H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων"

Transcript

1 H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων Dr. Παναγιώτης Μαδέσης Ι. Γανόπουλος, Ει. Μποσμαλή Κ. Πασέντσης, Α. Τσαυτάρης Ινστιτούτο Εφαρμοσμένων Βιοεπιστημών

2 Φυτογενετικοί πόροι και τοπικές ποικιλίες Φυτογενετικοί πόροι είναι το σύνολο του γενετικού υλικού των φυτών (άγριων και καλλιεργούμενων). Αποτελούν τη βάση για την ανάπτυξη: της γεωργίας, της δασοπονίας και της ανθοκομίας. και συμβάλλουν στη βελτίωση: της διατροφής, της υγείας και του φυσικού περιβάλλοντος. Παίζουν σημαντικό ρόλο στη βελτίωση των καλλιεργούμενων ποικιλιών

3 Φυτογενετικοί πόροι και τοπικές ποικιλίες Σημαντικοί για την τοπική κοινωνία: προσαρμοσμένοι στις τοπικές συνθήκες και πολλές φορές έχουν ιδιαίτερη θρεπτική και οικονομική σημασία Σημαντικοί για την Βελτίωση γιατί αποτελούν την πηγή πολύτιμων γονιδίων για την δημιουργία νέων ποικιλιών Γενετική διάβρωση: έχουν χαθεί πάνω από 90% των ποικιλιών σίτου και λαχανοκομικών ειδών που υπήρχαν πριν 50 χρόνια

4 Όσπρια Πολύ σημαντική οικογένεια δεύτερη μετά από τα σιτηρά σε σχέση με την παραγωγή και την έκταση που καλλιεργούνται Τα φασόλια είναι το ποιο σημαντικό είδος από πλευράς οικονομικότητας Το ένα τρίτο της πρωτεΐνης και του επεξεργασμένου φυτικού ελαίου που καταναλώνει ο άνθρωπος προέρχεται από τα όσπρια Σημαντικά για την διατήρηση της καλής υγείας του ανθρώπου Σημαντικά για την αειφόρο γεωργία λόγω της αζωτοδέσμευσης Στην Ελλάδα καλλιεργούνται σημαντικές ποικιλίες ΠΟΠ και ΠΓΕ

5 Αναγνώριση και ταυτοποίηση των ειδών και των ποικιλιών Δείκτες Φαινοτυπικοί Βιοχημικοί DNA μοριακοί δείκτες Μικροδορυφόροι (SSR + HRM) Χλωροπλαστικοί (DNA Barcoding + HRM)

6 Τι είναι οι μικροδορυφόροι? Επαναλαμβανόμενες αλληλουχίες με ένα μοτίβο επανάληψης 1-6 Dinucleotide (CT)6 - CTCTCTCTCTCT Trinucleotide (CTG)4 - CTGCTGCTGCTG Tetranucleotide (ACTC)4 - ACTCACTCACTCACTC Υποκατηγορίες Perfect repeat when repeat tract pure for one motif Compound SSR when repeat tract pure for two motifs Imperfect SSR if single base substitution Region of cryptic simplicity if complex but repetitive structure CTCTCTCTCTCT CTCTCTCACACA CTCTCTACTCTCT GTGTCACAGAGT

7 Απλές Επαναλαμβανόμενες αλληλουχίες (SSRs)

8 Τι είναι το DNA barcoding ; (Γραμμωτός κώδικας DNA) Η παραγωγή μικρών αλληλουχιών DNA που επιτρέπουν την αναγνώριση ειδών ή την αναγνώριση συγκεκριμένων ειδών σε συγκεκριμένους τομείς του δέντρου της ζωής (ευκαριωτικούς οργανισμούς).

9 Τι είναι το DNA barcoding ; In 2003, Paul Hebert, researcher at the University of Guelph in Ontario, Canada, proposed DNA barcoding as a way to identify species. Barcoding uses a very short genetic sequence from a standard part of the genome the way a supermarket scanner distinguishes products using the black stripes of the Universal Product Code (UPC). Two items may look very similar to the untrained eye, but in both cases the barcodes are distinct.

10 Xλωροπλάστης Τα φυτικά κύτταρα έχουν 3 γονιδιώματα Μιτοχόνδρια Πυρήνας

11 Χλωροπλαστικό γονιδίωμα Μικρό και συμπαγές kbp Περιέχει γονίδια που κωδικοποιούν πρωτεΐνες για τη φωτοσύνθεση και για την έκφραση αυτών Ο ρυθμός υποκατάστασης είναι χ 10-9 Στον πυρήνα 5-30 χ :3:12 μιτοχονδριο:χλωροπλαστης:πυρήνας bp bp Sugiura et. al. 1986, 2005

12 Επιλογή μιας κατάλληλης για τα φυτά περιοχής για Barcoding Έχουν προταθεί 7 περιοχές rpoc1<rpob<atpf atph<rbcl<matk<psbk psbi<trnh psba; και 3 έχουν προεπιλεχθεί rbcl : είναι εύκολη στην χρήση αλλά με μικρή διαχωριστική ικανότητα matk : έχει μεγαλύτερη διαχωριστική ικανότητα αλλά μικρότερη καθολικότητα trnh- psba : καλή καθολικότητα, μεγαλύτερη διαχωριστική ικανότητα αλλά μεταβλητό μέγεθος και οι αλληλουχίες συχνά σταματούν από SSRs

13 HRM-Ηigh Resolution Melting Yψηλής διακριτικής ικανότητας καμπυλών τήξης Τεχνική που μετράει τη θερμοκρασία τήξης ενός ενισχυμένου προϊόντος. Μοναδική για κάθε προϊόν, υπάρχει η δυνατότητα παρακολούθησης της αύξησης του φθορισμού που σχετίζεται με το άνοιγμα του δίκλωνου DNA. Οι λαμβανόμενες καμπύλες HRM είναι ιδιαίτερα χαρακτηριστικές για κάθε ενισχυόμενο προϊόν και εξαρτώνται από το GC περιεχόμενο του, το μήκος του ενισχυόμενου προϊόντος καθώς και την αλληλουχία του.

14 Εφαρμογές του Barcoding 1) Έρευνα και καταγραφή της βιοποικιλότητας, π.χ., αναγνώριση δυνητικών νέων (μη χαρακτηρισμένων) ειδών 2) Διευκόλυνση αναγνώρισης ειδών που έχουν ήδη περιγραφεί : Συνδέει εξελικτικά στάδια, είδη; Διαφοροποίηση κρυπτικών ειδών Αναγνώριση φυτών και τροφίμων με ονομασία προέλευσης Αναγνώριση προσμίξεων σε ΠΟΠ τρόφιμα

15 DNA Barcoding Ταυτοποίηση ειδών Barcoding σημαντικών για τον ελληνικό χώρο οικογενειών (ψυχανθή, δενδροκομικά είδη κ.α) ΠΟΠ προϊόντα

16 Ψυχανθή

17 Διαχωριστική ικανότητα των Barcoding περιοχών στα ψυχανθή trnl=its2>rpoc Από τα 25 είδη oι περιοχές trnl και ITS2 διαχώρισαν και τα 25 ενώ η rpoc διαχώρισε τα 18/25

18 Είδη Ψυχανθών Χρησιμοποιώντας την περιοχή trnl και τη βοήθεια της Bar-HRM μεθόδου Διαχωρίζουμε τα έιδη των ψυχανθών Έχει ενδιαφέρον να σημειώσουμε ότι διαχωρίζονται τα είδη λαθουριού και Τα κουκιά Chloroplast trnl region

19 Είδη Ψυχανθών Με καμπύλη αναφοράς το είδος Phaseolus vulgaris διαχωρίζονται Τα είδη των ψυχανθών με τη βοήθεια της Περιοχής trnl barcoding region

20 Διαχωρισμός ποικιλιών με μικροδορυφόρους και την χρήση της HRM Με καμπύλη αναφοράς τα φασόλι πλακέ μεγαλόσπερμα Πρεσπών διαχωρίζονται όλες οι άλλες ποικιλίες με τη χρήση του Μικροδορυφόρου PM139

21 Χρησιμοποιώντας την περιοχή trnl και τη βοήθεια της Bar-HRM μεθόδου Ανιχνεύουμε προσμίξεις έως 1% λαθούρι μέσα σε φάβα Σαντορίνης Φάβα Σαντορίνης

22 Ποικιλίες Φακής Χρησιμοποιώντας μικροδορυφόρους και τη βοήθεια της Bar-HRM μεθόδου Ανιχνεύουμε προσμίξεις έως 1% Βίκο σε φακές Ενγκλουβής 2012

23 Ποικιλίες Φακής Φακή Εγκλουβής (94) Lens esculentum rpoc contig (93) CTGCTTGAGCCTCCAAAGATAAAGGCACATGAACAGCCATTTGATCCCCATCAAAATCTGCATTGAACCCCTTACACACCAATGGATGTAA vicia sativa rpoc (93) CTGCTTGAGCCTCCAAAGATAAAGGCACATGAACAGCCATTTGATCCCCATCAAAGTCTGCATTGAATCCCTTACACACCAATGGATGTAA (185) Lens esculentum rpoc contig(184) AGAAATAGCACGTCCTTCTACTAAAATGGGTTGAAATGCCTGTATGCCCAATCTATGCAAAGTAGGCGCTCTATTCAGCAATACTGGATGC vicia sativa rpoc(184) ACAAATAGCACGTCCTTCTACTAAAATGGGTTGAAATGCCTGTATGCCCAATCTATGCAAAGTAGGCGCTCTATTCAGCAATACTGGATGC Βικός rpoclens_vicia R rpoclens_vicia F Σε κόκκινο κύκλο παρατηρούμαι τις διαφορές σε επίπεδο DNA που επιτρέπουν τον διαχωρισμο του βίκου με την φακή

24 Συμπεράσματα Με τη βοήθεια της τεχνικής Barcoding μπορούμε να αναγνωρίσουμε φυτικά είδη Ο Συνδυασμός μικροδορυφόρων και της HRM μπορεί να διαχωρίσει και ποικιλίες του ίδιου είδους Η χρήση συγκεκριμένων περιοχών ή και ο συνδυασμός χλωροπλαστικών περιοχών δίνει υψηλά ποσοστά αναγνώρισης ειδών Με τη βοήθεια της τεχνικής Barcoding μπορεί να γίνει αποτύπωση της βιοποικιλότητας Αναγνώριση φυτών και τροφίμων με ονομασία προέλευσης Αναγνώριση προσμίξεων σε ΠΟΠ (και όχι μόνο) τρόφιμα

25 Ευχαριστίες ΙΝΕΒ Ι. Γανόπουλος, Ει. Μποσμαλή Κ. Πασέντσης Α. Τσαυτάρης Τράπεζα Γενετικού Υλικού Π. Ράλλη Θ. Τσιβελίκα ΕΛΓΟ ΔΗΜΗΤΡΑ Ινστιτούτο Κτηνοτροφικών Φυτών Και Βοσκών Δ. Βλαχοστέργιο Συνεταιρισμός Σαντορίνης "SANTO"

26 Ευχαριστώ

Τοπικές Ποικιλίες. Γεωπονική Θεώρηση - O Ρόλος τους στην Σημερινή Γεωργία. Πηνελόπη Μπεμπέλη

Τοπικές Ποικιλίες. Γεωπονική Θεώρηση - O Ρόλος τους στην Σημερινή Γεωργία. Πηνελόπη Μπεμπέλη Τοπικές Ποικιλίες Γεωπονική Θεώρηση - O Ρόλος τους στην Σημερινή Γεωργία Πηνελόπη Μπεμπέλη Τοπικές Ποικιλίες (Εγχώριοι Πληθυσμοί) Είναι ετερογενείς πληθυσμοί Είναι τοπικά προσαρμοσμένοι Έχουν δημιουργηθεί

Διαβάστε περισσότερα

Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ

Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ ΙΝΣΤΙΤΟΥΤΟ KTHΝΟΤΡΟΦΙΚΩΝ ΦΥΤΩΝ ΚΑΙ ΒΟΣΚΩΝ ΘΕΟΦΡΑΣΤΟΥ 1, 41335 ΛΑΡΙΣΑ Τηλ: (2410) 533811, 660592 FAX.: (2410) 533809 E-mail: ikflaris@otenet.gr ΕΚΘΕΣΗ

Διαβάστε περισσότερα

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Α. Ντούλης, Ινστιτούτο Αμπέλου, Λαχανοκομίας & Ανθοκομίας Ηρακλείου (ΙΑΛΑΗ), Εθνικό Ίδρυμα Αγροτικών Ερευνών (ΕΘΙΑΓΕ) και

Διαβάστε περισσότερα

Όσπρια στην Ελλάδα Ποικιλίες, Σποροπαραγωγή.

Όσπρια στην Ελλάδα Ποικιλίες, Σποροπαραγωγή. Όσπρια στην Ελλάδα Ποικιλίες, Σποροπαραγωγή. Η καλλιέργεια των οσπρίων στη χώρα μας είναι εξαιρετικά περιορισμένη σε περίπου 140.000 στρέμματα. Η παραγόμενη ποσότητα οσπρίων δεν επαρκεί για την κάλυψη

Διαβάστε περισσότερα

Δρ. Δημήτριος Βλαχοστέργιος Ινστιτούτο Κτηνοτροφικών Φυτών & Βοσκών Λάρισας

Δρ. Δημήτριος Βλαχοστέργιος Ινστιτούτο Κτηνοτροφικών Φυτών & Βοσκών Λάρισας Δρ. Δημήτριος Βλαχοστέργιος Ινστιτούτο Κτηνοτροφικών Φυτών & Βοσκών Λάρισας Ξηρικά Όσπρια Ρεβίθι (Cicer arietinum L.) Φακή (Lens culinaris Medik.) Κουκί (Vicia faba L.) Λαθούρι (φάβα) (Lathyrous sp.) Ποτιστικά

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

των Τοπικών Ποικιλιών Οσπρίων στην Ελλάδα Πηνελόπη Μπεμπέλη, Ροίκος Θανόπουλος

των Τοπικών Ποικιλιών Οσπρίων στην Ελλάδα Πηνελόπη Μπεμπέλη, Ροίκος Θανόπουλος Ποικιλότητα των Τοπικών Ποικιλιών Οσπρίων στην Ελλάδα Πηνελόπη Μπεμπέλη, Ροίκος Θανόπουλος Όσπρια στην Ελλάδα Μπιζέλι (Pisum sativum) Φακή (Lens culinaris) Ρεβίθι (Cicer arientinum) Λαθούρια (Lathyrus

Διαβάστε περισσότερα

Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ

Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ ΙΝΣΤΙΤΟΥΤΟ KTHΝΟΤΡΟΦΙΚΩΝ ΦΥΤΩΝ ΚΑΙ ΒΟΣΚΩΝ ΘΕΟΦΡΑΣΤΟΥ 1, 41335 ΛΑΡΙΣΑ Τηλ: (2410) 533811, 660592 FAX.: (2410) 533809 E-mail: ikflaris@otenet.gr ΕΚΘΕΣΗ

Διαβάστε περισσότερα

Προβλήµατα & Προοπτικές της καλλιέργειας των ΟΣΠΡΙΩΝ ρ. ηµήτριος Βλαχοστέργιος Ινστιτούτο Κτηνοτροφικών Φυτών & Βοσκών Λάρισας ΚΥΡΙΟΤΕΡΑ ΟΣΠΡΙΑ Ξηρικά Όσπρια Ρεβίθι (Cicer arietinum L.) Φακή (Lens culinaris

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Ο ΑΝΑΠΛΗΡΩΤΗΣ ΥΠΟΥΡΓΟΣ ΠΑΡΑΓΩΓΙΚΗΣ ΑΝΑΣΥΓΚΡΟΤΗΣΗΣ, ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΕΝΕΡΓΕΙΑΣ

Ο ΑΝΑΠΛΗΡΩΤΗΣ ΥΠΟΥΡΓΟΣ ΠΑΡΑΓΩΓΙΚΗΣ ΑΝΑΣΥΓΚΡΟΤΗΣΗΣ, ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΕΝΕΡΓΕΙΑΣ ΘΕΜΑ : «Καθορισμός λεπτομερειών χορήγησης της συνδεδεμένης ενίσχυσης στα όσπρια που προορίζονται για ανθρώπινη κατανάλωση σε εκτέλεση του άρθρου 52 του Κανονισμού (ΕΚ) αριθ. 1307/2013 του Ευρωπαϊκού Κοινοβουλίου

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Ο ΡΟΛΟΣ ΤΩΝ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΟΣΠΡΙΩΝ & Η ΑΞΙΟΠΟΙΗΣΗ ΤΟΥΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΒΕΛΤΙΩΜΕΝΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ

Ο ΡΟΛΟΣ ΤΩΝ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΟΣΠΡΙΩΝ & Η ΑΞΙΟΠΟΙΗΣΗ ΤΟΥΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΒΕΛΤΙΩΜΕΝΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ & ΑΓΡΟΤΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Ο ΡΟΛΟΣ ΤΩΝ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΟΣΠΡΙΩΝ & Η ΑΞΙΟΠΟΙΗΣΗ ΤΟΥΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΒΕΛΤΙΩΜΕΝΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

Τοπικές ποικιλίες καλλιεργούμενων ειδών στην Κρήτη με έμφαση στα κηπευτικά: Ένα δυναμικό για πολλαπλή αξιοποίηση

Τοπικές ποικιλίες καλλιεργούμενων ειδών στην Κρήτη με έμφαση στα κηπευτικά: Ένα δυναμικό για πολλαπλή αξιοποίηση Τοπικές ποικιλίες καλλιεργούμενων ειδών στην Κρήτη με έμφαση στα κηπευτικά: Ένα δυναμικό για πολλαπλή αξιοποίηση Θανόπουλος, Ρ. 1, Σαμαράς, Στ. 2, Γανίτης Κ. 2, Γκατζελάκη Χ. 2, Κόταλη Ε. 2, Ψαρρά Ε. 2,

Διαβάστε περισσότερα

Προστατευόμενων Ονομασιών Προέλευσης και Προστατευόμενων Γεωγραφικών Ενδείξεων με έμφαση στα Όσπρια

Προστατευόμενων Ονομασιών Προέλευσης και Προστατευόμενων Γεωγραφικών Ενδείξεων με έμφαση στα Όσπρια Μανανά Σοφία Τμήμα ΠΟΠ ΠΓΕ Ιδιότυπων και Παραδοσιακών Προϊόντων Διεύθυνση Βιολογικής Γεωργίας Υπουργείο Αγροτικής Ανάπτυξης και Τροφίμων Προϋποθέσεις και Διαδικασία καταχώρισης ονομασιών στο Μητρώο της

Διαβάστε περισσότερα

ΕΝΑΛΛΑΚΤΙΚΕΣ ΠΗΓΕΣ ΠΡΩΤΕΙΝΗΣ ΓΙΑ ΤΟΥΣ ΧΟΙΡΟΥΣ. Ιωάννης Μαυρομιχάλης, PhD

ΕΝΑΛΛΑΚΤΙΚΕΣ ΠΗΓΕΣ ΠΡΩΤΕΙΝΗΣ ΓΙΑ ΤΟΥΣ ΧΟΙΡΟΥΣ. Ιωάννης Μαυρομιχάλης, PhD ΕΝΑΛΛΑΚΤΙΚΕΣ ΠΗΓΕΣ ΠΡΩΤΕΙΝΗΣ ΓΙΑ ΤΟΥΣ ΧΟΙΡΟΥΣ Ιωάννης Μαυρομιχάλης, PhD Οι τιμές του σογιαλεύρου και των κρυσταλλικών αμινοξέων παραμένουν ασταθείς. Κατά καιρούς, υπάρχει ενδιαφέρον για λιγότερο γνωστές

Διαβάστε περισσότερα

ΠΑΡΟΥΣΙΑΣΗ ΝΙΚΟΛΑΟΣ ΑΝ. ΣΤΕΡΓΙΟΥ << ΠΕΛΕΚΑΝΟΣ>>

ΠΑΡΟΥΣΙΑΣΗ ΝΙΚΟΛΑΟΣ ΑΝ. ΣΤΕΡΓΙΟΥ << ΠΕΛΕΚΑΝΟΣ>> ΠΑΡΟΥΣΙΑΣΗ ΝΙΚΟΛΑΟΣ ΑΝ. ΣΤΕΡΓΙΟΥ ΠΡΟΕΔΡΟΣ ΤΟΥ Δ.Σ. ΕΘΝΙΚΟΥ ΔΡΥΜΟΥ ΠΡΕΣΠΩΝ > ΠΡΟΕΛΕΥΣΗ ΤΟΠΙΚΗΣ ΠΟΙΚΙΛΙΑΣ Ηεξημέρωσητουφασολιούξεκινάπριναπό7000 χρόνια στην Κεντρική Αμερική. Το γένος Phaseolus

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Μελέτη της συγκαλλιέργειας βίκου-κριθής. κριθής και µπιζελιού- και ποιοτικά χαρακτηριστικά της παραγόµενης χλωροµάζας

Μελέτη της συγκαλλιέργειας βίκου-κριθής. κριθής και µπιζελιού- και ποιοτικά χαρακτηριστικά της παραγόµενης χλωροµάζας Μελέτη της συγκαλλιέργειας βίκου-κριθής κριθής και µπιζελιού- βρώµης ως προς τα ποσοτικά και ποιοτικά χαρακτηριστικά της παραγόµενης χλωροµάζας Χατζηγεωργίου Ι. 1, Φορτάτος Ε. 1, Τσιµπούκας Κ. 2, Ζέρβας

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ Το πρόγραμμα σπουδών του τμήματος Γεωπονικής Βιοτεχνολογίας πρέπει να ανταποκρίνεται στην εξαγωγή επιστημόνων Γεωπόνων Βιοτεχνολόγων ικανών να μελετούν, να αντιμετωπίζουν και να προτείνουν

Διαβάστε περισσότερα

Παραγωγικά συστήματα προβάτων και αιγών: Βιοποικιλότητα, τοπικές φυλές και προϊόντα τους

Παραγωγικά συστήματα προβάτων και αιγών: Βιοποικιλότητα, τοπικές φυλές και προϊόντα τους Παραγωγικά συστήματα προβάτων και αιγών: Βιοποικιλότητα, τοπικές φυλές και προϊόντα τους Αξίες και προκλήσεις στον τομέα της αιγο-προβατοτροφίας. Ποιες είναι οι προοπτικές για την ανάπτυξη δικτύων συνεργασίας;

Διαβάστε περισσότερα

ΤΟΠΙΚΕΣ ΠΟΙΚΙΛΙΕΣ: ΤΟ ΟΡΟΠΕΔΙΟ ΤΟΥ ΔΟΜΟΚΟΥ. Στίγκας Γρηγόρης

ΤΟΠΙΚΕΣ ΠΟΙΚΙΛΙΕΣ: ΤΟ ΟΡΟΠΕΔΙΟ ΤΟΥ ΔΟΜΟΚΟΥ. Στίγκας Γρηγόρης 2η Επιστημονική Συνάντηση για τις τοπικές ποικιλίες ΤΟΠΙΚΕΣ ΠΟΙΚΙΛΙΕΣ: ΤΟ ΟΡΟΠΕΔΙΟ ΤΟΥ ΔΟΜΟΚΟΥ Στίγκας Γρηγόρης ΤΟ ΟΡΟΠΕΔΙΟ ΤΟΥ ΔΟΜΟΚΟΥ ΤΟ ΟΡΟΠΕΔΙΟ ΤΟΥ ΔΟΜΟΚΟΥ Το οροπέδιο του Δομοκού, με μέσο υψόμετρο

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΠΡΟΣΤΑΣΙΑ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΜΕΣΩ ΤΗΣ ΠΙΣΤΟΠΟΙΗΣΗΣ ΤΩΝ ΠΑΡΑΓΟΜΕΝΩΝ ΠΡΟΙΟΝΤΩΝ

ΠΡΟΣΤΑΣΙΑ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΜΕΣΩ ΤΗΣ ΠΙΣΤΟΠΟΙΗΣΗΣ ΤΩΝ ΠΑΡΑΓΟΜΕΝΩΝ ΠΡΟΙΟΝΤΩΝ ΠΡΟΣΤΑΣΙΑ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΜΕΣΩ ΤΗΣ ΠΙΣΤΟΠΟΙΗΣΗΣ ΤΩΝ ΠΑΡΑΓΟΜΕΝΩΝ ΠΡΟΙΟΝΤΩΝ Σπύρος Στάχτιαρης 1ηΕπιστημονικήΣυνάντησηγιατιςΤοπικέςΠοικιλίες Γεωπονικό Πανεπιστήμιο Αθηνών 21.10.2011 Εισαγωγή Σκοπός: Διερεύνηση

Διαβάστε περισσότερα

Βιοτεχνολογία και Παραγωγή: Ποια ερωτήµατα πρέπει να απαντηθούν

Βιοτεχνολογία και Παραγωγή: Ποια ερωτήµατα πρέπει να απαντηθούν Βιοτεχνολογία και Παραγωγή: Ποια ερωτήµατα πρέπει να απαντηθούν Γ. Ν. Σκαράκης Γεωπονικό Πανεπιστήµιο Αθηνών Συνέδριο Αγροτικής Επιχειρηµατικότητας Αθήνα, 10 Μαΐου 2015 Βασικοί στόχοι γεωργικής ανάπτυξης

Διαβάστε περισσότερα

Αξιοποίηση των ελληνικών φυτών

Αξιοποίηση των ελληνικών φυτών ΓΕΩΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Δράμα, 10 και 11

Διαβάστε περισσότερα

Ελληνικές ποικιλίες οσπρίων

Ελληνικές ποικιλίες οσπρίων Ελληνικές ποικιλίες οσπρίων ΕΛΛΗΝΙΚΟΣ ΓΕΩΡΓΙΚΟΣ ΟΡΓΑΝΙΣΜΟΣ "ΔΗΜΗΤΡΑ" ΓΕΝΙΚΗ ΔΙΕΥΘΥΝΣΗ ΑΓΡΟΤΙΚΗΣ ΕΡΕΥΝΑΣ ΙΝΣΤΙΤΟΥΤΟ ΚΤΗΝΟΤΡΟΦΙΚΩΝ ΦΥΤΩΝ & ΒΟΣΚΩΝ ΛΑΡΙΣΑΣ Απρίλιος 2012 ΕΠΙΣΤΗΜΟΝΙΚΗ ΕΠΙΜΕΛΕΙΑ Δρ Δημήτριος

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ:

ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ: ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ: ΕΝΑ ΠΕΙΡΑΜΑ ΜΕ ΑΓΝΩΣΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΣΤΗΝ ΥΓΕΙΑ, ΤΟ ΠΕΡΙΒΑΛΛΟΝ, ΤΗΝ ΚΟΙΝΩΝΙΑ ΝΙΚΟΛΑΣ ΠΡΙΜΗΚΥΡΙΟΣ, ΓΕΩΠΟΝΟΣ, Δρ. ΦΥΣΙΟΛΟΓΙΑΣ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΦΥΤΩΝ ΓΕΝΕΤΙΚΑ

Διαβάστε περισσότερα

Φακή. Τζουραµάνη Ε., Ναβρούζογλου Π., Σιντόρη Αλ., Λιοντάκης Αγ., Παπαευθυµίου Μ. Καρανικόλας Π. και Αλεξόπουλος Γ.

Φακή. Τζουραµάνη Ε., Ναβρούζογλου Π., Σιντόρη Αλ., Λιοντάκης Αγ., Παπαευθυµίου Μ. Καρανικόλας Π. και Αλεξόπουλος Γ. Ινστιτούτο Γεωργοοικονοµικών και Κοινωνιολογικών Ερευνών Εθνικό Ίδρυµα Αγροτικής Έρευνας Λ. ηµοκρατίας 61, 135 61 Αγ. Ανάργυροι, Αττική Τηλ. 210 27 56 596, Fax 210 27 51 937 Email tzouramani.inagrop@nagref.gr

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων ΑΝΑΚΟΙΝΩΣΗ Από το Τμήμα Ιατρικής ανακοινώνεται ότι για το ακαδημαϊκό έτος 2014-2015 στο Τμήμα Ιατρικής κατατάσσονται : Οι πτυχιούχου Πανεπιστημίου, Τ.Ε.Ι. ή ισοτίμων προς αυτά, Α.ΣΠΑΙ.Τ.Ε., της Ελλάδος

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Π Ρ Ο Κ Η Ρ Υ Ξ Η. O ΕΛΛΗΝΙΚΟΣ ΓΕΩΡΓΙΚΟΣ ΟΡΓΑΝΙΣΜΟΣ ΔΗΜΗΤΡΑ προκηρύσσει την πλήρωση εκατό (100) θέσεων ερευνητών στη βαθμίδα Γ ή Δ ως κάτωθι:

Π Ρ Ο Κ Η Ρ Υ Ξ Η. O ΕΛΛΗΝΙΚΟΣ ΓΕΩΡΓΙΚΟΣ ΟΡΓΑΝΙΣΜΟΣ ΔΗΜΗΤΡΑ προκηρύσσει την πλήρωση εκατό (100) θέσεων ερευνητών στη βαθμίδα Γ ή Δ ως κάτωθι: Αθήνα 01.10.2014 Α.Π.: 23090 Π Ρ Ο Κ Η Ρ Υ Ξ Η O ΕΛΛΗΝΙΚΟΣ ΓΕΩΡΓΙΚΟΣ ΟΡΓΑΝΙΣΜΟΣ ΔΗΜΗΤΡΑ προκηρύσσει την πλήρωση εκατό (100) θέσεων ερευνητών στη βαθμίδα Γ ή Δ ως κάτωθι: Θεματική Ενότητα Κωδικός θεσης

Διαβάστε περισσότερα

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών ΓΕΩΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Δράμα, 10 και 11

Διαβάστε περισσότερα

Παγκόσμια Επισιτιστική Κρίση

Παγκόσμια Επισιτιστική Κρίση Παγκόσμια Επισιτιστική Κρίση Τ Tο πρόβλημα της διατροφής του ανθρώπου σε παγκόσμιο επίπεδο είναι ιδιαίτερα οξύ και καθημερινά οξύνεται περισσότερο, εξαιτίας του ρυθμού αύξησης του πληθυσμού της γης τον

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

προϊόντων ένα τρίπτυχο: Ποιότητα Ασφάλεια καταναλωτή Περιβαλλοντική μέριμνα.

προϊόντων ένα τρίπτυχο: Ποιότητα Ασφάλεια καταναλωτή Περιβαλλοντική μέριμνα. η καλλιεργεια της μηδικης στo ΝΟΜΟ ΛΑΡΙΣΑΣ Σήμερα όσο ποτέ άλλοτε το ζητούμενο στην Ελληνική γεωργία είναι η ποιότητα και η ανταγωνιστικότητα των προϊόντων της, η γεωργική παραγωγή είναι απαραίτητο να

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

Βιολογικό Κτηνοτροφικό Ρεβίθι

Βιολογικό Κτηνοτροφικό Ρεβίθι Ινστιτούτο Γεωργοοικονοµικών και Κοινωνιολογικών Ερευνών Εθνικό Ίδρυµα Αγροτικής Έρευνας Λ. ηµοκρατίας 61, 135 61 Αγ. Ανάργυροι, Αττική Τηλ. 210 27 56 596, Fax 210 27 51 937 Email tzouramani.inagrop@nagref.gr

Διαβάστε περισσότερα

DNA, οργάνωση και δομή του γενετικού υλικού

DNA, οργάνωση και δομή του γενετικού υλικού DNA, οργάνωση και δομή του γενετικού υλικού Κιούπη Βασιλική, εκπαιδευτικός κλ.πε04.04 Μια εκπαιδευτική δραστηριότητα βασισμένη σε εκθέματα του ιδρύματος Ευγενίδου Εισαγωγικός τομέας και προκαταρτική φάση

Διαβάστε περισσότερα

University of Cyprus Biomedical Imaging and Applied Optics. ΗΜΥ 370 Εισαγωγή στη Βιοϊατρική Μηχανική. Υπολογιστική Βιολογία και Βιοπληροφορική

University of Cyprus Biomedical Imaging and Applied Optics. ΗΜΥ 370 Εισαγωγή στη Βιοϊατρική Μηχανική. Υπολογιστική Βιολογία και Βιοπληροφορική University of Cyprus Biomedical Imaging and Applied Optics ΗΜΥ 370 Εισαγωγή στη Βιοϊατρική Μηχανική Υπολογιστική Βιολογία και Βιοπληροφορική Ορισμοί Ορισμοί του National Institutes of Health (NIH), USA

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Green Box Εκδοτική Α.E. Νίκης 24, Σύνταγμα, 105 57, Tηλ. 210/3232905, Fax 210/3232967 E-mail: info@agronews.gr www.agronews.gr

Green Box Εκδοτική Α.E. Νίκης 24, Σύνταγμα, 105 57, Tηλ. 210/3232905, Fax 210/3232967 E-mail: info@agronews.gr www.agronews.gr Smart Crops 3 το νεο status του ΠΑΡΑΔΟΣΙΑΚΟΥ καλλιεργητη που εγινε ΕΠΙΧΕΙΡΗΜΑΤΙΑΣ Γιάννης Πανάγος Εκδότης Διευθυντής Αγαπητέ αναγνώστη, Τα τελευταία χρόνια η αγροτική οικονομία όχι μόνο στην Ελλάδα αλλά

Διαβάστε περισσότερα

ΑΠΟΣΠΑΣΜΑ ΠΡΑΚΤΙΚΩΝ ΚΟΣΜΗΤΕΙΑΣ Συνεδρία αρ. 9/06.05.2014

ΑΠΟΣΠΑΣΜΑ ΠΡΑΚΤΙΚΩΝ ΚΟΣΜΗΤΕΙΑΣ Συνεδρία αρ. 9/06.05.2014 9η Συνεδρίαση της Κοσμητείας της Σχολής (αρ. 9/06-05-14) σελ. 1 ΑΠΟΣΠΑΣΜΑ ΠΡΑΚΤΙΚΩΝ ΚΟΣΜΗΤΕΙΑΣ Συνεδρία αρ. 9/06.05.2014 Η Κοσμητεία της Σχολής Τροφίμων Βιοτεχνολογίας και Ανάπτυξης, μετά από πρόσκληση

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΛΟΙΠΕΣ ΠΡΑΞΕΙΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ

ΛΟΙΠΕΣ ΠΡΑΞΕΙΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ C 273/26 Επίσημη Εφημερίδα της Ευρωπαϊκής Ένωσης 16.9.2011 ΛΟΙΠΕΣ ΠΡΑΞΕΙΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ Δημοσίευση αίτησης σύμφωνα με το άρθρο 6 παράγραφος 2 του κανονισμού (ΕΚ) αριθ. 510/2006 του Συμβουλίου για

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ. 1ο Εξάμηνο Σπουδών

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ. 1ο Εξάμηνο Σπουδών ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ 1ο Εξάμηνο Σπουδών Διδάσκοντες Ν001Υ Γενική και Ανόργανη Χημεία Φ.Νόλη, Γ.Ψωμάς, Β. Ταγκούλης (Τμ.Χημείας) Ν003Υ Πληροφορική Β. Μάνος Ν005Υ Μαθηματικά Ν.Φαρμάκης (Τμ.Μαθηματικών) Ν007Υ

Διαβάστε περισσότερα

«Canalization» και πλαστικότητα

«Canalization» και πλαστικότητα «Canalization» και πλαστικότητα ή πως οι περιβαλλοντικές αλλαγές επηρεάζουν την αύξηση και την ανάπτυξη; 1 of 45 http://www.agrool.gr CANALIZATION-PLASTICITY «Canalization» ονομάζεται, γενικά, η ικανότητα

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Βιολογική µηδική. Τζουραµάνη Ε., Σιντόρη Αλ., Λιοντάκης Αγ., Ναβρούζογλου Π., Παπαευθυµίου Μ. Καρανικόλας Π. και Αλεξόπουλος Γ.

Βιολογική µηδική. Τζουραµάνη Ε., Σιντόρη Αλ., Λιοντάκης Αγ., Ναβρούζογλου Π., Παπαευθυµίου Μ. Καρανικόλας Π. και Αλεξόπουλος Γ. Ινστιτούτο Γεωργοοικονοµικών και Κοινωνιολογικών Ερευνών Εθνικό Ίδρυµα Αγροτικής Έρευνας Λ. ηµοκρατίας 61, 135 61 Αγ. Ανάργυροι, Αττική Τηλ. 210 27 56 596, Fax 210 27 51 937 Email tzouramani.inagrop@nagref.gr

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΝΕΑ ΚΑΠ ΠΥΛΩΝΑΣ Ι: ΑΜΕΣΕΣ ΕΝΙΣΧΥΣΕΙΣ 2015-2020

ΝΕΑ ΚΑΠ ΠΥΛΩΝΑΣ Ι: ΑΜΕΣΕΣ ΕΝΙΣΧΥΣΕΙΣ 2015-2020 ΝΕΑ ΚΑΠ ΠΥΛΩΝΑΣ Ι: ΑΜΕΣΕΣ ΕΝΙΣΧΥΣΕΙΣ 2015-2020 Καθεστώτα Ενίσχυσης Ολοκληρωμένο Σύστημα Ενιαία Αίτηση Ενίσχυσης Μάρτιος 2015 Κανονισμός (ΕΕ)1307/2013 για τις άμεσες ενισχύσεις- Γενικά στοιχεία Ισχύει από

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Μέρος 5 ο. Γονιδιακοί δείκτες

Μέρος 5 ο. Γονιδιακοί δείκτες Μέρος 5 ο Γονιδιακοί δείκτες R.C. Lewontin 1966 K.B. Mullis 1983 Εισαγωγή στη δασική γενετική Γονιδιακοί δείκτες Όπως είδαµε στα προηγούµενα κεφάλαια, η γενετική πληροφορία είναι οργανωµένη πάνω σε µια

Διαβάστε περισσότερα

Σταδιοδρομία 2014. Κωνσταντίνος Βοσκαρίδης 30-11-2014. Τμήμα Βιολογικών Επιστημών & Κέντρο Ερευνών Μοριακής Ιατρικής Πανεπιστήμιο Κύπρου

Σταδιοδρομία 2014. Κωνσταντίνος Βοσκαρίδης 30-11-2014. Τμήμα Βιολογικών Επιστημών & Κέντρο Ερευνών Μοριακής Ιατρικής Πανεπιστήμιο Κύπρου Επάγγελμα: Γενετιστής - Μοριακός Βιολόγος Σταδιοδρομία 2014 Κωνσταντίνος Βοσκαρίδης Τμήμα Βιολογικών Επιστημών & Κέντρο Ερευνών Μοριακής Ιατρικής Πανεπιστήμιο Κύπρου 30-11-2014 20 Νοεμβρίου, 2010 ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

Ο ρόλος του ΕΛΓΟ ΔΗΜΗΤΡΑ στο νέο Πρόγραμμα Αγροτικής Ανάπτυξης 2014-2020

Ο ρόλος του ΕΛΓΟ ΔΗΜΗΤΡΑ στο νέο Πρόγραμμα Αγροτικής Ανάπτυξης 2014-2020 Ο ρόλος του ΕΛΓΟ ΔΗΜΗΤΡΑ στο νέο Πρόγραμμα Αγροτικής Ανάπτυξης 2014-2020 2 ος Πυλώνας: Αγροτική Ανάπτυξη Προώθηση μεταφοράς γνώσεων και καινοτομίας Βελτίωση της ανταγωνιστικότητας Οργάνωση αλυσίδας τροφίμων

Διαβάστε περισσότερα

Κ ι λ µα µ τι τ κές έ Α λλ λ α λ γές Επι π πτ π ώ τ σει ε ς στη τ β ιοπο π ικιλό λ τη τ τα τ κ αι τ η τ ν ν ά γρια ζ ωή

Κ ι λ µα µ τι τ κές έ Α λλ λ α λ γές Επι π πτ π ώ τ σει ε ς στη τ β ιοπο π ικιλό λ τη τ τα τ κ αι τ η τ ν ν ά γρια ζ ωή Επιπτώσεις στη βιοποικιλότητα και την άγρια ζωή Η παγκόσµια κλιµατική αλλαγή θεωρείται ως η σηµαντικότερη τρέχουσα απειλή για τη βιοποικιλότητα του πλανήτη. Παραδείγµατα από την Κυπριακή Φύση Μερικές από

Διαβάστε περισσότερα

Βιοτεχνολογικές καινοτομίες στην Αγροδιατροφή. Νώτης Αργυρίου, Ερευνητής Αν. Διευθυντής Ινστιτούτου Εφαρμοσμένων Βιοεπιστημών - ΕΚΕΤΑ

Βιοτεχνολογικές καινοτομίες στην Αγροδιατροφή. Νώτης Αργυρίου, Ερευνητής Αν. Διευθυντής Ινστιτούτου Εφαρμοσμένων Βιοεπιστημών - ΕΚΕΤΑ Βιοτεχνολογικές καινοτομίες στην Αγροδιατροφή Νώτης Αργυρίου, Ερευνητής Αν. Διευθυντής Ινστιτούτου Εφαρμοσμένων Βιοεπιστημών - ΕΚΕΤΑ 1 a timeline 2000 -INA Ινστιτούτο Αγροβιοτεχνολογίας 2012 - INAB Ινστιτούτο

Διαβάστε περισσότερα

ΠΡΟΤΑΣΗ ΣΤΡΑΤΗΓΙΚΩΝ ΕΠΙΛΟΓΩΝ ΤΩΝ ΘΕΜΑΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΡΑΤΗΓΙΚΟΥ ΣΧΕΔΙΑΣΜΟΥ, ΓΙΑ ΤΗΝ ΑΓΡΟΤΙΚΗ ΑΝΑΠΤΥΞΗ ΜΕΤΑ ΤΟ 2013 ΕΓΓΡΑΦΟ ΕΡΓΑΣΙΑΣ

ΠΡΟΤΑΣΗ ΣΤΡΑΤΗΓΙΚΩΝ ΕΠΙΛΟΓΩΝ ΤΩΝ ΘΕΜΑΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΡΑΤΗΓΙΚΟΥ ΣΧΕΔΙΑΣΜΟΥ, ΓΙΑ ΤΗΝ ΑΓΡΟΤΙΚΗ ΑΝΑΠΤΥΞΗ ΜΕΤΑ ΤΟ 2013 ΕΓΓΡΑΦΟ ΕΡΓΑΣΙΑΣ ΠΡΟΤΑΣΗ ΣΤΡΑΤΗΓΙΚΩΝ ΕΠΙΛΟΓΩΝ ΤΩΝ ΘΕΜΑΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΡΑΤΗΓΙΚΟΥ ΣΧΕΔΙΑΣΜΟΥ, ΓΙΑ ΤΗΝ ΑΓΡΟΤΙΚΗ ΑΝΑΠΤΥΞΗ ΜΕΤΑ ΤΟ 2013 ΕΓΓΡΑΦΟ ΕΡΓΑΣΙΑΣ ΔΕΚΕΜΒΡΙΟΣ 2012 1 Ενίσχυση της ανταγωνιστικότητας του αγροδιατροφικού τομέα

Διαβάστε περισσότερα

ΕΦΗΜΕΡΙΣ ΤΗΣ ΚΥΒΕΡΝΗΣΕΩΣ

ΕΦΗΜΕΡΙΣ ΤΗΣ ΚΥΒΕΡΝΗΣΕΩΣ 40633 ΕΦΗΜΕΡΙΣ ΤΗΣ ΚΥΒΕΡΝΗΣΕΩΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΔΗΜΟΚΡΑΤΙΑΣ ΤΕΥΧΟΣ ΔΕΥΤΕΡΟ Αρ. Φύλλου 2744 29 Οκτωβρίου 2013 ΠΕΡΙΕΧΟΜΕΝΑ ΑΠΟΦΑΣΕΙΣ Καθορισμός αποδοχών στελεχών των Παιδικών Εξο χών του Δήμου Αθηναίων....

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Δράση 1.1: βιολογική γεωργία ΠΡΟΓΡΑΜΜΑ ΑΓΡΟΤΙΚΗΣ ΑΝΑΠΤΥΞΗΣ ΤΗΣ ΕΛΛΑΔΑΣ 2007-2013

Δράση 1.1: βιολογική γεωργία ΠΡΟΓΡΑΜΜΑ ΑΓΡΟΤΙΚΗΣ ΑΝΑΠΤΥΞΗΣ ΤΗΣ ΕΛΛΑΔΑΣ 2007-2013 ΠΡΟΓΡΑΜΜΑ ΑΓΡΟΤΙΚΗΣ ΑΝΑΠΤΥΞΗΣ ΤΗΣ ΕΛΛΑΔΑΣ 2007-2013 Άξονας 2 : Προστασία του περιβάλλοντος και αειφόρος διαχείριση των φυσικών πόρων Μέτρο 2.1.4 : Γεωργό-περιβαλλοντικές ενισχύσεις Δράση 1.1: βιολογική

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Περιφέρεια Θεσσαλίας

Περιφέρεια Θεσσαλίας Περιφέρεια Θεσσαλίας Περιφερειακό Συμβούλιο Καινοτομίας Δημήτρης Κουρέτας, Καθηγητής ΠΘ, Πρόεδρος Αναπληρωτής Πρύτανη ΠΘ RIS3 Μεθοδολογία και αποτελέσματα εργασιών 16 Οκτωβρίου 2013 Έναρξη εργασιών: Μάιος

Διαβάστε περισσότερα

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ Σχολή Γεωτεχνικών Επιστημών και Διαχείρισης Περιβάλλοντος Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΜΑΣΤΕΡ (MSc) ΒΙΟΤΕΧΝΟΛΟΓΙΑ

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Τίτλος Προγράμματος Κατάρτισης : «ΖΩΙΚΗ ΠΑΡΑΓΩΓΗ - ΑΙΓΟΠΡΟΒΑΤΟΤΡΟΦΙΑ»

Τίτλος Προγράμματος Κατάρτισης : «ΖΩΙΚΗ ΠΑΡΑΓΩΓΗ - ΑΙΓΟΠΡΟΒΑΤΟΤΡΟΦΙΑ» Τίτλος Προγράμματος Κατάρτισης : Τίτλος Προγράμματος Κατάρτισης : «ΖΩΙΚΗ ΠΑΡΑΓΩΓΗ ΑΙΓΟΠΡΟΒΑΤΟΤΡΟΦΙΑ» Ημερ. Έναρξης: π.χ. 50202 Ημερ. Λήξης: π.χ. 602 Σύνολο ωρών: 50 Χώρος Υλοποίησης Προγράμματος Κατάρτισης:

Διαβάστε περισσότερα

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του 1 Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του μαστού. Ο καρκίνος του μαστού είναι με μεγάλη διαφορά

Διαβάστε περισσότερα

ΠΕΠΡΑΓΜΕΝΑ ΕΤΟΥΣ 2013

ΠΕΠΡΑΓΜΕΝΑ ΕΤΟΥΣ 2013 ΓΕΝΙΚΗ ΙΕΥΘΥΝΣΗ ΑΓΡΟΤΙΚΗΣ ΕΡΕΥΝΑΣ ΠΕΠΡΑΓΜΕΝΑ ΕΤΟΥΣ 2013 ΙΝΣΤΙΤΟΥΤΟ ΚΤΗΝΟΤΡΟΦΙΚΩΝ ΦΥΤΩΝ & ΒΟΣΚΩΝ ΛΑΡΙΣΑΣ 1. ΕΚΤΕΛΟΥΜΕΝΑ ΕΡΕΥΝΗΤΙΚΑ ΠΡΟΓΡΑΜΜΑΤΑ 1.1 Εθνικά Ανταγωνιστικά 1.1.1 Πρόγραµµα «ΘΑΛΗΣ». Τίτλος: «Selection

Διαβάστε περισσότερα

ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΚΑΡΠΕΡΟΥ

ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΚΑΡΠΕΡΟΥ ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΚΑΡΠΕΡΟΥ ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ-PROJECT Α ΛΥΚΕΙΟΥ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-13 ΘΕΜΑ: ΟΣΠΡΙΑ.Η ΔΙΑΧΡΟΝΙΚΗ ΤΟΥΣ ΑΞΙΑ ΣΤΗ ΔΙΑΤΡΟΦΗ ΜΑΣ ΚΑΙ ΣΤΗΝ ΟΙΚΟΝΟΜΙΑ ΤΟΥ ΤΟΠΟΥ ΜΑΣ. ΦΑΚΕΣ, ΡΕΒΙΘΙΑ, ΦΑΣΟΛΙΑ ΕΚΠΑΙΔΕΥΤΙΚΟΙ:

Διαβάστε περισσότερα

Πρόγραμμα εκπαίδευσης V-3DAS

Πρόγραμμα εκπαίδευσης V-3DAS Πρόγραμμα εκπαίδευσης V-3DAS 3. Συστήματα Πιστοποίησης της Ποιότητας Ιχνηλασιμότητας των Αγροτικών Προϊόντων 3.4. Συστήματα Παραγωγής και Πιστοποίησης Βιολογικών Προϊόντων 3.4.1. Νομοθετικό πλαίσιο, Κανονισμοί

Διαβάστε περισσότερα