: ک ی ن و ر ت ک ل ا ت س پ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download ": ک ی ن و ر ت ک ل ا ت س پ"

Transcript

1 م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ر ک ی م ه ی ر ش ن : 9 2 ی پ ا ی پ ر د ی ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ت ی ل ا ع ف ی س ر ر ب ی ر و ت س ا پ س و ک و ک و ل ی ف ا ت س ا ی ر ت ک ا ب ن ی م ا 2 *1 ی ن ی س ح ن ی م ا ر و خ ی ش ه د ن ا ی ز ر ب ل ا 1 س ا ن ش ر ا ک ن ی و ز ق ) ه ر ( ی ن ی م خ م ا م ا ی ل ل م ل ا ن ی ب ه ا گ ش ن ا د ی ز ر و ا ش ک ی ژ و ل و ن ک ت و ی ب د ش ر ا ن ی و ز ق ) ه ر ( ی ن ی م خ م ا م ا ی ل ل م ل ا ن ی ب ه ا گ ش ن ا د ی ز ر و ا ش ک ی ژ و ل و ن ک ت و ی ب ه و ر گ ی م ل ع ت ئ ی ه و ض ع 2 ن ا ر ی ا ن ی و ز ق ن ا ر ی ا ن ی و ز ق ر و ی ر ه ش 6 : ت ف ا ی ر د خ ی ر ا ت ن ا ب آ 9 2 : ش ر ی ذ پ خ ی ر ا ت ه د ی ک چ ی ا ه د ن و ی پ د ن ر د ا ق ه ک د ن ت س ه ا ه م ی ز ن آ ز ا ی ه و ر گ ) DNase( ا ه ز ا ئ ل ک و ن و ب ی ر ی س ک ا د د ن ر ا د ز ا ئ ل ک و ن ی ا ه م ی ز ن آ ه د ن ز ت ا د و ج و م م ا م ت ی ا ه ن و م ز آ و 16S rrna ر گ ن ا ش ن ز ا ه د ا ف ت س ا ا ب Staphylococcus pasteuri ی ر ت ک ا ب د ن ن ک ش ب ا ر DNA ل و ک ل و م ر ت س ا ی د و ف س ف ی س ک ا د ی ا ه م ی ز ن آ ت ی ل ا ع ف د ی س ر ت ب ث ه ب NCBI/EMBL ه ا گ ی ا پ ن ژ ک ن ا ب ر د KC ی س ر ت س د ه ر ا م ش ا ب و ی ی ا س ا ن ش ی ی ا ی م ی ش و ی ب ی س ر ر ب حلقوی و ی ط خ DNA ی و ر م ی ز ن آ ت ی ل ا ع ف ی ر ت م و ت و ف و ت ک پ س ا ش و ر ه س ا ب ه د م آ ت س د ب S pasteuri ی ر ت ک ا ب ر د ز ا ئ ل ک و ن و ب ی ر ر ا ر ق ی س ر ر ب د ر و م ا ه م ی ز ن آ ت ی ل ا ع ف ی و ر ز ی ن Mg 2 Ca 2 و Mn 2 Ca 2 Mg 2 کاتیونهای و NaCl ت ظ ل غ ph ی ا ه ر ا م ی ت ر ث ا د ش ش ر ب ر د ی م ی ز ن آ ی ا ه ی س ر ر ب ت س ا ی و ق ل ح DNA ل و ک ل و م ه ن ا گ ی ش ر ب ه ب ر د ا ق S pasteuri ی ر ت ک ا ب ز ا حاصل DNase م ی ز ن آ ت ف ر گ ن ی ا pet21a () د ی م س ال پ ش ر ب ش ی ا م ز آ ر د ه ک ی ر و ط ه ب د ن ک ی م ل م ع ی ص ا ص ت خ ا ت ر و ص ب م ی ز ن آ ن ی ا ه ک د ا د ن ا ش ن حلقوی DNA ه ب ط و ب ر م ش ر ا ز گ ن ی ل و ا ن ی ا د ر ا د ن ا ر ه ت ش ر و د DNA ل و ک ل و م ش ر ب ی ی ا ن ا و ت DNase م ی ز ن آ ن ی ا د ا د ش ر ب ا ر ه ط ق ن ک ی ا ه ن ت م ی ز ن آ ر و ض ح ر د و ph 5/5 ر ال و م 0/6 ت ظ ل غ ا ب NaCl ر و ض ح ر د م ی ز ن آ ت ی ل ا ع ف ن ی ر ت ش ی ب ت س ا S pasteuri ی ر ت ک ا ب در DNase ی ا ه م ی ز ن آ د ش ه د ه ا ش م 1 mm ت ظ ل غ ا ب Mg 2 Ca 2 ی ا ه ن و ی ت ا ک ن ا م ز م ه 16S rrna DNase ت ی ل ا ع ف Staphylococcus pasteuri ی ر ت ک ا ب : ی د ی ل ک ت ا م ل ک : ن ف ل ت ن ا ر ی ا ن ی و ز ق خ ی ش ه د ن ا ی ز ر ب ل ا ن ی م ا : ل و ئ س م ه د ن س ی و ن ن ی و ز ق ) ه ر ( ی ن ی م خ م ا م ا ی ل ل م ل ا ن ی ب ه ا گ ش ن ا د ی ز ر و ا ش ک ی ژ و ل و ن ک ت و ی ب ه و ر گ : س ر د آ : ک ی ن و ر ت ک ل ا ت س پ

2 9 2 ی پ ا ی پ م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ر ک ی م ه ی ر ش ن ه م د ق م ل ا س ر ر ر ر ر ر د ن ا ر ا ک م ه و و و و و و و ی ن س چ ا ر Staphylococcus pasteuri س ن ج د ن د ر ک شناسایی Staphylococcus 2 ی ا ر ا د س و ک و ک و ل ی ف ا ت س ا ت ف ه ز ا ه 3 ن و گ ه 9 ن و گ سلولللهای است ه ه ه ه ه ه ی و س ن ی ا ت ب ث م گرم کوکسی غیرمتحرک ا ز ر و پ س ا ر ی غ ی ر ت ک ا ب ο C ی ا ه ا م د ر د ی ی ا ت ر ا ه چ و جفت فرد ت ر و ص ب ز ا د ی س ک ا ت ب ث م ز آ ه ه ه ر و ا و ز ا ل ا ت ا ک د ن ک ی م د ش ر ه ج ر د و ز ر ا ک ا س ز ک و و و و و و و و ل گ ی ا ه د ن ق ف ر ص م ر د و ت س ا ی ی ف ن م ) )8 د ن ک ی م د ی ل و ت د ی س ا ز و ت ک و ر ف ن ی ل و ا ) DNase( ( ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ی ا ه م ی ز ن آ ی ی ا ی م ی ش و ی ب ت ر و ص ب ل ا س ر د د ر و م ی س ر ر ب ر ا ر ق ر ا ب ت ی م ه ا ز ا ی ص ا ص ت خ ا ز ا ئ ل ک و ن و د ن ا ای ه زیم ن آ ) )3 د ن ت ف ر گ ن و ن ک ا ت و ند ت س ه ر ا د ر و خ ر ب DNA گ ن ی ن و ل ک ر د ی ا ه ژ ی و ت ف ا ی ز ی ا م ت م ی ش ر ب ی ل ا و ت د و د ح ه د ش ه ع ل ا ط م و ج و ت ر ذ گیاهان در ا ه ز ا ئ ل ک و ن ت س ا ) 4 3 ( ( ( ( ) 9 2 و 0 1 ( د د ن ا ه ه د ش ا د ج ت ر ذ ع ع ا و ن ا ی خ ر ب ی ا ه ه ش ی ر ز ا II ز ا ئ ل ک و ن و ب ی ر ز ا ئ ل ک و ن ن ی ا گردید خالص نسبی ر و ط ه ب و ا ت 5/4 7/0 د ا د نشان فعالیت ی ل و ک ل و م ن ز و ا ب ت ر ذ ه ش ی ر ت ن ج و م ه م ی ز ن آ ن ی ا د م آ ت س د ب ر د ز ا ر گ ی د م ی ز ن آ ک ی ت ی ل ا ع ف 6/2 ph ه ن ی ه ب ph ر د ر ا ز ه 1 3 ن و ت ل ا د ن ا ش ن ه ن ی ه ب د و ب DNA و RNA ی اا ا ههههههه ته ش ر ز ی ل و ر د ی ه ه ب ر د ا ق و د ا د د ی س ا ک ی ل ر ب ی ژ ا ب و ج ه د ش ف ص ن ر ذ ب ن د ر ک ه ب و ک ن ا ) 0 1 ( ت ف ا ب ر د ا ر ا ه ز ا ئ ل ک و ن و ب ی ر ی س ک ا د و ز ا ئ ل ک و ن و ب ی ر ت ی ل ا ع ف ی ا م د ر د ا ه ش ن ک ا و ن ی ا د ا د ش ی ا ز ف ا ن ر و ل آ ه ج ر د 5 5 د ح ه ب 6 ph ی اک ر و خ چ ار ق ) 9 2 ( ( ( ( )) ( ( ( ( ( د ی س ر د و خ ه ن ی به ز ی ن Lentinus edodes ش ر ب ا ب ا ه م ی ز ن آ ن ی ا د ن ک می و ن و م ن ی ن ا و گ ز ا ئ ل ک و ن و د ه ت ش ر د ی ل و ت ) 5GMP( ( ( ( ت ا ف س ف Le1 ک ی DNA د ی ل و ت Le3 و ی ا ه ت ن ا و ) 8 1 ( د د ن ن ک ممی م Rhizoctonia stolonifer چ ر ا ق ر د ی ر گ ی د ی ا ه ز ا ئ ل ک و ن ی ا ه ن ن و ی ر ی ثث ث أ ت ت ح ت ه ک ت س ا شده بررسی ی ز ل ف ر ا ر ق ز ا آنزیم این د ر ی گ می ت س ا ل و ل س ن و ر ب ع و ن ک ی شدهانددد بررسی ز ی ن حشرات در ا ه ز ا ئ ل ک و ن ی ز ا ئ ل ک و ن ا ب ) 2 3 ( ( ( ( (( ( ( ه ن ی ه ب ph ت ی ل ا ع ف ه ه ه ه ر ش ح لاور محتوای ر د 0 1 5/ شد شناسایی ه ج ر د 5 5 ی ا م د ر د Spodoptera litura ع و ن ت DNase ی ا ه م ی ز ن آ )2( ممممممی م م م م م ن ا ش ن ی ی ا ل ا ب ر ا ی س ب ی ر ت ک ا ب ز ا ه د م آ ت س د ب DNase م ی ز ن آ ل ا ث م ی ا ر ب د ن ه د ر ی ا س ز ا Micrococcus pyogenes ی ا ر ب م ی ز ن آ ن ی ا ت س ا ت و ا ف ت م ا ا ا DNaseه ن و ی به فعالیت ر ا ی س ب Ca 2 و ال ا ب ی ا ه ا م د ه ب ی ا ه ظ ح ال م ل ب ا ق ر و ط ب و د ر ا د ز ا ی ن ph 8/6 ت س ا ت م و ا ق م ن ژ ک ی ا ه ن ت ن و ن ک ا ت ) )9 ( ی ر ت ک ا ب ر د و ه د ش ی س ر ر ب S aureus ه ن و گ ) 3 2 ( ت س ا ه د ش ن و ل ک ر د ز ا ئ ل ک و ن E coli ن ژ شدهترین حفاظت ریبوزومی RNA ه ب ط و ب ر م ن ژ ی ی ی ب ا ی ی ی ی ل ا و ت rrna ن ژ ) 6 3 ( ( ( ( ( ( ( ت س ا ل و ل س ر ه ن و ر د مختلف موجودات ز ا شده نوکلئوتیدی ن ی ا د ن ه د می ن ا ش ن شباهت توجهی ه ک بدست توالللیهای م ه ا ب د ن ن ا و ت می ه د آم ت ر و ص ه ب و ه د ش ه س ی ا ق م ک ی ن ژ و ل ی ف ی م و ن و س ک ا ت ن ی ی ع ت ی ا ر ب ی ل ا و ت ن ی ا ر ب ا بن د و ش ه اد ف ت س ا ا ه اکتررری ب ل م ا ک ت ط ب ا و ر د ن ا و ت می و ه ب ل ب ا ق ر ر ر و ط ت س ا ی ن ع م ن ی ا ه ب ف ل ت خ م موجوددددددددددات از ی ا ههههههه ه ه هه ه ه د ر ت س گ ن ی ب ع و ن ت ن ی م خ ت 16S rrna ن ا ش ن ا ر اا ا مممممه م سم ی ن ا گ ر ا و ر ک ی م ن ی ب ی ک ش ز پ و ی ط ی ح م ی ر ت ک ا ب ر ا ز ه 16S rrna ی ل ا و ت د ه د ی ژ و ی ب ت ا نن ع ال ط ا ی نن ل م ز نن ک ر م م م ت ی ا س ر د NCBI (http://wwwncbinlmnihgov) ت س ا د و ج و م ) 6 3 ( د ر ا د ل و ط د ی ت و ئ ل ک و ن ر ظ ن د ر و م ی ل ا و ت ضر ا ح ق ی ق ح ت ف د ه ت ی ل ا ع ف ی س ر ر ب ی س اک د ی ز ک ا خ ی ر ت ک ا ب ) DNase( ( ( ( ( ( ( ی ز ا ئ ل ک و ن و ب ی ر ن ی ل و ا ن ی ا ت س ا Staphylococcus pasteuri ش ر ا ز گ ه ن و گ ن ی ا ر د ریییییییبونوکلئازی داکسی ت ی ل ا ع ف د ور م ر د ت س ا ی ر ت ک ا ب

3 ت) رک ش ی) و ا ح تمام) شامل ی) و ا ح ت) ک ر ش ی ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ت ی ل ا ع ف ی س ر ر ب ا ه ش و ر و د ا و م ی ر ت ک ا ب ی ز ا س ا د ج و ک ا خ ه ن و م ن ی ر و آ ع م ج 1 ی ا ه ه ن و م ن سطحی 0 خاک گرمی سازی رقیق ش و ر ا ب شد برداشته ی ر ت م 1 ق م ع ا ت در سریالی ی 0 ت ن ا س ب آ ر و ظ ن م ه ب ه ک د م آ ت س د ب ن و ی ل ی م ر د ک ی ت ظ ل غ ل ی ر ت س ا ی تر ک ا ب ت ش ک ل و ل ح م ت س ا ب س ا ن م ت ش ک ط ی ح م ی و ر ر ب ک ی ن ی ا ز ا ر رر ر ر ر ر ر رر ر ر ر ر ر یت ل ی ل می Luria ( ( ( آگار LB ) Bertani Broth, Miller, HIMEDIA, M1245 ت د م ه ب ه ج ر د 7 3 ی ا م د ر د و ت ش ک ه ب و ک ن ا هفته یک ف ل ت خ م ی اا ا ییییییییه ی ی ی یی ن و ل ک ه ت ف ه ک ی ت ش ذ گ ز ا د ع ب د ش صفات نظر ز ا ه د م آ ت س د ب ی ک ی ژ و ل و ف ر و م ت س ت د ن ن ا م گرممم باکتریییییهااای شدند بررسی ی ر ت ک ا ب ل ک ش و م ر گ ه ب )Staphylococcus اال ن م ت ح ا ( ل ک ن ش ی و ر ن ک و ت ن ب ث م ا ت ر ث ک ا د ح ص و ل خ ه ب ن د ی س ر ر و ظ ن م ) 1 ل و د ج ( د ن د ش ت ش ک ا و ه ب ا ش م ج ا ر خ ت س ا ل س ن 4 ش ن ک ا و م ا ج ن ا و DNA 16S rrna ه ع ط ق ر ی ث ک ت ر د ط ی ا ر ش ی را ب PCR ن م و ی ن ش و ر ز ا اا ا یه ر ت ک ا ب ز ا DNA ج ا ر خ ت س ا ی ا ر ب ک ی ر و ظ ظ ن م ن ی ا ی ا ر ب ) 8 2 ( شد استفاده ن ا ر ا ک م ه ی ل ی م و و د ی ا ر ب g ر د ی ی ا ی ر ت ک ا ب سلول سوسپانسیون از ر ت ی ل ا ب ا ه ل و ل س ی و ر ع ی ا م ف ذ ح ز ا د ع ب د ش ژ و ی ف ی ر ت ن ا س ه ق ی ق د mm NaCl 001 mm( STE ر ف ا ب ر ت ی ل و ر ک ی م ه ت س ش ر ا ب و د ) ph:8 و EDTA 1 mm و Tris/HCl01 د ن د ش ب و س ر و د ت د م ه ب g ر د ا اا له ل ل ل ل ل و ل س س پ س ه د ا د ذف ح رویی مایع د ن د ش ر ف با ر ت ی ل و ر ک ی م ر د ا اا ا ا به ب ب ب و س ر د ی د ر گ و ه ق ی ق د 0 1 mm( TE ph:8 و EDTA 1 mm Tris/HCl 0 5 ه ش ی ش ه ل و ل گ گرم میلی ه ز ا د ن ا ا ب ی ا و د ش ه ف ا ض ا ا ه ب و س ر ه ب ر ت م و ر ک ی م ا ب ه د ش ع ا ب ش ا ( سپس شدند حل ل ن ف ر ت ی ل و ر ک ی م ن ی ا ت ی ا ه ن ر د و د ش ه اف ض ا TrisHCl ه ل ح ر م ن ی ا ز ا د ع ب شد ورتکس ه ی ن ا ث 0 6 ت د م ه ب ل و ل ح م ی ا ر ب g ر د اا ا هه ن و م ن ت د م ی ا م د ر د ه ق ی ق د 5 ی ی و ر ع ی ا م ز ا ر ت ی ل و ر ک ی م و شدند سانتریفیوژ درجه ر ا د ق م د ن د ش ل ق ت ن م جدید میکروتیوب ه ب 4 ر ت ی ل و ر ک ی م 0 4 ه د ن ا س ر ر ت ی ل و ر ک ی م ه ب م ج ح و ه ف ا ض ا ن آ ه ب TE ر ف ا ب ر ا د ق م د ش ه ف ا ض ا ل و ل ح م ه ب م ر ف و ر ل ک ر ر ت ی ل و ر ک ی م ت د م ه ب g ر د ل و ل ح م س پ س و ه د ش ر د ه ق ی ق د 5 ع ی ا م ز ا ر ت ی ل و ر ک ی م د ن د ش ژ و ی ف ی ر ت ن ا س ه ج ر د 4 ی ا م د ص ل ا خ DNA ن ا و ن ع ب ی ی و ر گردید جدا و ر د ی ا م د ی د ع ب آزمایشششششششهااای برای ه ج ر د 0 2 ت ی م ک و ص و ل خ A 260 A/ 280 سنجی طیف د ش ا ب ا ب د ش ی ر ا د ه گ ن ن ی ی ع ت DNA و 27F ) 8 3 ( ( ( ( ( ( ( ( ( ی ن ا ه ج ی ا ه ر گ ز ا غ آ ز ا ه د ا ف ت س ا 5AGAGTTTGATCATGGCTCAG3 27F( 1525R )5AAGGAGGTGATCCAACC3 1525R و 16S هههههه ه ه عه ط ق تکثیر برای ) ی ب و ن ج ه ر ک ر و ش ک Bioneer rrna ط ی ا ر ش ش ن ک ا و ق ب ا ط م PCR ت د م ه ب ه ج ر د 4 9 ه ی ل و ا سازی واسرشته ی ا م د د ش ن ی ی ع ت ر ی ز ت د م ه ب و ه ج ر د 49 چرخهها سازی واسرشته ی ا م د ت د م ه ب و ه ج ر د 4 5 ل ا ص ت ا ی ا م د ه ی ن ا ث ه ق ی ق د ی ا م د ه ی ن ا ث ی ی ا ه ن ر ی ث ک ت ی ا م د و ه ی ن ا ث 0 9 ت د م ه ب ه ج ر د 27 تکثیر 5 3 ش ن ک ا و چرخههای تعداد ه ق ی ق د 0 1 ت د م ه ب و ه ج ر د : ت ف ر ر ا ک ب ر ی ز د ا و م ش ن ک ا و ب و ی ت ر ه ر د د و ب 0 5 ng 0 2 pmol ت ف ر ر گ گ گ گ ز ا غ آ 0 2 pmol و گ ل ا DNA ر گ ز ا غ آ ت ش گ ر ب ت ی ک مستر میکرولیتر 7 و ه ز ی ن و ی د ب آ ر ت ی ل و ر ک ی م 0 1 KCl 0 5 mm PCR % 1 MgCl 2 2 mm ph 9 ا ب TrisHCl 0 1 mm ن و ت ی ر ت ) v/v( ل ر ت ن ک ) و گ ل ا ر ه ز ا ل و م و ر ک ی م X 0 1 ی گ ود ل آ عدم تایید ی ا ر ب ) ن ا ر ی ا ن اژ ن ی س ل ر ت ن ک و ز ا ر ی غ ه ب ش ن ک ا و ت ا ب ی ک ر ت م ا م ت ) dntp DNA ت ا ب ی ک ر ت ز ا ر ی غ ه ب س پ د ش م ا ج ن ا ش ن ک ا و ی ر س ر ه ر د ) ا ه ر گ ز ا غ آ ر ی ث ک ت ز ا

4 ت) خ ا س باز 0 جفت و) 9 2 ی پ ا ی پ م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ر ک ی م ه ی ر ش ن ی ز ا س ص ل ا خ و ب س ا ن م م ج ح ر د ر ظ ن د ر و م ه ع ط ق ل و ص ح م ص ل ا خ ت ی ک ز ا ه د ا ف ت س ا ا ب PCR Accuprep شرکت به ی ب ا ی د و د ح آمده بدست ت ک ر ش ت س ی ز و و و پ ا ک ت ی ز ا س توالی برای ) Bioneer ل و ص ح م شدند ارسسسسسال ت اش د ل و ط ه د ا د ه ا گ ی ا پ ز ا ه د ا ف ت س ا ا ب شده خوانده توالیهای ی س ر ر ب د ر و م د ی د ر گ ص خ ش م ت س ت ک ی ژ و ل و ی ز ی ف س ن ج و گرفته قرار ه ن و گ و NCBI اا ا ییییییییه ییی ی ری ت ک ا ب و ک ی ژ و ل و ف ر و م ی ا اا ا ا ته تت ت ت ت ت ت ت ت تت ت س ت م گر ز ال ا نن ت ا ک ی ر ت ک ا ات ک ی تر ک ا ب ل شک ی ا ر ب کشت محیط ر د ک م ن د ص ر د ل م ح ت ) 1 ل و د ج ( د ش م ا ج ن ا ن ی ئ ت و ر پ ج ا ر خ ت س ا د ی ی ا تت ت ی ی ا ه ن ی ر د ا ه ب ش و ر ز ا ا ه باکتری ز ا ن ی ئ ت و ر پ ج ا ر خ ت س ا ی ا ر ب استخراج برای ) 4( ( ( ( ( د ش ه د ا ف ت س ا : د ش ل م ع ر ی ز ل ح ا ر م ق ب ط ا ه ری ت ک ا ب ا د ت ب ا کشت محیط ( ر ر ر ا گ آ LB ن ی ئ ت و ر پ ز ا Luria Bertani ل ی ر ت س ا ) Broth, Miller, HIMEDIA, M1245 ه ی ه ت ی ا م د ا ب ر ر ز ی ر ف ر د شده ذخیره ک ت س ا ز ا ا ه ری ت ک ا ب د ش 0 8 ی و ر 2 ت د م ه ب ی ک ی ر ا ت و ه د ش ت ش ک ا اا نه آ ت 4 ع ا س ر د ی ا م د و ه ج ر د 7 3 ی ر ت ک ا ب ز ا س پ س د ش ه ب و ک ن ا ل ی ر ت س ا پ و ل ز ا ه د ا ف ت س ا ا ب کلون تک ک ی ه ت ف ا ی د ش ر کشت مایع LB ط ی ح م ر د و ه ت ش ا د ر ب د ش ت د م ه ب ی ک ی ر ا ت ه ج ر د 7 3 ی ا م د ا ب شیکر انکوباتور ر د ت ع ا س سپس شد انکوبه rpm ر و د ا ب ر ک ی ش ی ر ت اک ب ی ا م د د ش ر ه ت ف یا ر و د و ه ج ر د 4 ژ و ی ف ی ر ت ن ا س و ر ک ی م ز ا ه اد ف ت س ا ا ب 4 2 ی ل ی م 0 1 ای ر ب rpm با ت ل پ و د ش ه ت خ ی ر ر و د ی ی و ر ع ی ا م د ش ه د ا د ب و س ر ر ت ی ل ه ق ی ق د 2 ه ی ه ت و 50 mm TrisHCl( ی و ا ح TE ر ف ا ب ر ت ی ل ی ل ی م 1 ر د ه د ش م ا د ک ر ه 52 mm NaEDTA و ز ا ه اد ف ت س ا ا ب ) ph 8 ی ر ت ک ا ب ب و س ر ی ا ر ب ا د د ج م گردید حل شدید ورتکس ژ و ی ف ی ر ت ان س ه ق ی ق د ی ر ت ک ا ب ی ا دم ا ب 1 ی ا ر ب rpm و ه ج ر د 4 پلت شد ریخته ر و د رویی مایع د ش م ا ج ن ا ر د ل ص ا ح ر ت ی ل ی ل ی م 1 کی م ن ت ا ف فس ر ف با اا ا ب ژ ژ و ی ف ی ر ت ن ا س ا د د ج م د ش ل ح د ی د ش س ک ت ر و ا ب )PBS( د د د ش م ا ج ن ا ه ق ی ق د 1 ی ا ر ب rpm و ه ج ر د 4 ی ا م د ی ل ی م 0 1 ر د ل ص ا ح ی ا ه ت ل پ د ش ه ت خ ی ر ر و د ی ی و ر ع ی ا م ت د م ه ب و ه د ش ل ح سرد خالص استون ر ت ی ل ه ی ن ا ث ی ی ا م د اا ا ب سانتریفیوژ سپس شد انجام شدید ورتکس ع ای م د د ش م م م ا ج ن ا ه ق ی ق د 3 ی ی ی را ب rpm و ه ه ج ر د ض ر ع م ر د ا ه ت ل پ و د ش ه ت خ ی ر ر و د ی م ا ر آ ه ب ی ی و ر % 1 SDS ل و ل ح م ر ت ی ل ی ل ی م 1 شدند خشک ا و ه ل و ل ح م ا ی ه ف ا ض ا خشک باکتریایی ت ل پ ه ب ) mm ر ف ا ب ت ا ف س ف د ش ول ل ح م ا دد ج م س ک ت ر و ت مد ه ب د ی شد به ت د م و ه د ش م ا ج ن ا ه ی ن ا ث 0 2 ر د ه ق ی ق د 2 د ش ه ر خی ذ ق ا ت ا ی ا م د rpm و ه ه ج ر د 4 ی ی ی ا م د ا اا ب ژ ژ ژ ژ ژ و ی ف ی تر ن ا س ی ی و ر ع ی ا م د ش م ا ج ن ا ه ق ی ق د 5 ی ا ر ب ن ی ئ ت و ر پ ن ا و ن ع ه ب شد منتقل جدید استریل ب و ی ت ه ب ت ق د ا ب شده استخراج م ج ح 1/3 ن د و ز ف ا ( % 0 5 ل و ر س ی ل گ ک ت س ا ز ا ه د ا ف ت س ا ا ب و ن ی ئ ت و ر پ ک ت س ا ) ن ی ئ ت و ر پ ه ب گلیسرول استک ز ا 2 1 5/ ل% رو س ی ل گ د ن د ش ل ق ت ن م 20 ر ز ی ر ف به ی ز ا س ه ر ی خ ذ ت جه و شد ه ی ه ت ن ی ئ ت و ر پ ت ی ف ی ک و ت ی م ک ن ی ی ع ت ی ا ه ن ی ئ ت و ر پ ت ظ ل غ ی س ر ر ب صورت بردفورد ت خ ا س UV ش و ر با شده استخراج ی و ا ح ر ت م و ت و ف و ر ت ک پ س ا ه ا گ ت س د ) )7 ( ( ( ت ف ر گ 595 nm جذبببب در Labomed شرکتتتتتتت ن ا و ن ع ه ب ج ا ر خ ت س ا ر ف ا ب 0 2 µl ی و ا ح ه ن و م ن ز ا د ش م ا ج ن ا ه د ا ف ت س ا ا ب د ر ا د ن ا ت س ا ر ا د و م ن م س ر د ش ه د ا ف ت س ا صفر نمونه Sigma ت ک ر ش ( گاوی آلبومین سرم مختلف ر ی د ا ق م ز ا د ش م ا ج ن ا ) ن ا م ل آ Aldrich

5 و) د ل) و ل ح م ی ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ت ی ل ا ع ف ی س ر ر ب ه ل ی س س س و ه ب ه د ش ج ا ر خ ت س ا ی ا ه ن ی ئ ت و ر پ ت ی ف ی ک ی س ر ر ب ل ی ر ک آ ی ل پ ل ژ ی و ر ی د و م ع ز ر و ف و ر ت ک ل ا ت ا ف ل و س ل ی س د و د م ی د س ی س ک ا د زیم ز ز ن آ ی س ر ر ب ز ر ا گ آ ی ا ر ج ا ق ب ط ش ی ا م ز آ ن ی ا )SDSPAGE( د ی م آ ی و ا ح 02( ( د ش م ا ج ن ا ل ژ ی و و و ر ز ا ئ ل ک و ن و ب ی ر دادهتوسط شرح روش ن ی ا ر د ) 6 1 ( ( ( د ش م ا ج ن ا ن ا ر ا ک م ه و ن ی و ک ن و د ب شده استخراج ن ی ئ ت و ر پ ز ا ر ف ا ب SDS mm ی ا ج ه ب ر د SDS ل ا ع ف ر ی غ ث ع ا ب SDS ا ر ی ز شد استفاده د د ر گ ممی م ر د ش ی ا م ز آ ن ی ا ب ا ی غ و ر و ض ح ر د pet21a () دو کاتتتیونهای ی ت ی ف ر ظ ش و ر ت ا ف س ف ) ج ج ج ج ج ا ر خ ت س ا ه ل ح ر م ن د ش ا ه م ی ز ز ز ن آ د ی مس ا ل پ و ی ط خ DNA ر ال و ن ن م ی ی ی ل ی م 1 Mn 2 Ca 2 ا ه م ی ز ز ن آ کوفاکتورهااای تا د ن د ش سری پالسمیدهای م ض ه Mg 2 و ) 9 3 ( ( ( ( گردند معرفی ع ق ا و ر د pet21a () ی ا ه ی ی ل ا و ت ن ا ی ب ی ال ا ب ح ط س و گ ن ی ن و ل ک طراحی هیستیدییییییییینی ی ل پ ه ل ا ب ن د ه ب ه د ش مع ج ت ل مح یک دارای پالسمید د ی م س ال پ ن ی ا ه ز ا د ن ا ت س ا ر د ل ی ل د د ر مو ش ی ا م آز ن ی ا ی ش ر ب ه ا گ ی ا ج ی ا ر ا د ت 3 ف ج ی د ی ت پ پ ه د ش ت ه ج ل ص ت م این اند برشی جایگاههههههههههههای و د ه ب و ت س ا ز ا ب 1 ت تت ت ت ت ت ت ت ت تت ت ت ت ف ر گ ار ر ق ه د ا تف س ا انواع برای د ا ی ز ی ش ر ب م ی ز ن آ 2 ش ش ش ر ب ز ا جلوگیری و ن ا س آ کاربرد برای ط س و ت م ه ز ا د ن ا ر د ی ف د ا ص ت ی ا ه ت ا ت س ا ش ن ک ا و ب و ی ت ر ه 0 1 mm م 0 ی د س E یcoli ر ت ک ا ب ی م و ن ژ DNA 0 4 µg ph 4/6 ا ب pet21a() د ی م س ال پ 0 4 µg ا ی و Mn 2 Ca 2 ی اا ا نه ن ن و ی ت ا ک ز ا 1 mm و ی م ی ز ن آ ه ن و م ن 5 µl و ف ل ت خ م ی ا ه ر ا م ی ت ) ) ف ل ت خ م ر ا م ی ت Mg 2 د و ج و ه ب ن ا و ن ع ت ش ا د 7 3 ο C ی ا م د ر د ا ه ب و ی ت د و ب 5 2 µl ش ن ک ا و ی ی ا ه ن م ج ح ه ب ب و ی ت 3 ر ا م ی ت ر ه ی ا ر ب د ن د ش ه ب و ک ن ا ت ع ا س ک ی ی ا ر ب ی س ر ر ب ر ا ر ک ت ن ا و ن ع د ش م ا م ت ا ز ا س پ ر ه ز ا 0 1 µl د ش ی س ر ر ب % 0/8 آگارز ل ژ ز ر و ف و ر ت ک ل ا ه ل ی س و ه ب ه ن و م ن ز ا ه د ا ف ت س ا ا ب ز ا ئ ل ک و ن و ب ی ر داکسی آنزیم ی س ر ر ب ر ت م و ت و ف و ر ت ک پ س ا کوین روش ق ب ط ش ی ا م ز آ و د ق ا ف ن ی ئ ت و ر پ ز ا ز ی ن ش ی ا م ز آ ن ی ا ر د ) 6 1 ( ( ( د ش ل م ا ش و 1 ml ش ن ک ا و حجم شد استفاده م ا ج ن ا ن ا ا ا ر ا ک م ه SDS DNA 0 4 µg ت ا ت س ا م و ی ن و م آ ر د ل و ل ح م ه د ش ه ت ش ر ک ت گاوی تیموس 0 5 mm ی ا ه ن و ی ت ت ت ا ک ت ظ ل غ ا ب Ca 2 Mg 2 و Mg 2 Mn 2 Ca 2 ه ب ph 5/5 ا ب 1 mm EDTA و 1 mm س پ د و ب ی م ی ز ن آ ه ر ا ص ع 0 2 µl ه ف ا ض ا ز ا ن د و م ن ه ف ا ض ا ر د ا ه ب و ی ت و ه د ش م ا ج ن ا شدید ورتکس ی م ی ز ن آ ه ر ا ص ع ر ا م ی ت ر ه د ن د ش ه ب و ک ن ا ه ق ی ق د 0 3 ت د م ه ب 7 3 ο C ی ا م د د و ب ر ا ر ک ت 3 ل م ا ش % 5 د ی س ا ک ی ر ل ک ر پ 1 ml گذاری گرما اتمام ز ا س پ خ ی ی و ر ش ن ک ا و ل و ل ح م ه ب ه ب ه د م آ ت س د ب ل و ل ح م د و ش ف ق و ت م ش ن ک ا و ا ت د ش ه ف ا ض ا ت د م ت ح ت ه ق ی ق د 5 1 g س 0 پ س د ش ژ و ی ف ی ر ت ن ا س ل و ل ح م ز ا ر ت ی ل ی ل ی م ک ی ی و ا ح ر ف ص ه ن و م ن شد بررسی ر ت م و ن ا ن ج و م ل و ط ر د ی م ی ز ن آ ه ر ا ص ع ز ج ب د ا و م م ا م ت د و ب ه ک ق ب ط کرد طی ش ی ا م ز آ ی ا ه ه ن و م ن د ن ن ا م م ا م ت ل ح ا ر م ا ر کوین نتایج و ب ذ ذ ذ ج ر د ه ق ی ق د ر ب 0/1 0 0 ف ال ت خ ا ر ه ) 6 1 ( ن ا ر ا ک م ه ت س ا ن ی ئ ت و ر پ ت ظ ل غ ر ب م ی ز ن آ د ح ا و ک ی ل د ا ع م )min((( ن ا م ز / ) mg/ml( ( ( ( ( ( ( ی م ی ز ن آ عصاره غلظت ی م ی ز ن آ د ح ا و ) U/ml( Δ0= 6 2 / ر ت م و ت و ف و ر ت ک پ س ا ز ا ه د ا ف ت س ا ا ب ی م ی ز ن آ ی ا ه ی س ر ر ب ی ا ر ب ب ل ا ق ز ا ا ه ش ی ا م ز آ م ا م ت ر د ح ر ط ا ب صتادفی کاملا ر ا ز ف ا م ر ن ز ا ه د ا ف ت س ا ا ب ا ه ه د ا د ل ی ل ح ت د ش ه د ا ف ت س ا ر ا ر ک ت ر ا ز ف ا م ر ن ز ا ه د ا ف ت س ا ا ب اا ا رره ر ا د و م ن م س ر و SAS ل ی ل ح ت ر د د ش ام ج ن ا ب ی ر ض ز ا ج ی ا ت ن تمام واریانس 3 Excel د ش ه د ا ف ت س ا % 99 اطمینان

6 8 4 1 ن ش ر ی ه م ی ک ر و ب ی و ل و ژ ی د ا م پ ز ش ک ی / د و ر ه د ه م ش م ا ر ه د و م پ ی ا پ ی 9 2 ج د و ل : 1 م ق ا ی س ه پ ا س خ ه ا ی ب ا ک ت ر ی Staphylococcus pasteuri ش ن ا س ا ی ی ش د ه د ر آ ز م ا ی ش ب ا 7 ا س ت ر ی ن ا ز ا ی ن ب ا ک ت ر ی )8 ) ت س ت ب ا ک ت ر ی ا و ر ه آ ز ر ش د ب ی ه و ا ز ی ق ط ر ک ل و ن ی > mm 5 * ر ن گ ی ز ه م ا ل ت و ز م ا ن ی ت و ل ا ک س ی د ا ز S pasteuri 7 S pasteuri BM S pasteuri BM S pasteuri BM S pateuri BM S pasteuri BM S pasteuri BM BM10427 ن ت ا ی ج ب ا ک ت ر ی S pasteuri ش ن ا س ا ی ی ش د ه * ب ه م ع ن ا ی pigment ب ا ک ت ر ی : ن ت ی ج ه م ن ف ی : ن ت ی ج ه م ث ب ت DNase ر و ی DNA خ ط ی د ر ش ک ل 3 د ی د ه م ی ی ی ش و د ن ت ا ی ج ش ن ا س ا ی ی ب ا ک ت ر ی ب ا ن د ت ک ث ی ر ش د ه ا ز ژ ن 16S rrna ب ه ص و ر ت و ا ض ح ب د س ت آ م د ه و ا ن د ا ز ه آ ن ه ا ب ا اندازه مورد انتظار یعنی ج ف ت ب ا ز م ط ا ب ق ت د ا ش ت ( ش ک ل ) 1 پ س ی ا ب ی ق ط ع ا ت ت ک ث ی ر ی ت و ا ل ی ی ی ی ی ی ی ی ی ی یییه ا ا ا د ر NCBI/EMBL م ور د ب ر ر س ی و ه م ر د ی ف ش د ند د ر ج ن س ن ه ا ی ت Staphylococcus و گ و ن ه ا ز ت و ا ل ی پ ا ی گ ا ه د ا د ه pasteuri ع ن و ا ن ن ز د ی ک ت ر ی ن باکتری طبق ن ت ا ی ج ه م ر د ی ف ی ت و ا ل ی 16S rrna ب د س ت آ م د ب ا ک ت ر ی گ ر م م ث ب ت ک و ک س ی ب ه شکل کاتاالز م ث ب ت و ا ک س ی د ا ز م ن ف ی ب و د و ت ا 5 1 د ر ص د ن م ک ر ا ت ح م ل ( ج د و ل ن م و د ) 1 ی ک ش ا خ ص م ه م درStaphylococcus ت ح م ل 5 1 د ر ص د ن م ک د ر م ح ی ط ک ش ت ا س ت )8 ) ژ ن 16S rrna ب ا ک ت ر ی د ر پ ا ی گ ا ه NCBI/EMBL ب ا ش م ا ر ه گ ر د ی د نتایج بررسی آ گ ا ر ز پ ر و ت ئ ی ن ه ا ی ا س ت خ ر ا ج ی آ ن ز ی م م مم م م مم ه ا ی ب ا ک ت ر ی S pasteuri KC ث ب ت DNase ر و ی ژ ل S pasteuri ر و ی ژ ل 2 1 SDSPAGE کیفیت خوبی% غ ل ظ ت پ ر و ت ئ ی ن ب د س ت آ م د ه ط ب ق ن ت ا ی ج ن ش ا ن د ا د ( ش ک ل ا س پ ک ر و ف و ت و م ت ر ) / 1 µg/ml ب و د ن ت ا ی ج ب ر ر س ی ف ع ا ل ی ت آ ن ز ی م م م م م ه ا ی ه م ا ن ط و ر د ر ش ک ل د ی د ه م ی ش و د ه ی چ گ و ن ه ب ر ش ی د ر م و ل ک و ل DNA د و ر ش ت ه ا ی ج ا د ن ش د ه ا س ت ب ر ر س ی ه ض م DNA پ ال س م ی د ی ب ا ا س ت ف ا د ه ا ز پ ل سا م ی د pet21a () انجام شد ب ر ر س ی ه ا ی ه ض م آ ن ز ی م ی پ ال س م ی د د ر ش ک ل 4 د ی د ه م ی ش و د د د ه ض م ی ا ب ر ش پ ل ا س یم د ب ا ت ی م ا ر ه ا ی مختلف کاتیونی ب ر ا ی تعین کوفاکتور ا خ ت ص ا ص ی آ ن ز ی م برشی صورت گرفت ا م ا د ر ن ه ا ی ت ه ی چ ا خ ت ل ا ف ی ب ر ش ب ا کوفاکتورهای مختلف م ش ا ه د ه ن ش د آ ن ز ی م ی ب ا ک ت ر ی S pasteuri ب ا ع ث ا ف ز ا ی ش غ ل ظ ت ر ح ا ل ت ب ر ش ت ک ر ش ت ه ا ز پالسمید شده ک ه ا ی ن ب د ل ی ل و ج و د آنزیم نیکازاست ( ش ک ل ع ص ا ر ه ) 4 د ر ح ض و ر ت م ا م ک ا ت ی و ن ه ا ن ی ز ا ی ن ب ر ش دیده شد ب ا ت و ج ه ب ه ت ع د ا د ب ا ل یا ت ک را ر آ ز م ا ی ش و ن ی ز آ ز مو ن س ه کاتیون مختلف م ی ت و ا ن آ ن ز ی م ه ا ی ب ا ک ت ر ی ی ه ا ی S pasteuri ر ا ا ز ن و ع ن ی ک ا ز د ا ن س ت ن ی ک ا ز ه ا برش دهنده اختصاصی ی ک ک ال س ج د ی د ا ز آ ن ز ی م م ه ا ه س س س ت ن د ک ه ج ا ی گ ا ه ب ر ش ی ر ا ر و ی م و ل ک و ل DNA ت ش خ ی ص م ی د ه ن د و ت ن ه ا ی ک ر ش ت ه ا ز DNA ر ا ب ر ش م ی د ه ن د ا ز ا ی ن د س ت ه ا ز آ ن ز ی م ه ا ت ع د ا د ب س ی ا ر ک م ی ک ش ف ش د ه ا س ت ( 4 ) 2

7 د و) ب ر ر س ی ف ع ا ل ی ت د ا ک س ی ر ی ب و ن و ک ل ئ ا ز ی ش ک ل 1: ب ا ن د م و ر د ا ن ت ظ ا ر ژ ن 6 1 S rrna ب ا ا س ت ف ا د ه ا ز آ غ ا ز گ ر ه ا ی ش ک ل : 4 ه ض م م و ل ک و ل DNA پ ال س م ی د () pet21a ب ا آ ن ز ی م ه ا ی 1 پ ال س م ی د ب د و ن آ ن ز ی م S pasteuri ا ز ب ا ک ت ر ی DNase 2 پ ال س م ی د د ر ح ض و ر ع ص ا ر ه پ ر و ت ئ ی ن ی ب ا ک ت ر ی S pasteuri DNA م ا ر ک ر M A پ ال س م ی د ب ر ش خ و ر د ه ب ا آ ن ز ی م ن ی ک ا ز B پ ال س م ی د ح ل ق ه ب ا ز C پ ال س م ی د خ ط ی ( ب ر ش ی ا ف ت ه ) D پ ال س م ی د س و پ ر ک و ی ل E پ ال س م ی د ح ل ق ه ا ی ت ک ر ش ت ه S pasteuri 1 DNA 1 kb م ا ر ک ر M 1525R و 27F ن ت ا ی ج ح ا ص ل ا ز ا س پ ک ت ر و ف و ت و م ت ر ی ف ع ا ل ی ت آ ن ز ی م DNase ع ص ا ر ه ب ا ک ت ر ی S pasteuri ش ک ل : 2 ع ص ا ر ه پ ر و ت ئ ی ن ی ا س ت خ ر ا ج ش د ه ا ز ب ا ک ت ر ی S pasteuri ر و ی ژ ل M SDSPAGE م ا ر ک ر م و ل ک و ل ی 1 و 2 ا ل گ و ی ب ا ن د ی پ ر و ت ئ ی ن ی ب ا ک ت ر ی S pasteuri ت ک ر ا ر ) در حضور کاتیونهای م ن ی ز ی م ب ص و ر ت م ع ن ی دار کاهش ی ا ف ت د ر ح ض و ر ک ا ت ی و ن ه ا ی ک ل س ی م و م ن گ ن ز ف ع ا ل ی ت آ ن ز ی م ی ت غ ی ی ر م ع ن ی د ا ر ی ن ش ا ن ن د ا د ( ن م و د ا ر ) 1 ب ا ا ع م ا ل ت ی م ا ر 2 Mg 2 Ca د ر غ ل ظ ت 1 mm ف ع ا ل ی ت آ ن ز ی م ت ا چ ه ا ر ب ر ا ب ر ا ف ز ا ی ش ن ش ا ن د ا د غ ل ظ ت ه ا ی م خ ت ل ف ن م ک ف ع ا ل ی ت آ ن ز ی م DNase ا ی ن ب ا ک ت ر ی ر ا ب ط و ر م ع ن ی د ا ر د ر س ط ح % 9 9 ا ف ز ا ی ش د ا د غ ل ظ ت 0/6 م و ال ر ن م ک ب ا ع ث ب ی ش ت ر ی ن ا ف ز ا ی ش د ر ف ع ا ل ی ت آ ن ز ی م DNase ش د ف ع ا ل ی ت ph آ ن ز ی م DNase ب ط و ر م ع ن ی د ا ر ق ر ا ر ن ی ز ت ا ث ی ر ت ح ت 9 7 گ ر ف ت ن ش ا ن ت غ ی ی ر ی و ph ه ا ی د ر آ ن ز ی م ف ع ا ل ی ت ش ک ل : 3 ه ض م م و ل ک و ل DNA خ ط ی ب ا آ ن ز ی م ه ا ی DNase ا ز ب ا ک ت ر ی S 1 م و ل ک و ل DNA د و ر ش ت ه ب د و ن آ ن ز ی م DNA م ا ر ک ر M pasteuri 2 م و ل ک و ل DNA د و ر ش ت ه د ر ح ض و ر ع ص ا ر ه پ ر و ت ئ ی ن ی ب ا ک ت ر ی S pasteuri 3 م و ل ک و ل DNA د و ر ش ت ه د ر ح ض و ر آ ن ز ی م EcoRI ن د ا د د ر ح ا ل ی ک ه د ر ph ه ا ی 3 و 5 ف ع ا ل ی ت آ ن ز ی م DNase ب ا ا ط م ی ن ا ن % 9 9 ک ا ه ش پ ی د ا ک ر د ب ح ث ب ا ک ت ر ی Staphylococcus pasteuri ا ز خ ا ک س ط ح ی ج د ا و خ ا ل ص س ا ز ی ش د ا ی ن ب ا ک ت ر ی ب ا ش م ا ر ه

8 0 5 1 ن ش ر ی ه م ی ک ر و ب ی و ل و ژ ی د ا م پ ز ش ک ی / د و ر ه د ه م ش م ا ر ه د و م پ ی ا پ ی 9 2 NCBI/EMBL د س ت ر س ی KC پ ا ی گ ا ه د ر ب ه آ ن ز ی م ا ی ن د ا د ب ر ش ب ر ش ت و ا ن ا ی ی م و ل ک و ل DNase ث ب ت ر س ی د آ ن ز ی م DNase ب ا ک ت ر ی S pasteuri ق ا د ر ب ه DNA د و ر ش ت ه ر ا ن د ا ر د ا ی ن ا و ل ی ن گ ز ا ر ش م ر ب و ط ب ه ر ش ت ه ب ر ش DNA آ ن ز ی م ا ی ن ا س ت ی گ ا ن ه ج ز ا ح ت م ا ال آ ن ز ی م ه ا ی ب ا ک ت ر ی د ر S pasteuri ا س ت DNase 0/6 آ ن ز ی م ه ا ی ا س ت ن ی ک ا ز ب ر ر س ی ه ا ی ب ر ش د ر آ ن ز ی م ی ب ی ش ت ر ی ن ف ع ا ل ی ت آ ن ز ی م د ر ح ض و ر NaCl ب ا غ ل ظ ت آ ن ز ی م ا ی ن ک ه م ی د ه د ن ش ا ن ح ل ق و ی ب ص و ر ت م و ال ر ز م ا ن ه م ح ض و ر د ر و ک ا ت ی و ن ه ا ی ph 5/5 DNA ا خ ت ص ا ص ی ع م ل م ی ک ن د ب ه ط و ر ی ک ه د ر آ ز م ا ی ش ب ر ش 2 Mg 2 Ca ب ا غ ل ظ ت 1 mm م ش ا ه د ه ش د پ ال س م ی د () pet21a ر ا ن ق ط ه ی ک ت ن ه ا آ ن ز ی م ا ی ن ن م و د ا ر : 1 ن م و د ا ر ه ا ی ن ت ا ی ج ت ی م ا ر ه ا ی م خ ت ل ف NaCl ph و ک ا ت ی و ن ر و ی ع ص ا ر ه آ ن ز ی م ی ب ا ک ت ر ی S pasteuri 5 Bickle, TA, Krüger, DH (1993) Biology of DNA restriction FEMS Microbiology Reviews 57: Bourniquel, AA, Bickle, TA (2002) Complex restriction enzymes: NTPdriven molecular motors Biochimie 84: Bradford, MM (1976) A rapid and sensitive for the quantitation of microgram quantitites of protein utilizing the principle of proteindye binding Analytical Biochemistry 72: Chesneau, O, Morvan, A, Grimont, F, Labischinski, H, El Solh, N (1993) Staphylococcus pasteuri sp nov, isolated from human, animal, and food specimens International Journal of Systematbica Cteriologay 43: م ن ا ب ع 1 Abdurashitov, MA, Belitchenko, OA, Shevchenko, AV, Degtiarev, S (1996) NBstSE a sitespecific nickase from Bacillus stearothermophilus SE589 Journal of Molecular Biology 30: Ahmad, NS, Hadi, SM (1983) Purification and properties of a glycoprotein alkaline nuclease from the larvae of the army worm Spodoptera litura Insect Biochemistry 13: Bernard, EA (1969) Ribonucleases Annual Review of Biochemistry 38: Bhaduri, S, Paul, HD (1983) Simple and rapid method for disruption of bacteria for protein studies Applied and Environmental Microbiology 46: 9413

9 1 5 1 ی ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ت ی ل ا ع ف ی س ر ر ب 19 Kunitz, M (1940) Crystalline ribonuclease The Journal of General Physiology 24: Laemmli, UK, Favre, M (1973) Gel electrophoresis of protein Journal of Molecular Biology 80: Lai, B, Li, Y, Cao, A, Lai, L (2003) Metal ion binding and enzymatic mechanism of Methanococcus jannaschii RNase HII Biochemistry 42: Laskowski, M (1959) Enzymes hydrolyzing DNA Annals of the New York Academy of Sciences 81: Lin, LF, Posfai, J, Roberts, RJ, Kong, H (2001) Comparative genomics of the restrictionmodification systems in Helicobacter pylori Proceedings of the National Academy of Sciences 98: McCleland, SE, Sczcelkun, MD (2004) The type I and III restriction endonucleases: structural elements in molecular motors that process DNA Nucleic Acids and Molecular Biology 14: Morgan, RD, Calvet, C, Demeter, M, Agra, R, Kong, H (2000) Characterization of the specific DNA nicking activity of restriction endonuclease NBstNBI The Journal of Biological Chemistry 381: Murray, NE (2000) Type I restriction systems: sophisticated molecular machines (a legacy of Bertani and Weigle) Microbiology and Molecular Biology Reviews 64: Neumann, B, Pospiech, A, Schairrer, HU (1992) Rapid isolation of genomic DNA from gramnegative bacteria Trends in Genetics 8: Patel, JB (2001) 16S rrna gene sequencing for bacterial pathogen identification in the clinical laboratory Journal of Molecular Diagnostics 6: Pingoud, A, Fuxreiter, M, Pingouda, V, Wende, W (2005) Type II restriction endonucleases: structure and 9 Cunningham, L, Laskowski, M (1953) Presence of two different por desoxyribonucleode polymerases in veal kidney Biochimica et Biophysica Acta 11: Curtis, MW (1968) Plant nucleases I separation and purification of two ribonucleases and one nuclease from corn Plant Physiology 43: Desreux, V, Hacha, R, Fredericq, E (1962) Activation of deoxyribonucleases by divalent cations Journal of General Physiology 45: Feinstein, R N (1960) Activation of the neutral deoxyribonuclease The Journal of Biological Chemistry 235: Goedken, ER, Marqusee, S (2001) Cocrystal of Escherichia coli RNase HI with Mn 2 ions reveals two divalent metals bound in the active site The Journal of Biological Chemistry 276: Higgens, LS, Besnier, C, Kong, H (2001) The nicking endonuclease NBstNBI is closely related to type IIs restriction endonucleases MlyI and PleI Nucleic Acids Research 29: Keck, JL, Goedken, ER, Marqusee, S (1998) Activation/attenuation model for RNase H A onemetal mechanism with secondmetal inhibition The Journal of Biological Chemistry 273: Kevin, PB, Will, F, Baron, W, Henzel, J, Steven, AS (1998) Molecular cloning and characterization of human and murine DNase II Gene 215: Kobayashi, H, Fumi, K, Tadashi, I, Takashi, K, Norio, I (2000) Nuclease Lel 1 and 2 Study Bioscience, Biotechnology, Biochemistry 64: Koerner, JF, Sinsheimer, RL (1957) Deoxyribonuclease from calf spleen I Purification and properties The Journal of Biological Chemistry 228: 1039

10 9 2 ی پ ا ی پ م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ر ک ی م ه ی ر ش ن Xia, YN, Morgan, R, Schildkraut, I, Van Etten, JL (1988) A sitespecific single strand endonuclease activity induced by NYs1 virus infection of a Chlorellalike green alga Nucleic Acids Research 16: Zhang, Y, Nelson, M, Nietfeldt, J, Xia, Y, Burbank, D, Ropp, S, Van Etten, JL (1998) Chlorella virus NY 2A encodes at least 12 DNA endonuclease/methyltransferase genes Virology 240: Zheleznaya, LA, Perevyazova, TA, Zheleznyakova, EN, Matvienko, NI (2002) Some properties of sitespecific nickase bspd6i and the possibility of its use in hybridization analysis of DNA Biochemistry 67: mechanism Cellular and Molecular Life Sciences 62: Raleigh, EA, Brooks, JE (1998) Restriction modification systems: where they are and what they do Bacterial Genomes Rangrajan, S, Shankar, V (1999) Extracellular nuclease from Rhizopus stolonifer purification and characteristics of single strand preferential deoxyribose nuclease activity Biochimica et Biophysica Acta 1473: Roberts, RJ, Belfort, M, Bestor, T, Bhagwat, AS, Bickle, TA, Bitinaite, J et al (2003) A nomenclature for restriction enzymes, DNA methyltransferases, homing endonucleases and their genes Nucleic Acids Research 31: Roberts, RJ, Vincze, T, Posfai, J, Macelis, D (2005) REBASE restriction enzymes and DNA methyltransferases Nucleic Acids Research 33: Shimomura, M, Laskowski, M (1957) Purification of deoxyribonuclease II from spleen Biochimica et Biophysica Acta 26: Torsvik, V, Jostein, G (1990) High Diversity in DNA of Soil Bacteria Applied and Environmental Microbiology 56: Van Etten, JL (2003) Unusual life style of giant chlorella viruses Annual Review of Genetics 37: Virginia, W, Campbell, D, Jackson A (1980) The effect of divalent cations on the mode of action of DNase I Journal of Biologic Chemistry 255: Weisburg, WG, Barns, SM, Pelletier, DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study Journal of Bacteriology 173: Wiberg, JS, (1958) On the mechanism of metal activation of deoxyribonuclease I Archives of Biochemistry and Biophysics 73: 337

11 Journal of Veterinary Microbiology, Volume 10, Issue 2, 2014 A Study on the Staphylococcus pasteuri Deoxyribonuclease Activity AlborzianDehSheikh, A* 1, Hosseini, R 2 1 MSc of Agricultural Biotechnology, Imam Khomeini International University Qazvin, Qazvin, Iran 2 Faculty member of Agricultural Biotechnology, Imam Khomeini International University Qazvin, Qazvin, Iran Received Date:29 August 2013 Accepted Date: 16 November 2013 Abstract: All organisms have nuclease Deoxyribonucleases (DNase) are from enzyme group that are able to hydrolase phosphodiester bounds of DNA molecule bonds Staphylococcus pasteuri identified by 16S rrna marker and biochemical tests, and submitted to GenBank/EMBL with KC accession number The activity of DNase enzyme was detected through three spectrophotometric, detection of DNase activity on circular and double strand DNA molecule on agarose gel methods The effects of ph, NaCl and cations like Mg2, Ca2,Mn2andMg2Ca2 treatments were considered S pasteuri DNase was able to cut single strand of circular DNA S pasteuri DNase was able to cut single strand DNA Studies on circular DNA showed that the enzyme may nick specifically, whereas pet 21a () was restricted to one point The DNase does not cut double strand DNA This is the first report about S pasteuri DNase activity The most important activity of enzyme was observed in the presence of 06 M NaCl, 1mM Mg2Ca2 and ph 55 Keywords: Staphylococcus pasteuri, DNase activity, 16S rrna *Corresponding author: AlborzianDehSheikh, A Address: Imam Khomeini International University Qazvin, Qazvin, Iran Tel:

12

ر ک ش ل ن س ح ن د م ح م ب ن ی ز ن. ل و ئ س م ه د ن س ی و ن ( ی ر ک ش ل &

ر ک ش ل ن س ح ن د م ح م ب ن ی ز ن. ل و ئ س م ه د ن س ی و ن ( ی ر ک ش ل & ن- س ح ی ژ ر ن ا ل ا ق ت ن ا ر د ر ا و ی د ي ر ي گ ت ه ج و د ی ش ر و خ ش ب ا ت ه ی و ا ز و ت ه ج ه ط ب ا ر ل ی ل ح ت ) ر ال ر ه ش ي د ر و م ه ع ل ا ط م ( ي ر ي س م ر گ ي ا ه ر ه ش ر د ن ا م ت خ ا س ل خ

Διαβάστε περισσότερα

ی ا ک ل ا ه م ی ل ح ر

ی ا ک ل ا ه م ی ل ح ر ل- ال ج ه) ن و م ن م د ر م ت ک ر ا ش م د ر ک و ر ا ب ر ه ش ه د و س ر ف ا ه ت ف ا ب ز ا س و ن ) س و ل ا چ ر ه ش 6 ه ل ح م : د ر و م 1 ل م آ م ظ ع ل ال ج ر و ن د ح ا و م ال س ا د ا ز آ ه ا گ ش ن ا د ر ه

Διαβάστε περισσότερα

ی ن ل ض ا ف ب ی ر غ ن ق و ش ه ی ض ر م ی ) ل و ئ س م ه د ن س ی و ن ( ا ی ن ل ض ا ف ب ی ر غ 1-

ی ن ل ض ا ف ب ی ر غ ن ق و ش ه ی ض ر م ی ) ل و ئ س م ه د ن س ی و ن ( ا ی ن ل ض ا ف ب ی ر غ 1- ر د ی ا ه ل ی ب ق ی م و ق ب ص ع ت ای ه ی ر ی گ ت ه ج و ی ل ح م ت ا ح ی ج ر ت ر ی ث أ ت ل ی ل ح ت و ن ی ی ب ت زابل) ن ا ت س ر ه ش ب آ ت ش پ ش خ ب و ی ز ک ر م ش خ ب : ی د ر و م ه ع ل ا ط م ( ن ا ر ا ی ه

Διαβάστε περισσότερα

ت خ ی م آ ر ص ا ن ع ز ا ن ا گ د ن ن ک د ی د ز ا ب ی د ن م ت ی ا ض ر ی س ر ر ب د

ت خ ی م آ ر ص ا ن ع ز ا ن ا گ د ن ن ک د ی د ز ا ب ی د ن م ت ی ا ض ر ی س ر ر ب د ه ت خ م آ ر ص ا ع ز ا ا گ د ک د د ز ا ب د م ت ا ض ر س ر ر ب د ال م ج ر ب ر گ ش د ر گ ب ا ر ا ز ا ب خالر امر ا ر ا ا ر ه ت ا ر ه ت ه ا گ ش ا د ت ر د م ه د ک ش ا د ا گ ر ز ا ب ت ر د م ه و ر گ ر ا د ا ت س

Διαβάστε περισσότερα

ل ی ل خ د و و ا د ه ا ر ج ا ه م ز ا ن ه ب 3 د ن ک م ی ل س ی ف ر ش ا د ی ش ر ف : ه د ی ک چ.

ل ی ل خ د و و ا د ه ا ر ج ا ه م ز ا ن ه ب 3 د ن ک م ی ل س ی ف ر ش ا د ی ش ر ف : ه د ی ک چ. شی ز و م آ ت دیری م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و می ال س ا د ا ز آ ه ا گ ش ن ا د 5931 پاییز 3 ه ر ا م ش م ه د ل ا س 5 1 1-12 3 ص ص ی ل ی ل خ د و و ا د ه ب ی ل غ ش ت ی ا ض ر ی ر گ ی ج ن

Διαβάστε περισσότερα

ر ی د م ی د ه م ن ر ی د م ن ا س ح ا ن

ر ی د م ی د ه م ن ر ی د م ن ا س ح ا ن ز ا س م ه ی ر ا م ع م ی ح ا ر ط و ی م ی ل ق ا ش ی ا س آ ی ا ه ص خ ا ش ی س ر ر ب ن ا ج ن ز ر ه ش م ی ل ق ا ا ب ی ر ی د م ی د ه م ن ا ر ی ا ن ا ر ه ت ر ت ش ا ک ل ا م ی ت ع ن ص ه ا گ ش ن ا د ی ر ه ش ی ز ی

Διαβάστε περισσότερα

2

2 م ط ا ل ع ه) ف ص ل ن ا م ه ر ه ب ر ی و م د ر ت آ م و ز ش د ا ن ش گ ا ه آ ز ا د ا س ال م و ا ح د گ ر م س ا ر س ا ل ه ف ت م ش م ا ر ه ب ه ا ر 9 3 ص ص -8 3 7 ح س ن ع ل ب ر ر س ر ا ب ط ه م ا ن ر ه ب ر ت ح

Διαβάστε περισσότερα

: ک ی ن و ر ت ک ل ا ت س پ

: ک ی ن و ر ت ک ل ا ت س پ 5 7 0-9 : 5 2 ی پ ا ی پ 1 9 3 1 م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ک ی م ه ی ش ن م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ه د و

Διαβάστε περισσότερα

م ح ق ق س ا خ ت ه () ک ا ر ش ن ا س- ف ص ل ن ا م ه ر ه ب ر ی و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م. ش م ا ر ه 1 ب ه ا ر 3 9 3 1 ص ص -8 6 1 1 3 4 1

Διαβάστε περισσότερα

ش ز و م آ ت ی ر ی د م د ش ر ا س ا ن ش ر ا ک. 4

ش ز و م آ ت ی ر ی د م د ش ر ا س ا ن ش ر ا ک. 4 ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3931 تابستان 2 ه ر ا م ش. م ت ش ه ل ا س 9 4-5 6 ص ص ه ل خ ا د م م د ع و ی ل د ا ب ت ن ی ر ف آ ل و

Διαβάστε περισσότερα

ا د ی بن ت و ی ولا ی ذ ار گ د ف ه ما ن ت

ا د ی بن ت و ی ولا ی ذ ار گ د ف ه ما ن ت ي ش ز و م آ ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا س م ز 4 ه ر ا م ش م ف ه ل ا س 1 4-55 ص ص ه ط س و م ع ط ق م ر خ د ن ا ز و م آ ش ن ا د س ر

Διαβάστε περισσότερα

ر ه ش ت ی ر ی د م ه ب ن ا د ن و ر ه ش د ا م ت ع ا ن ا ز ی م ی ب ا ی ز ر ا )

ر ه ش ت ی ر ی د م ه ب ن ا د ن و ر ه ش د ا م ت ع ا ن ا ز ی م ی ب ا ی ز ر ا ) ه) ن و م ن ی ش ه و ژ پ ی- م ل ع ه م ا ن ل ص ف ی ن ا س ن ا ی ا ی ف ا ر غ ج ر د و ن ی ا ه ش ر گ ن 1396 بهار م و د ه ر ا م ش م ه ن ل ا س ی ر ه ش ت ی ر ی د م ه ب ن ا د ن و ر ه ش د ا م ت ع ا ن ا ز ی م ی ب ا

Διαβάστε περισσότερα

2 - Robbins 3 - Al Arkoubi 4 - fry

2 - Robbins 3 - Al Arkoubi 4 - fry ف ص ل ن ا م ه ر ه ب ر ی و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م ش م ا ر ه 3 پاییز 3931 ص ص -6 4 1 1 1 2 ح م ی د ب ر ر س ی ر ا ب ط ه ب ی ن ر ه ب ر ی

Διαβάστε περισσότερα

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 م ط ا ل ع ه) پژوهشهای جامعه شناختی سال نهم / شماره سوم / پاییز 49 Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 ر ت ب ه ب ن د ی ع و ا م ل م و ث ر ب ر ا ر ز ی ا ب ی ع م ل ک ر د م د ی ر

Διαβάστε περισσότερα

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 م و ر د م ط ا ل ع ه :) پژوهشهای جامعه شناختی سال نهم / شماره سوم / پاییز 49 Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 ب ر ر س ی ر ا ب ط ه ب ن ی ا ن ه ا ی ا خ ال ق ی و خ و د ک ا ر

Διαβάστε περισσότερα

(Camelus dromedarius)

(Camelus dromedarius) س ع ی د و 6 ن ش ر ی ه م ی ک ر ب ی و ل و ژ ی د ا م پ ز ش ک ی / د و ر ه ی ا ز د ه م ش م ا ر ه د و م 1 4 9 3 پ ی ا پ ی 0-9 1: 3 7 9 ج د ا س ا ز ی ک و ه ا ن ه ا ی ر ا ن ی و ش ن ا س ا ی ی گ و ن ه ه ا ی ا ن

Διαβάστε περισσότερα

ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3 9 3 1 ر ا ه ب 1 ه ر ا م ش. م ت ش ه ل ا س 5 4-8 5 ص ص EFQM ی ل ا ع ت ل د م س ا س ا ر ب ی ن ا م ز

Διαβάστε περισσότερα

1 2 Marsick & Watkins 3. Saw, Wilday & Harte 4 -Chen & Kuo 5. Liao,Chang & Wu 6 -Garvin

1 2 Marsick & Watkins 3. Saw, Wilday & Harte 4 -Chen & Kuo 5. Liao,Chang & Wu 6 -Garvin ي ش ز و م آ ت ي ي د م و ی ب ه ه م ا ن ل ص ف ا س م گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3931 زمستان 4 ه ا م ش م ت ش ه ل ا س 1 1 1-10 3 ص ص ه د ن ی گ د ا ی ن ا م ز ا س ای ه ه ف ل ؤ م ت س ب ا ک ا ب

Διαβάστε περισσότερα

Gholami, S. Ph.D student of Educational Psychology, University of Tabriz, Iran

Gholami, S. Ph.D student of Educational Psychology, University of Tabriz, Iran Journal of Industrial/Organization Psychology Vol. 4/Issue14/Spring 2013 PP: 2135 ف ص ل ن ا م ه ر و ا ن ش ن ا س ص ن ع ت / س ا ز م ا ن س ا ل چ ه ا ر م. ش م ا ر ه چ ه ا ر د ه م بهار 2931 ص ص : 3 5 2 1 1

Διαβάστε περισσότερα

2. Cropanzano, Byrne, Bobocel & Rupp 3. Maslach, & Leiter 4. Kivimaki,, Elovainio,., Vahtera., & Ferrie 5. Masterson., Lewise, Goldman, & Taylor 6.

2. Cropanzano, Byrne, Bobocel & Rupp 3. Maslach, & Leiter 4. Kivimaki,, Elovainio,., Vahtera., & Ferrie 5. Masterson., Lewise, Goldman, & Taylor 6. و ب و ش ش ز و م آ ت ر د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و م ال س ا د ا ز آ ه ا گ ش ن ا د 3 9 3 1 ر ا ه ب 1 ه ر ا م ش. م ت ش ه ل ا س 9 9-4 1 1 ص ص ت ل ا د ع ن ی ب ط ا ب ت ر ا ن ی ی ب ت ر د

Διαβάστε περισσότερα

ن ه ع ال م ط ا بی ان ز م

ن ه ع ال م ط ا بی ان ز م ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ار س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 4931 بهار 1 ه ر ا م ش م ه ل ا س 5 7-4 9 ص ص ش ق ه ع ل ا ط م ا ب ا م ز ا س ر گ د ا ر ب ر ا ز گ ت م د خ ر ب

Διαβάστε περισσότερα

ق ل ر ا ق د ا ج س 2 م ی ر ک ر و پ د ی س 3

ق ل ر ا ق د ا ج س 2 م ی ر ک ر و پ د ی س 3 ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 4931 بهار 1 ه ر ا م ش م ه ل ا س 5 9-5 1 1 ص ص د ا و ج ت ا س س ؤ م ش ه و ژ پ ا س ا ش ر ا ک ا ه ف ر ح ا ه

Διαβάστε περισσότερα

د ا ز ز ا ب ه ش ر و ال د ن

د ا ز ز ا ب ه ش ر و ال د ن ه د ا ز ز ا ب ه ش ر و ال د ن ا ر م ا ک 3 9 3 1 م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ر ک ی م ه ی ر ش ن 1 3 1-12 4 : 9 2 ی پ ا ی پ ی ا ه ه ی و س ی و ر ی ن ا ر ی ا ل س ع ر و ب ن ز

Διαβάστε περισσότερα

ATLAS green. AfWA /AAE

ATLAS green. AfWA /AAE مج م و ع ة ا لم ن ت ج ا ت K S A ا إل ص د ا ر ا ل د و ل ي ٠ ١ مج م و ع ة ا لم ن ت ج ا ت ٠ ٣ ج و ھ ر ة( ع د ت خ ص ص ة م TENVIRONMENTALLY FRIENDLY PRODUC ح د د ة م ا ل ھ و ي ة و ا ال ب ت ك ا ر و ا ل ط م و

Διαβάστε περισσότερα

ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا ت س ب ا ت 2 ه ر ا م ش م ت ف ه ل ا س 5 4-8 5 ص ص د ا ز آ ه ا گ ش ن ا د ن ا ي و ج ش ن ا

Διαβάστε περισσότερα

2. Knowledge Management

2. Knowledge Management ز و م آ ت در م و ر ب ر م ا ن ل ص ف ر ا س م ر گ د ح ا و م ال س ا د ا ز آ ا گ ن ا د 5 9 3 1 ر ا ب 1 ر ا م م د ل ا س 1 0 1-9 1 1 ص ص ن س ح ل ک ر ا د ا ر د ن ا م ز ا س ت م ال س ا ب ن ا د ت ر د م ر ا ر ق ت

Διαβάστε περισσότερα

ا ر ف ی و ن ع م ی ر ب ه ر ل د م س ا س ا ر ب 2

ا ر ف ی و ن ع م ی ر ب ه ر ل د م س ا س ا ر ب 2 ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3931 تابستان 2 ه ر ا م ش. م ت ش ه ل ا س 9 5 1-9 7 1 ص ص ن ا ر ب د ه ا گ د د ز ا و ن ع م ر ب ه ر ا ه

Διαβάστε περισσότερα

ی ا و ق ت د و ع س م ن

ی ا و ق ت د و ع س م ن ه د ک چ ت م ال س ر گ ش د ر گ ه ع س و ت ر د ر ث و م ل م ا و ع د ب ت و ل و ا و ا س ا ش ر و پ ل ر ب ک ا ل ع د س ا ر ا ا ه ف ص ا ه و ژ پ ص خ ا ش ه ا گ ش ه و ژ پ ر ا د ا ت س ا ا و ق ت د و ع س م ا ر ا ا ه ف

Διαβάστε περισσότερα

ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر غ ا ر م ن ا ت س ر ه ش ه ط س و ت م س ر ا د م 3

ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر غ ا ر م ن ا ت س ر ه ش ه ط س و ت م س ر ا د م 3 ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا ت س ب ا ت 2 ه ر ا م ش م ت ف ه ل ا س 1 3 1-4 4 1 ص ص ن ا ر دبی نی ا م ز ا س د ه ع ت و تی

Διαβάστε περισσότερα

ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا ت س م ز 4 ه ر ا م ش م ت ف ه ل ا س 7 5-70 ص ص ه ر و د م و س ل ا س ن ا ز و م آ ش ن ا د ن

Διαβάστε περισσότερα

ف ص ل ن ا م ه ر ه ب ر و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م. ش م ا ر ه 2 تابستان 3931 ص ص -7 8 6 7 ت ب ن ر ا ب ط ه ب ن ف ر ه ن گ س ا ز م ا ن و س ال

Διαβάστε περισσότερα

Employees in Oil Refinery Company

Employees in Oil Refinery Company Journal of Industrial/Organization Psychology Vol 3/Issue10/Spring 2012 PP: 73-84 ی ن ا م ز ا س / ی ت ع ن ص ی س ا ن ش ن ا و ر ه م ا ن ل ص ف 1 9 3 1 ر ا ه ب م ه د ه ر ا م ش م و س ل ا س 3 7-4 8 : ص ص ن ا

Διαβάστε περισσότερα

Phallocryptus spinosa ر ا

Phallocryptus spinosa ر ا 0 8 7 ا و لي ن گ ز ا ر ش م ش ا ه د ه Phallocryptus spinosa ا س ت ا ن ه ا ی ا ز و ي ز د ف ا ر س د ر ج ن و ب Anostraca( )Crustaceae; اي ر ا ن ب ه ر و ز 4 4 2 آ ت ش ب ا ر *, ر ا م ي ن م ن ا ف ف ر ن ا ص ر

Διαβάστε περισσότερα

ص خ ش ش ن ا د ت ی ر ی د م ت ر ا ه م و ی ن ا م ز ا س ت ی ا م ح ز ا ک ا ر د ا ن ی ب ه ط ب ا ر ی س ر ر ب س

ص خ ش ش ن ا د ت ی ر ی د م ت ر ا ه م و ی ن ا م ز ا س ت ی ا م ح ز ا ک ا ر د ا ن ی ب ه ط ب ا ر ی س ر ر ب س ر 2 ف د ا ه ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 3931 تابستا 2 ه ر ا م ش. م ت ش ه ل ا س 7 2-7 4 ص ص ص خ ش ش ا د ت ر د م ت ر ا ه م و ا م ز ا س

Διαβάστε περισσότερα

ر ک خواهد کمک ر گ ی د ن ا م ز ا س ر د ی ر ا ک م ا ج ن ا ه ب د ا ی ز ل ا م ت ح ا ه ب و ر ا ک ک ی م ا ج ن ا ر د ی ن ا م ز ا س 6

ر ک خواهد کمک ر گ ی د ن ا م ز ا س ر د ی ر ا ک م ا ج ن ا ه ب د ا ی ز ل ا م ت ح ا ه ب و ر ا ک ک ی م ا ج ن ا ر د ی ن ا م ز ا س 6 م ط ا ل ع ه) ک م ا ل ف ص ل ن ا م ه ه ب ی و م د ي ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ م س ا س ا ل ه ش ت م. ش م ا ه 2 تابستان 3931 ص ص -8 5 1 1 9 3 پ ی ش ب ی ن ی ف ت ا ش ه و ن د ی

Διαβάστε περισσότερα

Bacaan Doa dan Dzikir serta Taubat pilihan

Bacaan Doa dan Dzikir serta Taubat pilihan ijk Bacaan Doa dan Dzikir serta Taubat pilihan Dibawah ini adalah Dzikir Nabawiyah yang dibaca / diajarkan oleh Rasulullah SAW untuk ummatnya dan Nabi Muhammad SAW menganjurkan untuk diamalkan semua ummatnya.

Διαβάστε περισσότερα

S Ô Ñ ª ^ ھ ھ ھ ھ ا حل م د هلل ا ل ذ ي أ ك ر م ا ل ب رش ي ة ة ب م ب ع ث ا ل ر مح ة ا مل ه د ا ة و ا ل ن ع م ة املسداة خرية خ ل ق ا هلل ا ل ن ب ي ا مل ص ط ف ى و ا ل ر س و ل ا مل ج ت ب ى ن ب ي ن ا و إ م

Διαβάστε περισσότερα

Οι 5 πυλώνες της πίστης: Μέρος 2 Πίστη στους αγγέλους

Οι 5 πυλώνες της πίστης: Μέρος 2 Πίστη στους αγγέλους Οι 5 πυλώνες της πίστης: Μέρος 2 Πίστη στους αγγέλους أركان اإلميان - الركن الثاين : اإلميان ابملالئكة Άχμαντ Μ. Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org - Τζαμί «Σάλαφ ους Σαάλιχ»

Διαβάστε περισσότερα

الركن الخامس من اركان االيمان اإليمان باليوم

الركن الخامس من اركان االيمان اإليمان باليوم Οι 6 πυλώνες της πίστης: Μέρος 5 Πίστη στην Ημέρα της Κρίσης الركن الخامس من اركان االيمان اإليمان باليوم اآلخر Άχμαντ Μ.Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org Τζαμί «Σάλαφ ους

Διαβάστε περισσότερα

خ ہ ت ارف ادب جا زہ [+ ا ] through a cough and hiccough, he still had a rough

خ ہ ت ارف ادب جا زہ [+ ا ] through a cough and hiccough, he still had a rough ا ک( و ا ہ خان ب ری" ا جم ح د ث ان تح ات ا ہ پ جاب ) اج ) خ ا اور ت ظ ا واز ہ خ ہ ہ ا با د ا پر پا جا وا زبا وں ا ک روا ت ہ ان وت اور خ ا ا ار ں ت اد پا ا جاتا ہ تبد اں وت ات وا ن وجہ و وع پز ر وت ں جو

Διαβάστε περισσότερα

Benar sekali Allah memberi informasi dalam Quran dan lebih-lebih melalui lisan RasulNya Muhammad SAW tentang siksa dan nikmat kubur.

Benar sekali Allah memberi informasi dalam Quran dan lebih-lebih melalui lisan RasulNya Muhammad SAW tentang siksa dan nikmat kubur. ( ijk Assalamu 'Alaikum Wr.Wb. Pak Dasrul, Benar sekali Allah memberi informasi dalam Quran dan lebih-lebih melalui lisan RasulNya Muhammad SAW tentang siksa dan nikmat kubur. Kepada Fir'un di dalam kuburnya

Διαβάστε περισσότερα

الركن الثالث من أركان اإليمان: اإليمان بالكتب

الركن الثالث من أركان اإليمان: اإليمان بالكتب Οι 6 πυλώνες της πίστης: Μέρος 3 Πίστη στα βιβλία του Αλλάχ الركن الثالث من أركان اإليمان: اإليمان بالكتب Άχμαντ Μ.Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org Τζαμί «Σάλαφ ους Σαάλιχ»

Διαβάστε περισσότερα

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21

Διαβάστε περισσότερα

کار گا آه سضی کاربزد آهار زم افشار SPSS در پژ ص

کار گا آه سضی کاربزد آهار زم افشار SPSS در پژ ص کار گا آه سضی کاربزد آهار زم افشار SPSS در پژ ص عضو By:Reza Mazloum, PhD candidate 1 سیدرضا مظلوم ىیأت علمی دانشکده پرستاری و مامایی دکتری پرستاری rmazlomr@mums.ac.ir آهار تحلیلی یا است باطی Analytic Statistics

Διαβάστε περισσότερα

A Novel Fluorescence Assay for the Activity of Restriction Endonuclease Based on Molecular Beacon

A Novel Fluorescence Assay for the Activity of Restriction Endonuclease Based on Molecular Beacon 13 1 Vol13 No1 29 2 Life Science Research Feb 29 29 *,,,,, 4182 :,, (Molecular Beacon, MB),,,, 5~5 U / ml, 5 U / ml, Alu : ; ; : Q55 : A : 17-7847(29)1-6-5 A Novel Fluorescence Assay for the Activity of

Διαβάστε περισσότερα

a;$ ag\a$ d D lb\ a;$ d d\ a$ d Dcn\

a;$ ag\a$ d D lb\ a;$ d d\ a$ d Dcn\ Ἀρχιμ. Ἀριστοβούλου Κυριαζῆ, Μαθήματα ἐκκλ. Μουσικῆς 1 Μέρος 1 ον, Θ. Λειτουργία Ἀραβική διά ἀρχαρίους, ἦχος πλ. Δ على للحن الثامن Beginning of the Divine Liturgy Ἦχος πλ. Δ weνη1 \s;$ s;cn\ s;$ 1a5 \

Διαβάστε περισσότερα

ارزیابی ريش ای مختلف برآيرد تبخیر بر مبىای تابص در ایستگا سیى پتیک سمىان

ارزیابی ريش ای مختلف برآيرد تبخیر بر مبىای تابص در ایستگا سیى پتیک سمىان ارزیابی ريش ای مختلف برآيرد تبخیر بر مبىای تابص در ایستگا سیى پتیک سمىان 3 1 مسع د سمیعی حاتم حیاتی میالد میرزائی -1 - واسض اس اسضذ آتخيضداسي اداس ول ه لاتغ يثيؼل آتخيلضداسي ا ل اى فلاسسmassamie@yahoo.com

Διαβάστε περισσότερα

ﯽﺳﻮﻃ ﺮﯿﺼﻧ ﻪﺟاﻮﺧ ﯽﺘﻌﻨﺻ هﺎﮕﺸﻧاد

ﯽﺳﻮﻃ ﺮﯿﺼﻧ ﻪﺟاﻮﺧ ﯽﺘﻌﻨﺻ هﺎﮕﺸﻧاد دانشگاه صنعتی خواجه نصیر طوسی دانشکده برق - گروه کنترل آزمایشگاه کنترل سیستمهای خطی گزارش کار نمونه تابستان 383 به نام خدا گزارش کار آزمایش اول عنوان آزمایش: آشنایی با نحوه پیاده سازی الکترونیکی فرایندها

Διαβάστε περισσότερα

ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ

ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΡΓΑΣΤΗΡΙΟ ΠΟΙΟΤΙΚΟΥ ΕΛΕΓΧΟΥ & ΥΓΙΕΙΝΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΠΟΤΩΝ Π.Μ.Σ. «ΕΠΙΣΤΗΜΗ & ΤΕΧΝΟΛΟΓΙΑ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ» Η ΕΠΙΔΡΑΣΗ

Διαβάστε περισσότερα

اثر عصارۀ آبی بادرنجبویه officinalis( )Melissa بر پاسخ ایمنی و عملکرد جوجههای گوشتی

اثر عصارۀ آبی بادرنجبویه officinalis( )Melissa بر پاسخ ایمنی و عملکرد جوجههای گوشتی صفحههای 281-290 اثر عصارۀ آبی بادرنجبویه officinalis( )Melissa بر پاسخ ایمنی و عملکرد جوجههای گوشتی *2 1 فائزه عبدینژاد و مهرداد محمدی 1. دانشآموخته کارشناسیارشد گروه علوم دامی دانشکدۀ علوم کشاورزی دانشگاه

Διαβάστε περισσότερα

ﻰﺿﺎﻳﺭ ﻥﺎﺘﺴﺑﺩ ﻢﺸﺷ ۱۳۹١

ﻰﺿﺎﻳﺭ ﻥﺎﺘﺴﺑﺩ ﻢﺸﺷ ۱۳۹١ رياضى ششم دبستان ۱۳۹١ وزارت آموزش و پرورش سازمان پژوهش و برنامه ريزی آموزشی برنامهريزی محتوا و نظارت بر تا ليف: دفتر تا ليف کتابهای درسی ابتدايی و متوسطه نظری نام کتاب: رياضی ششم دبستان ۳۴/۶ مو ل فان:

Διαβάστε περισσότερα

فصل 5 :اصل گسترش و اعداد فازی

فصل 5 :اصل گسترش و اعداد فازی فصل 5 :اصل گسترش و اعداد فازی : 1-5 اصل گسترش در ریاضیات معمولی یکی از مهمترین ابزارها تابع می باشد.تابع یک نوع رابطه خاص می باشد رابطه ای که در نمایش زوج مرتبی عنصر اول تکراری نداشته باشد.معموال تابع

Διαβάστε περισσότερα

ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.

ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο. Α.Τ.Ε.Ι. ΚΡΗΤΗΣ Σ.Ε.Υ.Π. ΤΜΗΜΑ ΚΟΙΝΩΝΙΚΗΣ ΕΡΓΑΣΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Τίτλος: «Χρήση ψυχοτρόπων ουσιών από μαθητές Α Λυκείου της Δευτεροβάθμιας Εκπαίδευσης του Νομού Ηρακλείου και ο ρόλος του Κοινωνικού

Διαβάστε περισσότερα

ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ

ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΓΕΩΠΟΝΙΑΣ, ΔΑΣΟΛΟΓΙΑΣ ΚΑΙ ΦΥΣΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ ΤΟΜΕΑΣ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ Πτυχιούχου Γεωπόνου Κατόχου Μεταπτυχιακού

Διαβάστε περισσότερα

شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران )

شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران ) شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران ) 1 فاطمه کریمي دانشجوي دوره کارشناسي ارشد رشته مدیریت فناوري اطالعات دانشگاه آزاد اسالمي تهران ایران fatima.karimi04@gmail.com

Διαβάστε περισσότερα

هکا یک ساز ا ضار ا/ سال 1395/ د ر 6/ ضوار 4/ صفح DOI: **** حرارتی س ل ل ای دا طج ی کارض اس ارضذ ه ذسی هکا یک دا طگا عل م ف ى بابل بابل 2

هکا یک ساز ا ضار ا/ سال 1395/ د ر 6/ ضوار 4/ صفح DOI: **** حرارتی س ل ل ای دا طج ی کارض اس ارضذ ه ذسی هکا یک دا طگا عل م ف ى بابل بابل 2 ی س ا هکا یک ساز ا ضار ا/ سال 395/ د ر 6/ ضوار 4/ صفح 262-249 مجله علم ی ژپو هش ی م کانیک سازه اه و شاره اه DOI: **** اثر افسایص تعذاد چیذهاى ل ل یال گرم بر رفتار ر ب هاد تغییر فاز د ذ در هبذل حرارتی س

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ & ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΟΜΕΑΣ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ Υ ΑΤΙΚΩΝ & Ε ΑΦΙΚΩΝ ΠΟΡΩΝ ΕΠΙΒΑΡΥΝΣΗ ΜΕ ΒΑΡΕΑ ΜΕΤΑΛΛΑ Ε ΑΦΩΝ ΤΗΣ

Διαβάστε περισσότερα

یکاروخ یاهدیئولکوردیه یرب میزنآ یزاس لدم ندرک خرس نغور بذج هدش هعطق ینیمز بیس :یدیلک یاه هژاو

یکاروخ یاهدیئولکوردیه یرب میزنآ یزاس لدم ندرک خرس نغور بذج هدش هعطق ینیمز بیس :یدیلک یاه هژاو 21 1392 پاییز 21-36 صفحه 1 شماره اول سال غذایی نوین فناوریهای و علوم فصلنامه روغن جذب کاهش روی خوراکی هیدروکلوئیدهای و آنزیمبری تأثیر شده قطعه سیبزمینی سرخکردن طی 2 خیابانی صوتی محمود و 2* نیا دهقان جالل

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΥΠΟΛΟΓΙΣΤΩΝ Σύστημα Διαχείρισης Διαχρονικών Δεδομένων για Γονίδια ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Διαβάστε περισσότερα

هدف از این آزمایش آشنایی با برخی قضایاي ساده و در عین حال مهم مدار از قبیل قانون اهم جمع آثار مدار تونن و نورتن

هدف از این آزمایش آشنایی با برخی قضایاي ساده و در عین حال مهم مدار از قبیل قانون اهم جمع آثار مدار تونن و نورتن آزما ی ش سوم: ربرسی اقنون ا ه م و قوانین ولتاژ و جریان اهی کیرشهف قوانین میسقت ولتاژ و میسقت جریان ربرسی مدا ر تونن و نورتن قضیه ااقتنل حدا کثر توان و ربرسی مدا ر پ ل و تس ون هدف از این آزمایش آشنایی با

Διαβάστε περισσότερα

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση κατά του ιού της γρίπης Σε δομές του νομού Λάρισας

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση κατά του ιού της γρίπης Σε δομές του νομού Λάρισας ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΡΩΤΟΒΑΘΜΙΑ ΦΡΟΝΤΙΔΑ ΥΓΕΙΑΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.36 Έκδοση ενημερωτικών φυλλαδίων Υπεύθυνος φορέας: Κέντρο Ελέγχου

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία "Η ΣΗΜΑΝΤΙΚΟΤΗΤΑ ΤΟΥ ΜΗΤΡΙΚΟΥ ΘΗΛΑΣΜΟΥ ΣΤΗ ΠΡΟΛΗΨΗ ΤΗΣ ΠΑΙΔΙΚΗΣ ΠΑΧΥΣΑΡΚΙΑΣ" Ειρήνη Σωτηρίου Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. Χρυσάνθη Στυλιανού Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση

Διαβάστε περισσότερα

Medicago marina 2012

Medicago marina 2012 ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ Τµήµα Γεωπονικής Βιοτεχνολογίας ΣΚΑΓΙΑ. ΑΓΓΕΛΙΚΗ ΜΕΤΑΠΤΥΧΙΑΚΗ ΙΑΤΡΙΒΗ Χαρακτηρισµός και Φυλογενετική ανάλυση συµβιωτικών βακτηρίων που αποµονώθηκαν από τα φυµάτια της Medicago

Διαβάστε περισσότερα

Λιμνοποτάμιο Περιβάλλον και Οργανισμοί

Λιμνοποτάμιο Περιβάλλον και Οργανισμοί ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Λιμνοποτάμιο Περιβάλλον και Οργανισμοί Ενότητα 14: Επίδραση ρύπανσης στα ψάρια Επίκ. Καθηγήτρια Δήμητρα Μπόμπορη Άδειες Χρήσης Το παρόν

Διαβάστε περισσότερα

Archive of SID. یا یات کار دی وا د لا جان مقدمه 1 2 چکیده 1 SDE. ا درس الکترونیکی:

Archive of SID.  یا یات کار دی وا د لا جان مقدمه 1 2 چکیده 1 SDE. ا درس الکترونیکی: ج ه ر یا یات کار دی وا د لا جان سال م ماره ١ (ایپپی ٢۴ ھار ٨٩ ص ص ٩٣-١٠١ مقایسه عددی جواب معادله دیفرانسیل تصادفی با نوفه سفید گاوسی و پواسونی رمضان رضاییان رحمان فرنوش. چکیده دانشکده علوم پایه دانشگاه

Διαβάστε περισσότερα

Διπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης

Διπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης Διπλωματική Εργασία Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική Αντωνίου Φάνης Επιβλέπουσες: Θεοδώρα Παπαδοπούλου, Ομότιμη Καθηγήτρια ΕΜΠ Ζάννη-Βλαστού Ρόζα, Καθηγήτρια

Διαβάστε περισσότερα

تلفات خط انتقال ابررسی یک شبکة قدرت با 2 به شبکة شکل زیر توجه کنید. ژنراتور فرضیات شبکه: میباشد. تلفات خط انتقال با مربع توان انتقالی متناسب

تلفات خط انتقال ابررسی یک شبکة قدرت با 2 به شبکة شکل زیر توجه کنید. ژنراتور فرضیات شبکه: میباشد. تلفات خط انتقال با مربع توان انتقالی متناسب تلفات خط انتقال ابررسی یک شبکة قدرت با 2 به شبکة شکل زیر توجه کنید. ژنراتور فرضیات شبکه: این شبکه دارای دو واحد کامال یکسان آنها 400 MW میباشد. است تلفات خط انتقال با مربع توان انتقالی متناسب و حداکثر

Διαβάστε περισσότερα

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Τομέας Περιβαλλοντικής Υδραυλικής και Γεωπεριβαλλοντικής Μηχανικής (III) Εργαστήριο Γεωπεριβαλλοντικής Μηχανικής TECHNICAL UNIVERSITY OF CRETE SCHOOL of

Διαβάστε περισσότερα

نقػ افؽبظبزی و گسارغ دهی در پیؽگیری از خطبهب در بیمبرظتبنهب

نقػ افؽبظبزی و گسارغ دهی در پیؽگیری از خطبهب در بیمبرظتبنهب اصلی مقبله مجله ارتقبی ایمنی و پیؽگیری از مصذومیت هب ز ض 2. قوبض 2. تبثؿتبى 393 نفحبت 73 تب 84 (Original Article) نقػ افؽبظبزی و گسارغ دهی در پیؽگیری از خطبهب در بیمبرظتبنهب 2 * امیر اؼکبن نصیری پور پوران

Διαβάστε περισσότερα

Επίδραση της Συμβολαιακής Γεωργίας στην Χρηματοοικονομική Διοίκηση των Επιχειρήσεων Τροφίμων. Ιωάννης Γκανάς

Επίδραση της Συμβολαιακής Γεωργίας στην Χρηματοοικονομική Διοίκηση των Επιχειρήσεων Τροφίμων. Ιωάννης Γκανάς ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ ΚΑΙ ΑΝΑΠΤΥΞΗΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΟΥ ΑΝΘΡΩΠΟΥ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΟΡΓΑΝΩΣΗ ΚΑΙ ΔΙΟΙΚΗΣΗ ΕΠΙΧΕΙΡΗΣΕΩΝ ΤΡΟΦΙΜΩΝ & ΓΕΩΡΓΙΑΣ

Διαβάστε περισσότερα

Code Breaker. TEACHER s NOTES

Code Breaker. TEACHER s NOTES TEACHER s NOTES Time: 50 minutes Learning Outcomes: To relate the genetic code to the assembly of proteins To summarize factors that lead to different types of mutations To distinguish among positive,

Διαβάστε περισσότερα

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΨΥΧΟΛΟΓΙΚΕΣ ΕΠΙΠΤΩΣΕΙΣ ΣΕ ΓΥΝΑΙΚΕΣ ΜΕΤΑ ΑΠΟ ΜΑΣΤΕΚΤΟΜΗ ΓΕΩΡΓΙΑ ΤΡΙΣΟΚΚΑ Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ

Διαβάστε περισσότερα

Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ

Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΠΑΡΑΡΤΗΜΑ ΚΑΣΤΟΡΙΑΣ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η προβολή επιστημονικών θεμάτων από τα ελληνικά ΜΜΕ : Η κάλυψή τους στον ελληνικό ημερήσιο τύπο Σαραλιώτου

Διαβάστε περισσότερα

ا جزء ا ثا ا شد ػ ذشج ح

ا جزء ا ثا ا شد ػ ذشج ح ا جزء ا ثا ا شد ػ ذشج ح ) ش د ج ( ا صخش وا د ا ض ح ) 4 : ( 1 و 10 Holy_bible_1 ا ضؤاي ثاي اخش 9-4: او 10 ج ؼ ششت ا ششاتا احذا س ح ا - أل وا ا ششت صخشج س ح ح ذاتؼر 1Co 10:4 ا صخشج وا د ا ض ح. ال جشب ا ض

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Πτυχιακή εργασία ΓΝΩΣΕΙΣ ΚΑΙ ΣΤΑΣΕΙΣ ΝΟΣΗΛΕΥΤΩΝ ΠΡΟΣ ΤΟΥΣ ΦΟΡΕΙΣ ΜΕ ΣΥΝΔΡΟΜΟ ΕΠΙΚΤΗΤΗΣ ΑΝΟΣΟΑΝΕΠΑΡΚΕΙΑΣ (AIDS) Αλέξης Δημήτρη Α.Φ.Τ: 20085675385 Λεμεσός

Διαβάστε περισσότερα

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No 2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:

Διαβάστε περισσότερα

انجزء انصانس نهسد ػه شث ح ا االنف ان اء انثدا ح ان ا ح اال ل االخس يضاف نضفس انسؤ ا

انجزء انصانس نهسد ػه شث ح ا االنف ان اء انثدا ح ان ا ح اال ل االخس يضاف نضفس انسؤ ا اال ل االخس زؤ 17 1: Holy_bible_1 انجزء انصانس نهسد ػه شث ح ا االنف ان اء انثدا ح ان ا ح اال ل االخس يضاف نضفس انسؤ ا 3( صفس زؤ ا د ا انال ذ 17 1: ف ه ا ز أ ر ص ق ط د ػ د ز ج ه ك د ف ض غ د ان ػ ه ق ائ

Διαβάστε περισσότερα

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns 2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in

Διαβάστε περισσότερα

Αξιολόγηση Ημιαγώγιμων Υμενίων Σεληνιούχου Καδμίου Σε Υπόστρωμα Νικελίου Για Φωτοβολταϊκές Εφαρμογές

Αξιολόγηση Ημιαγώγιμων Υμενίων Σεληνιούχου Καδμίου Σε Υπόστρωμα Νικελίου Για Φωτοβολταϊκές Εφαρμογές ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΜΕΤΑΔΟΣΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΛΙΚΩΝ Αξιολόγηση Ημιαγώγιμων Υμενίων Σεληνιούχου Καδμίου Σε Υπόστρωμα

Διαβάστε περισσότερα

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure. Otorhinolaryngologia - Head and Neck Surgery Issue 50, October - November - December 2012, pages 18-22 ORIGINAL REVIEW ARITCLE Mitomycin C application for the prevention of postoperative synechiae formation

Διαβάστε περισσότερα

ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΣΕΞΟΥΑΛΙΚΗΣ ΔΡΑΣΤΗΡΙΟΤΗΤΑΣ ΤΩΝ ΓΥΝΑΙΚΩΝ ΚΑΤΑ ΤΗ ΔΙΑΡΚΕΙΑ ΤΗΣ ΕΓΚΥΜΟΣΥΝΗΣ ΑΝΔΡΕΟΥ ΣΤΕΦΑΝΙΑ Λεμεσός 2012 i ii ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

ΣΤΗΝ ΟΛΟΚΛΗΡΩΜΕΝΗ ΙΑΧΕΙΡΙΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΑΓΡΟΤΙΚΟΥ ΧΩΡΟΥ ΠΕΡΙΒΑΛΛΟΝΤΙΚΕΣ ΜΗ ΚΥΒΕΡΝΗΤΙΚΕΣ ΟΡΓΑΝΩΣΕΙΣ ΠΟΣΟ «ΠΡΑΣΙΝΕΣ ΕΙΝΑΙ»;

ΣΤΗΝ ΟΛΟΚΛΗΡΩΜΕΝΗ ΙΑΧΕΙΡΙΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΑΓΡΟΤΙΚΟΥ ΧΩΡΟΥ ΠΕΡΙΒΑΛΛΟΝΤΙΚΕΣ ΜΗ ΚΥΒΕΡΝΗΤΙΚΕΣ ΟΡΓΑΝΩΣΕΙΣ ΠΟΣΟ «ΠΡΑΣΙΝΕΣ ΕΙΝΑΙ»; Γ Ε Ω Π Ο Ν Ι Κ Ο ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ:Αγροτικής οικονοµιας & Ανάπτυξης ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥ ΩΝ ΣΤΗΝ ΟΛΟΚΛΗΡΩΜΕΝΗ ΙΑΧΕΙΡΙΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΑΓΡΟΤΙΚΟΥ ΧΩΡΟΥ ΠΕΡΙΒΑΛΛΟΝΤΙΚΕΣ ΜΗ ΚΥΒΕΡΝΗΤΙΚΕΣ ΟΡΓΑΝΩΣΕΙΣ

Διαβάστε περισσότερα

Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΑΙΘΑΝΟΛΗΣ,ΤΗΣ ΜΕΘΑΝΟΛΗΣ ΚΑΙ ΤΟΥ ΑΙΘΥΛΟΤΡΙΤΟΤΑΓΗ ΒΟΥΤΥΛΑΙΘΕΡΑ ΣΤΙΣ ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΒΕΝΖΙΝΗΣ

Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΑΙΘΑΝΟΛΗΣ,ΤΗΣ ΜΕΘΑΝΟΛΗΣ ΚΑΙ ΤΟΥ ΑΙΘΥΛΟΤΡΙΤΟΤΑΓΗ ΒΟΥΤΥΛΑΙΘΕΡΑ ΣΤΙΣ ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΒΕΝΖΙΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΚΩΝ ΕΦΑΡΜΟΓΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΑΙΘΑΝΟΛΗΣ,ΤΗΣ ΜΕΘΑΝΟΛΗΣ ΚΑΙ ΤΟΥ ΑΙΘΥΛΟΤΡΙΤΟΤΑΓΗ ΒΟΥΤΥΛΑΙΘΕΡΑ ΣΤΙΣ ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΒΕΝΖΙΝΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ

Διαβάστε περισσότερα

Εἰρηνικά Θείας Λειτουργίας Κλασσικά Ἦχος ςeνη1

Εἰρηνικά Θείας Λειτουργίας Κλασσικά Ἦχος ςeνη1 Εἰρηνικά Θείας Λειτουργίας Κλασσικά Ἦχος ςeνη1 nassj\pa #gif j \ndcnf: j[ aa\x#pa duaγ d \ndlb Κσ ρι ε ε λε ε ε η ζον Κσ ρι ε ε λε ε ε η ζον Ya a ra ab u u u ur 7am Ya a ra ab u u u ur 7am Го спо ди по

Διαβάστε περισσότερα

Refugee Phrasebook/Greece March 2016-c

Refugee Phrasebook/Greece March 2016-c Refugee Phrasebook/Greece March 2016-c Arabic / Farsi / Urdu / Greek alphabet / Greek phonetic / English These icons come from the The Noun Project (CC-BY 3.0, not edited). Source: https://thenounproject.com/.

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΠΩΣ Η ΚΑΤΑΝΑΛΩΣΗ ΦΡΟΥΤΩΝ ΚΑΙ ΛΑΧΑΝΙΚΩΝ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ Όνομα φοιτήτριας ΚΑΛΑΠΟΔΑ ΜΑΡΚΕΛΛΑ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός

Διαβάστε περισσότερα

چگونگي عملكرد درايوهاي كنترل كننده دور موتورهاي الكتريكي بازرس فني برق واحد فني و مهندسي سيمان خاش

چگونگي عملكرد درايوهاي كنترل كننده دور موتورهاي الكتريكي بازرس فني برق واحد فني و مهندسي سيمان خاش مهندس وحيد گودرزي چگونگي عملكرد درايوهاي كنترل كننده دور موتورهاي الكتريكي بازرس فني برق واحد فني و مهندسي سيمان خاش 1- مقدمه موتوره ای DC اولین وس یله تبدیل ان رژی الکتریکی به ان رژی مکانیکی بودند. موتورهای

Διαβάστε περισσότερα

Μεταπτυχιακό Πρόγραμμα Κλινικής Χημείας. Τμήμα Χημείας, ΕΚΠΑ. Παρουσίαση και αξιολόγηση 20 ετών συνεχούς λειτουργίας

Μεταπτυχιακό Πρόγραμμα Κλινικής Χημείας. Τμήμα Χημείας, ΕΚΠΑ. Παρουσίαση και αξιολόγηση 20 ετών συνεχούς λειτουργίας Μεταπτυχιακό Πρόγραμμα Κλινικής Χημείας Τμήμα Χημείας, ΕΚΠΑ Παρουσίαση και αξιολόγηση 20 ετών συνεχούς λειτουργίας Εύη Λιανίδου Καθηγήτρια Αναλυτικής Χημείας Κλινικής Χημείας Τμήμα Χημείας, Πανεπιστήμιο

Διαβάστε περισσότερα

Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης

Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης Τρίμηνη, ηλεκτρονική έκδοση του Τμήματος Νοσηλευτικής Α, Τεχνολογικό Εκπαιδευτικό Ίδρυμα Αθήνας _ΑΝΑΣΚΟΠΗΣΗ_ Πολυκανδριώτη Μαρία 1, Φούκα Γεωργία 2 1. Καθηγήτρια Εφαρμογών Νοσηλευτικής Α, ΤΕΙ Αθήνας 2.

Διαβάστε περισσότερα

Ελαφρές κυψελωτές πλάκες - ένα νέο προϊόν για την επιπλοποιία και ξυλουργική. ΒΑΣΙΛΕΙΟΥ ΒΑΣΙΛΕΙΟΣ και ΜΠΑΡΜΠΟΥΤΗΣ ΙΩΑΝΝΗΣ

Ελαφρές κυψελωτές πλάκες - ένα νέο προϊόν για την επιπλοποιία και ξυλουργική. ΒΑΣΙΛΕΙΟΥ ΒΑΣΙΛΕΙΟΣ και ΜΠΑΡΜΠΟΥΤΗΣ ΙΩΑΝΝΗΣ Ελαφρές κυψελωτές πλάκες - ένα νέο προϊόν για την επιπλοποιία και ξυλουργική ΒΑΣΙΛΕΙΟΥ ΒΑΣΙΛΕΙΟΣ και ΜΠΑΡΜΠΟΥΤΗΣ ΙΩΑΝΝΗΣ Αριστοτέλειο Πανεπιστήµιο Θεσσαλονίκης Σχολή ασολογίας και Φυσικού Περιβάλλοντος,

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΗΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΗΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΗΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Πτυχιακή εργασία ΠΑΡΑΓΩΓΗ ΦΟΥΜΟΝΙΣΙΝΩΝ ΣΤΟΥΣ ΜΑΥΡΟΥΣ ΑΣΠΕΡΓΙΛΛΟΥΣ Λία Μάρκου Λεμεσός 2016 i ii ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

Εξοικονόμηση Ενέργειας σε Εγκαταστάσεις Δρόμων, με Ρύθμιση (Dimming) ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Εξοικονόμηση Ενέργειας σε Εγκαταστάσεις Δρόμων, με Ρύθμιση (Dimming) ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΗΛΕΚΤΡΙΚΗΣ ΙΣΧΥΟΣ Εξοικονόμηση Ενέργειας σε Εγκαταστάσεις Δρόμων, με Ρύθμιση (Dimming) ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Νικηφόρος

Διαβάστε περισσότερα

يﺮﻫز ﺖﺠﺣ ﺐﺳﺎﻨﺗ ﺚﺤﺒﻣ.ﺪﯿﺘﺴﻫ ﺎﻨﺷآ ﯽﯾاﺪﺘﺑا ﻊﻄﻘﻣ زا ﺐﺳﺎﻨﺗ ﺚﺤﺒﻣ ﺎﺑ ﺎﻤﺷ ﺰﯾﺰﻋ زﻮﻣآ ﺶﻧاد ﺪ

يﺮﻫز ﺖﺠﺣ ﺐﺳﺎﻨﺗ ﺚﺤﺒﻣ.ﺪﯿﺘﺴﻫ ﺎﻨﺷآ ﯽﯾاﺪﺘﺑا ﻊﻄﻘﻣ زا ﺐﺳﺎﻨﺗ ﺚﺤﺒﻣ ﺎﺑ ﺎﻤﺷ ﺰﯾﺰﻋ زﻮﻣآ ﺶﻧاد ﺪ مبحث تناسب حجت زهري دانش آموز عزیز شما با مبحث تناسب از مقطع ابتدایی آشنا هستید. تناسب نوعی رابطه بین اعداد است که در آن اعداد و کمیتها به دو صورت می توانند با یکدیگر نسبت داشته باشند. مدل : تناسب مستقیم:

Διαβάστε περισσότερα

Φυτοεξυγίανση εδάφους από Cd και Pb με τα αλόφυτα: Halimione portulacoides(l.) Aellen, Tamarix parviflora (DC) και Limoniastrum monopetalum (L.

Φυτοεξυγίανση εδάφους από Cd και Pb με τα αλόφυτα: Halimione portulacoides(l.) Aellen, Tamarix parviflora (DC) και Limoniastrum monopetalum (L. ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Π.Μ.Σ.: Περιβαλλοντική και Υγειονομική Μηχανική Μεταπτυχιακή Διατριβή Φυτοεξυγίανση εδάφους από Cd και Pb με τα αλόφυτα: Halimione portulacoides(l.) Aellen,

Διαβάστε περισσότερα

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ Μελέτη των υλικών των προετοιμασιών σε υφασμάτινο υπόστρωμα, φορητών έργων τέχνης (17ος-20ος αιώνας). Διερεύνηση της χρήσης της τεχνικής της Ηλεκτρονικής Μικροσκοπίας

Διαβάστε περισσότερα