία τη στιγμή της διάγνωσης. Το RNA το οποίο σχηματίστηκε από μονοπύρηνα κύτταρα μυελού των οστών υβριδοποιήθηκε σε πλακίδια ολιγονουκλεοτιδίων υψηλής πυκνότητας (της εταιρείας Affyetrx) τα οποία περιείχαν μοριακούς ανιχνευτές για 6.87 ανθρώπινα γονίδια και για κάθε γονίδιο λήφθηκε ένα επίπεδο έκφρασης. Τα δείγματα υπέστησαν έναν τυπικό ποιοτικό έλεγχο σχετικά με την ποσότητα του σημασμένου RNA και την ποιότητα που καταγράφηκε στην εικόνα της μικροσυστοιχίας. Οι τιμές των εντάσεων φθορισμού παρουσιάζονται στον κανονικοποιημένο πίνακα που είναι διαθέσιμος στην ιστοσελίδα Η διαδικασία της κανονικοποίησης των δεδομένων αποτελεί προϋπόθεση για κάθε είδους ανάλυση μικροσυστοιχιών DNA και ορίζεται ως ο μετασχηματισμός των δεδομένων που απομακρύνει την τυχαία και συστηματική μεταβλητότητα. Η μεταβλητότητα αυτή μπορεί να προέρχεται από διαφορές πηγές όπως διαφορές στην κατασκευή των πλακιδίων, μη σταθερή εργαστηριακή προετοιμασία του δείγματος, πρωτόκολλα υβριδοποίησης, μη ακριβείς μετρήσεις του σήματος οφειλόμενες στον σαρωτή και διαφορές στην απόδοση της υβριδοποίησης από γονίδιο σε γονίδιο. Σύμφωνα με τους Golub et al., σε αυτόν τον πίνακα εφαρμόζονται τρία προκαταρκτικά βήματα: - 2 -

35 () () () Αντικατάσταση των τιμών που είναι μικρότερες του με το και των τιμών που είναι μεγαλύτερες του 6. με το 6.. Αποκλεισμός των γονιδίων για τα οποία ο λόγος της μεγαλύτερης προς την μικρότερη τιμή είναι μικρότερος ή ίσος του 5 ή η διαφορά της μεγαλύτερης και της μικρότερης τιμής είναι μικρότερη ή ίση του 5. Λογαρίθμηση των τιμών. Τέλος, σχεδιάζοντας τα θηκογράμματα των εκφράσεων των γονιδίων για κάθε ένα από τα 38 δείγματα διαπιστώνουμε την ανάγκη μετατροπής των τιμών των εκφράσεων των γονιδίων σε τιμές που ακολουθούν την τυπική κανονική κατανομή. Πραγματοποιώντας τα παραπάνω βήματα τα δεδομένα συνοψίζονται σε έναν πίνακα x j X =, =,...,2.9, j =,...,38 με τις γραμμές να αντιστοιχούν στα γονίδια και τις στήλες στα δείγματα και όπου x j η μέτρηση της έκφρασης του γονιδίου στο δείγμα j. Το δεύτερο σύνολο δεδομένων που θα χρησιμοποιήσουμε προέρχεται από το πείραμα που πραγματοποίησαν οι Scholtens et al. (24) και είναι διαθέσιμο στο κοινό μέσα από την ιστοσελίδα του Boconductor Στο πείραμα αυτό οι ερευνητές εστίασαν το ενδιαφέρον τους στην επίδραση του οιστρογόνου, κατά τη διάρκεια του χρόνου, σε γονίδια κυττάρων που είχαν προσβληθεί από καρκίνο του μαστού. Μελέτησαν τα επίπεδα έκφρασης 2625 γονιδίων σε Affyetrx πλακίδια για 8 δείγματα καρκίνου του μαστού. Εξέθεσαν τα 4 δείγματα σε οιστρογόνο και στη συνέχεια μέτρησαν την «αφθονία» του RNA αντιγράφου μετά από ώρες για τα δύο δείγματα και μετά από 48 ώρες για τα άλλα δύο. Τα υπόλοιπα 4 δείγματα τα άφησαν χωρίς καμία επεξεργασία και μέτρησαν την «αφθονία» του RNA αντιγράφου μετά από ώρες για τα δύο δείγματα και μετά από 48 ώρες για τα άλλα δύο. Το πείραμα αυτό έχει δύο παράγοντες, το οιστρογόνο και τον χρόνο και ο καθένας από αυτούς δύο επίπεδα. Παρουσία ή απουσία οιστρογόνου και ή 48 ώρες, αποτελεί δηλαδή έναν παραγοντικό σχεδιασμό γνωστό ως "Estrogen 2x2 Factoral Desgn". Σκοπός της μελέτης αυτής είναι η αναγνώριση των γονιδίων που αποκρίνονται στο οιστρογόνο και η ταξινόμηση αυτών σε σχέση με το χρόνο απόκρισης

36 - 4 -

37 ΚΕΦΑΛΑΙΟ 2 2. Πολλαπλοί Έλεγχοι Υποθέσεων Σε ένα πείραμα μικροσυστοιχιών, τα δεδομένα μας αποτελούνται από τις εκφράσεις γονιδίων σε n δείγματα, κάθε ένα από τα οποία σχετίζεται με μία απόκριση ή συμμεταβλητή ενδιαφέροντος. Στην παρούσα εργασία, όπως αναφέρεται αναλυτικά στο Κεφάλαιο, το πρώτο σύνολο δεδομένων προέρχεται από τις μετρήσεις της έκφρασης γονιδίων σε βιοψία τμήματος όγκου από ασθενείς με λευχαιμία. Η απόκριση που μας ενδιαφέρει είναι ο τύπος του όγκου και στόχος μας είναι η ταυτοποίηση των γονιδίων που είναι διαφορετικά εκφρασμένα στους διαφορετικούς τύπους όγκου. Τα δεδομένα συγκεντρώνονται σε έναν n πίνακα X = ( x j ), =,...,, j =,..., n, με τις γραμμές να αντιστοιχούν στα γονίδια και τις στήλες στα δείγματα: είναι η μέτρηση της έκφρασης του γονιδίου στο δείγμα j. x j Θεωρούμε ότι τα n τυχαία διανύσματα διάστασης- X j, j =,..., n ), που αντιστοιχούν στις μετρήσεις έκφρασης των γονιδίων στα n δείγματα είναι ανεξάρτητα και ισόνομα. Το τυχαίο διάνυσμα X = ( X,..., X j ακολουθεί κάποια κατανομή P η οποία ανήκει σε μία j j οικογένεια κατανομών M. Γενικότερα, σε μελέτες μικροσυστοιχιών που αφορούν σε έρευνες για τον καρκίνο, συμβολίζουμε με ( j,..., X g j ) έκφρασης των γονιδίων και με (,..., ) αποτελεσμάτων για τον ασθενή j, X, < g <, το διάνυσμα των μετρήσεων της X + το διάνυσμα των βιολογικών και κλινικών ( g ) j X j j =,...,n. Οι ποσότητες που μας ενδιαφέρουν είναι συναρτήσεις της άγνωστης κατανομής P και ενδέχεται να εκφράζουν μέσες τιμές, διαφορές μέσων τιμών ή συσχετίσεις. Θα τις συμβολίζουμε γενικά με μ, =,...,. Πιο συγκεκριμένα, στην περίπτωση ανάλυσης των μικροσυστοιχιών μπορεί να είναι το μέσο επίπεδο έκφρασης μ =Ε ( X j ), j =,..., n, ή η διαφορά των μέσων επιπέδων έκφρασης μ = E X j E Y j, j =,..., n, j2 =,..., n2, του γονιδίου, =,...,, σε δύο 2-5 -

38 πληθυσμούς (πλήθους και n ). Μπορεί επίσης να είναι παράμετροι παλινδρόμησης για τη n 2 μέτρηση της σχέσης του επιπέδου έκφρασης X, =,..., g, j =,..., n, με αποτελέσματα ή j αποκρίσεις X j, = g+,...,, j =,..., n. Το βιολογικό ερώτημα της διαφορετικής έκφρασης μπορεί να διατυπωθεί ως ένα πρόβλημα ταυτόχρονου ελέγχου για τα γονίδια, της μηδενικής υπόθεσης της μη ύπαρξης σχέσης μεταξύ των επιπέδων έκφρασης ισοδύναμα με τον πολλαπλό έλεγχο υποθέσεων: Η έναντι της εναλλακτικής υπόθεσης για =,...,. Η Η X j και της απόκρισης ή συμμεταβλητής, ή :το γονίδιο δεν είναι διαφορετικά εκφρασμένο : το γονίδιο είναι διαφορετικά εκφρασμένο, ( Η είναι αληθής Η = ) όταν P M και ψευδής Η = ) διαφορετικά. Το { : P } S = M είναι το σύνολο των αληθών μηδενικών υποθέσεων, όπου πλήθος των στοιχείων του συνόλου ψευδών μηδενικών υποθέσεων. ( = S το c S και το Sο = { : P M } το σύνολο των = Οι αποφάσεις για την απόρριψη ή όχι των μηδενικών υποθέσεων βασίζονται στο διάνυσμα διάστασης των στατιστικών T ( n,..., ) n = T, =. Κάθε στατιστικό T n αποτελεί συνάρτηση των X, X 2,..., X n και μεγάλες ή μικρές τιμές του οδηγούν σε απόρριψη της μηδενικής υπόθεσης. Η από κοινού κατανομή των θα συμβολίζεται με. T n F n Ο έλεγχος πολλαπλών υποθέσεων ουσιαστικά παράγει ένα σύνολο S n το οποίο αποτελεί εκτίμηση του συνόλου S c S εξαρτάται από τα δεδομένα Tn των ψευδών μηδενικών υποθέσεων. Το σύνολο n = S( T, F n, a ) { :H απορρίπτεται } {,..., } ( j,..., Xj) X, T n j =,..., n, μέσω των στατιστικών συναρτήσεων, από την από κοινού κατανομή F των υπό την μηδενική υπόθεση και από το επίπεδο α του πολλαπλού ελέγχου. 2.. Πιθανότητες Σφαλμάτων Τύπου Ι n Κατά τον στατιστικό έλεγχο των υποθέσεων μπορεί να εμφανιστούν δύο είδη σφαλμάτων: το λανθασμένα θετικό αποτέλεσμα ή σφάλμα τύπου Ι, το οποίο πραγματοποιείται όταν ένα - 6 -

39 γονίδιο δηλωθεί ως διαφορετικά εκφρασμένο ενώ στην πραγματικότητα δεν είναι και το λανθασμένα αρνητικό αποτέλεσμα ή σφάλμα τύπου II, το οποίο συμβαίνει όταν ο έλεγχος αποτυγχάνει να αναγνωρίσει τα διαφορετικά εκφρασμένα γονίδια. Στόχος μας είναι να έχουμε μεγάλη πιθανότητα να δηλώσουμε ορθά τη διαφορετική έκφραση ενός γονιδίου, κρατώντας την πιθανότητα να έχουμε μία λανθασμένη δήλωση διαφορετικής έκφρασης χαμηλή, δηλαδή να αυξήσουμε την ισχύ του ελέγχου. Το γεγονός ότι σε κάθε πείραμα μικροσυστοιχιών εμφανίζονται ταυτόχρονα τα επίπεδα έκφρασης χιλιάδων γονιδίων έχει ως αποτέλεσμα την εμφάνιση έντονων προβλημάτων πολλαπλότητας. Συνήθως, κατά τον έλεγχο μιας υπόθεσης έχουμε μία προκαθορισμένη πιθανότητα σφάλματος τύπου I, η οποία όμως αυξάνεται με τον αριθμό των υποθέσεων. Συγκεκριμένα, μία τιμή-p ίση με. για ένα γονίδιο ανάμεσα σε αρκετές χιλιάδες δεν αποτελεί σημαντικό αποτέλεσμα, αφού μπορεί να έχει εμφανιστεί τυχαία κάτω από τη μηδενική υπόθεση θεωρώντας ένα τόσο μεγάλο σύνολο γονιδίων. Έτσι τα σφάλματα τύπου I και II πρέπει να ρυθμιστούν για ολόκληρο το σύνολο των γονιδίων. Επομένως, αυτό που μας ενδιαφέρει σε ένα πρόβλημα ταυτόχρονου συμπεράσματος είναι ο προσδιορισμός μιας κατάλληλης πιθανότητας σφαλμάτων τύπου I και η επινόηση ισχυρών διαδικασιών πολλαπλών υποθέσεων οι οποίες ελέγχουν την πιθανότητα σφάλματος τύπου Ι. Ένας συνηθισμένος τρόπος παρουσίασης του προβλήματος του ταυτόχρονου ελέγχου των μηδενικών υποθέσεων είναι αυτός που φαίνεται στο πίνακα 2.. (Benjan and Hochberg, 995). Ορθές μηδενικές υποθέσεις Ψευδείς μηδενικές υποθέσεις Αριθμός υποθέσεων που δεν έχουν απορριφθεί U n N n R n R n Αριθμός υποθέσεων που έχουν απορριφθεί V n W n Πίνακας 2.. Το πρόβλημα του ταυτόχρονου ελέγχου των μηδενικών υποθέσεων. Οι υποθέσεις είναι γνωστές εκ των προτέρων, οι αριθμοί και = των ορθών και ψευδών μηδενικών υποθέσεων είναι άγνωστες παράμετροι, το R n είναι μία - 7 -

40 παρατηρήσιμη τυχαία μεταβλητή και τα U, V, N και Wn είναι μη παρατηρήσιμες τυχαίες μεταβλητές. n n n Στην περίπτωση του ελέγχου μίας υπόθεσης, η πιθανότητα σφάλματος τύπου I, δηλαδή της απόρριψης της μηδενικής υπόθεσης ενώ αυτή ισχύει, συνήθως ρυθμίζεται σε ένα προκαθορισμένο επίπεδο α. Στη συνέχεια, επιλέγεται μία κρίσιμη τιμή c α τέτοια ώστε Pr ( T cα Η ) a για το στατιστικό T που έχουμε αποφασίσει να χρησιμοποιήσουμε και η H απορρίπτεται όταν T. Αντίστοιχα, μία διαδικασία πολλαπλών υποθέσεων λέμε ότι ρυθμίζει μία συγκεκριμένη πιθανότητα σφάλματος τύπου Ι σε ένα επίπεδο α, αν αυτή η πιθανότητα είναι μικρότερη ή ίση με α όταν η δεδομένη διαδικασία εφαρμόζεται για να παραχθεί ένα σύνολο από R n c α απορριφθείσες υποθέσεις. Στους πολλαπλούς ελέγχους υπάρχει μία ποικιλία γενικεύσεων για τον προσδιορισμό της πιθανότητας σφάλματος τύπου Ι. Εδώ θα μελετήσουμε τις πιθανότητες σφάλματος που ορίζονται ως συναρτήσεις της κατανομής ενός αριθμού σφαλμάτων τύπου Ι. Η Per-Coparson Error Rate (PCER) ορίζεται ως ο αναμενόμενος αριθμός των σφαλμάτων τύπου Ι διά το πλήθος των υποθέσεων. EV PC ER = n. Η Per-Faly Error Rate (PFER) ορίζεται ως ο αναμενόμενος αριθμός των σφαλμάτων τύπου Ι. PFER = E. V n Η Faly-Wse Error Rate (FWER) ορίζεται ως η πιθανότητα να εμφανιστεί τουλάχιστον ένα σφάλμα τύπου Ι. ( V ) FWER = Pr n. Η False Dscovery Rate (FDR) (Benjan & Hochberg, 995) ορίζεται ως το αναμενόμενο ποσοστό των σφαλμάτων τύπου Ι ανάμεσα στις υποθέσεις που έχουν απορριφθεί. FDR = E ( Qn ), όπου V n Q n = αν n > Rn R και Q = αν =. Η Postve False Dscovery Rate (pfdr) (Storey, 22), ορίζεται ως το αναμενόμενο ποσοστό των σφαλμάτων τύπου Ι ανάμεσα στις υποθέσεις που έχουν απορριφθεί, δεδομένου ότι έχουμε μία τουλάχιστον απόρριψη. n R n - 8 -

41 V n pfdr = E Rn > R n 2..2 Σύγκριση των πιθανοτήτων των σφαλμάτων τύπου I Γενικά, για μία δεδομένη διαδικασία πολλαπλών ελέγχων, δηλαδή μία διαδικασία με τη ίδια περιοχή απόρριψης στον -διάστατο χώρο, ισχύει ότι: PCER FDR FWER PFER. Η σχέση αυτή δηλώνει ότι οι διαδικασίες που ρυθμίζουν την PFER είναι πιο συντηρητικές από αυτές που ρυθμίζουν την FWER και αντίστοιχα για τις υπόλοιπες, που σημαίνει ότι οδηγούν σε λιγότερες απορρίψεις. Επίσης, ισχύει αποδεικνύονται ως εξής: o Αρχικά για την ανισότητα Έτσι για R > μπορούμε να γράψουμε ότι n PCER FDR γνωρίζουμε ότι, V R με V = όταν =. n n Vn n V R n n FDR pfdr. Τα παραπάνω Και αν πάρουμε τις αναμενόμενες τιμές καταλήγουμε στην ζητούμενη ανισότητα, o Για την ανισότητα Vn Vn E E Rn > R δηλαδή n FDR FWER R n PCER FDR. (α) αν όλες οι μηδενικές υποθέσεις είναι αληθείς, δηλαδή =, τότε FDR = FWER. Η παραπάνω σχέση ισχύει διότι: έχουμε ότι = οπότε συνεπάγεται ότι Wn = Vn = R n. αν V = τότε Q = Pr( V ) = E( Q ) = αν n n n n n τότε Q = Pr V = E Q = V > (β) αν n <, τότε FDR FWER. V Αν V n n > Qn = I( V n ) όπου I( Vn ) R n n n δείκτρια συνάρτηση. Από την τελευταία σχέση αν πάρουμε τις μέσες τιμές προκύπτει το ζητούμενο, δηλαδή ότι Pr( V ) E Q n n - 9 -

42 o Τέλος, σύμφωνα με την ανισότητα του Markov Pr( V ) E( V ) άρα FWER RFER. n n 2..3 Ισχυρή και Ασθενής Ρύθμιση Οι αναμενόμενες τιμές και οι πιθανότητες που παρουσιάστηκαν παραπάνω ορίζονται κάτω από τη μηδενική και τυπικά άγνωστη κατανομή P των δεδομένων. Συγκεκριμένα, εξαρτώνται από το ποιο σύνολο S {,...,} αντιστοιχεί στο σύνολο των αληθών μηδενικών υποθέσεων για αυτή την κατανομή. Για παράδειγμα, ρύθμιση της FWER σημαίνει ρύθμιση της πιθανότητας όπου I S Pr ( V I H ) = Pr ( απόρριψη μίας τουλάχιστον H, S H ) H n S το σύνολο των αληθών μηδενικών υποθέσεων για την από κοινού κατανομή των δεδομένων. Η ρύθμιση αυτή ονομάζεται ακριβής ρύθμιση. Ένας βασικός διαχωρισμός είναι αυτός μεταξύ της ισχυρής και της ασθενούς ρύθμισης της πιθανότητας του σφάλματος τύπου Ι. Η ισχυρή ρύθμιση αναφέρεται στη ρύθμιση της πιθανότητας σφάλματος τύπου Ι κάτω από οποιοδήποτε συνδυασμό αληθών και ψευδών μηδενικών υποθέσεων, δηλαδή για κάθε υποσύνολο S {,...,} c κάτω από την πλήρη μηδενική υπόθεση H = H με =, δηλαδή όταν όλες οι I S αληθών μηδενικών υποθέσεων. Για την FWER, ισχυρή ρύθμιση σημαίνει ρύθμιση της ax Pr V HS. Αντίθετα η ασθενής ρύθμιση αναφέρεται στη ρύθμιση της πιθανότητας σφάλματος τύπου Ι μηδενικές υποθέσεις είναι αληθείς. Για την FWER, ασθενής ρύθμιση σημαίνει ρύθμιση της c ( Vn H ) Pr. I = S Στην πραγματικότητα, ορισμένες μηδενικές υποθέσεις μπορεί να είναι αληθείς και άλλες μπορεί να είναι ψευδείς, αλλά το υποσύνολο παραμένει άγνωστο. Σε ένα σύστημα μικροσυστοιχιών όπου δεν είναι πολύ πιθανό να μην υπάρχουν διαφορετικά εκφρασμένα γονίδια, η πλήρης μηδενική υπόθεση είναι σχεδόν απίθανο να ισχύει, κάτι που καθιστά την ασθενή ρύθμιση μη ικανοποιητική. Είναι σημαντικό λοιπόν να εξασφαλίζουμε την ισχυρή ρύθμιση της πιθανότητας σφάλματος τύπου Ι, διότι αυτή μας βεβαιώνει ότι ο έλεγχος γίνεται κάτω από την αληθή και άγνωστη κατανομή δεδομένων. S - 2 -

43 2..4 Προσαρμοσμένες και μη τιμές-p, τιμές-q Θεωρούμε αρχικά τον έλεγχο μίας υπόθεσης H σε ένα προκαθορισμένο επίπεδο α και περιοχή απόρριψης τέτοια ώστε (α) για a a ( T H ) Pr Γ = α Γa Γ a Γ a 2 2 αμφίπλευρο έλεγχο, οι περιοχές απόρριψης, α cα, a c είναι τέτοιες ώστε Pr T Γ H = = a. Τότε η τιμή-p για την παρατηρούμενη τιμή T = t δίνεται από τη σχέση: α ( a ) ) και (β) για α. Χρησιμοποιώντας το στατιστικό Τ για τον Γ = ( ] [ p value ( t ) = n Pr ( T Γ H = ) { Γ : t Γ } a a Δηλαδή, η τιμή-p ορίζεται ως η ελάχιστη τιμή του σφάλματος τύπου Ι για όλες τις περιοχές απόρριψης Γ που περιέχουν την παρατηρούμενη τιμή T = t. Για έναν αμφίπλευρο έλεγχο η τιμή-p δίνεται από την πιθανότητα a a p = Pr T t H και έτσι όταν αυτή είναι πολύ μικρή έχουμε ένδειξη για την απόρριψη της μηδενικής υπόθεσης. Σημειώνεται ότι η απόρριψη της H όταν p a μας παρέχει τη ρύθμιση του σφάλματος τύπου Ι σε επίπεδο α. Αυτός ο ορισμός των τιμών-p, τις οποίες θα τις αναφέρουμε ως ακατέργαστες τιμές-p ή απλά τιμές-p, μπορεί να επεκταθεί και στα προβλήματα του πολλαπλού ελέγχου υποθέσεων. Αν p = Pr ( T t H είναι η τιμή-p για την υπόθεση H, =,...,, η διαδικασία ) πολλαπλού ελέγχου μπορεί να καθοριστεί με δύο τρόπους. Ο πρώτος τρόπος είναι μέσω των τιμών-p των ατομικών υποθέσεων, δηλαδή την απόρριψη της H,,..., όταν p a, = όπου το a έχει επιλεγεί ώστε να ρυθμίζει την πιθανότητα σφάλματος τύπου Ι (FWER, PCER, RFER ή FDR) σε ένα επίπεδο α. Ο δεύτερος τρόπος είναι μέσω των προσαρμοσμένων τιμών-p, οι οποίες μπορούν να συγκριθούν κατευθείαν με το προκαθορισμένο επίπεδο α ή την πιθανότητα σφάλματος τύπου Ι. Οι προσαρμοσμένες τιμές-p ορίζονται ως εξής. Ορισμός 2.. Για κάθε διαδικασία πολλαπλού ελέγχου, η προσαρμοσμένη τιμή-p, η οποία αντιστοιχεί στον έλεγχο μίας υπόθεσης H,,...,, μπορεί να οριστεί ως το επίπεδο = σημαντικότητας ολόκληρης της διαδικασίας του ελέγχου στο οποίο η απορρίπτεται, δεδομένων των τιμών όλων των στατιστικών. H οριακά - 2 -

44 Η προσαρμοσμένη τιμή-p ορίζεται σε σχέση με κάποια διαδικασία ελέγχου. Αν και η αναλυτική παρουσίαση των διαδικασιών ελέγχου γίνεται σε επόμενη παράγραφο, για την καλύτερη κατανόηση του ορισμού θα θεωρήσουμε τον έλεγχο της υπόθεσης Η,,..., =, χρησιμοποιώντας τη γνωστή διαδικασία Bonferron. Συγκεκριμένα, αν χρησιμοποιήσουμε την FWER= a, η Η απορρίπτεται αν FWER p a όπου a = και από την παραπάνω ανισότητα μπορούμε να γράψουμε: FWER p p FWER (2.) Έτσι αν θέλουμε να ρυθμίσουμε την FWER, η FWER προσαρμοσμένη τιμή-p για την υπόθεση είναι: Η [,] ~ = απορρίπτεται για FWER = a} p nf{ a : H δηλαδή, η ελάχιστη τιμή του επιπέδου σημαντικότητας όλης της διαδικασίας για την οποία απορρίπτεται η μηδενική υπόθεση. Από τη σχέση (2.) προκύπτει ότι η προσαρμοσμένη τιμήp είναι: και η υπόθεση απορρίπτεται, με p% FWER = a, αν = p p% a. Όμοια ορίζονται και οι προσαρμοσμένες τιμές-p για όλες τις πιθανότητες σφάλματος τύπου Ι. Το πλεονέκτημα που μας δίνουν οι προσαρμοσμένες τιμές-p είναι ότι δεν απαιτούν την επιλογή μιας συγκεκριμένης πιθανότητας σφάλματος τύπου Ι ή τον προκαθορισμό του επιπέδου σημαντικότητας α, αλλά μας δίνουν την δυνατότητα να επιλέξουμε για κάθε πείραμα τον κατάλληλο συνδυασμό απορρίψεων και λανθασμένα θετικών αποτελεσμάτων. Σε αναλογία με τις προσαρμοσμένες τιμές-p μπορούμε, μέσω μιας συγκεκριμένης πιθανότητας σφάλματος τύπου Ι, της pfdr, να ορίσουμε και τις τιμές-q,. Έχοντας υπόψη τον ορισμό που δώσαμε παραπάνω για τις τιμές-p, θεωρούμε τον ελάχιστο αριθμό των σφαλμάτων τύπου Ι για όλες τις δυνατές περιοχές απόρριψης που περιέχουν την παρατηρούμενη τιμή T = t. Αν pfdr Γ ) η pfdr στην περίπτωση που κάθε υπόθεση ( a Γ a

45 απορρίπτεται από την ίδια περιοχή απόρριψης Γ a, τότε η τιμή-q ορίζεται ανάλογα από τη σχέση: q value () t = nf { Γ : t Γ } a a pfdr ( Γ ) a Για τις τιμές-q θα μιλήσουμε εκτενέστερα στην ενότητα Διαδικασίες Πολλαπλού Ελέγχου Κάθε μία από τις πιθανότητες σφάλματος τύπου Ι που ορίσαμε παραπάνω ρυθμίζεται σε επίπεδο α από μία συγκεκριμένη διαδικασία πολλαπλών ελέγχων. Διακρίνουμε τρεις τύπους διαδικασιών πολλαπλού ελέγχου, τις sngle-step, τις step-down και τις step-up διαδικασίες. Στις sngle-step διαδικασίες κάθε μία υπόθεση εξετάζεται ανεξάρτητα από τα αποτελέσματα των υπολοίπων, ενώ στις stepwse διαδικασίες η απόρριψη μιας συγκεκριμένης υπόθεσης βασίζεται όχι μόνο στο πλήθος των υποθέσεων αλλά και στα αποτελέσματα που προκύπτουν από τον έλεγχο των προηγούμενων υποθέσεων. Συγκεκριμένα, στις step-down διαδικασίες ελέγχονται διαδοχικά οι υποθέσεις ξεκινώντας από αυτήν που αντιστοιχεί στο πιο σημαντικό στατιστικό. Στη συνέχεια, αν αυτή απορριφθεί πηγαίνουμε βηματικά στην υπόθεση που αντιστοιχεί στο επόμενο λιγότερο σημαντικό στατιστικό. Αν σε κάποιο βήμα ο έλεγχος αποτύχει να απορρίψει την μηδενική υπόθεση τότε κανένας από τους υπόλοιπους ελέγχους δεν θα την απορρίπτει. Αντίθετα, στις step-up διαδικασίες ξεκινάμε με τον έλεγχο της υπόθεσης που αντιστοιχεί στο λιγότερο σημαντικό στατιστικό και αν δεν απορριφθεί συνεχίζουμε βηματικά με το επόμενο πιο σημαντικό στατιστικό. Αν κάποια υπόθεση απορριφθεί, θα απορριφθούν και όλες οι υπόλοιπες. Για παράδειγμα, έστω p p p p p () ( 2) () 3 ( 4) ( 5) H() οι διατεταγμένες τιμές-p και υποθέσεις που αντιστοιχούν σε αυτές. Μία step-down διαδικασία ξεκινά με τον έλεγχο της υπόθεσης H, H, H, H, H που αντιστοιχεί στην μικρότερη τιμή-p, δηλαδή στην ( 2) ( 3) ( 4) ( 5) p () οι. Αν αυτή απορριφθεί τότε ο έλεγχος συνεχίζεται για την υπόθεση H (2 ). Αν όχι, τότε σταματά και αποτυγχάνει να απορρίψει και τις τέσσερις υπόλοιπες υποθέσεις. Αντίθετα, μία step-up διαδικασία ξεκινά με τον έλεγχο της υπόθεσης H( 5 ) που αντιστοιχεί στην μεγαλύτερη τιμή-p,

46 δηλαδή στην p ( 5). Αν αυτή απορριφθεί τότε ο έλεγχος σταματά και απορρίπτει και τις τέσσερις υπόλοιπες υποθέσεις. Αν όχι, τότε συνεχίζεται για την υπόθεση H( 4 ) Ρύθμιση της Faly Wse Error Rate 2.2..α Μέθοδοι Sngle-step.. Η πιο παραδοσιακή μέθοδος στον έλεγχο πολλαπλών υποθέσεων είναι η μέθοδος Bonferron. Για το σύνολο των υποθέσεων Ι ίση με a = a a, κάθε υπόθεση. Εδώ θεωρούμε ότι H H,..., και για πιθανότητα σφάλματος τύπου Η ελέγχεται σε επίπεδο σημαντικότητας, τέτοιο ώστε a = a. Η ερμηνεία της διαδικασίας αυτής βασίζεται στην ανισότητα Bonferron. Υποθέτουμε ότι οι μηδενικές υποθέσεις είναι αληθείς για όλα τα, δηλαδή ότι =, και ότι το επίπεδο σημαντικότητας για κάθε υπόθεση χωριστά είναι a κοινό και ίσο με a. Έτσι, η πιθανότητα μη απόρριψης των μηδενικών υποθέσεων για όλα τα είναι a. Αν p είναι η ακατέργαστη τιμή-p για την υπόθεση Η, τότε η Η απορρίπτεται όταν p a. Έτσι, οι αντίστοιχες sngle-step Bonferron προσαρμοσμένες τιμές-p δίνονται από τη σχέση: = n (,) p% p (2.2) 2. Η διαδικασία Sdak είναι ανάλογη με τη μέθοδο Bonferron και απορρίπτει την υπόθεση Η, =,...,, όταν η τιμή-p είναι μικρότερη ή ίση του (. Υποθέτοντας ότι έχουμε ανεξάρτητα στατιστικά T, T2,..., T a ) / για τον έλεγχο των υποθέσεων H, H 2,..., H σε επίπεδο σημαντικότητας a για την κάθε μία, τότε η πιθανότητα να μην απορρίψουμε καμμία υπόθεση δεδομένου ότι είναι όλες αληθείς είναι: Pr [ I ( η H δεν απορρίπτεται ) όλες οι είναι αληθείς = H ] = Pr ( η H δεν απορρίπτεται η H είναι αληθής = ) =

47 = ( ) = ( a ) a Έτσι, το επίπεδο σημαντικότητας για τον πολλαπλό έλεγχο σημαντικότητας θα είναι: / a a = a a = ( a) a =. Οι αντίστοιχες sngle-step Sdak προσαρμοσμένες τιμές-p δίνονται από τη σχέση: p% = p, =,..., (2.3) 3. Μία άλλη μέθοδος η οποία λαμβάνει υπόψη την εξάρτηση μεταξύ των ελέγχων, είναι αυτή των Westfall and Young (993). Σύμφωνα με αυτή, οι sngle-step np προσαρμοσμένες τιμές-p δίνονται από τη σχέση: c ( ) p% = Pr n P p H k k c c όπου H είναι η πλήρης μηδενική υπόθεση ( H = I = H ) και Pk η τυχαία μεταβλητή για τις ακατέργαστες τιμές-p της υπόθεσης k. στατιστικά 4. Ανάλογα ορίζονται και οι sngle-step axt προσαρμοσμένες τιμές-p, με βάση τα T, από τη σχέση: c ( ) p% = Pr ax T t H k k 2.2..β Μέθοδοι Step-down. Στις step-down μεθόδους θεωρούμε τις διατεταγμένες ακατέργαστες τιμές-p p() p( 2)... p( ) και τις αντίστοιχες υποθέσεις H (), H ( 2),..., H.. Σύμφωνα με τη διαδικασία Hol (979) πραγματοποιείται ένας ακολουθιακός έλεγχος Bonferron στο επίπεδο a ως εξής: Ξεκινάμε συγκρίνοντας τη μικρότερη τιμή-p με την τιμή a /. Αν p () a / απορρίπτουμε την υπόθεση H () και συνεχίζουμε τον έλεγχο με υποθέσεις, διαφορετικά δεν απορρίπτουμε καμμία υπόθεση. Συνεχίζοντας με τον ίδιο τρόπο, αν p a /( απορρίπτουμε την υπόθεση H ( 2), αν όχι δεν απορρίπτουμε καμία από τις 2 ) υπόλοιπες υποθέσεις. Η διαδικασία αυτή συνεχίζεται για 2,..., υποθέσεις μέχρι το

48 σημείο όπου καμμία απόρριψη δεν θα μπορεί να γίνει, δηλαδή είτε όταν αποδεχτούμε όλες τις υποθέσεις που απομένουν είτε όταν απορρίψουμε και την τελευταία υπόθεση H. Στον ακολουθιακό έλεγχο Bonferron, οι τιμές-p συγκρίνονται με τους αριθμούς a a a,,..., a ενώ στην κλασσική μέθοδο Bonferron, με. Το γεγονός αυτό δηλώνει ότι η πιθανότητα απόρριψης για ένα σύνολο μηδενικών υποθέσεων χρησιμοποιώντας την κλασική μέθοδο Bonferron είναι μικρότερη ή ίση από την αντίστοιχη πιθανότητα απόρριψης αν χρησιμοποιήσουμε τον ακολουθιακό έλεγχο Bonferron. Η χρήση του συγκεκριμένου ελέγχου βασίζεται στο παρακάτω θεώρημα. Θεώρημα 2.. Εάν είναι δυνατόν να εμφανιστούν όλα τα υποσύνολα μηδενικών υποθέσεων τότε ο ακολουθιακός έλεγχος απόρριψης Bonferron έχει πολλαπλό επίπεδο σημαντικότητας α. Απόδειξη. (Υπενθυμίζουμε ότι το είναι το σύνολο των αληθών μηδενικών S υποθέσεων.) Η πιθανότητα απόρριψης τουλάχιστον μίας από τις επιμέρους μηδενικές υποθέσεις είναι a a a a Pr P Pr P = = = a U S. S S a Αν το ενδεχόμενο P > συμβεί για όλα τα S, δηλαδή αν αποδεχθούμε όλες τις αληθείς μηδενικές υποθέσεις, τότε P a και ο ακολουθιακός έλεγχος σταματά στο ( + ) > βήμα + ή νωρίτερα, έχοντας δημιουργήσει ένα σύνολο από μη απορριφθείσες υποθέσεις. Αυτό περιέχει το σύνολο των αληθών μηδενικών υποθέσεων. Σημείωση. Με τη φράση για όλα τα υποσύνολα μηδενικών υποθέσεων θέλουμε να δηλώσουμε ότι οποιαδήποτε από τις μηδενικές υποθέσεις ενδέχεται να είναι αληθής. Η έννοια αυτή χαρακτηρίζεται από τη φράση για ανεξάρτητους συνδυασμούς. { } Σύμφωνα με τα παραπάνω, αν ορίσουμε ως J = n : p() > a / + τότε απορρίπτουμε την υπόθεση H, για τα =,..., J. Αν δε βρεθεί ένα τέτοιο J τότε ()

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Η ΙΣΧΥΣ ΕΝΟΣ ΕΛΕΓΧΟΥ. (Power of a Test) ΚΕΦΑΛΑΙΟ 21

Η ΙΣΧΥΣ ΕΝΟΣ ΕΛΕΓΧΟΥ. (Power of a Test) ΚΕΦΑΛΑΙΟ 21 ΚΕΦΑΛΑΙΟ 21 Η ΙΣΧΥΣ ΕΝΟΣ ΕΛΕΓΧΟΥ (Power of a Test) Όπως είδαμε προηγουμένως, στον Στατιστικό Έλεγχο Υποθέσεων, ορίζουμε δύο είδη πιθανών λαθών (κινδύνων) που μπορεί να συμβούν όταν παίρνουμε αποφάσεις

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Διαδικασία Ελέγχου Μηδενικών Υποθέσεων

Διαδικασία Ελέγχου Μηδενικών Υποθέσεων Διαδικασία Ελέγχου Μηδενικών Υποθέσεων Πέτρος Ρούσσος, Τμήμα Ψυχολογίας, ΕΚΠΑ Η λογική της διαδικασίας Ο σάκος περιέχει έναν μεγάλο αλλά άγνωστο αριθμό (αρκετές χιλιάδες) λευκών και μαύρων βόλων: 1 Το

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ

Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ DNA μικροσυστοιχίες: βήμα προς βήμα Παραγωγή DNA ανιχνευτών Οι επιστήμονες μπορούν να παράγουν «σπιτικές» μικροσυστοιχίες χρησιμοποιώντας την αλυσιδωτή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

3.4.2 Ο Συντελεστής Συσχέτισης τ Του Kendall

3.4.2 Ο Συντελεστής Συσχέτισης τ Του Kendall 3..2 Ο Συντελεστής Συσχέτισης τ Του Kendall Ο συντελεστής συχέτισης τ του Kendall μοιάζει με τον συντελεστή ρ του Spearman ως προς το ότι υπολογίζεται με βάση την τάξη μεγέθους των παρατηρήσεων και όχι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ. Ερωτήσεις πολλαπλής επιλογής. Συντάκτης: Δημήτριος Κρέτσης

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ. Ερωτήσεις πολλαπλής επιλογής. Συντάκτης: Δημήτριος Κρέτσης ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ Ερωτήσεις πολλαπλής επιλογής Συντάκτης: Δημήτριος Κρέτσης 1. Ο κλάδος της περιγραφικής Στατιστικής: α. Ασχολείται με την επεξεργασία των δεδομένων και την ανάλυση

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα