Κεφάλαιο 6: Μεταλλάξεις

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Κεφάλαιο 6: Μεταλλάξεις"


1 Κεφάλαιο 6: Μεταλλάξεις ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Τι ονομάζονται μεταλλάξεις και ποια τα κυριότερα είδη τους; 2. Ποιες οι διαφορές μεταξύ γονιδιακών και χρωμοσωμικών μεταλλάξεων; 3. Οι μεταλλάξεις στα σωματικά κύτταρα α. είναι υπεύθυνες για κληρονομικές ασθένειες β. είναι μόνο χρωμοσωμικές γ. προκαλούν ασήμαντα προβλήματα στον οργανισμό δ. είναι περισσότερες από τις αντίστοιχες γενετικές μεταλλάξεις που συμβαίνουν σε κάποιο οργανισμό. 4. Τι γνωρίζετε για τη δρεπανοκυτταρική αναιμία; 5. Τα άτομα με ομόζυγη δρεπανοκυτταρική αναιμία εμφανίζουν αιμοσφαιρίνη α. με α και β πολυπεπτιδικές αλυσίδες β. με α και β s πολυπεπτιδικές αλυσίδες γ. με α, β και β s πολυπεπτιδικές αλυσίδες δ. με β s πολυπεπτιδικές αλυσίδες αποκλειστικά. 6. Αναπτύξτε τι γνωρίζετε για τις επιδράσεις που μπορεί να έχει η αντικατάσταση μιας βάσης από κάποια άλλη, στο πλαίσιο ανάγνωσης που παράγει μια πρωτεΐνη. 7. Τι προβλήματα μπορεί να δημιουργήσει προσθήκη ή έλλειψη βάσεων σε ένα γονίδιο; 8. Ποια η σημασία των μεταλλάξεων στην εξέλιξη; 9. Ποιες μεταλλάξεις χαρακτηρίζονται σαν ουδέτερες και ποιες σαν σιωπηλές; 10. Σε ποιες περιπτώσεις οι μεταλλάξεις δεν προκαλούν σοβαρές επιπτώσεις στον οργανισμό; 11. Οι μεταλλάξεις α. δημιουργούν πάντα προβλήματα στους οργανισμούς β. οφείλονται αποκλειστικά σε περιβαλλοντικούς παράγοντες γ. συμβάλουν στη γενετική ποικιλότητα και στην εξέλιξη των οργανισμών δ. δε μπορούν να αντιμετωπιστούν από το κύτταρο άπαξ και εμφανιστούν. 12. Ποιοι παράγοντες καλούνται μεταλλαξιογόνοι; Αναφέρατε μερικούς τέτοιους παράγοντες 13. Με ποιους μηχανισμούς το κύτταρο αντιμετωπίζει τις μεταλλάξεις; 14. Τι είναι η αιμοσφαιρίνη;

2 15. Ποιες είναι οι φυσιολογικές μορφές της αιμοσφαιρίνης που εμφανίζονται σε ένα έμβρυο και ποιες σε ένα ανήλικο άτομο; 16. Τι είναι οι θαλασσαιμίες; Σε ποιες κατηγορίες χωρίζονται και ποιο το κοινό κλινικό συμπτώματά τους; 17. Γιατί εμφανίζεται μεγάλη συχνότητα δρεπανοκυτταρικής αναιμίας και β-θαλασσαιμίας στις Μεσογειακές χώρες; 18. Κατά την ετερόζυγη μορφή της β-θαλασσαιμίας εμφανίζεται α. αυξημένη ποσότητα HbF στον οργανισμό β. αυξημένη ποσότητα HbA 2 στον οργανισμό γ. σοβαρή αναιμία δ. αυξημένη ποσότητα HbA στον οργανισμό 19. Ποια συμπτώματα εμφανίζουν τα άτομα με ομόζυγη β-θαλασσαιμία και πώς γίνεται η κλινική αντιμετώπισή τους; 20. Πώς δικαιολογείται ότι η α-θαλασσαιμία εμφανίζει διαβαθμίσεις στη σοβαρότητα των συμπτωμάτων της, στα άτομα που νοσούν από αυτή; 21. Η β-θαλασσαιμίας κληρονομείται με τύπο κληρονομικότητας: α. αυτοσωμικό υπολειπόμενο β. αυτοσωμικό επικρατή γ. φυλοσύνδετο υπολειπόμενο δ. φυλοσύνδετο επικρατή 22. Αντιστοιχείστε τους παρακάτω τύπους αιμοσφαιρίνης (πρώτη στήλη) με τη σύσταση των αλυσίδων που αυτές εμφανίζουν (δεύτερη στήλη). α. HbA 1. α 2 β 2 β. HbA 2 2. α 2 β s 2 γ. HbF 3. α 2 γ 2 δ. HbS 4. α 2 δ Αντιστοιχείστε τις ασθένειες της πρώτης στήλης με τις λέξεις της δεύτερης στήλης: α. δρεπανοκυτταρική αναιμία 1. φαινυλαλανίνη β. φαινυλκετονουρία 2. HbS γ. β-θαλασσαιμία 3. μελανίνη δ. αλφισμός 4. αιμοσφαιρίνη Α 24. Τι γνωρίζετε για τη φαινυλκετονουρία; 25. Τι είναι ο αλφισμός και που οφείλεται; 26. Τι είναι μεταλλάξεις και πώς δημιουργούνται; Δώστε από δύο χαρακτηριστικά παραδείγματα των συνεπειών των γονιδιακών μεταλλάξεων και χρωμοσωμικών ανωμαλιών στον άνθρωπο.

3 27. Τι είναι γονιδιακές μεταλλάξεις που οφείλονται και πώς προκαλούνται; Πώς προκαλούνται οι χρωμοσωμικές ανωμαλίες; Να περιγραφούν οι συνήθεις χρωμοσωμικές ανωμαλίες στον άνθρωπο. 28. Με ποιους τρόπους δύο γονίδια που βρίσκονται σε διαφορετικό χρωμόσωμα μπορούν να βρεθούν στο ίδιο; 29. Ποιες είναι οι αριθμητικές χρωμοσωμικές ανωμαλίες, σε ποιες κατηγορίες τις κατατάσσουμε και πώς δημιουργούνται; 30. Τι γνωρίζετε για τις τρισωμίες στον άνθρωπο; 31. Τι γνωρίζετε για το σύνδρομο Down; 32. Περιγράψτε τα σύνδρομα που προκύπτουν α) από έλλειψη και β) από πλεονασμό ενός φυλετικού χρωμοσώματος σε ανθρώπους. 33. Αντιστοιχείστε τους γονότυπους της πρώτης στήλης με τους χαρακτηρισμούς της δεύτερης στήλης: α. ΧΟ 1. άτομο με σύνδρομο Turner β. ΧΥ 2. φυσιολογικό θηλυκό άτομο γ. ΧΧ 3. στείρο θηλυκό άτομο δ. ΧΧΥ 4. άτομο με σύνδρομο Down 34. Άτομα με σύνδρομο Turner: α. έχουν μόνο ένα φυλετικό χρωμόσωμα το Υ β. έχουν για φυλετικά χρωμοσώματα δύο Χ και ένα Υ 5. φυσιολογικό αρσενικό άτομο γ. πάσχουν από δομική χρωμοσωμική ανωμαλία και είναι στείρα δ. δεν εμφανίζουν δευτερογενή χαρακτηριστικά φύλου. 35. To σύνδρομο Kleinefelter οφείλεται σε α. μια γονιδιακή μετάλλαξη β. ανευπλοειδία γ. δομική χρωμοσωμική ανωμαλία δ. μονοσωμία. 36. Ποιες χρωμοσωμικές ανωμαλίες χαρακτηρίζονται σαν δομικές; Που οφείλονται και σε ποιες κατηγορίες τις διακρίνουμε; 37. Πώς δικαιολογείται ότι άτομα που εμφανίζουν μετατόπιση είναι συνήθως φυσιολογικά; Τι προβλήματα μπορεί να δημιουργήσει αυτή η μετατόπιση στους απογόνους τους; 38. To σύνδρομο Chi du chat οφείλεται σε: α. διπλασιασμό τμήματος του χρωμοσώματος β. αναστροφή τμήματος του χρωμοσώματος γ. έλλειψη τμήματος του χρωμοσώματος δ. μετατόπιση τμήματος του χρωμοσώματος.

4 39. Ποιοι οι στόχοι της διάγνωσης των γενετικών ασθενειών; 40. Με ποιες μεθόδους πραγματοποιείται η διάγνωση των γενετικών ασθενειών; 41. Την τρισωμία 13 στον άνθρωπο θα μπορούσαμε να διαγνώσουμε με α. τη μελέτη των ζωνών Giemsa μετά από χρώση των χρωμοσωμάτων β. τον προσδιορισμό καταλλήλων πρωτεϊνών του αίματος γ. τη δοκιμασία δρεπάνωσης δ. απλή μελέτη του καρυότυπου 42. Αντιστοιχείστε τις ασθένειες (πρώτη στήλη) με τις μεθόδους διάγνωσής τους (δεύτερη στήλη) α. Δρεπανοκυτταρική αναιμία 1. Μελέτη των ζωνών Giemsa β. Chi du chat 2. Προσδιορισμός αιμοσφαιρίνης HbS γ. PKU 3. Υπολογισμός φαινυλαλανίνης στο αίμα δ. Σύνδρομο Turner 4. Έλεγχος αριθμού χρωμοσωμάτων στον καρυότυπο 43. Ποιος ο σκοπός της γενετικής καθοδήγησης; Ποιες κατηγορίες γονέων είναι απαραίτητο να απευθύνονται στους ειδικούς για γενετική καθοδήγηση; 44. Ποια η διαφορά γενετικής καθοδήγησης και προγεννητικού ελέγχου; 45. Τι γνωρίζετε για την αιτιολογία, τα συμπτώματα, και τις μεθόδους διάγνωσης της δρεπανοκυτταρικής αναιμίας; 46. Αναπτύξατε τι γνωρίζετε για την αμνιοπαρακέντηση και για τη λήψη χοριακών λαχνών, σαν μεθόδους προγεννητικού ελέγχου. Συγκρίνατε τις δύο μεθόδους μεταξύ τους. 47. Τι είναι ο καρκίνος; Ποιοι τύποι γονιδίων σχετίζονται με την καρκινογένεση; 48. Αποτέλεσμα ποιων μεταβολών σε γενετικό επίπεδο είναι η εμφάνιση καρκίνου; 49. Τι γνωρίζετε για τα πρωτοογκογονίδια και τι για τα ογκοκατασταλτικά γονίδια; Ποιος ο φυσιολογικός τους ρόλος; Με ποιο μηχανισμό αυτά μπορούν να οδηγήσουν σε καρκινογένεση; 50. Πώς οι βλάβες των μηχανισμών επιδιόρθωσης έχουν σαν αποτέλεσμα την αύξηση των καρκίνων; Αναφέρατε ένα παράδειγμα. 51. Γιατί ο καρκίνος δε μπορεί να θεωρηθεί σαν μια απλή κληρονομική ασθένεια; ΕΠΑΝΑΛΗΨΗ ΟΡΟΛΟΓΙΑΣ ΚΕΦΑΛΑΙΟΥ Συμπληρώστε τις έννοιες στις οποίες αντιστοιχούν οι παρακάτω προτάσεις: 01) Κληρονομούμενη με αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας απουσία χρωστικής από το δέρμα, τα μαλλιά και τους οφθαλμούς ενός οργανισμού:

5 02) Η ασθένεια που οφείλεται στον ανεξέλεγκτο πολλαπλασιασμό των κυττάρων ενός ιστού: 03) Κληρονομούμενη αναιμία που οφείλεται σε σημειακή μετάλλαξη: 04) Χαρακτηρισμός ατόμων με περισσότερα ή λιγότερα χρωμοσώματα από το φυσιολογικό: 05) Χαρακτηρισμός μετάλλαξης που εμφανίζεται αιφνίδια στον πληθυσμό: 06) Η απώλεια τμήματος DNA από ένα χρωμόσωμα: 07) Σύνδρομο που οφείλεται στη ύπαρξη ενός επιπλέον Χ χρωμοσώματος στα ΧΥ άτομα: 08) Ομάδα ενζύμων που επιδιορθώνουν τα λάθη στην ακολουθία βάσεων του DNA: 09) Η αλλαγή στο γενετικό υλικό ενός οργανισμού: 10) Χαρακτηρισμός μεταλλάξεων που συνίστανται σε αλλαγές σε επίπεδο γονιδίου: 11) Χαρακτηρισμός μεταλλάξεων που συνίστανται σε αλλαγές σε μεγάλο μέρος ενός χρωμοσώματος: 12) Ο περιβαλλοντικός παράγοντας, φυσικός ή χημικός, που μπορεί να προκαλέσει τη δημιουργία μεταλλάξεων: 13) Χαρακτηρισμός μεταλλάξεων που συνίστανται σε αλλαγή μιας μόνο βάσης: 14) Συμβολισμός της επικρατούς αιμοσφαιρίνης στους ενήλικες: 15) Χαρακτηρισμός μεταλλάξεων που λόγω του εκφυλισμού του γενετικού κώδικα δεν οδηγούν στην αλλαγή της αλληλουχίας των αμινοξέων της δημιουργούμενης πρωτεΐνης: 16) Σύνδρομο που οφείλεται στη τρισωμία 21: 17) Ασθένεια που οφείλεται σε ελαττωμένη σύνθεση α ή β αλυσίδων της αιμοσφαιρίνης: 18) Κύρια αιμοσφαιρίνη της εμβρυϊκής ηλικίας: 19) Εναλλακτική στην αμνιοπαρακέντηση μέθοδος προγεννητικού ελέγχου με δυνατότητα πιο έγκαιρης διάγνωσης: 20) Συμβολισμός της αιμοσφαιρίνης που κυρίως φέρνουν τα άτομα που πάσχουν από δρεπανοκυτταρική αναιμία: 21) Σύνδρομο που οφείλεται στην έλλειψη ενός μεγάλου τμήματος του μικρού βραχίονα του χρωμοσώματος 5 στον άνθρωπο: 22) Η ύπαρξη, σε διπλοειδές κύτταρο, τριών αντιγράφων ενός χρωμοσώματος, αντί των φυσιολογικών δύο:

6 23) Συμβολισμός της αιμοσφαιρίνης που ανιχνεύεται σε μικρά ποσοστά στα φυσιολογικά ενήλικα άτομα: 24) Φαρμακευτική αγωγή που αντιμετωπίζει το πρόβλημα υπερφόρτωσης με σίδηρο ενός πολυμεταγγιζόμενου ατόμου με θαλασσαιμία: 25) Το έκτο αμινοξύ της β πολυπεπτιδικής αλυσίδας της αιμοσφαιρίνης HbS: 26) Ασθένεια στην οποία είναι απρόσβλητοι οι φορείς δρεπανοκυτταρικής αναιμίας: 27) Η διαδικασία παραλαβής μικρής ποσότητας αμνιακού υγρού από τον αμνιακό σάκο εγκύου με τη βοήθεια βελόνας: 28) Κληρονομική ασθένεια που οφείλεται στην έλλειψη του ενζύμου που μετατρέπει τη φαινυλαλανίνη σε τυροσίνη: 29) Αμινοξύ στο οποίο μετατρέπεται στα φυσιολογικά άτομα η φαινυλαλανίνη: 30) Χρωστική του δέρματος, των μαλλιών και της ίριδας του οφθαλμού: 31) Χαρακτηρισμός ανωμαλιών που οφείλονται σε αλλαγή του αριθμού των χρωμοσωμάτων: 32) Σύνδρομο που στην ύπαρξη ενός μόνο φυλετικού χρωμοσώματος, του Χ: 33) Χαρακτηρισμός μεταλλαγμένου γονιδίου που σχετίζεται με τον ανεξέλεγκτο πολλαπλασιασμό ενός κυττάρου: 34) Ένα φυσιολογικό γονίδιο που σχετίζεται με τη ρύθμιση του κυτταρικού κύκλου και το οποίο αν ενεργοποιηθεί από μια μετάλλαξη μπορεί να μετατραπεί σε ογκογονίδιο:. 35) Εμβρυακή μεμβράνη που συμμετέχει στη δημιουργία του πλακούντα: 36) Δοκιμασία, στην οποία παρατηρείται η μορφολογία των ερυθροκυττάρων σε συνθήκες έλλειψης οξυγόνου: 37) Πάθηση που αυξάνει την πιθανότητα εμφάνισης καρκίνου στο δέρμα: 38) Καρκίνος που εμφανίζεται στον αμφιβληστροειδή χιτώνα του ματιού: 39) Το έκτο αμινοξύ της β πολυπεπτιδικής αλυσίδας της αιμοσφαιρίνης HbA: 40) Η ύπαρξη, σε διπλοειδές κύτταρο, ενός μόνο αντιγράφου από κάποιο ζεύγος χρωμοσωμάτων:. 41) Ένα φυσιολογικό γονίδιο που σχετίζεται με τον περιορισμό του αριθμού των κυτταρικών διαιρέσεων:

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής Κεφάλαιο 6: ΜΕΤΑΛΛΑΞΕΙΣ -ΘΕΩΡΙΑ- Μεταλλάξεις είναι οι αλλαγές που συμβαίνουν στο γενετικό υλικό ενός οργανισμού, τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις) όσο και σε χρωμοσωμικό επίπεδο (χρωμοσωμικές

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα


ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΜΕΤΑΛΛΑΞΕΙΣ Γίνονται μόνο στο γενετικό υλικό των κυττάρων, δηλαδή στο DNA και έχουν μόνιμο χαρακτήρα. Δεν θεωρούνται μεταλλάξεις, μεταβολές των προϊόντων της έκφρασης του γενετικού

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα


ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ Μια εργασία των: Μακρυδάκη Ελευθερία Μπούρλα Ελένη Τμήμα: Γ 3 Ημερομηνία: 27/1/2015 Γενικά με

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα»

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» «Τι είναι Μετάλλαξη» Γενικά με τον όρο μετάλλαξη ονομάζουμε τις αλλαγές στο γενετικό υλικό, το DNA δηλαδή ενός ζωντανού οργανισμού και πρόκειται

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα

Ασκησεις για το Κεφάλαιο 6: Μεταλλάξεις

Ασκησεις για το Κεφάλαιο 6: Μεταλλάξεις A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Ένα ανθρώπινο σπερματοζωάριο

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις ΚΒφόίΙοιο 6 ΜειαΠΠά^εις 1. Ενας γενετιστής βρήκε ότι μια μετάλλαξη σε ένα γονίδιο δεν είχε επίδραση στην πολυπεπτιδική αλυσίδα που κωδικοποιείται από αυτό. Σε τι μπορεί να οφείλεται η συγκεκριμένη μετάλλαξη;

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/2015 29 12 2016 ΘΕΜΑ 1 ο Επιλέξτε τη σωστή απάντηση που συμπληρώνει τις παρακάτω προτάσεις: 1. Η περιοριστική

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος:

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 6 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

Έκφραση της γενετικής πληροφορίας

Έκφραση της γενετικής πληροφορίας Η ροή της γενετικής πληροφορίας Έκφραση της γενετικής πληροφορίας To DNA ενός οργανισμού είναι ο μοριακός «σκληρός δίσκος» που περιέχει αποθηκευμένες ακριβείς οδηγίες, οι οποίες καθορίζουν τη δομή και

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ΜΕΤΑΛΛΑΞΕΙΣ. Βαρυπάτη Αθηνά Φυσικός


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κριτήριο αξιολόγησης-βιολογία Κατεύθυνσης

Κριτήριο αξιολόγησης-βιολογία Κατεύθυνσης ΘΕΜΑ Α. Στις παρακάτω προτάσεις από Α1 έως και Α5 να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Όταν ένας σύνθετος φάγος που έχει το πρωτεϊνικό κάλυμμα του φάγου Τ 2 και το DNA του φάγου

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα



Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA

KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Πώς ονοµάζονται

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα


Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα

Ταυτοποίηση χρωμοσωμικών ανωμαλιών με χρήση καρυότυπου

Ταυτοποίηση χρωμοσωμικών ανωμαλιών με χρήση καρυότυπου Ταυτοποίηση χρωμοσωμικών ανωμαλιών με χρήση καρυότυπου Θεωρητικό Υπόβαθρο Καρυότυπος Καρυότυπος είναι η απεικόνιση των μεταφασικών χρωμοσωμάτων ενός οργανισμού κατά ελαττούμενο μέγεθος, όπου φαίνονται

Διαβάστε περισσότερα

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΗΣΗΣ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΚΛΗΡΟΝΟΜΙΚΩΝ ΝΟΣΩΝ ΑΥΤΟΣΩΜΙΚΗ ΕΠΙΚΡΑΤΗΣ ΑΥΤΟΣΩΜΙΚΗ ΥΠΟΛΕΙΠΟΜΕΝΗ ΦΥΛΟΣΥΝ ΕΤΗ ΥΠΟΛΕΙΠΟΜΕΝΗ

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα 3 ο 12 Θέμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Κεφάλαιο 5. Copyright The McGraw-Hill Companies, Inc Utopia Publishing, All rights reserved

Κεφάλαιο 5. Copyright The McGraw-Hill Companies, Inc Utopia Publishing, All rights reserved Κεφάλαιο 5 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Μια ανασκόπηση ΓΕΝΕΤΙΚΗ Cardinalis cardinalis Cardinalis sinuatus 2011 Utopia Publishing, All rights reserved

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα


Τρίτη, 30 Μαΐου 2006 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 30 Μαΐου 2006 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

2002 ΟΜΟΓΕΝΕΙΣ 1. Τα άτοµα που πάσχουν από το σύνδροµο Kleinefelter έχουν : γ. 47 χρωµοσώµατα

2002 ΟΜΟΓΕΝΕΙΣ 1. Τα άτοµα που πάσχουν από το σύνδροµο Kleinefelter έχουν : γ. 47 χρωµοσώµατα 1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 6 Ο ΚΕΦΑΛΑΙΟ - ΜΕΤΑΛΛΑΞΕΙΣ 2001 ΟΜΟΓΕΝΕΙΣ 3. Τα άτοµα που πάσχουν από σύνδροµο Turner είναι: α. µόνο αρσενικά; β. µόνο θηλυκά; γ. είτε αρσενικά

Διαβάστε περισσότερα


ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΡΩΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΡΩΤΗΣΕΙΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. Πότε ανακαλύφτηκε το DNA και πότε αποδείχτηκε για πρώτη φορά ότι το DNA είναι το γενετικό υλικό; Τι πίστευαν οι επιστήμονες μέχρι να αποδειχτεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Χρωμοσωμικές ανωμαλίες Τα φυλετικά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368)

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368) ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα

Λέξεις κλειδιά στη γενετική

Λέξεις κλειδιά στη γενετική ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα


ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. σελ. 24 σχ. βιβλίου «Κάθε φυσιολογικό μεταφασικό χρωμόσωμα...η απεικόνιση αυτή αποτελεί τον καρυότυπο». «Ο αριθμός και η μορφολογία

Διαβάστε περισσότερα


ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ ΠΡΟΛΟΓΟΣ ΠΡΟΕΛΕΥΣΗ-ΠΑΡΟΥΣΙΑ ΣΗΜΕΡΑ ΠΡΟΛΟΓΟΣ ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ Η μεσογειακή αναιμία ή θαλασσαιμία είναι κληρονομική αυτοσωμική υπολειπόμενη νόσος η οποία εντοπίζεται κυρίως στην περιοχή της Μεσογείου Θάλασσας. Στη Μεσογειακή αναιμία η γονιδιακή

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα