: ک ی ن و ر ت ک ل ا ت س پ

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download ": ک ی ن و ر ت ک ل ا ت س پ"

Transcript

1 م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ر ک ی م ه ی ر ش ن : 9 2 ی پ ا ی پ ر د ی ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ت ی ل ا ع ف ی س ر ر ب ی ر و ت س ا پ س و ک و ک و ل ی ف ا ت س ا ی ر ت ک ا ب ن ی م ا 2 *1 ی ن ی س ح ن ی م ا ر و خ ی ش ه د ن ا ی ز ر ب ل ا 1 س ا ن ش ر ا ک ن ی و ز ق ) ه ر ( ی ن ی م خ م ا م ا ی ل ل م ل ا ن ی ب ه ا گ ش ن ا د ی ز ر و ا ش ک ی ژ و ل و ن ک ت و ی ب د ش ر ا ن ی و ز ق ) ه ر ( ی ن ی م خ م ا م ا ی ل ل م ل ا ن ی ب ه ا گ ش ن ا د ی ز ر و ا ش ک ی ژ و ل و ن ک ت و ی ب ه و ر گ ی م ل ع ت ئ ی ه و ض ع 2 ن ا ر ی ا ن ی و ز ق ن ا ر ی ا ن ی و ز ق ر و ی ر ه ش 6 : ت ف ا ی ر د خ ی ر ا ت ن ا ب آ 9 2 : ش ر ی ذ پ خ ی ر ا ت ه د ی ک چ ی ا ه د ن و ی پ د ن ر د ا ق ه ک د ن ت س ه ا ه م ی ز ن آ ز ا ی ه و ر گ ) DNase( ا ه ز ا ئ ل ک و ن و ب ی ر ی س ک ا د د ن ر ا د ز ا ئ ل ک و ن ی ا ه م ی ز ن آ ه د ن ز ت ا د و ج و م م ا م ت ی ا ه ن و م ز آ و 16S rrna ر گ ن ا ش ن ز ا ه د ا ف ت س ا ا ب Staphylococcus pasteuri ی ر ت ک ا ب د ن ن ک ش ب ا ر DNA ل و ک ل و م ر ت س ا ی د و ف س ف ی س ک ا د ی ا ه م ی ز ن آ ت ی ل ا ع ف د ی س ر ت ب ث ه ب NCBI/EMBL ه ا گ ی ا پ ن ژ ک ن ا ب ر د KC ی س ر ت س د ه ر ا م ش ا ب و ی ی ا س ا ن ش ی ی ا ی م ی ش و ی ب ی س ر ر ب حلقوی و ی ط خ DNA ی و ر م ی ز ن آ ت ی ل ا ع ف ی ر ت م و ت و ف و ت ک پ س ا ش و ر ه س ا ب ه د م آ ت س د ب S pasteuri ی ر ت ک ا ب ر د ز ا ئ ل ک و ن و ب ی ر ر ا ر ق ی س ر ر ب د ر و م ا ه م ی ز ن آ ت ی ل ا ع ف ی و ر ز ی ن Mg 2 Ca 2 و Mn 2 Ca 2 Mg 2 کاتیونهای و NaCl ت ظ ل غ ph ی ا ه ر ا م ی ت ر ث ا د ش ش ر ب ر د ی م ی ز ن آ ی ا ه ی س ر ر ب ت س ا ی و ق ل ح DNA ل و ک ل و م ه ن ا گ ی ش ر ب ه ب ر د ا ق S pasteuri ی ر ت ک ا ب ز ا حاصل DNase م ی ز ن آ ت ف ر گ ن ی ا pet21a () د ی م س ال پ ش ر ب ش ی ا م ز آ ر د ه ک ی ر و ط ه ب د ن ک ی م ل م ع ی ص ا ص ت خ ا ت ر و ص ب م ی ز ن آ ن ی ا ه ک د ا د ن ا ش ن حلقوی DNA ه ب ط و ب ر م ش ر ا ز گ ن ی ل و ا ن ی ا د ر ا د ن ا ر ه ت ش ر و د DNA ل و ک ل و م ش ر ب ی ی ا ن ا و ت DNase م ی ز ن آ ن ی ا د ا د ش ر ب ا ر ه ط ق ن ک ی ا ه ن ت م ی ز ن آ ر و ض ح ر د و ph 5/5 ر ال و م 0/6 ت ظ ل غ ا ب NaCl ر و ض ح ر د م ی ز ن آ ت ی ل ا ع ف ن ی ر ت ش ی ب ت س ا S pasteuri ی ر ت ک ا ب در DNase ی ا ه م ی ز ن آ د ش ه د ه ا ش م 1 mm ت ظ ل غ ا ب Mg 2 Ca 2 ی ا ه ن و ی ت ا ک ن ا م ز م ه 16S rrna DNase ت ی ل ا ع ف Staphylococcus pasteuri ی ر ت ک ا ب : ی د ی ل ک ت ا م ل ک : ن ف ل ت ن ا ر ی ا ن ی و ز ق خ ی ش ه د ن ا ی ز ر ب ل ا ن ی م ا : ل و ئ س م ه د ن س ی و ن ن ی و ز ق ) ه ر ( ی ن ی م خ م ا م ا ی ل ل م ل ا ن ی ب ه ا گ ش ن ا د ی ز ر و ا ش ک ی ژ و ل و ن ک ت و ی ب ه و ر گ : س ر د آ : ک ی ن و ر ت ک ل ا ت س پ

2 9 2 ی پ ا ی پ م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ر ک ی م ه ی ر ش ن ه م د ق م ل ا س ر ر ر ر ر ر د ن ا ر ا ک م ه و و و و و و و ی ن س چ ا ر Staphylococcus pasteuri س ن ج د ن د ر ک شناسایی Staphylococcus 2 ی ا ر ا د س و ک و ک و ل ی ف ا ت س ا ت ف ه ز ا ه 3 ن و گ ه 9 ن و گ سلولللهای است ه ه ه ه ه ه ی و س ن ی ا ت ب ث م گرم کوکسی غیرمتحرک ا ز ر و پ س ا ر ی غ ی ر ت ک ا ب ο C ی ا ه ا م د ر د ی ی ا ت ر ا ه چ و جفت فرد ت ر و ص ب ز ا د ی س ک ا ت ب ث م ز آ ه ه ه ر و ا و ز ا ل ا ت ا ک د ن ک ی م د ش ر ه ج ر د و ز ر ا ک ا س ز ک و و و و و و و و ل گ ی ا ه د ن ق ف ر ص م ر د و ت س ا ی ی ف ن م ) )8 د ن ک ی م د ی ل و ت د ی س ا ز و ت ک و ر ف ن ی ل و ا ) DNase( ( ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ی ا ه م ی ز ن آ ی ی ا ی م ی ش و ی ب ت ر و ص ب ل ا س ر د د ر و م ی س ر ر ب ر ا ر ق ر ا ب ت ی م ه ا ز ا ی ص ا ص ت خ ا ز ا ئ ل ک و ن و د ن ا ای ه زیم ن آ ) )3 د ن ت ف ر گ ن و ن ک ا ت و ند ت س ه ر ا د ر و خ ر ب DNA گ ن ی ن و ل ک ر د ی ا ه ژ ی و ت ف ا ی ز ی ا م ت م ی ش ر ب ی ل ا و ت د و د ح ه د ش ه ع ل ا ط م و ج و ت ر ذ گیاهان در ا ه ز ا ئ ل ک و ن ت س ا ) 4 3 ( ( ( ( ) 9 2 و 0 1 ( د د ن ا ه ه د ش ا د ج ت ر ذ ع ع ا و ن ا ی خ ر ب ی ا ه ه ش ی ر ز ا II ز ا ئ ل ک و ن و ب ی ر ز ا ئ ل ک و ن ن ی ا گردید خالص نسبی ر و ط ه ب و ا ت 5/4 7/0 د ا د نشان فعالیت ی ل و ک ل و م ن ز و ا ب ت ر ذ ه ش ی ر ت ن ج و م ه م ی ز ن آ ن ی ا د م آ ت س د ب ر د ز ا ر گ ی د م ی ز ن آ ک ی ت ی ل ا ع ف 6/2 ph ه ن ی ه ب ph ر د ر ا ز ه 1 3 ن و ت ل ا د ن ا ش ن ه ن ی ه ب د و ب DNA و RNA ی اا ا ههههههه ته ش ر ز ی ل و ر د ی ه ه ب ر د ا ق و د ا د د ی س ا ک ی ل ر ب ی ژ ا ب و ج ه د ش ف ص ن ر ذ ب ن د ر ک ه ب و ک ن ا ) 0 1 ( ت ف ا ب ر د ا ر ا ه ز ا ئ ل ک و ن و ب ی ر ی س ک ا د و ز ا ئ ل ک و ن و ب ی ر ت ی ل ا ع ف ی ا م د ر د ا ه ش ن ک ا و ن ی ا د ا د ش ی ا ز ف ا ن ر و ل آ ه ج ر د 5 5 د ح ه ب 6 ph ی اک ر و خ چ ار ق ) 9 2 ( ( ( ( )) ( ( ( ( ( د ی س ر د و خ ه ن ی به ز ی ن Lentinus edodes ش ر ب ا ب ا ه م ی ز ن آ ن ی ا د ن ک می و ن و م ن ی ن ا و گ ز ا ئ ل ک و ن و د ه ت ش ر د ی ل و ت ) 5GMP( ( ( ( ت ا ف س ف Le1 ک ی DNA د ی ل و ت Le3 و ی ا ه ت ن ا و ) 8 1 ( د د ن ن ک ممی م Rhizoctonia stolonifer چ ر ا ق ر د ی ر گ ی د ی ا ه ز ا ئ ل ک و ن ی ا ه ن ن و ی ر ی ثث ث أ ت ت ح ت ه ک ت س ا شده بررسی ی ز ل ف ر ا ر ق ز ا آنزیم این د ر ی گ می ت س ا ل و ل س ن و ر ب ع و ن ک ی شدهانددد بررسی ز ی ن حشرات در ا ه ز ا ئ ل ک و ن ی ز ا ئ ل ک و ن ا ب ) 2 3 ( ( ( ( (( ( ( ه ن ی ه ب ph ت ی ل ا ع ف ه ه ه ه ر ش ح لاور محتوای ر د 0 1 5/ شد شناسایی ه ج ر د 5 5 ی ا م د ر د Spodoptera litura ع و ن ت DNase ی ا ه م ی ز ن آ )2( ممممممی م م م م م ن ا ش ن ی ی ا ل ا ب ر ا ی س ب ی ر ت ک ا ب ز ا ه د م آ ت س د ب DNase م ی ز ن آ ل ا ث م ی ا ر ب د ن ه د ر ی ا س ز ا Micrococcus pyogenes ی ا ر ب م ی ز ن آ ن ی ا ت س ا ت و ا ف ت م ا ا ا DNaseه ن و ی به فعالیت ر ا ی س ب Ca 2 و ال ا ب ی ا ه ا م د ه ب ی ا ه ظ ح ال م ل ب ا ق ر و ط ب و د ر ا د ز ا ی ن ph 8/6 ت س ا ت م و ا ق م ن ژ ک ی ا ه ن ت ن و ن ک ا ت ) )9 ( ی ر ت ک ا ب ر د و ه د ش ی س ر ر ب S aureus ه ن و گ ) 3 2 ( ت س ا ه د ش ن و ل ک ر د ز ا ئ ل ک و ن E coli ن ژ شدهترین حفاظت ریبوزومی RNA ه ب ط و ب ر م ن ژ ی ی ی ب ا ی ی ی ی ل ا و ت rrna ن ژ ) 6 3 ( ( ( ( ( ( ( ت س ا ل و ل س ر ه ن و ر د مختلف موجودات ز ا شده نوکلئوتیدی ن ی ا د ن ه د می ن ا ش ن شباهت توجهی ه ک بدست توالللیهای م ه ا ب د ن ن ا و ت می ه د آم ت ر و ص ه ب و ه د ش ه س ی ا ق م ک ی ن ژ و ل ی ف ی م و ن و س ک ا ت ن ی ی ع ت ی ا ر ب ی ل ا و ت ن ی ا ر ب ا بن د و ش ه اد ف ت س ا ا ه اکتررری ب ل م ا ک ت ط ب ا و ر د ن ا و ت می و ه ب ل ب ا ق ر ر ر و ط ت س ا ی ن ع م ن ی ا ه ب ف ل ت خ م موجوددددددددددات از ی ا ههههههه ه ه هه ه ه د ر ت س گ ن ی ب ع و ن ت ن ی م خ ت 16S rrna ن ا ش ن ا ر اا ا مممممه م سم ی ن ا گ ر ا و ر ک ی م ن ی ب ی ک ش ز پ و ی ط ی ح م ی ر ت ک ا ب ر ا ز ه 16S rrna ی ل ا و ت د ه د ی ژ و ی ب ت ا نن ع ال ط ا ی نن ل م ز نن ک ر م م م ت ی ا س ر د NCBI ( ت س ا د و ج و م ) 6 3 ( د ر ا د ل و ط د ی ت و ئ ل ک و ن ر ظ ن د ر و م ی ل ا و ت ضر ا ح ق ی ق ح ت ف د ه ت ی ل ا ع ف ی س ر ر ب ی س اک د ی ز ک ا خ ی ر ت ک ا ب ) DNase( ( ( ( ( ( ( ی ز ا ئ ل ک و ن و ب ی ر ن ی ل و ا ن ی ا ت س ا Staphylococcus pasteuri ش ر ا ز گ ه ن و گ ن ی ا ر د ریییییییبونوکلئازی داکسی ت ی ل ا ع ف د ور م ر د ت س ا ی ر ت ک ا ب

3 ت) رک ش ی) و ا ح تمام) شامل ی) و ا ح ت) ک ر ش ی ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ت ی ل ا ع ف ی س ر ر ب ا ه ش و ر و د ا و م ی ر ت ک ا ب ی ز ا س ا د ج و ک ا خ ه ن و م ن ی ر و آ ع م ج 1 ی ا ه ه ن و م ن سطحی 0 خاک گرمی سازی رقیق ش و ر ا ب شد برداشته ی ر ت م 1 ق م ع ا ت در سریالی ی 0 ت ن ا س ب آ ر و ظ ن م ه ب ه ک د م آ ت س د ب ن و ی ل ی م ر د ک ی ت ظ ل غ ل ی ر ت س ا ی تر ک ا ب ت ش ک ل و ل ح م ت س ا ب س ا ن م ت ش ک ط ی ح م ی و ر ر ب ک ی ن ی ا ز ا ر رر ر ر ر ر ر رر ر ر ر ر ر یت ل ی ل می Luria ( ( ( آگار LB ) Bertani Broth, Miller, HIMEDIA, M1245 ت د م ه ب ه ج ر د 7 3 ی ا م د ر د و ت ش ک ه ب و ک ن ا هفته یک ف ل ت خ م ی اا ا ییییییییه ی ی ی یی ن و ل ک ه ت ف ه ک ی ت ش ذ گ ز ا د ع ب د ش صفات نظر ز ا ه د م آ ت س د ب ی ک ی ژ و ل و ف ر و م ت س ت د ن ن ا م گرممم باکتریییییهااای شدند بررسی ی ر ت ک ا ب ل ک ش و م ر گ ه ب )Staphylococcus اال ن م ت ح ا ( ل ک ن ش ی و ر ن ک و ت ن ب ث م ا ت ر ث ک ا د ح ص و ل خ ه ب ن د ی س ر ر و ظ ن م ) 1 ل و د ج ( د ن د ش ت ش ک ا و ه ب ا ش م ج ا ر خ ت س ا ل س ن 4 ش ن ک ا و م ا ج ن ا و DNA 16S rrna ه ع ط ق ر ی ث ک ت ر د ط ی ا ر ش ی را ب PCR ن م و ی ن ش و ر ز ا اا ا یه ر ت ک ا ب ز ا DNA ج ا ر خ ت س ا ی ا ر ب ک ی ر و ظ ظ ن م ن ی ا ی ا ر ب ) 8 2 ( شد استفاده ن ا ر ا ک م ه ی ل ی م و و د ی ا ر ب g ر د ی ی ا ی ر ت ک ا ب سلول سوسپانسیون از ر ت ی ل ا ب ا ه ل و ل س ی و ر ع ی ا م ف ذ ح ز ا د ع ب د ش ژ و ی ف ی ر ت ن ا س ه ق ی ق د mm NaCl 001 mm( STE ر ف ا ب ر ت ی ل و ر ک ی م ه ت س ش ر ا ب و د ) ph:8 و EDTA 1 mm و Tris/HCl01 د ن د ش ب و س ر و د ت د م ه ب g ر د ا اا له ل ل ل ل ل و ل س س پ س ه د ا د ذف ح رویی مایع د ن د ش ر ف با ر ت ی ل و ر ک ی م ر د ا اا ا ا به ب ب ب و س ر د ی د ر گ و ه ق ی ق د 0 1 mm( TE ph:8 و EDTA 1 mm Tris/HCl 0 5 ه ش ی ش ه ل و ل گ گرم میلی ه ز ا د ن ا ا ب ی ا و د ش ه ف ا ض ا ا ه ب و س ر ه ب ر ت م و ر ک ی م ا ب ه د ش ع ا ب ش ا ( سپس شدند حل ل ن ف ر ت ی ل و ر ک ی م ن ی ا ت ی ا ه ن ر د و د ش ه اف ض ا TrisHCl ه ل ح ر م ن ی ا ز ا د ع ب شد ورتکس ه ی ن ا ث 0 6 ت د م ه ب ل و ل ح م ی ا ر ب g ر د اا ا هه ن و م ن ت د م ی ا م د ر د ه ق ی ق د 5 ی ی و ر ع ی ا م ز ا ر ت ی ل و ر ک ی م و شدند سانتریفیوژ درجه ر ا د ق م د ن د ش ل ق ت ن م جدید میکروتیوب ه ب 4 ر ت ی ل و ر ک ی م 0 4 ه د ن ا س ر ر ت ی ل و ر ک ی م ه ب م ج ح و ه ف ا ض ا ن آ ه ب TE ر ف ا ب ر ا د ق م د ش ه ف ا ض ا ل و ل ح م ه ب م ر ف و ر ل ک ر ر ت ی ل و ر ک ی م ت د م ه ب g ر د ل و ل ح م س پ س و ه د ش ر د ه ق ی ق د 5 ع ی ا م ز ا ر ت ی ل و ر ک ی م د ن د ش ژ و ی ف ی ر ت ن ا س ه ج ر د 4 ی ا م د ص ل ا خ DNA ن ا و ن ع ب ی ی و ر گردید جدا و ر د ی ا م د ی د ع ب آزمایشششششششهااای برای ه ج ر د 0 2 ت ی م ک و ص و ل خ A 260 A/ 280 سنجی طیف د ش ا ب ا ب د ش ی ر ا د ه گ ن ن ی ی ع ت DNA و 27F ) 8 3 ( ( ( ( ( ( ( ( ( ی ن ا ه ج ی ا ه ر گ ز ا غ آ ز ا ه د ا ف ت س ا 5AGAGTTTGATCATGGCTCAG3 27F( 1525R )5AAGGAGGTGATCCAACC3 1525R و 16S هههههه ه ه عه ط ق تکثیر برای ) ی ب و ن ج ه ر ک ر و ش ک Bioneer rrna ط ی ا ر ش ش ن ک ا و ق ب ا ط م PCR ت د م ه ب ه ج ر د 4 9 ه ی ل و ا سازی واسرشته ی ا م د د ش ن ی ی ع ت ر ی ز ت د م ه ب و ه ج ر د 49 چرخهها سازی واسرشته ی ا م د ت د م ه ب و ه ج ر د 4 5 ل ا ص ت ا ی ا م د ه ی ن ا ث ه ق ی ق د ی ا م د ه ی ن ا ث ی ی ا ه ن ر ی ث ک ت ی ا م د و ه ی ن ا ث 0 9 ت د م ه ب ه ج ر د 27 تکثیر 5 3 ش ن ک ا و چرخههای تعداد ه ق ی ق د 0 1 ت د م ه ب و ه ج ر د : ت ف ر ر ا ک ب ر ی ز د ا و م ش ن ک ا و ب و ی ت ر ه ر د د و ب 0 5 ng 0 2 pmol ت ف ر ر گ گ گ گ ز ا غ آ 0 2 pmol و گ ل ا DNA ر گ ز ا غ آ ت ش گ ر ب ت ی ک مستر میکرولیتر 7 و ه ز ی ن و ی د ب آ ر ت ی ل و ر ک ی م 0 1 KCl 0 5 mm PCR % 1 MgCl 2 2 mm ph 9 ا ب TrisHCl 0 1 mm ن و ت ی ر ت ) v/v( ل ر ت ن ک ) و گ ل ا ر ه ز ا ل و م و ر ک ی م X 0 1 ی گ ود ل آ عدم تایید ی ا ر ب ) ن ا ر ی ا ن اژ ن ی س ل ر ت ن ک و ز ا ر ی غ ه ب ش ن ک ا و ت ا ب ی ک ر ت م ا م ت ) dntp DNA ت ا ب ی ک ر ت ز ا ر ی غ ه ب س پ د ش م ا ج ن ا ش ن ک ا و ی ر س ر ه ر د ) ا ه ر گ ز ا غ آ ر ی ث ک ت ز ا

4 ت) خ ا س باز 0 جفت و) 9 2 ی پ ا ی پ م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ر ک ی م ه ی ر ش ن ی ز ا س ص ل ا خ و ب س ا ن م م ج ح ر د ر ظ ن د ر و م ه ع ط ق ل و ص ح م ص ل ا خ ت ی ک ز ا ه د ا ف ت س ا ا ب PCR Accuprep شرکت به ی ب ا ی د و د ح آمده بدست ت ک ر ش ت س ی ز و و و پ ا ک ت ی ز ا س توالی برای ) Bioneer ل و ص ح م شدند ارسسسسسال ت اش د ل و ط ه د ا د ه ا گ ی ا پ ز ا ه د ا ف ت س ا ا ب شده خوانده توالیهای ی س ر ر ب د ر و م د ی د ر گ ص خ ش م ت س ت ک ی ژ و ل و ی ز ی ف س ن ج و گرفته قرار ه ن و گ و NCBI اا ا ییییییییه ییی ی ری ت ک ا ب و ک ی ژ و ل و ف ر و م ی ا اا ا ا ته تت ت ت ت ت ت ت ت تت ت س ت م گر ز ال ا نن ت ا ک ی ر ت ک ا ات ک ی تر ک ا ب ل شک ی ا ر ب کشت محیط ر د ک م ن د ص ر د ل م ح ت ) 1 ل و د ج ( د ش م ا ج ن ا ن ی ئ ت و ر پ ج ا ر خ ت س ا د ی ی ا تت ت ی ی ا ه ن ی ر د ا ه ب ش و ر ز ا ا ه باکتری ز ا ن ی ئ ت و ر پ ج ا ر خ ت س ا ی ا ر ب استخراج برای ) 4( ( ( ( ( د ش ه د ا ف ت س ا : د ش ل م ع ر ی ز ل ح ا ر م ق ب ط ا ه ری ت ک ا ب ا د ت ب ا کشت محیط ( ر ر ر ا گ آ LB ن ی ئ ت و ر پ ز ا Luria Bertani ل ی ر ت س ا ) Broth, Miller, HIMEDIA, M1245 ه ی ه ت ی ا م د ا ب ر ر ز ی ر ف ر د شده ذخیره ک ت س ا ز ا ا ه ری ت ک ا ب د ش 0 8 ی و ر 2 ت د م ه ب ی ک ی ر ا ت و ه د ش ت ش ک ا اا نه آ ت 4 ع ا س ر د ی ا م د و ه ج ر د 7 3 ی ر ت ک ا ب ز ا س پ س د ش ه ب و ک ن ا ل ی ر ت س ا پ و ل ز ا ه د ا ف ت س ا ا ب کلون تک ک ی ه ت ف ا ی د ش ر کشت مایع LB ط ی ح م ر د و ه ت ش ا د ر ب د ش ت د م ه ب ی ک ی ر ا ت ه ج ر د 7 3 ی ا م د ا ب شیکر انکوباتور ر د ت ع ا س سپس شد انکوبه rpm ر و د ا ب ر ک ی ش ی ر ت اک ب ی ا م د د ش ر ه ت ف یا ر و د و ه ج ر د 4 ژ و ی ف ی ر ت ن ا س و ر ک ی م ز ا ه اد ف ت س ا ا ب 4 2 ی ل ی م 0 1 ای ر ب rpm با ت ل پ و د ش ه ت خ ی ر ر و د ی ی و ر ع ی ا م د ش ه د ا د ب و س ر ر ت ی ل ه ق ی ق د 2 ه ی ه ت و 50 mm TrisHCl( ی و ا ح TE ر ف ا ب ر ت ی ل ی ل ی م 1 ر د ه د ش م ا د ک ر ه 52 mm NaEDTA و ز ا ه اد ف ت س ا ا ب ) ph 8 ی ر ت ک ا ب ب و س ر ی ا ر ب ا د د ج م گردید حل شدید ورتکس ژ و ی ف ی ر ت ان س ه ق ی ق د ی ر ت ک ا ب ی ا دم ا ب 1 ی ا ر ب rpm و ه ج ر د 4 پلت شد ریخته ر و د رویی مایع د ش م ا ج ن ا ر د ل ص ا ح ر ت ی ل ی ل ی م 1 کی م ن ت ا ف فس ر ف با اا ا ب ژ ژ و ی ف ی ر ت ن ا س ا د د ج م د ش ل ح د ی د ش س ک ت ر و ا ب )PBS( د د د ش م ا ج ن ا ه ق ی ق د 1 ی ا ر ب rpm و ه ج ر د 4 ی ا م د ی ل ی م 0 1 ر د ل ص ا ح ی ا ه ت ل پ د ش ه ت خ ی ر ر و د ی ی و ر ع ی ا م ت د م ه ب و ه د ش ل ح سرد خالص استون ر ت ی ل ه ی ن ا ث ی ی ا م د اا ا ب سانتریفیوژ سپس شد انجام شدید ورتکس ع ای م د د ش م م م ا ج ن ا ه ق ی ق د 3 ی ی ی را ب rpm و ه ه ج ر د ض ر ع م ر د ا ه ت ل پ و د ش ه ت خ ی ر ر و د ی م ا ر آ ه ب ی ی و ر % 1 SDS ل و ل ح م ر ت ی ل ی ل ی م 1 شدند خشک ا و ه ل و ل ح م ا ی ه ف ا ض ا خشک باکتریایی ت ل پ ه ب ) mm ر ف ا ب ت ا ف س ف د ش ول ل ح م ا دد ج م س ک ت ر و ت مد ه ب د ی شد به ت د م و ه د ش م ا ج ن ا ه ی ن ا ث 0 2 ر د ه ق ی ق د 2 د ش ه ر خی ذ ق ا ت ا ی ا م د rpm و ه ه ج ر د 4 ی ی ی ا م د ا اا ب ژ ژ ژ ژ ژ و ی ف ی تر ن ا س ی ی و ر ع ی ا م د ش م ا ج ن ا ه ق ی ق د 5 ی ا ر ب ن ی ئ ت و ر پ ن ا و ن ع ه ب شد منتقل جدید استریل ب و ی ت ه ب ت ق د ا ب شده استخراج م ج ح 1/3 ن د و ز ف ا ( % 0 5 ل و ر س ی ل گ ک ت س ا ز ا ه د ا ف ت س ا ا ب و ن ی ئ ت و ر پ ک ت س ا ) ن ی ئ ت و ر پ ه ب گلیسرول استک ز ا 2 1 5/ ل% رو س ی ل گ د ن د ش ل ق ت ن م 20 ر ز ی ر ف به ی ز ا س ه ر ی خ ذ ت جه و شد ه ی ه ت ن ی ئ ت و ر پ ت ی ف ی ک و ت ی م ک ن ی ی ع ت ی ا ه ن ی ئ ت و ر پ ت ظ ل غ ی س ر ر ب صورت بردفورد ت خ ا س UV ش و ر با شده استخراج ی و ا ح ر ت م و ت و ف و ر ت ک پ س ا ه ا گ ت س د ) )7 ( ( ( ت ف ر گ 595 nm جذبببب در Labomed شرکتتتتتتت ن ا و ن ع ه ب ج ا ر خ ت س ا ر ف ا ب 0 2 µl ی و ا ح ه ن و م ن ز ا د ش م ا ج ن ا ه د ا ف ت س ا ا ب د ر ا د ن ا ت س ا ر ا د و م ن م س ر د ش ه د ا ف ت س ا صفر نمونه Sigma ت ک ر ش ( گاوی آلبومین سرم مختلف ر ی د ا ق م ز ا د ش م ا ج ن ا ) ن ا م ل آ Aldrich

5 و) د ل) و ل ح م ی ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ت ی ل ا ع ف ی س ر ر ب ه ل ی س س س و ه ب ه د ش ج ا ر خ ت س ا ی ا ه ن ی ئ ت و ر پ ت ی ف ی ک ی س ر ر ب ل ی ر ک آ ی ل پ ل ژ ی و ر ی د و م ع ز ر و ف و ر ت ک ل ا ت ا ف ل و س ل ی س د و د م ی د س ی س ک ا د زیم ز ز ن آ ی س ر ر ب ز ر ا گ آ ی ا ر ج ا ق ب ط ش ی ا م ز آ ن ی ا )SDSPAGE( د ی م آ ی و ا ح 02( ( د ش م ا ج ن ا ل ژ ی و و و ر ز ا ئ ل ک و ن و ب ی ر دادهتوسط شرح روش ن ی ا ر د ) 6 1 ( ( ( د ش م ا ج ن ا ن ا ر ا ک م ه و ن ی و ک ن و د ب شده استخراج ن ی ئ ت و ر پ ز ا ر ف ا ب SDS mm ی ا ج ه ب ر د SDS ل ا ع ف ر ی غ ث ع ا ب SDS ا ر ی ز شد استفاده د د ر گ ممی م ر د ش ی ا م ز آ ن ی ا ب ا ی غ و ر و ض ح ر د pet21a () دو کاتتتیونهای ی ت ی ف ر ظ ش و ر ت ا ف س ف ) ج ج ج ج ج ا ر خ ت س ا ه ل ح ر م ن د ش ا ه م ی ز ز ز ن آ د ی مس ا ل پ و ی ط خ DNA ر ال و ن ن م ی ی ی ل ی م 1 Mn 2 Ca 2 ا ه م ی ز ز ن آ کوفاکتورهااای تا د ن د ش سری پالسمیدهای م ض ه Mg 2 و ) 9 3 ( ( ( ( گردند معرفی ع ق ا و ر د pet21a () ی ا ه ی ی ل ا و ت ن ا ی ب ی ال ا ب ح ط س و گ ن ی ن و ل ک طراحی هیستیدییییییییینی ی ل پ ه ل ا ب ن د ه ب ه د ش مع ج ت ل مح یک دارای پالسمید د ی م س ال پ ن ی ا ه ز ا د ن ا ت س ا ر د ل ی ل د د ر مو ش ی ا م آز ن ی ا ی ش ر ب ه ا گ ی ا ج ی ا ر ا د ت 3 ف ج ی د ی ت پ پ ه د ش ت ه ج ل ص ت م این اند برشی جایگاههههههههههههای و د ه ب و ت س ا ز ا ب 1 ت تت ت ت ت ت ت ت ت تت ت ت ت ف ر گ ار ر ق ه د ا تف س ا انواع برای د ا ی ز ی ش ر ب م ی ز ن آ 2 ش ش ش ر ب ز ا جلوگیری و ن ا س آ کاربرد برای ط س و ت م ه ز ا د ن ا ر د ی ف د ا ص ت ی ا ه ت ا ت س ا ش ن ک ا و ب و ی ت ر ه 0 1 mm م 0 ی د س E یcoli ر ت ک ا ب ی م و ن ژ DNA 0 4 µg ph 4/6 ا ب pet21a() د ی م س ال پ 0 4 µg ا ی و Mn 2 Ca 2 ی اا ا نه ن ن و ی ت ا ک ز ا 1 mm و ی م ی ز ن آ ه ن و م ن 5 µl و ف ل ت خ م ی ا ه ر ا م ی ت ) ) ف ل ت خ م ر ا م ی ت Mg 2 د و ج و ه ب ن ا و ن ع ت ش ا د 7 3 ο C ی ا م د ر د ا ه ب و ی ت د و ب 5 2 µl ش ن ک ا و ی ی ا ه ن م ج ح ه ب ب و ی ت 3 ر ا م ی ت ر ه ی ا ر ب د ن د ش ه ب و ک ن ا ت ع ا س ک ی ی ا ر ب ی س ر ر ب ر ا ر ک ت ن ا و ن ع د ش م ا م ت ا ز ا س پ ر ه ز ا 0 1 µl د ش ی س ر ر ب % 0/8 آگارز ل ژ ز ر و ف و ر ت ک ل ا ه ل ی س و ه ب ه ن و م ن ز ا ه د ا ف ت س ا ا ب ز ا ئ ل ک و ن و ب ی ر داکسی آنزیم ی س ر ر ب ر ت م و ت و ف و ر ت ک پ س ا کوین روش ق ب ط ش ی ا م ز آ و د ق ا ف ن ی ئ ت و ر پ ز ا ز ی ن ش ی ا م ز آ ن ی ا ر د ) 6 1 ( ( ( د ش ل م ا ش و 1 ml ش ن ک ا و حجم شد استفاده م ا ج ن ا ن ا ا ا ر ا ک م ه SDS DNA 0 4 µg ت ا ت س ا م و ی ن و م آ ر د ل و ل ح م ه د ش ه ت ش ر ک ت گاوی تیموس 0 5 mm ی ا ه ن و ی ت ت ت ا ک ت ظ ل غ ا ب Ca 2 Mg 2 و Mg 2 Mn 2 Ca 2 ه ب ph 5/5 ا ب 1 mm EDTA و 1 mm س پ د و ب ی م ی ز ن آ ه ر ا ص ع 0 2 µl ه ف ا ض ا ز ا ن د و م ن ه ف ا ض ا ر د ا ه ب و ی ت و ه د ش م ا ج ن ا شدید ورتکس ی م ی ز ن آ ه ر ا ص ع ر ا م ی ت ر ه د ن د ش ه ب و ک ن ا ه ق ی ق د 0 3 ت د م ه ب 7 3 ο C ی ا م د د و ب ر ا ر ک ت 3 ل م ا ش % 5 د ی س ا ک ی ر ل ک ر پ 1 ml گذاری گرما اتمام ز ا س پ خ ی ی و ر ش ن ک ا و ل و ل ح م ه ب ه ب ه د م آ ت س د ب ل و ل ح م د و ش ف ق و ت م ش ن ک ا و ا ت د ش ه ف ا ض ا ت د م ت ح ت ه ق ی ق د 5 1 g س 0 پ س د ش ژ و ی ف ی ر ت ن ا س ل و ل ح م ز ا ر ت ی ل ی ل ی م ک ی ی و ا ح ر ف ص ه ن و م ن شد بررسی ر ت م و ن ا ن ج و م ل و ط ر د ی م ی ز ن آ ه ر ا ص ع ز ج ب د ا و م م ا م ت د و ب ه ک ق ب ط کرد طی ش ی ا م ز آ ی ا ه ه ن و م ن د ن ن ا م م ا م ت ل ح ا ر م ا ر کوین نتایج و ب ذ ذ ذ ج ر د ه ق ی ق د ر ب 0/1 0 0 ف ال ت خ ا ر ه ) 6 1 ( ن ا ر ا ک م ه ت س ا ن ی ئ ت و ر پ ت ظ ل غ ر ب م ی ز ن آ د ح ا و ک ی ل د ا ع م )min((( ن ا م ز / ) mg/ml( ( ( ( ( ( ( ی م ی ز ن آ عصاره غلظت ی م ی ز ن آ د ح ا و ) U/ml( Δ0= 6 2 / ر ت م و ت و ف و ر ت ک پ س ا ز ا ه د ا ف ت س ا ا ب ی م ی ز ن آ ی ا ه ی س ر ر ب ی ا ر ب ب ل ا ق ز ا ا ه ش ی ا م ز آ م ا م ت ر د ح ر ط ا ب صتادفی کاملا ر ا ز ف ا م ر ن ز ا ه د ا ف ت س ا ا ب ا ه ه د ا د ل ی ل ح ت د ش ه د ا ف ت س ا ر ا ر ک ت ر ا ز ف ا م ر ن ز ا ه د ا ف ت س ا ا ب اا ا رره ر ا د و م ن م س ر و SAS ل ی ل ح ت ر د د ش ام ج ن ا ب ی ر ض ز ا ج ی ا ت ن تمام واریانس 3 Excel د ش ه د ا ف ت س ا % 99 اطمینان

6 8 4 1 ن ش ر ی ه م ی ک ر و ب ی و ل و ژ ی د ا م پ ز ش ک ی / د و ر ه د ه م ش م ا ر ه د و م پ ی ا پ ی 9 2 ج د و ل : 1 م ق ا ی س ه پ ا س خ ه ا ی ب ا ک ت ر ی Staphylococcus pasteuri ش ن ا س ا ی ی ش د ه د ر آ ز م ا ی ش ب ا 7 ا س ت ر ی ن ا ز ا ی ن ب ا ک ت ر ی )8 ) ت س ت ب ا ک ت ر ی ا و ر ه آ ز ر ش د ب ی ه و ا ز ی ق ط ر ک ل و ن ی > mm 5 * ر ن گ ی ز ه م ا ل ت و ز م ا ن ی ت و ل ا ک س ی د ا ز S pasteuri 7 S pasteuri BM S pasteuri BM S pasteuri BM S pateuri BM S pasteuri BM S pasteuri BM BM10427 ن ت ا ی ج ب ا ک ت ر ی S pasteuri ش ن ا س ا ی ی ش د ه * ب ه م ع ن ا ی pigment ب ا ک ت ر ی : ن ت ی ج ه م ن ف ی : ن ت ی ج ه م ث ب ت DNase ر و ی DNA خ ط ی د ر ش ک ل 3 د ی د ه م ی ی ی ش و د ن ت ا ی ج ش ن ا س ا ی ی ب ا ک ت ر ی ب ا ن د ت ک ث ی ر ش د ه ا ز ژ ن 16S rrna ب ه ص و ر ت و ا ض ح ب د س ت آ م د ه و ا ن د ا ز ه آ ن ه ا ب ا اندازه مورد انتظار یعنی ج ف ت ب ا ز م ط ا ب ق ت د ا ش ت ( ش ک ل ) 1 پ س ی ا ب ی ق ط ع ا ت ت ک ث ی ر ی ت و ا ل ی ی ی ی ی ی ی ی ی ی یییه ا ا ا د ر NCBI/EMBL م ور د ب ر ر س ی و ه م ر د ی ف ش د ند د ر ج ن س ن ه ا ی ت Staphylococcus و گ و ن ه ا ز ت و ا ل ی پ ا ی گ ا ه د ا د ه pasteuri ع ن و ا ن ن ز د ی ک ت ر ی ن باکتری طبق ن ت ا ی ج ه م ر د ی ف ی ت و ا ل ی 16S rrna ب د س ت آ م د ب ا ک ت ر ی گ ر م م ث ب ت ک و ک س ی ب ه شکل کاتاالز م ث ب ت و ا ک س ی د ا ز م ن ف ی ب و د و ت ا 5 1 د ر ص د ن م ک ر ا ت ح م ل ( ج د و ل ن م و د ) 1 ی ک ش ا خ ص م ه م درStaphylococcus ت ح م ل 5 1 د ر ص د ن م ک د ر م ح ی ط ک ش ت ا س ت )8 ) ژ ن 16S rrna ب ا ک ت ر ی د ر پ ا ی گ ا ه NCBI/EMBL ب ا ش م ا ر ه گ ر د ی د نتایج بررسی آ گ ا ر ز پ ر و ت ئ ی ن ه ا ی ا س ت خ ر ا ج ی آ ن ز ی م م مم م م مم ه ا ی ب ا ک ت ر ی S pasteuri KC ث ب ت DNase ر و ی ژ ل S pasteuri ر و ی ژ ل 2 1 SDSPAGE کیفیت خوبی% غ ل ظ ت پ ر و ت ئ ی ن ب د س ت آ م د ه ط ب ق ن ت ا ی ج ن ش ا ن د ا د ( ش ک ل ا س پ ک ر و ف و ت و م ت ر ) / 1 µg/ml ب و د ن ت ا ی ج ب ر ر س ی ف ع ا ل ی ت آ ن ز ی م م م م م ه ا ی ه م ا ن ط و ر د ر ش ک ل د ی د ه م ی ش و د ه ی چ گ و ن ه ب ر ش ی د ر م و ل ک و ل DNA د و ر ش ت ه ا ی ج ا د ن ش د ه ا س ت ب ر ر س ی ه ض م DNA پ ال س م ی د ی ب ا ا س ت ف ا د ه ا ز پ ل سا م ی د pet21a () انجام شد ب ر ر س ی ه ا ی ه ض م آ ن ز ی م ی پ ال س م ی د د ر ش ک ل 4 د ی د ه م ی ش و د د د ه ض م ی ا ب ر ش پ ل ا س یم د ب ا ت ی م ا ر ه ا ی مختلف کاتیونی ب ر ا ی تعین کوفاکتور ا خ ت ص ا ص ی آ ن ز ی م برشی صورت گرفت ا م ا د ر ن ه ا ی ت ه ی چ ا خ ت ل ا ف ی ب ر ش ب ا کوفاکتورهای مختلف م ش ا ه د ه ن ش د آ ن ز ی م ی ب ا ک ت ر ی S pasteuri ب ا ع ث ا ف ز ا ی ش غ ل ظ ت ر ح ا ل ت ب ر ش ت ک ر ش ت ه ا ز پالسمید شده ک ه ا ی ن ب د ل ی ل و ج و د آنزیم نیکازاست ( ش ک ل ع ص ا ر ه ) 4 د ر ح ض و ر ت م ا م ک ا ت ی و ن ه ا ن ی ز ا ی ن ب ر ش دیده شد ب ا ت و ج ه ب ه ت ع د ا د ب ا ل یا ت ک را ر آ ز م ا ی ش و ن ی ز آ ز مو ن س ه کاتیون مختلف م ی ت و ا ن آ ن ز ی م ه ا ی ب ا ک ت ر ی ی ه ا ی S pasteuri ر ا ا ز ن و ع ن ی ک ا ز د ا ن س ت ن ی ک ا ز ه ا برش دهنده اختصاصی ی ک ک ال س ج د ی د ا ز آ ن ز ی م م ه ا ه س س س ت ن د ک ه ج ا ی گ ا ه ب ر ش ی ر ا ر و ی م و ل ک و ل DNA ت ش خ ی ص م ی د ه ن د و ت ن ه ا ی ک ر ش ت ه ا ز DNA ر ا ب ر ش م ی د ه ن د ا ز ا ی ن د س ت ه ا ز آ ن ز ی م ه ا ت ع د ا د ب س ی ا ر ک م ی ک ش ف ش د ه ا س ت ( 4 ) 2

7 د و) ب ر ر س ی ف ع ا ل ی ت د ا ک س ی ر ی ب و ن و ک ل ئ ا ز ی ش ک ل 1: ب ا ن د م و ر د ا ن ت ظ ا ر ژ ن 6 1 S rrna ب ا ا س ت ف ا د ه ا ز آ غ ا ز گ ر ه ا ی ش ک ل : 4 ه ض م م و ل ک و ل DNA پ ال س م ی د () pet21a ب ا آ ن ز ی م ه ا ی 1 پ ال س م ی د ب د و ن آ ن ز ی م S pasteuri ا ز ب ا ک ت ر ی DNase 2 پ ال س م ی د د ر ح ض و ر ع ص ا ر ه پ ر و ت ئ ی ن ی ب ا ک ت ر ی S pasteuri DNA م ا ر ک ر M A پ ال س م ی د ب ر ش خ و ر د ه ب ا آ ن ز ی م ن ی ک ا ز B پ ال س م ی د ح ل ق ه ب ا ز C پ ال س م ی د خ ط ی ( ب ر ش ی ا ف ت ه ) D پ ال س م ی د س و پ ر ک و ی ل E پ ال س م ی د ح ل ق ه ا ی ت ک ر ش ت ه S pasteuri 1 DNA 1 kb م ا ر ک ر M 1525R و 27F ن ت ا ی ج ح ا ص ل ا ز ا س پ ک ت ر و ف و ت و م ت ر ی ف ع ا ل ی ت آ ن ز ی م DNase ع ص ا ر ه ب ا ک ت ر ی S pasteuri ش ک ل : 2 ع ص ا ر ه پ ر و ت ئ ی ن ی ا س ت خ ر ا ج ش د ه ا ز ب ا ک ت ر ی S pasteuri ر و ی ژ ل M SDSPAGE م ا ر ک ر م و ل ک و ل ی 1 و 2 ا ل گ و ی ب ا ن د ی پ ر و ت ئ ی ن ی ب ا ک ت ر ی S pasteuri ت ک ر ا ر ) در حضور کاتیونهای م ن ی ز ی م ب ص و ر ت م ع ن ی دار کاهش ی ا ف ت د ر ح ض و ر ک ا ت ی و ن ه ا ی ک ل س ی م و م ن گ ن ز ف ع ا ل ی ت آ ن ز ی م ی ت غ ی ی ر م ع ن ی د ا ر ی ن ش ا ن ن د ا د ( ن م و د ا ر ) 1 ب ا ا ع م ا ل ت ی م ا ر 2 Mg 2 Ca د ر غ ل ظ ت 1 mm ف ع ا ل ی ت آ ن ز ی م ت ا چ ه ا ر ب ر ا ب ر ا ف ز ا ی ش ن ش ا ن د ا د غ ل ظ ت ه ا ی م خ ت ل ف ن م ک ف ع ا ل ی ت آ ن ز ی م DNase ا ی ن ب ا ک ت ر ی ر ا ب ط و ر م ع ن ی د ا ر د ر س ط ح % 9 9 ا ف ز ا ی ش د ا د غ ل ظ ت 0/6 م و ال ر ن م ک ب ا ع ث ب ی ش ت ر ی ن ا ف ز ا ی ش د ر ف ع ا ل ی ت آ ن ز ی م DNase ش د ف ع ا ل ی ت ph آ ن ز ی م DNase ب ط و ر م ع ن ی د ا ر ق ر ا ر ن ی ز ت ا ث ی ر ت ح ت 9 7 گ ر ف ت ن ش ا ن ت غ ی ی ر ی و ph ه ا ی د ر آ ن ز ی م ف ع ا ل ی ت ش ک ل : 3 ه ض م م و ل ک و ل DNA خ ط ی ب ا آ ن ز ی م ه ا ی DNase ا ز ب ا ک ت ر ی S 1 م و ل ک و ل DNA د و ر ش ت ه ب د و ن آ ن ز ی م DNA م ا ر ک ر M pasteuri 2 م و ل ک و ل DNA د و ر ش ت ه د ر ح ض و ر ع ص ا ر ه پ ر و ت ئ ی ن ی ب ا ک ت ر ی S pasteuri 3 م و ل ک و ل DNA د و ر ش ت ه د ر ح ض و ر آ ن ز ی م EcoRI ن د ا د د ر ح ا ل ی ک ه د ر ph ه ا ی 3 و 5 ف ع ا ل ی ت آ ن ز ی م DNase ب ا ا ط م ی ن ا ن % 9 9 ک ا ه ش پ ی د ا ک ر د ب ح ث ب ا ک ت ر ی Staphylococcus pasteuri ا ز خ ا ک س ط ح ی ج د ا و خ ا ل ص س ا ز ی ش د ا ی ن ب ا ک ت ر ی ب ا ش م ا ر ه

8 0 5 1 ن ش ر ی ه م ی ک ر و ب ی و ل و ژ ی د ا م پ ز ش ک ی / د و ر ه د ه م ش م ا ر ه د و م پ ی ا پ ی 9 2 NCBI/EMBL د س ت ر س ی KC پ ا ی گ ا ه د ر ب ه آ ن ز ی م ا ی ن د ا د ب ر ش ب ر ش ت و ا ن ا ی ی م و ل ک و ل DNase ث ب ت ر س ی د آ ن ز ی م DNase ب ا ک ت ر ی S pasteuri ق ا د ر ب ه DNA د و ر ش ت ه ر ا ن د ا ر د ا ی ن ا و ل ی ن گ ز ا ر ش م ر ب و ط ب ه ر ش ت ه ب ر ش DNA آ ن ز ی م ا ی ن ا س ت ی گ ا ن ه ج ز ا ح ت م ا ال آ ن ز ی م ه ا ی ب ا ک ت ر ی د ر S pasteuri ا س ت DNase 0/6 آ ن ز ی م ه ا ی ا س ت ن ی ک ا ز ب ر ر س ی ه ا ی ب ر ش د ر آ ن ز ی م ی ب ی ش ت ر ی ن ف ع ا ل ی ت آ ن ز ی م د ر ح ض و ر NaCl ب ا غ ل ظ ت آ ن ز ی م ا ی ن ک ه م ی د ه د ن ش ا ن ح ل ق و ی ب ص و ر ت م و ال ر ز م ا ن ه م ح ض و ر د ر و ک ا ت ی و ن ه ا ی ph 5/5 DNA ا خ ت ص ا ص ی ع م ل م ی ک ن د ب ه ط و ر ی ک ه د ر آ ز م ا ی ش ب ر ش 2 Mg 2 Ca ب ا غ ل ظ ت 1 mm م ش ا ه د ه ش د پ ال س م ی د () pet21a ر ا ن ق ط ه ی ک ت ن ه ا آ ن ز ی م ا ی ن ن م و د ا ر : 1 ن م و د ا ر ه ا ی ن ت ا ی ج ت ی م ا ر ه ا ی م خ ت ل ف NaCl ph و ک ا ت ی و ن ر و ی ع ص ا ر ه آ ن ز ی م ی ب ا ک ت ر ی S pasteuri 5 Bickle, TA, Krüger, DH (1993) Biology of DNA restriction FEMS Microbiology Reviews 57: Bourniquel, AA, Bickle, TA (2002) Complex restriction enzymes: NTPdriven molecular motors Biochimie 84: Bradford, MM (1976) A rapid and sensitive for the quantitation of microgram quantitites of protein utilizing the principle of proteindye binding Analytical Biochemistry 72: Chesneau, O, Morvan, A, Grimont, F, Labischinski, H, El Solh, N (1993) Staphylococcus pasteuri sp nov, isolated from human, animal, and food specimens International Journal of Systematbica Cteriologay 43: م ن ا ب ع 1 Abdurashitov, MA, Belitchenko, OA, Shevchenko, AV, Degtiarev, S (1996) NBstSE a sitespecific nickase from Bacillus stearothermophilus SE589 Journal of Molecular Biology 30: Ahmad, NS, Hadi, SM (1983) Purification and properties of a glycoprotein alkaline nuclease from the larvae of the army worm Spodoptera litura Insect Biochemistry 13: Bernard, EA (1969) Ribonucleases Annual Review of Biochemistry 38: Bhaduri, S, Paul, HD (1983) Simple and rapid method for disruption of bacteria for protein studies Applied and Environmental Microbiology 46: 9413

9 1 5 1 ی ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ت ی ل ا ع ف ی س ر ر ب 19 Kunitz, M (1940) Crystalline ribonuclease The Journal of General Physiology 24: Laemmli, UK, Favre, M (1973) Gel electrophoresis of protein Journal of Molecular Biology 80: Lai, B, Li, Y, Cao, A, Lai, L (2003) Metal ion binding and enzymatic mechanism of Methanococcus jannaschii RNase HII Biochemistry 42: Laskowski, M (1959) Enzymes hydrolyzing DNA Annals of the New York Academy of Sciences 81: Lin, LF, Posfai, J, Roberts, RJ, Kong, H (2001) Comparative genomics of the restrictionmodification systems in Helicobacter pylori Proceedings of the National Academy of Sciences 98: McCleland, SE, Sczcelkun, MD (2004) The type I and III restriction endonucleases: structural elements in molecular motors that process DNA Nucleic Acids and Molecular Biology 14: Morgan, RD, Calvet, C, Demeter, M, Agra, R, Kong, H (2000) Characterization of the specific DNA nicking activity of restriction endonuclease NBstNBI The Journal of Biological Chemistry 381: Murray, NE (2000) Type I restriction systems: sophisticated molecular machines (a legacy of Bertani and Weigle) Microbiology and Molecular Biology Reviews 64: Neumann, B, Pospiech, A, Schairrer, HU (1992) Rapid isolation of genomic DNA from gramnegative bacteria Trends in Genetics 8: Patel, JB (2001) 16S rrna gene sequencing for bacterial pathogen identification in the clinical laboratory Journal of Molecular Diagnostics 6: Pingoud, A, Fuxreiter, M, Pingouda, V, Wende, W (2005) Type II restriction endonucleases: structure and 9 Cunningham, L, Laskowski, M (1953) Presence of two different por desoxyribonucleode polymerases in veal kidney Biochimica et Biophysica Acta 11: Curtis, MW (1968) Plant nucleases I separation and purification of two ribonucleases and one nuclease from corn Plant Physiology 43: Desreux, V, Hacha, R, Fredericq, E (1962) Activation of deoxyribonucleases by divalent cations Journal of General Physiology 45: Feinstein, R N (1960) Activation of the neutral deoxyribonuclease The Journal of Biological Chemistry 235: Goedken, ER, Marqusee, S (2001) Cocrystal of Escherichia coli RNase HI with Mn 2 ions reveals two divalent metals bound in the active site The Journal of Biological Chemistry 276: Higgens, LS, Besnier, C, Kong, H (2001) The nicking endonuclease NBstNBI is closely related to type IIs restriction endonucleases MlyI and PleI Nucleic Acids Research 29: Keck, JL, Goedken, ER, Marqusee, S (1998) Activation/attenuation model for RNase H A onemetal mechanism with secondmetal inhibition The Journal of Biological Chemistry 273: Kevin, PB, Will, F, Baron, W, Henzel, J, Steven, AS (1998) Molecular cloning and characterization of human and murine DNase II Gene 215: Kobayashi, H, Fumi, K, Tadashi, I, Takashi, K, Norio, I (2000) Nuclease Lel 1 and 2 Study Bioscience, Biotechnology, Biochemistry 64: Koerner, JF, Sinsheimer, RL (1957) Deoxyribonuclease from calf spleen I Purification and properties The Journal of Biological Chemistry 228: 1039

10 9 2 ی پ ا ی پ م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ر ک ی م ه ی ر ش ن Xia, YN, Morgan, R, Schildkraut, I, Van Etten, JL (1988) A sitespecific single strand endonuclease activity induced by NYs1 virus infection of a Chlorellalike green alga Nucleic Acids Research 16: Zhang, Y, Nelson, M, Nietfeldt, J, Xia, Y, Burbank, D, Ropp, S, Van Etten, JL (1998) Chlorella virus NY 2A encodes at least 12 DNA endonuclease/methyltransferase genes Virology 240: Zheleznaya, LA, Perevyazova, TA, Zheleznyakova, EN, Matvienko, NI (2002) Some properties of sitespecific nickase bspd6i and the possibility of its use in hybridization analysis of DNA Biochemistry 67: mechanism Cellular and Molecular Life Sciences 62: Raleigh, EA, Brooks, JE (1998) Restriction modification systems: where they are and what they do Bacterial Genomes Rangrajan, S, Shankar, V (1999) Extracellular nuclease from Rhizopus stolonifer purification and characteristics of single strand preferential deoxyribose nuclease activity Biochimica et Biophysica Acta 1473: Roberts, RJ, Belfort, M, Bestor, T, Bhagwat, AS, Bickle, TA, Bitinaite, J et al (2003) A nomenclature for restriction enzymes, DNA methyltransferases, homing endonucleases and their genes Nucleic Acids Research 31: Roberts, RJ, Vincze, T, Posfai, J, Macelis, D (2005) REBASE restriction enzymes and DNA methyltransferases Nucleic Acids Research 33: Shimomura, M, Laskowski, M (1957) Purification of deoxyribonuclease II from spleen Biochimica et Biophysica Acta 26: Torsvik, V, Jostein, G (1990) High Diversity in DNA of Soil Bacteria Applied and Environmental Microbiology 56: Van Etten, JL (2003) Unusual life style of giant chlorella viruses Annual Review of Genetics 37: Virginia, W, Campbell, D, Jackson A (1980) The effect of divalent cations on the mode of action of DNase I Journal of Biologic Chemistry 255: Weisburg, WG, Barns, SM, Pelletier, DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study Journal of Bacteriology 173: Wiberg, JS, (1958) On the mechanism of metal activation of deoxyribonuclease I Archives of Biochemistry and Biophysics 73: 337

11 Journal of Veterinary Microbiology, Volume 10, Issue 2, 2014 A Study on the Staphylococcus pasteuri Deoxyribonuclease Activity AlborzianDehSheikh, A* 1, Hosseini, R 2 1 MSc of Agricultural Biotechnology, Imam Khomeini International University Qazvin, Qazvin, Iran 2 Faculty member of Agricultural Biotechnology, Imam Khomeini International University Qazvin, Qazvin, Iran Received Date:29 August 2013 Accepted Date: 16 November 2013 Abstract: All organisms have nuclease Deoxyribonucleases (DNase) are from enzyme group that are able to hydrolase phosphodiester bounds of DNA molecule bonds Staphylococcus pasteuri identified by 16S rrna marker and biochemical tests, and submitted to GenBank/EMBL with KC accession number The activity of DNase enzyme was detected through three spectrophotometric, detection of DNase activity on circular and double strand DNA molecule on agarose gel methods The effects of ph, NaCl and cations like Mg2, Ca2,Mn2andMg2Ca2 treatments were considered S pasteuri DNase was able to cut single strand of circular DNA S pasteuri DNase was able to cut single strand DNA Studies on circular DNA showed that the enzyme may nick specifically, whereas pet 21a () was restricted to one point The DNase does not cut double strand DNA This is the first report about S pasteuri DNase activity The most important activity of enzyme was observed in the presence of 06 M NaCl, 1mM Mg2Ca2 and ph 55 Keywords: Staphylococcus pasteuri, DNase activity, 16S rrna *Corresponding author: AlborzianDehSheikh, A Address: Imam Khomeini International University Qazvin, Qazvin, Iran Tel:

12

ر ک ش ل ن س ح ن د م ح م ب ن ی ز ن. ل و ئ س م ه د ن س ی و ن ( ی ر ک ش ل &

ر ک ش ل ن س ح ن د م ح م ب ن ی ز ن. ل و ئ س م ه د ن س ی و ن ( ی ر ک ش ل & ن- س ح ی ژ ر ن ا ل ا ق ت ن ا ر د ر ا و ی د ي ر ي گ ت ه ج و د ی ش ر و خ ش ب ا ت ه ی و ا ز و ت ه ج ه ط ب ا ر ل ی ل ح ت ) ر ال ر ه ش ي د ر و م ه ع ل ا ط م ( ي ر ي س م ر گ ي ا ه ر ه ش ر د ن ا م ت خ ا س ل خ

Διαβάστε περισσότερα

ی ا ک ل ا ه م ی ل ح ر

ی ا ک ل ا ه م ی ل ح ر ل- ال ج ه) ن و م ن م د ر م ت ک ر ا ش م د ر ک و ر ا ب ر ه ش ه د و س ر ف ا ه ت ف ا ب ز ا س و ن ) س و ل ا چ ر ه ش 6 ه ل ح م : د ر و م 1 ل م آ م ظ ع ل ال ج ر و ن د ح ا و م ال س ا د ا ز آ ه ا گ ش ن ا د ر ه

Διαβάστε περισσότερα

ی ن ل ض ا ف ب ی ر غ ن ق و ش ه ی ض ر م ی ) ل و ئ س م ه د ن س ی و ن ( ا ی ن ل ض ا ف ب ی ر غ 1-

ی ن ل ض ا ف ب ی ر غ ن ق و ش ه ی ض ر م ی ) ل و ئ س م ه د ن س ی و ن ( ا ی ن ل ض ا ف ب ی ر غ 1- ر د ی ا ه ل ی ب ق ی م و ق ب ص ع ت ای ه ی ر ی گ ت ه ج و ی ل ح م ت ا ح ی ج ر ت ر ی ث أ ت ل ی ل ح ت و ن ی ی ب ت زابل) ن ا ت س ر ه ش ب آ ت ش پ ش خ ب و ی ز ک ر م ش خ ب : ی د ر و م ه ع ل ا ط م ( ن ا ر ا ی ه

Διαβάστε περισσότερα

ه ش ر ا د ی ا پ ت ال ح م د ر ک ی و ر ر ب د ی ک ا ت ا ب ی ر ه ش ت ال ح م ی ر ا د ی ا پ ش ج ن س )

ه ش ر ا د ی ا پ ت ال ح م د ر ک ی و ر ر ب د ی ک ا ت ا ب ی ر ه ش ت ال ح م ی ر ا د ی ا پ ش ج ن س ) ه) د ن س ی و ن د) ر و م ی ش ه و ژ پ ی- م ل ع ه م ا ن ل ص ف ) ی ا ه ق ط ن م ی ز ی ر ه م ا ن ر ب ( ا ی ف ا ر غ ج تابستان ه ر ا م ش م ت ف ه ل ا س - : ص ص ری ه ش ر ا د ی ا پ ت ال ح م د ر ک ی و ر ر ب د ی ک

Διαβάστε περισσότερα

ت خ ی م آ ر ص ا ن ع ز ا ن ا گ د ن ن ک د ی د ز ا ب ی د ن م ت ی ا ض ر ی س ر ر ب د

ت خ ی م آ ر ص ا ن ع ز ا ن ا گ د ن ن ک د ی د ز ا ب ی د ن م ت ی ا ض ر ی س ر ر ب د ه ت خ م آ ر ص ا ع ز ا ا گ د ک د د ز ا ب د م ت ا ض ر س ر ر ب د ال م ج ر ب ر گ ش د ر گ ب ا ر ا ز ا ب خالر امر ا ر ا ا ر ه ت ا ر ه ت ه ا گ ش ا د ت ر د م ه د ک ش ا د ا گ ر ز ا ب ت ر د م ه و ر گ ر ا د ا ت س

Διαβάστε περισσότερα

ل ی ل خ د و و ا د ه ا ر ج ا ه م ز ا ن ه ب 3 د ن ک م ی ل س ی ف ر ش ا د ی ش ر ف : ه د ی ک چ.

ل ی ل خ د و و ا د ه ا ر ج ا ه م ز ا ن ه ب 3 د ن ک م ی ل س ی ف ر ش ا د ی ش ر ف : ه د ی ک چ. شی ز و م آ ت دیری م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و می ال س ا د ا ز آ ه ا گ ش ن ا د 5931 پاییز 3 ه ر ا م ش م ه د ل ا س 5 1 1-12 3 ص ص ی ل ی ل خ د و و ا د ه ب ی ل غ ش ت ی ا ض ر ی ر گ ی ج ن

Διαβάστε περισσότερα

ی ن ا م ز ا س ی ر ت ر ا ت ی و ه ر ی ظ ن ( ن ا ر ظ ن ب ح ا ص و

ی ن ا م ز ا س ی ر ت ر ا ت ی و ه ر ی ظ ن ( ن ا ر ظ ن ب ح ا ص و ف ص ل ن ا م ه ر ه ب ر ی و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م ش م ا ر ه 3 پاییز 3931 ص ص -9 9 7 9 ر ا ب ط ه ب ی ن ر ا ه ب ر د ه ا ی م د ی ر ی ت ت

Διαβάστε περισσότερα

ر ی د م ی د ه م ن ر ی د م ن ا س ح ا ن

ر ی د م ی د ه م ن ر ی د م ن ا س ح ا ن ز ا س م ه ی ر ا م ع م ی ح ا ر ط و ی م ی ل ق ا ش ی ا س آ ی ا ه ص خ ا ش ی س ر ر ب ن ا ج ن ز ر ه ش م ی ل ق ا ا ب ی ر ی د م ی د ه م ن ا ر ی ا ن ا ر ه ت ر ت ش ا ک ل ا م ی ت ع ن ص ه ا گ ش ن ا د ی ر ه ش ی ز ی

Διαβάστε περισσότερα

: ک ی ن و ر ت ک ل ا ت س پ

: ک ی ن و ر ت ک ل ا ت س پ 5 7 0-9 : 5 2 ی پ ا ی پ 1 9 3 1 م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ک ی م ه ی ش ن م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ه د و

Διαβάστε περισσότερα

2

2 م ط ا ل ع ه) ف ص ل ن ا م ه ر ه ب ر ی و م د ر ت آ م و ز ش د ا ن ش گ ا ه آ ز ا د ا س ال م و ا ح د گ ر م س ا ر س ا ل ه ف ت م ش م ا ر ه ب ه ا ر 9 3 ص ص -8 3 7 ح س ن ع ل ب ر ر س ر ا ب ط ه م ا ن ر ه ب ر ت ح

Διαβάστε περισσότερα

م ح ق ق س ا خ ت ه () ک ا ر ش ن ا س- ف ص ل ن ا م ه ر ه ب ر ی و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م. ش م ا ر ه 1 ب ه ا ر 3 9 3 1 ص ص -8 6 1 1 3 4 1

Διαβάστε περισσότερα

Website:http://journals.iau-garmsar.ac.ir

Website:http://journals.iau-garmsar.ac.ir ه ب د ن و ا د خ م ا ن ه د ن ش خ ب ن ا ب ر ه م ف ص ل ن ا م ه ع ل م ی - پ ژ و ه ش ی ر ه ب ر ی و م د ير ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر ب ه ا س ت ن ا د م ص و ب ا ت ک

Διαβάστε περισσότερα

ش ز و م آ ت ی ر ی د م د ش ر ا س ا ن ش ر ا ک. 4

ش ز و م آ ت ی ر ی د م د ش ر ا س ا ن ش ر ا ک. 4 ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3931 تابستان 2 ه ر ا م ش. م ت ش ه ل ا س 9 4-5 6 ص ص ه ل خ ا د م م د ع و ی ل د ا ب ت ن ی ر ف آ ل و

Διαβάστε περισσότερα

ص ا د ق ف ص ل ن ا م ه ر ه ب ر ی و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م. ش م ا ر ه 1 ب ه ا ر 3 9 3 1 ص ص -2 8 5 9 م ق ا ی س ه م ی ز ا ن ک ا ر ب س ت

Διαβάστε περισσότερα

ا د ی بن ت و ی ولا ی ذ ار گ د ف ه ما ن ت

ا د ی بن ت و ی ولا ی ذ ار گ د ف ه ما ن ت ي ش ز و م آ ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا س م ز 4 ه ر ا م ش م ف ه ل ا س 1 4-55 ص ص ه ط س و م ع ط ق م ر خ د ن ا ز و م آ ش ن ا د س ر

Διαβάστε περισσότερα

2 - Robbins 3 - Al Arkoubi 4 - fry

2 - Robbins 3 - Al Arkoubi 4 - fry ف ص ل ن ا م ه ر ه ب ر ی و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م ش م ا ر ه 3 پاییز 3931 ص ص -6 4 1 1 1 2 ح م ی د ب ر ر س ی ر ا ب ط ه ب ی ن ر ه ب ر ی

Διαβάστε περισσότερα

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 م ط ا ل ع ه) پژوهشهای جامعه شناختی سال نهم / شماره سوم / پاییز 49 Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 ر ت ب ه ب ن د ی ع و ا م ل م و ث ر ب ر ا ر ز ی ا ب ی ع م ل ک ر د م د ی ر

Διαβάστε περισσότερα

ر ه ش ت ی ر ی د م ه ب ن ا د ن و ر ه ش د ا م ت ع ا ن ا ز ی م ی ب ا ی ز ر ا )

ر ه ش ت ی ر ی د م ه ب ن ا د ن و ر ه ش د ا م ت ع ا ن ا ز ی م ی ب ا ی ز ر ا ) ه) ن و م ن ی ش ه و ژ پ ی- م ل ع ه م ا ن ل ص ف ی ن ا س ن ا ی ا ی ف ا ر غ ج ر د و ن ی ا ه ش ر گ ن 1396 بهار م و د ه ر ا م ش م ه ن ل ا س ی ر ه ش ت ی ر ی د م ه ب ن ا د ن و ر ه ش د ا م ت ع ا ن ا ز ی م ی ب ا

Διαβάστε περισσότερα

An Investigation into Personal and Organizational Factors Affecting the Creativity of the National Iranian Gas Company Employees

An Investigation into Personal and Organizational Factors Affecting the Creativity of the National Iranian Gas Company Employees Journal of Industrial/Organization Psychology Vol. 3/Issue/Summer 0 PP: -34 ف ص ل ن ا م ه ر و ا ن ش ن ا س ی ص ن ع ت ی / س ا ز م ا ن ی س ا ل س و م. ش م ا ر ه ی ا ز د ه م ت ا ب س ت ا ن 9 3 ص ص : 3-4 ب ر

Διαβάστε περισσότερα

ن ا ب ر ق د ا و ج د م ح م ن

ن ا ب ر ق د ا و ج د م ح م ن ه ک ب ش ت ی ض و و ی ژ و ل و ف م و ئ ژ ا ب ن آ ه ط ب ا و ی ن و ک س م ی ا ه ز ا س و ت خ ا س ه س و ت ل ی ل ح ت ی ل ز ن ا ن ب ه ش ج ن پ ه ی ح ا ن : ی و م ه ل ا ط م ی ه ش ن و ت ا ف ا ص ت و ل ق ن و ل م ح 1 ه

Διαβάστε περισσότερα

م ش د ی ج م ن گ ر ب ه م ط ا ف ن ) ل و ئ س م ه د ن س ی و ن ( ی گ ر ز ب

م ش د ی ج م ن گ ر ب ه م ط ا ف ن ) ل و ئ س م ه د ن س ی و ن ( ی گ ر ز ب ش) خ ب ر 4 ف ن ر ا د ی ا پ ه ع س و ت د ر ک ی و ر ا ب ی ر ه ش ل ق ن لو م ح ی ط ی ح م ت س ی ز ت ا ر ث ا ی ب ا ی ز ر ا ) ر ی ال م ر ه ش ی ز ک ر م س م ش د ی ج م ن ا ر ی ا ر ی ال م ر ی ال م د ح ا و ی م ال س

Διαβάστε περισσότερα

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 م و ر د م ط ا ل ع ه :) پژوهشهای جامعه شناختی سال نهم / شماره سوم / پاییز 49 Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 ب ر ر س ی ر ا ب ط ه ب ن ی ا ن ه ا ی ا خ ال ق ی و خ و د ک ا ر

Διαβάστε περισσότερα

ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3 9 3 1 ر ا ه ب 1 ه ر ا م ش. م ت ش ه ل ا س 5 4-8 5 ص ص EFQM ی ل ا ع ت ل د م س ا س ا ر ب ی ن ا م ز

Διαβάστε περισσότερα

1 2 Marsick & Watkins 3. Saw, Wilday & Harte 4 -Chen & Kuo 5. Liao,Chang & Wu 6 -Garvin

1 2 Marsick & Watkins 3. Saw, Wilday & Harte 4 -Chen & Kuo 5. Liao,Chang & Wu 6 -Garvin ي ش ز و م آ ت ي ي د م و ی ب ه ه م ا ن ل ص ف ا س م گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3931 زمستان 4 ه ا م ش م ت ش ه ل ا س 1 1 1-10 3 ص ص ه د ن ی گ د ا ی ن ا م ز ا س ای ه ه ف ل ؤ م ت س ب ا ک ا ب

Διαβάστε περισσότερα

(Camelus dromedarius)

(Camelus dromedarius) س ع ی د و 6 ن ش ر ی ه م ی ک ر ب ی و ل و ژ ی د ا م پ ز ش ک ی / د و ر ه ی ا ز د ه م ش م ا ر ه د و م 1 4 9 3 پ ی ا پ ی 0-9 1: 3 7 9 ج د ا س ا ز ی ک و ه ا ن ه ا ی ر ا ن ی و ش ن ا س ا ی ی گ و ن ه ه ا ی ا ن

Διαβάστε περισσότερα

نگرشهاي كارشناس چكيده توسعهي نشان ميدهد

نگرشهاي كارشناس چكيده توسعهي نشان ميدهد فصلنامه علمي-پژوهشي نو در جغرافياي انساني نگرشهاي 1395 سال هشتم شماره چهارم پاييز گردشگري در منطقه آزاد اروند راهكارهاي توسعه بررسي 1 پريسا سجادي جهانگردي موسسه آموزش عالي قشم قشم ايران جهانگردي گرايش

Διαβάστε περισσότερα

Website:http://journals.iau-garmsar.ac.ir

Website:http://journals.iau-garmsar.ac.ir ه ب د ن و ا د خ م ا ن ه د ن ش خ ب ن ا ب ر ه م ف ص ل ن ا م ه ع ل م - پ ژ و ه ش ر ه ب ر و م د ير ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر ب ه ا س ت ن ا د م ص و ب ا ت ک م س و

Διαβάστε περισσότερα

: ک ی ن و ر ت ک ل ا ت س پ

: ک ی ن و ر ت ک ل ا ت س پ * د ن س ی و ن د ی ع س د ی س 12 1 : 24 ی پ ا ی پ 9 3 1 1 ل و ا ر ا م ش م ت ش ر و د / ی ک ش پ م ا د ی ژ و ل و ی ب ر ک ی م ی ر ش ن ش ر و ر پ و ر ی ث ک ت ع ر ا م ی ی ا ی ر ت ک ا ب ی ا ی ر ا م ی ب ع ل ا ط م

Διαβάστε περισσότερα

ن ه ع ال م ط ا بی ان ز م

ن ه ع ال م ط ا بی ان ز م ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ار س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 4931 بهار 1 ه ر ا م ش م ه ل ا س 5 7-4 9 ص ص ش ق ه ع ل ا ط م ا ب ا م ز ا س ر گ د ا ر ب ر ا ز گ ت م د خ ر ب

Διαβάστε περισσότερα

Gholami, S. Ph.D student of Educational Psychology, University of Tabriz, Iran

Gholami, S. Ph.D student of Educational Psychology, University of Tabriz, Iran Journal of Industrial/Organization Psychology Vol. 4/Issue14/Spring 2013 PP: 2135 ف ص ل ن ا م ه ر و ا ن ش ن ا س ص ن ع ت / س ا ز م ا ن س ا ل چ ه ا ر م. ش م ا ر ه چ ه ا ر د ه م بهار 2931 ص ص : 3 5 2 1 1

Διαβάστε περισσότερα

2. Cropanzano, Byrne, Bobocel & Rupp 3. Maslach, & Leiter 4. Kivimaki,, Elovainio,., Vahtera., & Ferrie 5. Masterson., Lewise, Goldman, & Taylor 6.

2. Cropanzano, Byrne, Bobocel & Rupp 3. Maslach, & Leiter 4. Kivimaki,, Elovainio,., Vahtera., & Ferrie 5. Masterson., Lewise, Goldman, & Taylor 6. و ب و ش ش ز و م آ ت ر د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و م ال س ا د ا ز آ ه ا گ ش ن ا د 3 9 3 1 ر ا ه ب 1 ه ر ا م ش. م ت ش ه ل ا س 9 9-4 1 1 ص ص ت ل ا د ع ن ی ب ط ا ب ت ر ا ن ی ی ب ت ر د

Διαβάστε περισσότερα

ATLAS green. AfWA /AAE

ATLAS green. AfWA /AAE مج م و ع ة ا لم ن ت ج ا ت K S A ا إل ص د ا ر ا ل د و ل ي ٠ ١ مج م و ع ة ا لم ن ت ج ا ت ٠ ٣ ج و ھ ر ة( ع د ت خ ص ص ة م TENVIRONMENTALLY FRIENDLY PRODUC ح د د ة م ا ل ھ و ي ة و ا ال ب ت ك ا ر و ا ل ط م و

Διαβάστε περισσότερα

ق ل ر ا ق د ا ج س 2 م ی ر ک ر و پ د ی س 3

ق ل ر ا ق د ا ج س 2 م ی ر ک ر و پ د ی س 3 ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 4931 بهار 1 ه ر ا م ش م ه ل ا س 5 9-5 1 1 ص ص د ا و ج ت ا س س ؤ م ش ه و ژ پ ا س ا ش ر ا ک ا ه ف ر ح ا ه

Διαβάστε περισσότερα

ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا ت س ب ا ت 2 ه ر ا م ش م ت ف ه ل ا س 5 4-8 5 ص ص د ا ز آ ه ا گ ش ن ا د ن ا ي و ج ش ن ا

Διαβάστε περισσότερα

د ا ز ز ا ب ه ش ر و ال د ن

د ا ز ز ا ب ه ش ر و ال د ن ه د ا ز ز ا ب ه ش ر و ال د ن ا ر م ا ک 3 9 3 1 م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ر ک ی م ه ی ر ش ن 1 3 1-12 4 : 9 2 ی پ ا ی پ ی ا ه ه ی و س ی و ر ی ن ا ر ی ا ل س ع ر و ب ن ز

Διαβάστε περισσότερα

ا ر ف ی و ن ع م ی ر ب ه ر ل د م س ا س ا ر ب 2

ا ر ف ی و ن ع م ی ر ب ه ر ل د م س ا س ا ر ب 2 ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3931 تابستان 2 ه ر ا م ش. م ت ش ه ل ا س 9 5 1-9 7 1 ص ص ن ا ر ب د ه ا گ د د ز ا و ن ع م ر ب ه ر ا ه

Διαβάστε περισσότερα

ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر غ ا ر م ن ا ت س ر ه ش ه ط س و ت م س ر ا د م 3

ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر غ ا ر م ن ا ت س ر ه ش ه ط س و ت م س ر ا د م 3 ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا ت س ب ا ت 2 ه ر ا م ش م ت ف ه ل ا س 1 3 1-4 4 1 ص ص ن ا ر دبی نی ا م ز ا س د ه ع ت و تی

Διαβάστε περισσότερα

ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا ت س م ز 4 ه ر ا م ش م ت ف ه ل ا س 7 5-70 ص ص ه ر و د م و س ل ا س ن ا ز و م آ ش ن ا د ن

Διαβάστε περισσότερα

ی ا و ق ت د و ع س م ن

ی ا و ق ت د و ع س م ن ه د ک چ ت م ال س ر گ ش د ر گ ه ع س و ت ر د ر ث و م ل م ا و ع د ب ت و ل و ا و ا س ا ش ر و پ ل ر ب ک ا ل ع د س ا ر ا ا ه ف ص ا ه و ژ پ ص خ ا ش ه ا گ ش ه و ژ پ ر ا د ا ت س ا ا و ق ت د و ع س م ا ر ا ا ه ف

Διαβάστε περισσότερα

2. Knowledge Management

2. Knowledge Management ز و م آ ت در م و ر ب ر م ا ن ل ص ف ر ا س م ر گ د ح ا و م ال س ا د ا ز آ ا گ ن ا د 5 9 3 1 ر ا ب 1 ر ا م م د ل ا س 1 0 1-9 1 1 ص ص ن س ح ل ک ر ا د ا ر د ن ا م ز ا س ت م ال س ا ب ن ا د ت ر د م ر ا ر ق ت

Διαβάστε περισσότερα

Employees in Oil Refinery Company

Employees in Oil Refinery Company Journal of Industrial/Organization Psychology Vol 3/Issue10/Spring 2012 PP: 73-84 ی ن ا م ز ا س / ی ت ع ن ص ی س ا ن ش ن ا و ر ه م ا ن ل ص ف 1 9 3 1 ر ا ه ب م ه د ه ر ا م ش م و س ل ا س 3 7-4 8 : ص ص ن ا

Διαβάστε περισσότερα

Investigation of relation between work values with job and work involvement among oil refinery personnel of Isfahan

Investigation of relation between work values with job and work involvement among oil refinery personnel of Isfahan Journal of Industrial/Organization Psychology Vol 5/Issue19/Summer 2014 PP: 31-41 ف ص ل ن ا م ه ر و ا ن ش ن ا س ی ص ن ع ت ی / س ا ز م ا ن ی س ا ل پ ن ج م ش م ا ر ه ن و ز د ه م تابستان 3931 ص ص : 4-1 3

Διαβάστε περισσότερα

amongst the Faculty Members

amongst the Faculty Members Journal of Industrial/Organization Psychology Vol 3/Issue9/Winter 2012 PP: 919 ن ا م ز ا س / ت ع ن ص س ا ن ش ن ا و ر م ا ن ل ص ف 0 9 3 1 ن ا ت س م ز م ن ر ا م ش م و س ل ا س 9 19 : ص ص م ل ع ت أ ا ض ع ا

Διαβάστε περισσότερα

ن ا ر ه ت ه ا گ ش ن ا د ر ا ی ش ن ا د - 3.

ن ا ر ه ت ه ا گ ش ن ا د ر ا ی ش ن ا د - 3. ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3 9 3 1 ر ا ه ب 1 ه ر ا م ش. م ت ش ه ل ا س 9-3 2 ص ص ن ا ر ی د م ی ن ا م ز ا س س ف ن ت ز ع و ه ی ح

Διαβάστε περισσότερα

ف ص ل ن ا م ه ر ه ب ر و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م. ش م ا ر ه 2 تابستان 3931 ص ص -7 8 6 7 ت ب ن ر ا ب ط ه ب ن ف ر ه ن گ س ا ز م ا ن و س ال

Διαβάστε περισσότερα

Phallocryptus spinosa ر ا

Phallocryptus spinosa ر ا 0 8 7 ا و لي ن گ ز ا ر ش م ش ا ه د ه Phallocryptus spinosa ا س ت ا ن ه ا ی ا ز و ي ز د ف ا ر س د ر ج ن و ب Anostraca( )Crustaceae; اي ر ا ن ب ه ر و ز 4 4 2 آ ت ش ب ا ر *, ر ا م ي ن م ن ا ف ف ر ن ا ص ر

Διαβάστε περισσότερα

ص خ ش ش ن ا د ت ی ر ی د م ت ر ا ه م و ی ن ا م ز ا س ت ی ا م ح ز ا ک ا ر د ا ن ی ب ه ط ب ا ر ی س ر ر ب س

ص خ ش ش ن ا د ت ی ر ی د م ت ر ا ه م و ی ن ا م ز ا س ت ی ا م ح ز ا ک ا ر د ا ن ی ب ه ط ب ا ر ی س ر ر ب س ر 2 ف د ا ه ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 3931 تابستا 2 ه ر ا م ش. م ت ش ه ل ا س 7 2-7 4 ص ص ص خ ش ش ا د ت ر د م ت ر ا ه م و ا م ز ا س

Διαβάστε περισσότερα

ر ک خواهد کمک ر گ ی د ن ا م ز ا س ر د ی ر ا ک م ا ج ن ا ه ب د ا ی ز ل ا م ت ح ا ه ب و ر ا ک ک ی م ا ج ن ا ر د ی ن ا م ز ا س 6

ر ک خواهد کمک ر گ ی د ن ا م ز ا س ر د ی ر ا ک م ا ج ن ا ه ب د ا ی ز ل ا م ت ح ا ه ب و ر ا ک ک ی م ا ج ن ا ر د ی ن ا م ز ا س 6 م ط ا ل ع ه) ک م ا ل ف ص ل ن ا م ه ه ب ی و م د ي ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ م س ا س ا ل ه ش ت م. ش م ا ه 2 تابستان 3931 ص ص -8 5 1 1 9 3 پ ی ش ب ی ن ی ف ت ا ش ه و ن د ی

Διαβάστε περισσότερα

Bacaan Doa dan Dzikir serta Taubat pilihan

Bacaan Doa dan Dzikir serta Taubat pilihan ijk Bacaan Doa dan Dzikir serta Taubat pilihan Dibawah ini adalah Dzikir Nabawiyah yang dibaca / diajarkan oleh Rasulullah SAW untuk ummatnya dan Nabi Muhammad SAW menganjurkan untuk diamalkan semua ummatnya.

Διαβάστε περισσότερα

Οι 6 πυλώνες της πίστης: Μέρος 6 Πίστη Θειο διάταγμα (Κάνταρ Πεπρωμένο) اإليمان بالقدر. Άχμαντ Μ.Ελντίν

Οι 6 πυλώνες της πίστης: Μέρος 6 Πίστη Θειο διάταγμα (Κάνταρ Πεπρωμένο) اإليمان بالقدر. Άχμαντ Μ.Ελντίν Οι 6 πυλώνες της πίστης: Μέρος 6 Πίστη Θειο διάταγμα (Κάνταρ Πεπρωμένο) الركن السادس من أركان اإليمان بالقدر اإليمان: Άχμαντ Μ.Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org Τζαμί «Σάλαφ

Διαβάστε περισσότερα

ة من ي لأ م و ة بي ال ع ج 2 1

ة من ي لأ م و ة بي ال ع ج 2 1 ج ا م ع ة ن ا ي ف ا أل م ن ي ة ل ل ع ل و م ا ل ع ر ب ي ة = = =m ^ á _ Â ª ^ = I = } _ s ÿ ^ = ^ È ƒ = I = ø _ ^ = I = fl _ Â ª ^ = I = Ó É _ Î ÿ ^ = = =KÉ ^ Ñ ƒ d = _ s Î = Ñ π ` = f = π à ÿ ^ Ñ g ƒ =

Διαβάστε περισσότερα

S Ô Ñ ª ^ ھ ھ ھ ھ ا حل م د هلل ا ل ذ ي أ ك ر م ا ل ب رش ي ة ة ب م ب ع ث ا ل ر مح ة ا مل ه د ا ة و ا ل ن ع م ة املسداة خرية خ ل ق ا هلل ا ل ن ب ي ا مل ص ط ف ى و ا ل ر س و ل ا مل ج ت ب ى ن ب ي ن ا و إ م

Διαβάστε περισσότερα

Οι 5 πυλώνες της πίστης: Μέρος 2 Πίστη στους αγγέλους

Οι 5 πυλώνες της πίστης: Μέρος 2 Πίστη στους αγγέλους Οι 5 πυλώνες της πίστης: Μέρος 2 Πίστη στους αγγέλους أركان اإلميان - الركن الثاين : اإلميان ابملالئكة Άχμαντ Μ. Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org - Τζαμί «Σάλαφ ους Σαάλιχ»

Διαβάστε περισσότερα

خ ہ ت ارف ادب جا زہ [+ ا ] through a cough and hiccough, he still had a rough

خ ہ ت ارف ادب جا زہ [+ ا ] through a cough and hiccough, he still had a rough ا ک( و ا ہ خان ب ری" ا جم ح د ث ان تح ات ا ہ پ جاب ) اج ) خ ا اور ت ظ ا واز ہ خ ہ ہ ا با د ا پر پا جا وا زبا وں ا ک روا ت ہ ان وت اور خ ا ا ار ں ت اد پا ا جاتا ہ تبد اں وت ات وا ن وجہ و وع پز ر وت ں جو

Διαβάστε περισσότερα

الركن الخامس من اركان االيمان اإليمان باليوم

الركن الخامس من اركان االيمان اإليمان باليوم Οι 6 πυλώνες της πίστης: Μέρος 5 Πίστη στην Ημέρα της Κρίσης الركن الخامس من اركان االيمان اإليمان باليوم اآلخر Άχμαντ Μ.Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org Τζαμί «Σάλαφ ους

Διαβάστε περισσότερα

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21

Διαβάστε περισσότερα

Benar sekali Allah memberi informasi dalam Quran dan lebih-lebih melalui lisan RasulNya Muhammad SAW tentang siksa dan nikmat kubur.

Benar sekali Allah memberi informasi dalam Quran dan lebih-lebih melalui lisan RasulNya Muhammad SAW tentang siksa dan nikmat kubur. ( ijk Assalamu 'Alaikum Wr.Wb. Pak Dasrul, Benar sekali Allah memberi informasi dalam Quran dan lebih-lebih melalui lisan RasulNya Muhammad SAW tentang siksa dan nikmat kubur. Kepada Fir'un di dalam kuburnya

Διαβάστε περισσότερα

الركن الثالث من أركان اإليمان: اإليمان بالكتب

الركن الثالث من أركان اإليمان: اإليمان بالكتب Οι 6 πυλώνες της πίστης: Μέρος 3 Πίστη στα βιβλία του Αλλάχ الركن الثالث من أركان اإليمان: اإليمان بالكتب Άχμαντ Μ.Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org Τζαμί «Σάλαφ ους Σαάλιχ»

Διαβάστε περισσότερα

محاسبه ی برآیند بردارها به روش تحلیلی

محاسبه ی برآیند بردارها به روش تحلیلی محاسبه ی برآیند بردارها به روش تحلیلی برای محاسبه ی برآیند بردارها به روش تحلیلی باید توانایی تجزیه ی یک بردار در دو راستا ( محور x ها و محور y ها ) را داشته باشیم. به بردارهای تجزیه شده در راستای محور

Διαβάστε περισσότερα

به روش الیهبرداری الکتروشیمیائی

به روش الیهبرداری الکتروشیمیائی )س( مجلة فیزیک کاربردی دانشگاه الزهرا سال پنجم شمارة 2 پاییز و زمستان 1394 بررسی خواص الکتریکی ذر ات گراف ن ساخته شده به روش الیهبرداری الکتروشیمیائی 1 رضا ثابت داریانی 2 مریم هادی طالع تاریخ دریافت: 94/6/7

Διαβάστε περισσότερα

ANTIGONE Ptolemaion 29Α Tel.:

ANTIGONE Ptolemaion 29Α Tel.: Ενημερώσου για τα τις δράσεις μας μέσα από τη σελίδα του 123help.gr και κάλεσε στο 2310 285 688 ή στείλε email στο info@antigone.gr για περισσότερες πληροφορίες. Get informed on ANTIGONE s activities through

Διαβάστε περισσότερα

الركن الرابع من أركان اإلميان: اإلميان ابلرسل

الركن الرابع من أركان اإلميان: اإلميان ابلرسل Οι 6 πυλώνες της πίστης: Μέρος 4 Πίστη στoυς Προφήτες/Αγγελιοφόρους الركن الرابع من أركان اإلميان: اإلميان ابلرسل Άχμαντ Μ.Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org Τζαμί «Σάλαφ ους

Διαβάστε περισσότερα

A Novel Fluorescence Assay for the Activity of Restriction Endonuclease Based on Molecular Beacon

A Novel Fluorescence Assay for the Activity of Restriction Endonuclease Based on Molecular Beacon 13 1 Vol13 No1 29 2 Life Science Research Feb 29 29 *,,,,, 4182 :,, (Molecular Beacon, MB),,,, 5~5 U / ml, 5 U / ml, Alu : ; ; : Q55 : A : 17-7847(29)1-6-5 A Novel Fluorescence Assay for the Activity of

Διαβάστε περισσότερα

جریان سیال غیر نیوتنی بر روی مرز با سرعت متغیر و در شرایط ناپایا ارائه متغیر تشابهی و روش حل نوین

جریان سیال غیر نیوتنی بر روی مرز با سرعت متغیر و در شرایط ناپایا ارائه متغیر تشابهی و روش حل نوین م م سال دوازدم شمار 9 زمستان 9 جریان سیال غیر نیوتنی بر روی مرز با سرعت متغیر و در شرایط ناپایا ارائ متغیر تشابی و روش حل نوین 4 * مازیار دقان مصطفی میرزایی محمدصادق ولیپور سیفالل سعدالدین اطالعات مقال

Διαβάστε περισσότερα

جلسه ی ۱۰: الگوریتم مرتب سازی سریع

جلسه ی ۱۰: الگوریتم مرتب سازی سریع دانشکده ی علوم ریاضی داده ساختارها و الگوریتم ها ۸ مهر ۹ جلسه ی ۱۰: الگوریتم مرتب سازی سریع مدر س: دکتر شهرام خزاي ی نگارنده: محمد امین ادر یسی و سینا منصور لکورج ۱ شرح الگور یتم الگوریتم مرتب سازی سریع

Διαβάστε περισσότερα

نانوالیه. Investigation of Structural and Electronic Properties of Chalcopyrite Semiconductors in Bulk and its Nanolayers: Ab initio Study

نانوالیه. Investigation of Structural and Electronic Properties of Chalcopyrite Semiconductors in Bulk and its Nanolayers: Ab initio Study علوم و مهنذسی سطح 69-80)1396(31 بزرسی خواص الکتزونی و ساختاری تزکیبهای کلکوپزیت در حالت انبوهه و نانوالیه حمذاله صالحی الهام گزدانیان گش ف ض ل دا طگا ض ذ چوشاى ا اص ( دریافت مقاله: 95/03/09- پذیزش مقاله:

Διαβάστε περισσότερα

جلسه ی ۳: نزدیک ترین زوج نقاط

جلسه ی ۳: نزدیک ترین زوج نقاط دانشکده ی علوم ریاضی ا نالیز الگوریتم ها ۴ بهمن ۱۳۹۱ جلسه ی ۳: نزدیک ترین زوج نقاط مدر س: دکتر شهرام خزاي ی نگارنده: امیر سیوانی اصل ۱ پیدا کردن نزدیک ترین زوج نقطه فرض می کنیم n نقطه داریم و می خواهیم

Διαβάστε περισσότερα

کار گا آه سضی کاربزد آهار زم افشار SPSS در پژ ص

کار گا آه سضی کاربزد آهار زم افشار SPSS در پژ ص کار گا آه سضی کاربزد آهار زم افشار SPSS در پژ ص عضو By:Reza Mazloum, PhD candidate 1 سیدرضا مظلوم ىیأت علمی دانشکده پرستاری و مامایی دکتری پرستاری rmazlomr@mums.ac.ir آهار تحلیلی یا است باطی Analytic Statistics

Διαβάστε περισσότερα

ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ

ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΡΓΑΣΤΗΡΙΟ ΠΟΙΟΤΙΚΟΥ ΕΛΕΓΧΟΥ & ΥΓΙΕΙΝΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΠΟΤΩΝ Π.Μ.Σ. «ΕΠΙΣΤΗΜΗ & ΤΕΧΝΟΛΟΓΙΑ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ» Η ΕΠΙΔΡΑΣΗ

Διαβάστε περισσότερα

جلسه ی ۲۴: ماشین تورینگ

جلسه ی ۲۴: ماشین تورینگ دانشکده ی علوم ریاضی نظریه ی زبان ها و اتوماتا ۲۶ ا ذرماه ۱۳۹۱ جلسه ی ۲۴: ماشین تورینگ مدر س: دکتر شهرام خزاي ی نگارندگان: حمید ملک و امین خسر وشاهی ۱ ماشین تور ینگ تعریف ۱ (تعریف غیررسمی ماشین تورینگ)

Διαβάστε περισσότερα

سلسله مزاتب سبان مقدمه فصل : زبان های فارغ از متن زبان های منظم

سلسله مزاتب سبان مقدمه فصل : زبان های فارغ از متن زبان های منظم 1 ماشیه ای توریىگ مقدمه فصل : سلسله مزاتب سبان a n b n c n? ww? زبان های فارغ از متن n b n a ww زبان های منظم a * a*b* 2 زبان ها پذیرفته می شوند بوسیله ی : ماشین های تورینگ a n b n c n ww زبان های فارغ

Διαβάστε περισσότερα

http://econometrics.blog.ir/ متغيرهای وابسته نماد متغيرهای وابسته مدت زمان وصول حساب های دريافتني rcp چرخه تبدیل وجه نقد ccc متغیرهای کنترلی نماد متغيرهای کنترلي رشد فروش اندازه شرکت عملکرد شرکت GROW SIZE

Διαβάστε περισσότερα

ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.

ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο. Α.Τ.Ε.Ι. ΚΡΗΤΗΣ Σ.Ε.Υ.Π. ΤΜΗΜΑ ΚΟΙΝΩΝΙΚΗΣ ΕΡΓΑΣΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Τίτλος: «Χρήση ψυχοτρόπων ουσιών από μαθητές Α Λυκείου της Δευτεροβάθμιας Εκπαίδευσης του Νομού Ηρακλείου και ο ρόλος του Κοινωνικού

Διαβάστε περισσότερα

فرزیه رضایی اژي ای کلیدی : عبختبس عش بی ثذ ی بی ث ذ ذت ث ش داس ک تب ذت ؽشکت بی ک چک ت عظ.

فرزیه رضایی اژي ای کلیدی : عبختبس عش بی ثذ ی بی ث ذ ذت ث ش داس ک تب ذت ؽشکت بی ک چک ت عظ. ثشسعی ػ ا تؼیی ک ذ عبختبس عش بی ؽشکت بی ثب ا ذاص ک چک ت عظ * وظام الدیه رحیمیان ** فرزیه رضایی *** حسیه ماستری فرا اوی 1390/03/11 1390/02/15 تبسیخ دسیبفت: تاسیخ پزیشػ: چکیدي ذف اف ی ای مب ثشسعی تزشثی ػ

Διαβάστε περισσότερα

ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ

ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΓΕΩΠΟΝΙΑΣ, ΔΑΣΟΛΟΓΙΑΣ ΚΑΙ ΦΥΣΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ ΤΟΜΕΑΣ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ Πτυχιούχου Γεωπόνου Κατόχου Μεταπτυχιακού

Διαβάστε περισσότερα

دبیرستان غیر دولتی موحد

دبیرستان غیر دولتی موحد دبیرستان غیر دلتی محد هندسه تحلیلی فصل دم معادله های خط صفحه ابتدا باید بدانیم که از یک نقطه به مازات یک بردار تنها یک خط می گذرد. با تجه به این مطلب برای نشتن معادله یک خط احتیاج به داشتن یک نقطه از خط

Διαβάστε περισσότερα

a;$ ag\a$ d D lb\ a;$ d d\ a$ d Dcn\

a;$ ag\a$ d D lb\ a;$ d d\ a$ d Dcn\ Ἀρχιμ. Ἀριστοβούλου Κυριαζῆ, Μαθήματα ἐκκλ. Μουσικῆς 1 Μέρος 1 ον, Θ. Λειτουργία Ἀραβική διά ἀρχαρίους, ἦχος πλ. Δ على للحن الثامن Beginning of the Divine Liturgy Ἦχος πλ. Δ weνη1 \s;$ s;cn\ s;$ 1a5 \

Διαβάστε περισσότερα

ارزیابی بیان فیمبریه Fim2( و Bordetella pertussis )Fim3 در مراحل مختلف کشت به منظور تولید واکسن

ارزیابی بیان فیمبریه Fim2( و Bordetella pertussis )Fim3 در مراحل مختلف کشت به منظور تولید واکسن و 4 ارزیابی بیان فیمبریه Fim2( و Bordetella pertussis )Fim3 در مراحل مختلف کشت به منظور تولید واکسن 3 *2 1 طیبه لطیفی مجتبی نوفلی لیال جبل عاملی چکیده زمینه و هدف: فیمبریه) Fim2 و )Fim3 یکی از فاکتورهای

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ & ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΟΜΕΑΣ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ Υ ΑΤΙΚΩΝ & Ε ΑΦΙΚΩΝ ΠΟΡΩΝ ΕΠΙΒΑΡΥΝΣΗ ΜΕ ΒΑΡΕΑ ΜΕΤΑΛΛΑ Ε ΑΦΩΝ ΤΗΣ

Διαβάστε περισσότερα

بررسی م دهای فونونهای اپتیکی در یک نانوساختار نیمهرسانا

بررسی م دهای فونونهای اپتیکی در یک نانوساختار نیمهرسانا مجلة فیزیک کاربردی دانشگاه الزهرا )س( سال چهارم شمارة 1 بهار و تابستان 1393 بررسی م دهای فونونهای اپتیکی در یک نانوساختار نیمهرسانا 1 عباس شاهبندی قوچانی تاریخ دریافت: 92/7/13 تاریخ تصویب: 92/11/9 چکیده

Διαβάστε περισσότερα

مدار معادل تونن و نورتن

مدار معادل تونن و نورتن مدار معادل تونن و نورتن در تمامی دستگاه های صوتی و تصویری اگرچه قطعات الکتریکی زیادی استفاده می شود ( مانند مقاومت سلف خازن دیود ترانزیستور IC ترانس و دهها قطعه ی دیگر...( اما هدف از طراحی چنین مداراتی

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΥΠΟΛΟΓΙΣΤΩΝ Σύστημα Διαχείρισης Διαχρονικών Δεδομένων για Γονίδια ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Διαβάστε περισσότερα

دانشکده ی علوم ریاضی جلسه ی ۵: چند مثال

دانشکده ی علوم ریاضی جلسه ی ۵: چند مثال دانشکده ی علوم ریاضی احتمال و کاربردا ن ۴ اسفند ۹۲ جلسه ی : چند مثال مدر س: دکتر شهرام خزاي ی نگارنده: مهدی پاک طینت (تصحیح: قره داغی گیوه چی تفاق در این جلسه به بررسی و حل چند مثال از مطالب جلسات گذشته

Διαβάστε περισσότερα

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση κατά του ιού της γρίπης Σε δομές του νομού Λάρισας

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση κατά του ιού της γρίπης Σε δομές του νομού Λάρισας ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΡΩΤΟΒΑΘΜΙΑ ΦΡΟΝΤΙΔΑ ΥΓΕΙΑΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.36 Έκδοση ενημερωτικών φυλλαδίων Υπεύθυνος φορέας: Κέντρο Ελέγχου

Διαβάστε περισσότερα

بهار ١٣٨۶ چکيده باشيم. ١- مقدمه

بهار ١٣٨۶ چکيده باشيم. ١- مقدمه حل مسي له تخصيص منابع پروژه های چند حالته با منابع محدود بوسيله الگوريتم ژنتيک چکيده مسعود قاسم زاده ٨٢٣٢٠٠٢۵ [masood.ghz@gmail.com] دانشکده برق رايانه و فناوری اطلاعات دانشگاه ا زاد واحد قزوين بهار ١٣٨۶

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία "Η ΣΗΜΑΝΤΙΚΟΤΗΤΑ ΤΟΥ ΜΗΤΡΙΚΟΥ ΘΗΛΑΣΜΟΥ ΣΤΗ ΠΡΟΛΗΨΗ ΤΗΣ ΠΑΙΔΙΚΗΣ ΠΑΧΥΣΑΡΚΙΑΣ" Ειρήνη Σωτηρίου Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. Χρυσάνθη Στυλιανού Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

بسمه تعالی «تمرین شماره یک»

بسمه تعالی «تمرین شماره یک» بسمه تعالی «تمرین شماره یک» شماره دانشجویی : نام و نام خانوادگی : نام استاد: دکتر آزاده شهیدیان ترمودینامیک 1 نام درس : ردیف 0.15 m 3 میباشد. در این حالت یک فنر یک دستگاه سیلندر-پیستون در ابتدا حاوي 0.17kg

Διαβάστε περισσότερα

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση

Διαβάστε περισσότερα

دانهه يا روغني- اندازهگیري همزمان مقدار آب و روغن- روش طیف سنجي رزونانس مغناطیسي هسته پالسي

دانهه يا روغني- اندازهگیري همزمان مقدار آب و روغن- روش طیف سنجي رزونانس مغناطیسي هسته پالسي KI. INSO 17508 1st. Edition 014 استاندارد ملي ايران 80571 چاپ اول 89 جمهوري اسالمي ايران Islamic Republic of Iran سازمان ملي استاندارد ايران Iranian National Standardization Organization ه يا روغني- اندازهگیري

Διαβάστε περισσότερα

ﯽﺳﻮﻃ ﺮﯿﺼﻧ ﻪﺟاﻮﺧ ﯽﺘﻌﻨﺻ هﺎﮕﺸﻧاد

ﯽﺳﻮﻃ ﺮﯿﺼﻧ ﻪﺟاﻮﺧ ﯽﺘﻌﻨﺻ هﺎﮕﺸﻧاد دانشگاه صنعتی خواجه نصیر طوسی دانشکده برق - گروه کنترل آزمایشگاه کنترل سیستمهای خطی گزارش کار نمونه تابستان 383 به نام خدا گزارش کار آزمایش اول عنوان آزمایش: آشنایی با نحوه پیاده سازی الکترونیکی فرایندها

Διαβάστε περισσότερα

Medicago marina 2012

Medicago marina 2012 ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Τµήµα Γεωπονικής Βιοτεχνολογίας ΣΚΑΓΙΑ. ΑΓΓΕΛΙΚΗ ΜΕΤΑΠΤΥΧΙΑΚΗ ΙΑΤΡΙΒΗ Χαρακτηρισµός και Φυλογενετική ανάλυση συµβιωτικών βακτηρίων που αποµονώθηκαν από τα φυµάτια της Medicago

Διαβάστε περισσότερα

ت ٤ یس VHH ف ی ٦ ز ی ٠ ته ق ١٤ س ٥ ث ٦ ضؾپت ٤ ض VEGF ا ١ ؿب ١ ی ٣ تقیی ٠ ذه ٤ نیبت آ

ت ٤ یس VHH ف ی ٦ ز ی ٠ ته ق ١٤ س ٥ ث ٦ ضؾپت ٤ ض VEGF ا ١ ؿب ١ ی ٣ تقیی ٠ ذه ٤ نیبت آ دا ؽکذ عل م پبی گر زیعتؼ بظی )گرایػ ثی ؼیوی( ت ٤ یس VHH ف ی ٦ ز ی ٠ ته ق ١٤ س ٥ ث ٦ ضؾپت ٤ ض VEGF ا ١ ؿب ١ ی ٣ تقیی ٠ ذه ٤ نیبت آ اظ: ػیذ ؿیشی ؿب یب اؾبتیس ضا ٢٧ ب: دوتش سضب حؼ ػبخذی دوتش صبدق حؼ یب دوتش

Διαβάστε περισσότερα

Λιμνοποτάμιο Περιβάλλον και Οργανισμοί

Λιμνοποτάμιο Περιβάλλον και Οργανισμοί ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Λιμνοποτάμιο Περιβάλλον και Οργανισμοί Ενότητα 14: Επίδραση ρύπανσης στα ψάρια Επίκ. Καθηγήτρια Δήμητρα Μπόμπορη Άδειες Χρήσης Το παρόν

Διαβάστε περισσότερα

ﻰﺿﺎﻳﺭ ﻥﺎﺘﺴﺑﺩ ﻢﺸﺷ ۱۳۹١

ﻰﺿﺎﻳﺭ ﻥﺎﺘﺴﺑﺩ ﻢﺸﺷ ۱۳۹١ رياضى ششم دبستان ۱۳۹١ وزارت آموزش و پرورش سازمان پژوهش و برنامه ريزی آموزشی برنامهريزی محتوا و نظارت بر تا ليف: دفتر تا ليف کتابهای درسی ابتدايی و متوسطه نظری نام کتاب: رياضی ششم دبستان ۳۴/۶ مو ل فان:

Διαβάστε περισσότερα

واژههای کلیدی: اعتماد مشتری تخصص نیروی فروش عملکرد نیروی فروش فروش گرایی.

واژههای کلیدی: اعتماد مشتری تخصص نیروی فروش عملکرد نیروی فروش فروش گرایی. کنفرانس ملی تحقیقات بازاریابی بهمنماه 3 مرکز همایشهای بینالمللی شهید بهشتی تهران ویژهنامه فصلنامه علمی- پژوهشی تحقیقات بازاریابی نوین صص: 55-47 بررسی تأثیر فروشگرایی و تخصص نیروی فروش بر عملکرد نیروی فروش

Διαβάστε περισσότερα

اثر عصارۀ آبی بادرنجبویه officinalis( )Melissa بر پاسخ ایمنی و عملکرد جوجههای گوشتی

اثر عصارۀ آبی بادرنجبویه officinalis( )Melissa بر پاسخ ایمنی و عملکرد جوجههای گوشتی صفحههای 281-290 اثر عصارۀ آبی بادرنجبویه officinalis( )Melissa بر پاسخ ایمنی و عملکرد جوجههای گوشتی *2 1 فائزه عبدینژاد و مهرداد محمدی 1. دانشآموخته کارشناسیارشد گروه علوم دامی دانشکدۀ علوم کشاورزی دانشگاه

Διαβάστε περισσότερα

شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران )

شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران ) شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران ) 1 فاطمه کریمي دانشجوي دوره کارشناسي ارشد رشته مدیریت فناوري اطالعات دانشگاه آزاد اسالمي تهران ایران fatima.karimi04@gmail.com

Διαβάστε περισσότερα

Διπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης

Διπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης Διπλωματική Εργασία Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική Αντωνίου Φάνης Επιβλέπουσες: Θεοδώρα Παπαδοπούλου, Ομότιμη Καθηγήτρια ΕΜΠ Ζάννη-Βλαστού Ρόζα, Καθηγήτρια

Διαβάστε περισσότερα