H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων"

Transcript

1 H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων Dr. Παναγιώτης Μαδέσης Ι. Γανόπουλος, Ει. Μποσμαλή Κ. Πασέντσης, Α. Τσαυτάρης Ινστιτούτο Εφαρμοσμένων Βιοεπιστημών

2 Φυτογενετικοί πόροι και τοπικές ποικιλίες Φυτογενετικοί πόροι είναι το σύνολο του γενετικού υλικού των φυτών (άγριων και καλλιεργούμενων). Αποτελούν τη βάση για την ανάπτυξη: της γεωργίας, της δασοπονίας και της ανθοκομίας. και συμβάλλουν στη βελτίωση: της διατροφής, της υγείας και του φυσικού περιβάλλοντος. Παίζουν σημαντικό ρόλο στη βελτίωση των καλλιεργούμενων ποικιλιών

3 Φυτογενετικοί πόροι και τοπικές ποικιλίες Σημαντικοί για την τοπική κοινωνία: προσαρμοσμένοι στις τοπικές συνθήκες και πολλές φορές έχουν ιδιαίτερη θρεπτική και οικονομική σημασία Σημαντικοί για την Βελτίωση γιατί αποτελούν την πηγή πολύτιμων γονιδίων για την δημιουργία νέων ποικιλιών Γενετική διάβρωση: έχουν χαθεί πάνω από 90% των ποικιλιών σίτου και λαχανοκομικών ειδών που υπήρχαν πριν 50 χρόνια

4 Όσπρια Πολύ σημαντική οικογένεια δεύτερη μετά από τα σιτηρά σε σχέση με την παραγωγή και την έκταση που καλλιεργούνται Τα φασόλια είναι το ποιο σημαντικό είδος από πλευράς οικονομικότητας Το ένα τρίτο της πρωτεΐνης και του επεξεργασμένου φυτικού ελαίου που καταναλώνει ο άνθρωπος προέρχεται από τα όσπρια Σημαντικά για την διατήρηση της καλής υγείας του ανθρώπου Σημαντικά για την αειφόρο γεωργία λόγω της αζωτοδέσμευσης Στην Ελλάδα καλλιεργούνται σημαντικές ποικιλίες ΠΟΠ και ΠΓΕ

5 Αναγνώριση και ταυτοποίηση των ειδών και των ποικιλιών Δείκτες Φαινοτυπικοί Βιοχημικοί DNA μοριακοί δείκτες Μικροδορυφόροι (SSR + HRM) Χλωροπλαστικοί (DNA Barcoding + HRM)

6 Τι είναι οι μικροδορυφόροι? Επαναλαμβανόμενες αλληλουχίες με ένα μοτίβο επανάληψης 1-6 Dinucleotide (CT)6 - CTCTCTCTCTCT Trinucleotide (CTG)4 - CTGCTGCTGCTG Tetranucleotide (ACTC)4 - ACTCACTCACTCACTC Υποκατηγορίες Perfect repeat when repeat tract pure for one motif Compound SSR when repeat tract pure for two motifs Imperfect SSR if single base substitution Region of cryptic simplicity if complex but repetitive structure CTCTCTCTCTCT CTCTCTCACACA CTCTCTACTCTCT GTGTCACAGAGT

7 Απλές Επαναλαμβανόμενες αλληλουχίες (SSRs)

8 Τι είναι το DNA barcoding ; (Γραμμωτός κώδικας DNA) Η παραγωγή μικρών αλληλουχιών DNA που επιτρέπουν την αναγνώριση ειδών ή την αναγνώριση συγκεκριμένων ειδών σε συγκεκριμένους τομείς του δέντρου της ζωής (ευκαριωτικούς οργανισμούς).

9 Τι είναι το DNA barcoding ; In 2003, Paul Hebert, researcher at the University of Guelph in Ontario, Canada, proposed DNA barcoding as a way to identify species. Barcoding uses a very short genetic sequence from a standard part of the genome the way a supermarket scanner distinguishes products using the black stripes of the Universal Product Code (UPC). Two items may look very similar to the untrained eye, but in both cases the barcodes are distinct.

10 Xλωροπλάστης Τα φυτικά κύτταρα έχουν 3 γονιδιώματα Μιτοχόνδρια Πυρήνας

11 Χλωροπλαστικό γονιδίωμα Μικρό και συμπαγές kbp Περιέχει γονίδια που κωδικοποιούν πρωτεΐνες για τη φωτοσύνθεση και για την έκφραση αυτών Ο ρυθμός υποκατάστασης είναι χ 10-9 Στον πυρήνα 5-30 χ :3:12 μιτοχονδριο:χλωροπλαστης:πυρήνας bp bp Sugiura et. al. 1986, 2005

12 Επιλογή μιας κατάλληλης για τα φυτά περιοχής για Barcoding Έχουν προταθεί 7 περιοχές rpoc1<rpob<atpf atph<rbcl<matk<psbk psbi<trnh psba; και 3 έχουν προεπιλεχθεί rbcl : είναι εύκολη στην χρήση αλλά με μικρή διαχωριστική ικανότητα matk : έχει μεγαλύτερη διαχωριστική ικανότητα αλλά μικρότερη καθολικότητα trnh- psba : καλή καθολικότητα, μεγαλύτερη διαχωριστική ικανότητα αλλά μεταβλητό μέγεθος και οι αλληλουχίες συχνά σταματούν από SSRs

13 HRM-Ηigh Resolution Melting Yψηλής διακριτικής ικανότητας καμπυλών τήξης Τεχνική που μετράει τη θερμοκρασία τήξης ενός ενισχυμένου προϊόντος. Μοναδική για κάθε προϊόν, υπάρχει η δυνατότητα παρακολούθησης της αύξησης του φθορισμού που σχετίζεται με το άνοιγμα του δίκλωνου DNA. Οι λαμβανόμενες καμπύλες HRM είναι ιδιαίτερα χαρακτηριστικές για κάθε ενισχυόμενο προϊόν και εξαρτώνται από το GC περιεχόμενο του, το μήκος του ενισχυόμενου προϊόντος καθώς και την αλληλουχία του.

14 Εφαρμογές του Barcoding 1) Έρευνα και καταγραφή της βιοποικιλότητας, π.χ., αναγνώριση δυνητικών νέων (μη χαρακτηρισμένων) ειδών 2) Διευκόλυνση αναγνώρισης ειδών που έχουν ήδη περιγραφεί : Συνδέει εξελικτικά στάδια, είδη; Διαφοροποίηση κρυπτικών ειδών Αναγνώριση φυτών και τροφίμων με ονομασία προέλευσης Αναγνώριση προσμίξεων σε ΠΟΠ τρόφιμα

15 DNA Barcoding Ταυτοποίηση ειδών Barcoding σημαντικών για τον ελληνικό χώρο οικογενειών (ψυχανθή, δενδροκομικά είδη κ.α) ΠΟΠ προϊόντα

16 Ψυχανθή

17 Διαχωριστική ικανότητα των Barcoding περιοχών στα ψυχανθή trnl=its2>rpoc Από τα 25 είδη oι περιοχές trnl και ITS2 διαχώρισαν και τα 25 ενώ η rpoc διαχώρισε τα 18/25

18 Είδη Ψυχανθών Χρησιμοποιώντας την περιοχή trnl και τη βοήθεια της Bar-HRM μεθόδου Διαχωρίζουμε τα έιδη των ψυχανθών Έχει ενδιαφέρον να σημειώσουμε ότι διαχωρίζονται τα είδη λαθουριού και Τα κουκιά Chloroplast trnl region

19 Είδη Ψυχανθών Με καμπύλη αναφοράς το είδος Phaseolus vulgaris διαχωρίζονται Τα είδη των ψυχανθών με τη βοήθεια της Περιοχής trnl barcoding region

20 Διαχωρισμός ποικιλιών με μικροδορυφόρους και την χρήση της HRM Με καμπύλη αναφοράς τα φασόλι πλακέ μεγαλόσπερμα Πρεσπών διαχωρίζονται όλες οι άλλες ποικιλίες με τη χρήση του Μικροδορυφόρου PM139

21 Χρησιμοποιώντας την περιοχή trnl και τη βοήθεια της Bar-HRM μεθόδου Ανιχνεύουμε προσμίξεις έως 1% λαθούρι μέσα σε φάβα Σαντορίνης Φάβα Σαντορίνης

22 Ποικιλίες Φακής Χρησιμοποιώντας μικροδορυφόρους και τη βοήθεια της Bar-HRM μεθόδου Ανιχνεύουμε προσμίξεις έως 1% Βίκο σε φακές Ενγκλουβής 2012

23 Ποικιλίες Φακής Φακή Εγκλουβής (94) Lens esculentum rpoc contig (93) CTGCTTGAGCCTCCAAAGATAAAGGCACATGAACAGCCATTTGATCCCCATCAAAATCTGCATTGAACCCCTTACACACCAATGGATGTAA vicia sativa rpoc (93) CTGCTTGAGCCTCCAAAGATAAAGGCACATGAACAGCCATTTGATCCCCATCAAAGTCTGCATTGAATCCCTTACACACCAATGGATGTAA (185) Lens esculentum rpoc contig(184) AGAAATAGCACGTCCTTCTACTAAAATGGGTTGAAATGCCTGTATGCCCAATCTATGCAAAGTAGGCGCTCTATTCAGCAATACTGGATGC vicia sativa rpoc(184) ACAAATAGCACGTCCTTCTACTAAAATGGGTTGAAATGCCTGTATGCCCAATCTATGCAAAGTAGGCGCTCTATTCAGCAATACTGGATGC Βικός rpoclens_vicia R rpoclens_vicia F Σε κόκκινο κύκλο παρατηρούμαι τις διαφορές σε επίπεδο DNA που επιτρέπουν τον διαχωρισμο του βίκου με την φακή

24 Συμπεράσματα Με τη βοήθεια της τεχνικής Barcoding μπορούμε να αναγνωρίσουμε φυτικά είδη Ο Συνδυασμός μικροδορυφόρων και της HRM μπορεί να διαχωρίσει και ποικιλίες του ίδιου είδους Η χρήση συγκεκριμένων περιοχών ή και ο συνδυασμός χλωροπλαστικών περιοχών δίνει υψηλά ποσοστά αναγνώρισης ειδών Με τη βοήθεια της τεχνικής Barcoding μπορεί να γίνει αποτύπωση της βιοποικιλότητας Αναγνώριση φυτών και τροφίμων με ονομασία προέλευσης Αναγνώριση προσμίξεων σε ΠΟΠ (και όχι μόνο) τρόφιμα

25 Ευχαριστίες ΙΝΕΒ Ι. Γανόπουλος, Ει. Μποσμαλή Κ. Πασέντσης Α. Τσαυτάρης Τράπεζα Γενετικού Υλικού Π. Ράλλη Θ. Τσιβελίκα ΕΛΓΟ ΔΗΜΗΤΡΑ Ινστιτούτο Κτηνοτροφικών Φυτών Και Βοσκών Δ. Βλαχοστέργιο Συνεταιρισμός Σαντορίνης "SANTO"

26 Ευχαριστώ

Τοπικές Ποικιλίες. Γεωπονική Θεώρηση - O Ρόλος τους στην Σημερινή Γεωργία. Πηνελόπη Μπεμπέλη

Τοπικές Ποικιλίες. Γεωπονική Θεώρηση - O Ρόλος τους στην Σημερινή Γεωργία. Πηνελόπη Μπεμπέλη Τοπικές Ποικιλίες Γεωπονική Θεώρηση - O Ρόλος τους στην Σημερινή Γεωργία Πηνελόπη Μπεμπέλη Τοπικές Ποικιλίες (Εγχώριοι Πληθυσμοί) Είναι ετερογενείς πληθυσμοί Είναι τοπικά προσαρμοσμένοι Έχουν δημιουργηθεί

Διαβάστε περισσότερα

Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ

Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ ΙΝΣΤΙΤΟΥΤΟ KTHΝΟΤΡΟΦΙΚΩΝ ΦΥΤΩΝ ΚΑΙ ΒΟΣΚΩΝ ΘΕΟΦΡΑΣΤΟΥ 1, 41335 ΛΑΡΙΣΑ Τηλ: (2410) 533811, 660592 FAX.: (2410) 533809 E-mail: ikflaris@otenet.gr ΕΚΘΕΣΗ

Διαβάστε περισσότερα

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Α. Ντούλης, Ινστιτούτο Αμπέλου, Λαχανοκομίας & Ανθοκομίας Ηρακλείου (ΙΑΛΑΗ), Εθνικό Ίδρυμα Αγροτικών Ερευνών (ΕΘΙΑΓΕ) και

Διαβάστε περισσότερα

Όσπρια στην Ελλάδα Ποικιλίες, Σποροπαραγωγή.

Όσπρια στην Ελλάδα Ποικιλίες, Σποροπαραγωγή. Όσπρια στην Ελλάδα Ποικιλίες, Σποροπαραγωγή. Η καλλιέργεια των οσπρίων στη χώρα μας είναι εξαιρετικά περιορισμένη σε περίπου 140.000 στρέμματα. Η παραγόμενη ποσότητα οσπρίων δεν επαρκεί για την κάλυψη

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Δρ. Δημήτριος Βλαχοστέργιος Ινστιτούτο Κτηνοτροφικών Φυτών & Βοσκών Λάρισας

Δρ. Δημήτριος Βλαχοστέργιος Ινστιτούτο Κτηνοτροφικών Φυτών & Βοσκών Λάρισας Δρ. Δημήτριος Βλαχοστέργιος Ινστιτούτο Κτηνοτροφικών Φυτών & Βοσκών Λάρισας Ξηρικά Όσπρια Ρεβίθι (Cicer arietinum L.) Φακή (Lens culinaris Medik.) Κουκί (Vicia faba L.) Λαθούρι (φάβα) (Lathyrous sp.) Ποτιστικά

Διαβάστε περισσότερα

των Τοπικών Ποικιλιών Οσπρίων στην Ελλάδα Πηνελόπη Μπεμπέλη, Ροίκος Θανόπουλος

των Τοπικών Ποικιλιών Οσπρίων στην Ελλάδα Πηνελόπη Μπεμπέλη, Ροίκος Θανόπουλος Ποικιλότητα των Τοπικών Ποικιλιών Οσπρίων στην Ελλάδα Πηνελόπη Μπεμπέλη, Ροίκος Θανόπουλος Όσπρια στην Ελλάδα Μπιζέλι (Pisum sativum) Φακή (Lens culinaris) Ρεβίθι (Cicer arientinum) Λαθούρια (Lathyrus

Διαβάστε περισσότερα

Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ

Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ Ε Θ Ν Ι Κ Ο Ι Ρ Υ Μ Α Α Γ Ρ Ο Τ Ι Κ Η Σ Ε Ρ Ε Υ Ν Α Σ ΙΝΣΤΙΤΟΥΤΟ KTHΝΟΤΡΟΦΙΚΩΝ ΦΥΤΩΝ ΚΑΙ ΒΟΣΚΩΝ ΘΕΟΦΡΑΣΤΟΥ 1, 41335 ΛΑΡΙΣΑ Τηλ: (2410) 533811, 660592 FAX.: (2410) 533809 E-mail: ikflaris@otenet.gr ΕΚΘΕΣΗ

Διαβάστε περισσότερα

Προβλήµατα & Προοπτικές της καλλιέργειας των ΟΣΠΡΙΩΝ ρ. ηµήτριος Βλαχοστέργιος Ινστιτούτο Κτηνοτροφικών Φυτών & Βοσκών Λάρισας ΚΥΡΙΟΤΕΡΑ ΟΣΠΡΙΑ Ξηρικά Όσπρια Ρεβίθι (Cicer arietinum L.) Φακή (Lens culinaris

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Ο ΑΝΑΠΛΗΡΩΤΗΣ ΥΠΟΥΡΓΟΣ ΠΑΡΑΓΩΓΙΚΗΣ ΑΝΑΣΥΓΚΡΟΤΗΣΗΣ, ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΕΝΕΡΓΕΙΑΣ

Ο ΑΝΑΠΛΗΡΩΤΗΣ ΥΠΟΥΡΓΟΣ ΠΑΡΑΓΩΓΙΚΗΣ ΑΝΑΣΥΓΚΡΟΤΗΣΗΣ, ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΕΝΕΡΓΕΙΑΣ ΘΕΜΑ : «Καθορισμός λεπτομερειών χορήγησης της συνδεδεμένης ενίσχυσης στα όσπρια που προορίζονται για ανθρώπινη κατανάλωση σε εκτέλεση του άρθρου 52 του Κανονισμού (ΕΚ) αριθ. 1307/2013 του Ευρωπαϊκού Κοινοβουλίου

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

τηςσυγκαλλιέργειαςβίκου κριθήςως χαρακτηριστικάτης τηςχλωροµάζας.

τηςσυγκαλλιέργειαςβίκου κριθήςως χαρακτηριστικάτης τηςχλωροµάζας. Μελέτητης τηςσυγκαλλιέργειαςβίκου κριθήςως ωςπροςταποσοτικάκαιποιοτικά χαρακτηριστικάτης τηςχλωροµάζας. Ι. Χατζηγεωργίου 1, Κ. Τσιµπούκας 2 και Γ. Ζέρβας 1 1 Εργαστήριο Φυσιολογίας Θρέψεως και ιατροφής,

Διαβάστε περισσότερα

Κ. Δήμας. Αναπληρωτής Καθηγητής. Τμήμα Τεχνολόγων Γεωπόνων Α.Τ.Ε.Ι. Θεσσαλονίκης

Κ. Δήμας. Αναπληρωτής Καθηγητής. Τμήμα Τεχνολόγων Γεωπόνων Α.Τ.Ε.Ι. Θεσσαλονίκης Κ. Δήμας Αναπληρωτής Καθηγητής Τμήμα Τεχνολόγων Γεωπόνων Α.Τ.Ε.Ι. Θεσσαλονίκης ΧΟΡΤΟΔΟΤΙΚΑ ΨΥΧΑΝΘΗ (Leguminose) Ετήσια Trifolium incrntum Trifolium lexndrinum Trifolium resupintum Trifolium hirtum Trifolium

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Ιοί ντόπιων ποικιλιών ψυχανθών: παράγοντες υποβάθμισης ή ανάδυσης γονιδίων ανθεκτικότητας;

Ιοί ντόπιων ποικιλιών ψυχανθών: παράγοντες υποβάθμισης ή ανάδυσης γονιδίων ανθεκτικότητας; Ιοί ντόπιων ποικιλιών ψυχανθών: παράγοντες υποβάθμισης ή ανάδυσης γονιδίων ανθεκτικότητας; Ελισάβετ Κ. Χατζηβασιλείου (echatz@aua.gr) Εργαστήριο Φυτοπαθολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Οι ιοί είναι

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα

Ο ΡΟΛΟΣ ΤΩΝ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΟΣΠΡΙΩΝ & Η ΑΞΙΟΠΟΙΗΣΗ ΤΟΥΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΒΕΛΤΙΩΜΕΝΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ

Ο ΡΟΛΟΣ ΤΩΝ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΟΣΠΡΙΩΝ & Η ΑΞΙΟΠΟΙΗΣΗ ΤΟΥΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΒΕΛΤΙΩΜΕΝΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ & ΑΓΡΟΤΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Ο ΡΟΛΟΣ ΤΩΝ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΟΣΠΡΙΩΝ & Η ΑΞΙΟΠΟΙΗΣΗ ΤΟΥΣ ΣΤΗΝ ΠΑΡΑΓΩΓΗ ΒΕΛΤΙΩΜΕΝΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ

Διαβάστε περισσότερα

ΠΑΡΟΥΣΙΑΣΗ ΝΙΚΟΛΑΟΣ ΑΝ. ΣΤΕΡΓΙΟΥ << ΠΕΛΕΚΑΝΟΣ>>

ΠΑΡΟΥΣΙΑΣΗ ΝΙΚΟΛΑΟΣ ΑΝ. ΣΤΕΡΓΙΟΥ << ΠΕΛΕΚΑΝΟΣ>> ΠΑΡΟΥΣΙΑΣΗ ΝΙΚΟΛΑΟΣ ΑΝ. ΣΤΕΡΓΙΟΥ ΠΡΟΕΔΡΟΣ ΤΟΥ Δ.Σ. ΕΘΝΙΚΟΥ ΔΡΥΜΟΥ ΠΡΕΣΠΩΝ > ΠΡΟΕΛΕΥΣΗ ΤΟΠΙΚΗΣ ΠΟΙΚΙΛΙΑΣ Ηεξημέρωσητουφασολιούξεκινάπριναπό7000 χρόνια στην Κεντρική Αμερική. Το γένος Phaseolus

Διαβάστε περισσότερα

Μελέτη της συγκαλλιέργειας βίκου-κριθής. κριθής και µπιζελιού- και ποιοτικά χαρακτηριστικά της παραγόµενης χλωροµάζας

Μελέτη της συγκαλλιέργειας βίκου-κριθής. κριθής και µπιζελιού- και ποιοτικά χαρακτηριστικά της παραγόµενης χλωροµάζας Μελέτη της συγκαλλιέργειας βίκου-κριθής κριθής και µπιζελιού- βρώµης ως προς τα ποσοτικά και ποιοτικά χαρακτηριστικά της παραγόµενης χλωροµάζας Χατζηγεωργίου Ι. 1, Φορτάτος Ε. 1, Τσιµπούκας Κ. 2, Ζέρβας

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΕΝΑΛΛΑΚΤΙΚΕΣ ΠΗΓΕΣ ΠΡΩΤΕΙΝΗΣ ΓΙΑ ΤΟΥΣ ΧΟΙΡΟΥΣ. Ιωάννης Μαυρομιχάλης, PhD

ΕΝΑΛΛΑΚΤΙΚΕΣ ΠΗΓΕΣ ΠΡΩΤΕΙΝΗΣ ΓΙΑ ΤΟΥΣ ΧΟΙΡΟΥΣ. Ιωάννης Μαυρομιχάλης, PhD ΕΝΑΛΛΑΚΤΙΚΕΣ ΠΗΓΕΣ ΠΡΩΤΕΙΝΗΣ ΓΙΑ ΤΟΥΣ ΧΟΙΡΟΥΣ Ιωάννης Μαυρομιχάλης, PhD Οι τιμές του σογιαλεύρου και των κρυσταλλικών αμινοξέων παραμένουν ασταθείς. Κατά καιρούς, υπάρχει ενδιαφέρον για λιγότερο γνωστές

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Τοπικές ποικιλίες καλλιεργούμενων ειδών στην Κρήτη με έμφαση στα κηπευτικά: Ένα δυναμικό για πολλαπλή αξιοποίηση

Τοπικές ποικιλίες καλλιεργούμενων ειδών στην Κρήτη με έμφαση στα κηπευτικά: Ένα δυναμικό για πολλαπλή αξιοποίηση Τοπικές ποικιλίες καλλιεργούμενων ειδών στην Κρήτη με έμφαση στα κηπευτικά: Ένα δυναμικό για πολλαπλή αξιοποίηση Θανόπουλος, Ρ. 1, Σαμαράς, Στ. 2, Γανίτης Κ. 2, Γκατζελάκη Χ. 2, Κόταλη Ε. 2, Ψαρρά Ε. 2,

Διαβάστε περισσότερα

Έλεγχος Σπόρου Έλεγχος τροφής. Βάσω Κανελλοπούλου Εκπρόσωπος του Πελίτι www.peliti.gr

Έλεγχος Σπόρου Έλεγχος τροφής. Βάσω Κανελλοπούλου Εκπρόσωπος του Πελίτι www.peliti.gr Έλεγχος Σπόρου Έλεγχος τροφής Βάσω Κανελλοπούλου Εκπρόσωπος του Πελίτι www.peliti.gr Σπόροι Μπορούμε να χωρίσουμε τους σπόρους που σήμερα καλλιεργούνται σε δυο βασικές κατηγορίες - τους παραδοσιακούς (Σπόροι

Διαβάστε περισσότερα

Προστατευόμενων Ονομασιών Προέλευσης και Προστατευόμενων Γεωγραφικών Ενδείξεων με έμφαση στα Όσπρια

Προστατευόμενων Ονομασιών Προέλευσης και Προστατευόμενων Γεωγραφικών Ενδείξεων με έμφαση στα Όσπρια Μανανά Σοφία Τμήμα ΠΟΠ ΠΓΕ Ιδιότυπων και Παραδοσιακών Προϊόντων Διεύθυνση Βιολογικής Γεωργίας Υπουργείο Αγροτικής Ανάπτυξης και Τροφίμων Προϋποθέσεις και Διαδικασία καταχώρισης ονομασιών στο Μητρώο της

Διαβάστε περισσότερα

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 1 Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης, Ηράκλειο Κρήτης. 2 Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 Department of Biology, Faculty of Science, Dokuz

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

Μεθοδολογίες άμεσης μεταφοράς γονιδίων στο φυτό

Μεθοδολογίες άμεσης μεταφοράς γονιδίων στο φυτό Μεθοδολογίες άμεσης μεταφοράς γονιδίων στο φυτό μεταφορά μεγάλων ποσοτήτων «γυμνού DNA» σε παροδικώς διαπερατά φυτικά κύτταρα μεταμόρφωση φυτών με φυσικές, χημικές και μηχανικές μεθοδολογίες: βομβαρδισμός

Διαβάστε περισσότερα

ΑΓΡΟΤΙΚΗ ΕΡΕΥΝΑ: ΜΕ ΤΟ ΒΛΕΜΜΑ ΣΤΟ ΠΑΡΕΛΘΟΝ ΑΤΕΝΙΖEI ΤΟ ΜΕΛΛΟΝ

ΑΓΡΟΤΙΚΗ ΕΡΕΥΝΑ: ΜΕ ΤΟ ΒΛΕΜΜΑ ΣΤΟ ΠΑΡΕΛΘΟΝ ΑΤΕΝΙΖEI ΤΟ ΜΕΛΛΟΝ ΑΓΡΟΤΙΚΗ ΕΡΕΥΝΑ: ΜΕ ΤΟ ΒΛΕΜΜΑ ΣΤΟ ΠΑΡΕΛΘΟΝ ΑΤΕΝΙΖEI ΤΟ ΜΕΛΛΟΝ Η ΑΓΡΟΤΙΚΗ ΕΡΕΥΝΑ ΣΤΗΝ ΕΛΛΑΔΑ ΔΗΜΙΟΥΡΓΕΙΤΑΙ ΤΗΝ ΔΕΚΑΕΤΙΑ ΤΟΥ 20 ΜΕΣΑ ΑΠΟ ΤΟ ΧΑΟΣ ΟΙ ΟΙΚΟΝΟΜΙΚΕΣ ΚΡΙΣΕΙΣ ΕΙΝΑΙ ΚΥΚΛΙΚΕΣ?!.. Μικρασιατική Καταστροφή

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

Παραγωγικά συστήματα προβάτων και αιγών: Βιοποικιλότητα, τοπικές φυλές και προϊόντα τους

Παραγωγικά συστήματα προβάτων και αιγών: Βιοποικιλότητα, τοπικές φυλές και προϊόντα τους Παραγωγικά συστήματα προβάτων και αιγών: Βιοποικιλότητα, τοπικές φυλές και προϊόντα τους Αξίες και προκλήσεις στον τομέα της αιγο-προβατοτροφίας. Ποιες είναι οι προοπτικές για την ανάπτυξη δικτύων συνεργασίας;

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Προστασία Φυτο- γενετικών Πόρων. Επισιτιστική Αυτάρκεια. Βάσω Κανελλοπούλου ΠΕΛΙΤΙ

Προστασία Φυτο- γενετικών Πόρων. Επισιτιστική Αυτάρκεια. Βάσω Κανελλοπούλου ΠΕΛΙΤΙ Προστασία Φυτο- γενετικών Πόρων ε Επισιτιστική Αυτάρκεια Βάσω Κανελλοπούλου ΠΕΛΙΤΙ ΦΟΡΟΥΜ-ΠΟΛΙΤΙΚΟ ΕΡΓΑΣΤΗΡΙ ΕΥΗΜΕΡΙΑ ΧΩΡΙΣ ΑΝΑΠΤΥΞΗ Αθήνα, Πολυτεχνείο, 20-22/2/2015 Διοργάνωση: Ηλιόσποροι, δίκτυο για

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Αϖοµόνωση και γενετική διαφοροϖοίηση ϖληθυσµών του ζαρκαδιού (Capreoluscapreolus) στην Ελλάδα νέα δεδοµένα για αϖοτελεσµατικότερη διαχείριση και διατήρηση ηµήτρης Τσαϖάρης Παναγιώτης Κασαϖίδης Κωνσταντίνος

Διαβάστε περισσότερα

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ Το πρόγραμμα σπουδών του τμήματος Γεωπονικής Βιοτεχνολογίας πρέπει να ανταποκρίνεται στην εξαγωγή επιστημόνων Γεωπόνων Βιοτεχνολόγων ικανών να μελετούν, να αντιμετωπίζουν και να προτείνουν

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

Αξιοποίηση των ελληνικών φυτών

Αξιοποίηση των ελληνικών φυτών ΓΕΩΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Δράμα, 10 και 11

Διαβάστε περισσότερα

ΤΟΠΙΚΕΣ ΠΟΙΚΙΛΙΕΣ: ΤΟ ΟΡΟΠΕΔΙΟ ΤΟΥ ΔΟΜΟΚΟΥ. Στίγκας Γρηγόρης

ΤΟΠΙΚΕΣ ΠΟΙΚΙΛΙΕΣ: ΤΟ ΟΡΟΠΕΔΙΟ ΤΟΥ ΔΟΜΟΚΟΥ. Στίγκας Γρηγόρης 2η Επιστημονική Συνάντηση για τις τοπικές ποικιλίες ΤΟΠΙΚΕΣ ΠΟΙΚΙΛΙΕΣ: ΤΟ ΟΡΟΠΕΔΙΟ ΤΟΥ ΔΟΜΟΚΟΥ Στίγκας Γρηγόρης ΤΟ ΟΡΟΠΕΔΙΟ ΤΟΥ ΔΟΜΟΚΟΥ ΤΟ ΟΡΟΠΕΔΙΟ ΤΟΥ ΔΟΜΟΚΟΥ Το οροπέδιο του Δομοκού, με μέσο υψόμετρο

Διαβάστε περισσότερα

Διαφύλαξη της γεωργικής μας κληρονομιάς

Διαφύλαξη της γεωργικής μας κληρονομιάς Διαφύλαξη της γεωργικής μας κληρονομιάς Αλκίνοος Νικολαΐδης, Διευθυντής Αξία των τοπικών ποικιλιών Οι τοπικές ποικιλίες καλλιεργούμενων ειδών είναι αποτέλεσμα μακροχρόνιας εξελικτικής διαδικασίας και επιλογής

Διαβάστε περισσότερα

Ανάδειξη Ελληνικών Προϊόντων

Ανάδειξη Ελληνικών Προϊόντων Ανάδειξη Ελληνικών Προϊόντων Αναγνώστης Αργυρίου Ερευνητής, Αναπληρωτής Διευθυντής Ινστιτούτου Εφαρμοσμένων Βιοεπιστημών ΕΚΕΤΑ, Αντιπρόεδρος Ινστιτούτου Διατροφικού Πολιτισμού και Γαστρονομίας Αγρο-διατροφή

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

ΠΡΟΣΤΑΣΙΑ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΜΕΣΩ ΤΗΣ ΠΙΣΤΟΠΟΙΗΣΗΣ ΤΩΝ ΠΑΡΑΓΟΜΕΝΩΝ ΠΡΟΙΟΝΤΩΝ

ΠΡΟΣΤΑΣΙΑ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΜΕΣΩ ΤΗΣ ΠΙΣΤΟΠΟΙΗΣΗΣ ΤΩΝ ΠΑΡΑΓΟΜΕΝΩΝ ΠΡΟΙΟΝΤΩΝ ΠΡΟΣΤΑΣΙΑ ΤΟΠΙΚΩΝ ΠΟΙΚΙΛΙΩΝ ΜΕΣΩ ΤΗΣ ΠΙΣΤΟΠΟΙΗΣΗΣ ΤΩΝ ΠΑΡΑΓΟΜΕΝΩΝ ΠΡΟΙΟΝΤΩΝ Σπύρος Στάχτιαρης 1ηΕπιστημονικήΣυνάντησηγιατιςΤοπικέςΠοικιλίες Γεωπονικό Πανεπιστήμιο Αθηνών 21.10.2011 Εισαγωγή Σκοπός: Διερεύνηση

Διαβάστε περισσότερα

Τοπικές ποικιλίες: Αναγκαίες αποσαφηνίσεις και επισκόπηση δράσεων

Τοπικές ποικιλίες: Αναγκαίες αποσαφηνίσεις και επισκόπηση δράσεων Τοπικές ποικιλίες: Αναγκαίες αποσαφηνίσεις και επισκόπηση δράσεων Δρ. Ρ. Θανόπουλος Τμήμα Γεωργικών Εκμεταλεύσεων Γ.Π.Α. Π. Μπεμπέλη Καθηγήτρια Εργαστήριο Βελτίωσης Φυτών και Γεωργικού Πειραματισμού Γ.Π.Α.

Διαβάστε περισσότερα

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Γενετική δομή και πρότυπα διαφοροποίησης των πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Δημήτρης Τσαπάρης Jacob Fric Αθήνα, Οκτώβριος 2012 Jon

Διαβάστε περισσότερα

Σίνος Γκιώκας Πανεπιστήμιο Πατρών Τμήμα Βιολογίας Πάτρα 2015 ΒΙΟΛΟΓΙΑ ΖΩΩΝ Ι - ΕΙΣΑΓΩΓΗ - ΒΑΣΙΚΕΣ ΑΡΧΕΣ - Σίνος Γκιώκας - Πανεπιστήμιο Πατρών 2015 1

Σίνος Γκιώκας Πανεπιστήμιο Πατρών Τμήμα Βιολογίας Πάτρα 2015 ΒΙΟΛΟΓΙΑ ΖΩΩΝ Ι - ΕΙΣΑΓΩΓΗ - ΒΑΣΙΚΕΣ ΑΡΧΕΣ - Σίνος Γκιώκας - Πανεπιστήμιο Πατρών 2015 1 Σίνος Γκιώκας Πανεπιστήμιο Πατρών Τμήμα Βιολογίας Πάτρα 2015 2015 1 Αντικείμενο μαθήματος: Περιεχόμενο μαθήματος: Προτεινόμενο σύγγραμμα: Διδάσκοντες: Μέθοδοι διδασκαλίας: Μέθοδοι αξιολόγησης: Τύπος μαθήματος:

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

327 Αξιοποίησης Φυσικών Πόρων και Γεωργικής Μηχανικής Γεωπονικού Παν. Αθήνας

327 Αξιοποίησης Φυσικών Πόρων και Γεωργικής Μηχανικής Γεωπονικού Παν. Αθήνας 327 Αξιοποίησης Φυσικών Πόρων και Γεωργικής Μηχανικής Γεωπονικού Παν. Αθήνας Σκοπός Οποιαδήποτε προσπάθεια για την ορθολογική ανάπτυξη του αγροτικού χώρου απαιτεί τη δημιουργία και τη φροντίδα μιας αποτελεσματικής

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

Φύλλο εργασίας 1 Το γενετικό υλικό οργανώνεται σε χρωμοσώματα. Ονοματεπώνυμο Τμήμα Ημερομηνία.

Φύλλο εργασίας 1 Το γενετικό υλικό οργανώνεται σε χρωμοσώματα. Ονοματεπώνυμο Τμήμα Ημερομηνία. Ενότητα λογισμικού Γενετική Φύλλο εργασίας 1 Το γενετικό υλικό οργανώνεται σε χρωμοσώματα Βιολογία Γ Γυμνασίου Ονοματεπώνυμο Τμήμα Ημερομηνία. Όλοι οι οργανισμοί εμφανίζουν συγκεκριμένα δομικά χαρακτηριστικά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

σπανίων φυλών των ζώων

σπανίων φυλών των ζώων Προβλήματα διατήρησης των σπανίων φυλών των ζώων Problems of conservation of rare breeds of animals Ανεξέλεγκτες διασταυρώσεις στα ποίμνια Μικρό μέγεθος Ελεγχο ομομειξίας μ Αδυναμία κατάταξης των ζώων

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο Διάλεξη 2 Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο (Κ. Ματθιόπουλοσ) Τι είναι «είδος»; Μοριακή ταυτοποίηση: είδος, άτομο,, φύλο Πόσο αξίζει μια ομάδα οργανισμών τις προσπάθειες διατήρησής τους Δηλαδή: πόσο

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

Βιοτεχνολογία και Παραγωγή: Ποια ερωτήµατα πρέπει να απαντηθούν

Βιοτεχνολογία και Παραγωγή: Ποια ερωτήµατα πρέπει να απαντηθούν Βιοτεχνολογία και Παραγωγή: Ποια ερωτήµατα πρέπει να απαντηθούν Γ. Ν. Σκαράκης Γεωπονικό Πανεπιστήµιο Αθηνών Συνέδριο Αγροτικής Επιχειρηµατικότητας Αθήνα, 10 Μαΐου 2015 Βασικοί στόχοι γεωργικής ανάπτυξης

Διαβάστε περισσότερα

ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ:

ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ: ΤΡΟΦΙΜΑ ΑΠΟ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ: ΕΝΑ ΠΕΙΡΑΜΑ ΜΕ ΑΓΝΩΣΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΣΤΗΝ ΥΓΕΙΑ, ΤΟ ΠΕΡΙΒΑΛΛΟΝ, ΤΗΝ ΚΟΙΝΩΝΙΑ ΝΙΚΟΛΑΣ ΠΡΙΜΗΚΥΡΙΟΣ, ΓΕΩΠΟΝΟΣ, Δρ. ΦΥΣΙΟΛΟΓΙΑΣ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΦΥΤΩΝ ΓΕΝΕΤΙΚΑ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

Φακή. Τζουραµάνη Ε., Ναβρούζογλου Π., Σιντόρη Αλ., Λιοντάκης Αγ., Παπαευθυµίου Μ. Καρανικόλας Π. και Αλεξόπουλος Γ.

Φακή. Τζουραµάνη Ε., Ναβρούζογλου Π., Σιντόρη Αλ., Λιοντάκης Αγ., Παπαευθυµίου Μ. Καρανικόλας Π. και Αλεξόπουλος Γ. Ινστιτούτο Γεωργοοικονοµικών και Κοινωνιολογικών Ερευνών Εθνικό Ίδρυµα Αγροτικής Έρευνας Λ. ηµοκρατίας 61, 135 61 Αγ. Ανάργυροι, Αττική Τηλ. 210 27 56 596, Fax 210 27 51 937 Email tzouramani.inagrop@nagref.gr

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

Ελληνικές ποικιλίες οσπρίων

Ελληνικές ποικιλίες οσπρίων Ελληνικές ποικιλίες οσπρίων ΕΛΛΗΝΙΚΟΣ ΓΕΩΡΓΙΚΟΣ ΟΡΓΑΝΙΣΜΟΣ "ΔΗΜΗΤΡΑ" ΓΕΝΙΚΗ ΔΙΕΥΘΥΝΣΗ ΑΓΡΟΤΙΚΗΣ ΕΡΕΥΝΑΣ ΙΝΣΤΙΤΟΥΤΟ ΚΤΗΝΟΤΡΟΦΙΚΩΝ ΦΥΤΩΝ & ΒΟΣΚΩΝ ΛΑΡΙΣΑΣ Απρίλιος 2012 ΕΠΙΣΤΗΜΟΝΙΚΗ ΕΠΙΜΕΛΕΙΑ Δρ Δημήτριος

Διαβάστε περισσότερα

ΦΥΤΙΚΗ ΠΑΡΑΓΩΓΗ 2011 1.Περιφέρεια: Περιφερειακή Ενότητα Σερρών

ΦΥΤΙΚΗ ΠΑΡΑΓΩΓΗ 2011 1.Περιφέρεια: Περιφερειακή Ενότητα Σερρών ΦΥΤΙΚΗ ΠΑΡΑΓΩΓΗ 2011 1.Περιφέρεια: Περιφερειακή Ενότητα Σερρών ΞΗΡΙΚΗ ΠΟΤΙΣΤΙΚΗ ΞΗΡΙΚΗ ΠΟΤΙΣΤΙΚΗ Εκτάσεις σε καλή γεωργική κατάσταση 73.000 Σιτηρά Σίτος μαλακός 87.000 30.450 ξ.β. ξ.β. 0,35 ξ.β. Σίτος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

Δημήτρης Σωτηρόπουλος Τεχνολόγος Γεωπονίας DS Consulting

Δημήτρης Σωτηρόπουλος Τεχνολόγος Γεωπονίας DS Consulting Δημήτρης Σωτηρόπουλος Τεχνολόγος Γεωπονίας Κανονισμοί Ευρωπαϊκής Ένωσης Λειτουργία Συστήματος Ελέγχου Πιστοποίηση Προϊόντων Κανονισμός (ΕΚ) 834/2007 Κανονισμός (ΕΚ) 889/2008 Κανονισμός (ΕΚ) 710/2009 Κανονισμός

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών ΓΕΩΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Δράμα, 10 και 11

Διαβάστε περισσότερα