ΜΟΡΙΑΚΗ ΕΞΕΛΙΞΗ. Η γονιδιακή πορεία της εξέλιξης

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΜΟΡΙΑΚΗ ΕΞΕΛΙΞΗ. Η γονιδιακή πορεία της εξέλιξης"


1 ΜΟΡΙΑΚΗ ΕΞΕΛΙΞΗ Η γονιδιακή πορεία της εξέλιξης


3 ΜΟΡΙΑΚΗ ΕΞΕΛΙΞΗ Η μοριακή εξέλιξη περιλαμβάνει δύο μεγάλες περιοχές μελέτης: α) την εξέλιξη των μακρομορίων και β) την κατασκευή της εξελικτικής ιστορίας των γόνων και κατ επέκταση των οργανισμών.

4 Εξέλιξη των μακρομορίων Ο όρος εξέλιξη των μακρομορίων αναφέρεται στους ρυθμούς καθώς και στα σχέδια των αλλαγών που λαμβάνουν χώρα στο γενετικό υλικό (DNA) καθώς και στα προϊόντα αυτού (πρωτεΐνες) κατά τη διάρκεια του εξελικτικού χρόνου, όπως επίσης και των μηχανισμών οι οποίοι είναι υπεύθυνοι για τις αλλαγές αυτές. Για αυτόν το σκοπό απαιτείται τόσο η περιγραφή του είδους των αλλαγών που συντελούνται όσο και η αντίστοιχη συχνότητα με την οποία εμφανίζονται. Σημαντική επιπλέον θεωρείται η γνώση της σχέσης δομής -λειτουργίας των αλληλουχιών του DNA, έτσι ώστε να είναι δυνατή η εκτίμηση καθώς και η σημασία του αποτελέσματος των αλλαγών στο επίπεδο του DNA. Τόσο η ποσοτική όσο και η ποιοτική θεώρηση των μηχανισμών οι οποίοι οδηγούν σε αλλαγές στο μόριο του DNA καθώς οι μηχανισμοί οι οποίοι προλαμβάνουν τέτοιες αλλαγές (επαναδιόρθωση DNA), πρέπει να γίνουν κατανοητοί. Τέλος πρέπει να μάθουμε με ποιό τρόπο όλοι αυτοί οι παράμετροι μεταβάλλονται μεταξύ των διαφόρων οργανισμών και πώς επηρεάζονται από τις περιβαλλοντολογικές συνθήκες μέσα στις οποίες ζουν οι διάφοροι οργανισμοί.

5 Κατασκευή της εξελικτικής ιστορίας των γόνων και των οργανισμών. Η περιοχή αυτή είναι περισσότερο γνωστή με τον όρο μοριακή φυλογένεση και αναφέρεται στην εξελικτική ιστορία των οργανισμών και των μακρομορίων όπως αυτή προκύπει με βάση τα μοριακά δεδομένα. Η χρησιμοποίηση των μοριακών δεδομένων στην εύρεση των φυλογενετικών σχέσεων βασίζεται στην όλο και αυξανόμενη γνώση της γενετικής βάσης καθώς και της κατανόησης πολλών εκ των μοριακών διαδικασιών οι οποίες ενέχονται στις νουκλεοτιδικές αντικαταστάσεις. Τα αποτελέσματα από τη χρήση μοριακών δεδομένων δεν εγγυώνται πάντα την ορθότητα των φυλογενετικών σχέσεων.

6 Δύο είναι οι κύριες πηγές ανακριβών πληροφοριών οι οποίες ενέχονται σε αυτό το πρόβλημα. Η πρώτη από αυτές έχει ως βάση την διατήρηση της ομοιότητας λόγω συμβολής του πολυμορφισμού του κοινού προγόνου και είναι δυνατό να επηρεάζει κάθε γόνο ο οποίος παρουσιάζει πολυμορφισμό. Η δεύτερη αφορά την επικάλυψη των πληροφοριών η οποία προκύπτει από την πολλαπλή υποκατάσταση σε μία νουκλεοτιδική θέση.

7 Ορισμοί ΚΙΣΤΡΟΝΙΟ είναι η μονάδα κωδικοποίησης ενός πολυπεπτιδίου. ΜΟΥΤΟΝΙΟ είναι ένα νουκλεϊνικό ζευγάρι του DNA. Το ΓΟΝΙΔΙΟ αποτελείται από όλες εκείνες τις νουκλεοτιδικές αλληλουχίες DNA (δομικές και ρυθμιστικές) που είναι απαραίτητες για να δώσουν ένα απλό λειτουργικό πολυπεπτίδιο ή μια αλληλουχία RNA. Τα γονίδια κατατάσσονται σε: Δομικά γονίδια που περιέχουν: Ιντρόνια (οι περιοχές που δεν μεταφράζονται) Εξόνια (οι περιοχές που μεταφράζονται)

8 Τα γονίδια κατατάσσονται σε: Ρυθμιστικές Αλληλουχίες όπως: Υποκινητές Κωδικοί έναρξης, λήξης Δέσμευση της RNA πολυμεράσης Ρυθμιστικά γονίδια όπως: Αντιγραφής Ανασυνδυασμού Διαχωρισμού Διαμόρφωσης θέσεων δέσμευσης με πρωτείνες ή βιομόρια Κωδικοποίησης πρωτεινών που αλληλεπιδρούν με DNA Ομοιοτικά

9 Γενετικός Πολυμορφισμός Ενα γονίδιο είναι πολυμορφικό, άν συνυπάρχουν στον πληθυσμό δύο ή περισσότερα αλληλόμορφα. Ως μέτρο της πολυμορφίας ορίζεται η νουκλεοτιδική ποικιλότητα: π=σ χi χj πij

10 Τί είδους μεταλλαγές υπάρχουν? (ανάλογα με το εύρος των νουκλεοτιδίων που επηρεάζονται) Γονιδιακές (gene-level mutations) Χρωμοσωματικές (chromosomal mutations)

11 Απλές αντικαταστάσεις βάσεων (Βase substitutions) Με λάθος νόημα (Μissense), συνώνυμη ή μή συνώνυμη (synonymoys or nonsynonymous) Xωρίς νόημα (Nonsense) Σιωπηλές (Silent)

12 Σιωπηλές μεταλλαγές και με λάθος νόημα μεταλλαγές (συνώνυμες και μη συνώνυμες) Σιωπηλές Μεταλλαγές / Συνώνυμες AGG CGG (αργινίνη αργινίνη) UCA UCG (σερίνη σερίνη) Με λάθος νόημα μεταλλαγές Μη συνώνυμες / συντηρητικές ΑΑΑ ΑGA (βασική λυσίνη βασική αργινίνη) Με λάθος νόημα μεταλλαγές Μη συνώνυμες / ημισυντηρητικές UUU UCU (υδρόφοβη φαινυλαλανίνη πολική σερίνη

13 Προσθήκες (Insertions)

14 Αφαιρέσεις (Deletions)

15 Μεταλλαγές μετατόπισης πλαισίου (Frameshift mutations)

16 Παράδειγμα 1


18 Παράδειγμα 2 συνέχεια AUG AAA CUU CGC AGG AUG AUG AUG


20 Σχέδια νουκλεοτιδικών υποκαταστάσεων Όπου Α και G οι βάσεις αδενίνη και γουανίνη αντίστοιχα οι οποίες ανήκουν στην ομάδα των πουρινών. Όπου C και T οι βάσεις κυτοσίνη και θυμίνη αντίστοιχα οι οποίες ανήκουν στην ομάδα των πυριμιδών. Οι αλλαγές μεταξύ των βάσεων που αναπαριστώνται με διακεκομμένη γραμμή αφορούν αλλαγές μεταξύ πουρινών ή μεταξύ πυριμιδών και χαρακτηρίζονται ως μεταπτώσεις. Οι αλλαγές μεταξύ των βάσεων που αναπαριστώνται με συνεχή γραμμή αφορούν αλλαγές από πουρίνη σε πυριμιδίνη ή αντίστροφα και χαρακτηρίζονται ως μεταστροφές.

21 Σχήματα νουκλ. υποκαταστάσεων Πιθανότητα αλλαγής μιας βάσης Η υπόθεση κατά την οποία κάθε βάση αλλάζει σε οποιαδήποτε άλλη βάση με την ίδια πιθανότητα, για διάφορους λόγους δεν επαληθεύεται ποτέ. Ο αριθμός των μεταπτώσεων (αλλαγές βάσεων από πουρίνες σε πουρίνες ή από πυριμιδίνες σε πυριμιδίνες, φαίνεται να είναι διαφορετικός από τον αριθμό των μεταστροφών (αλλαγές βάσεων από πουρίνες σε πυριμιδίνες και αντίστροφα) Επίσης ο αριθμός των μεταπτώσεων που αντιστοιχούν σε πουρίνες μπορεί να μην είναι ίδιος με τον αριθμό των μεταπτώσεων που αντιστοιχούν σε πυριμιδίνες. Σχήμα Jukes-Cantor Σχήμα Kimura

22 Μοντέλα νουκλ. υποκατάστασης

23 Η παρατηρούμενη αναλογία των μεταπτώσεων ως προς τις μεταστροφές μπορεί να μην είναι σταθερή από τάξη σε τάξη, συνήθως όμως παρατηρείται μεγαλύτερη αναλογία μεταπτώσεων στις περιπτώσεις πρόσφατα διαχωρισμένων ειδών, σε σχέση με αυτές που απαντώνται μεταξύ απομακρυσμένων ειδών. Αυτό παρατηρείται επειδή, λόγω των πολλαπλών υποκαταστάσεων έχουμε συσσώρευση μεταστροφών με ταυτόχρονη μείωση των μεταπτώσεων.

24 Με άλλα λόγια παρόλο που οι μεταπτώσεις θεωρητικά λαμβάνουν χώρα με μεγαλύτερη συχνότητα σε σχέση με τις μεταστροφές κατά τη διάρκεια της εξέλιξης, επικράτηση των μεταπτώσεων παρατηρείται μόνο στην περίπτωση πρόσφατα διαχωρισμένων ειδών ή στην περίπτωση γενετικών θέσεων με μικρό ρυθμό εξέλιξης.

25 Πολλαπλές αντικαταστάσεις Άλλα προβλήματα ως προς την επίτευξη των φυλογενετικών σχέσεων βασιζόμενη σε μοριακά δεδομένα προκύπτουν από το γεγονός ότι υπάρχουν μόνο τέσσερις καταστάσεις νουκλεοτιδικών χαρακτήρων A,C,G και Τ. Η υποκατάσταση μιας βάσης σε μία θέση μπορεί να υποκρύπτει μια προηγούμενη υποκατάσταση στην ίδια θέση (πολλαπλές υποκαταστάσεις).

26 Τα αμινοξέα υπό τη μορφή νουκλεοτιδικών τριπλετών μπορούν να παρουσιάσουν φαινόμενα πολλαπλών υποκαταστάσεων λόγω του εκφυλισμού του γενετικού κώδικα. Έτσι οι διάφορες καταστάσεις των μοριακών χαρακτήρων οι οποίες συναντώνται στα διάφορα taxa ίσως να αποτελούν ουσιαστικά το αποτέλεσμα τυχαίων γεγονότων και όχι να προέρχονται ως ομοιότητες ή διαφορές λόγω της κοινής ή μη προγονικής προέλευσης.

27 Ωστόσο με τους μοριακούς χαρακτήρες έχουμε το πλεονέκτημα της γνώσης των μοριακών διαδικασιών ως προς την κατασκευή και τη λειτουργία τους, πληροφορίες οι οποίες μπορούν να βοηθήσουν να καθορίσουμε στατιστικά ποιά σημεία είναι περισσότερο πιθανό να υπόκεινται σε τέτοιες πολλαπλές υποκαταστάσεις.

28 Συνώνυμες και μη συνώνυμες υποκαταστάσεις Συνώνυμη νουκλ. υποκατάσταση είναι αυτή όπου δεν προκύπτει αλλαγή στην αμινοξική ακολουθία. Συνώνυμες υποκ. κ μεταλλαγές σε μη γονιδιακό DNA = Σιωπηλές μεταλλαγές

29 Μη συνώνυμη υποκατάσταση Συντηρητική (αμινοξύ με παρόμοιες φυσικοχημικές ιδιότητες) Ημι-συντηρητική (+ /- αμινοξύ) Πλήρης (εντελώς διαφορετικό αμινοξύ)

30 Ρυθμοί μεταλλαγής και πρότυπα αμινοξικών υποκαταστάσεων Το ποσοστό μη συνωνύμων υποκαταστάσεων είναι περίπου το 71% του συνολικού αριθμού αμινοξικών υποκαταστάσεων. Συνώνυμες μεταλλαγές συμβαίνουν στο 72% των υποκαταστάσεων του πρώτου νουκλεοτιδίου και 5% του τρίτου νουκλεοτιδίου.

31 Η μεγάλη ποικιλία στους ρυθμούς των μη συνωνύμων υποκαταστάσεων μεταξύ γονιδίων μπορεί να αποδοθεί στον ρυθμό μετάλλαξης στην ένταση της επιλογής Ρυθμοί υποκατάστασης σε mtdna και cpdna




35 Είναι οι συνώνυμες αντικαταστάσεις εξελικτικά ουδέτερες; Μερικά κωδικόνια μεταφράζονται πιο αποτελεσματικά (πιο γρήγορα/ ακριβέστερα) από άλλα (Drosophila, adh gene, μείωση παραγωγής ενζύμου) Επίδραση στη δευτεροταγή δομή των πρωτεινών (Saccharomyces, χαμηλότερη ανθεκτικότητα εθανόλης) Καταστροφή σημάτων για RNA splicing


37 Προγονικός πολυμορφισμός Προβλήματα στην ανακατασκευή της ιστορίας των ειδών βάση των μοριακών δεδομένων αρχίζουν να προκύπτουν όταν τα διάφορα άτομα τα οποία διαχωρίζονται προς την κατεύθυνση νέου είδους προέρχονται από πολυμορφικές καταστάσεις του κοινού προγόνου. Λόγω αυτής της διαδικασίας οι αλλαγές υποκαταστάσεων οι οποίες προκύπτουν μέσα από τη μοριακή ανάλυση είναι ουσιαστικά παλαιότερες από το χρόνο ειδογένεσης και έχουν ενσωματωθεί ή έχουν χαθεί τυχαία μεταξύ των ειδών. Σε τέτοιες περιπτώσεις οι φυλογενετικές σχέσεις των γόνων είναι απίθανο να αντανακλούν την πραγματική φυλογένεια των ειδών.

38 Η σοβαρότητα του προβλήματος αυξάνει καθώς ο χρόνος των γεγονότων ειδογένεσης είναι μικρός, όπως για παράδειγμα σε περιπτώσεις ακτινωτής εξέλιξης. Σε τέτοιες περιπτώσεις το πρόβλημα της τυχαίας εδραίωσης του προγονικού πολυμορφισμού μπορεί να αυξηθεί με την έλλειψη πληροφοριών ως προς τις αλλαγές βάσεων που προκύπτουν στις μικρές εσωτερικές διακλαδώσεις του δέντρου, το οποίο περιγράφει την εξελικτική ιστορία. Το πρόβλημα αυτό υπάρχει ανεξάρτητα από το κατά πόσο η ακτινωτή εξέλιξη έχει λάβει χώρα σχετικά πρόσφατα ή στο μακρύτερο παρελθόν και έτσι το πρόβλημα μπορεί να προκύψει και σε ανώτερα ταξινομικά επίπεδα. Δεδομένου ότι τα φαινόμενα ραγδαίας ειδογένεσης φαίνεται να αποτελούν συχνό φαινόμενο στην ιστορία των οργανισμών το πρόβλημα αυτό δε θα πρέπει να θεωρείται αμελητέο.

39 Θεωρία της ουδετερότητας Η θεωρία της ουδετερότητας αναγνωρίζει πως σε κάθε γόνο, το μεγαλύτερο ποσοστό των πιθανών μεταλλαγών που μπορούν να συμβούν είναι επιβλαβείς και για αυτόν το λόγο αυτές εξαλείφονται ή διατηρούνται σε πολύ μικρές συχνότητες λόγω της επίδρασης της φυσικής επιλογής. Η εξέλιξη των μορφολογικών, των οικολογικών καθώς και των ηθολογικών χαρακτήρων ελέγχονται σε μεγάλο βαθμό από τη δράση της φυσικής επιλογής, δεδομένου ότι αυτή είναι κάθε φορά η κύρια δύναμη απομάκρυνσης των επιβλαβών μεταλλαγών και της διατήρησης των επιθυμητών χαρακτήρων. Ωστόσο υπάρχει ένας αριθμός μεταλλαγών οι οποίες δε μεταβάλλουν την προσαρμοστικότητα των οργανισμών και για αυτόν το λόγο δεν υπόκεινται στη δράση της φυσικής επιλογής. Με αυτόν τον τρόπο η θεωρία της ουδετερότητας υποστηρίζει ότι η πλειοψηφία των νουκλεοτιδικών αλλαγών στην εξελικτική πορεία είναι απλά το αποτέλεσμα της τυχαίας και βαθμιαίας ενσωμάτωσης ουδέτερων ή σχεδόν ουδέτερων αλλαγών και όχι το αποτέλεσμα της απόλυτης κυριαρχίας της φυσικής επιλογής (Νεο-Δαρβινική θεωρία). Οι ουδέτερες μεταλλαγές μπορούν να διαδοθούν σε έναν πληθυσμό δεδομένου ότι μόνο ένα σχετικά μικρό ποσοστό γαμετών από την αρχική γενετική δεξαμενή συμμετέχει στην επόμενη γενεά (δράση της τυχαίας γενετικής παρέκκλισης). Έτσι λόγω τύχης οι αλλαγές αυτές μπορούν να μεταδοθούν στην επόμενη γενεά με μεγαλύτερη συχνότητα.

40 Σύμφωνα με τη θεωρία της ουδετερότητας, η συχνότητα των αλληλομόρφων καθορίζεται αποκλειστικά από τυχαίους παράγοντες ενώ οι πολυμορφικές θέσεις βρίσκονται απλά σε ένα στάδιο δυναμικής διαδικασίας κατά την οποία οι αλληλικές μορφές βρίσκονται προς την κατεύθυνση της ενσωμάτωσης ή της εξαφάνισης. Αντίθετα η Νεο-Δαρβινική θεωρία υποστηρίζει ότι οι περισσότεροι γενετικοί πολυμορφισμοί στη φύση είναι σταθεροί. Συνοπτικά και οι δύο θεωρίες δέχονται ότι οι περισσότερες μεταλλαγές είναι επιβλαβείς και απομακρύνονται από τη δράση της φυσικής επιλογής, διαφέρουν όμως ως προς το ποσοστό των ουδέτερων μεταλλαγών στο σύνολο των μη επιβλαβών. Οι οπαδοί της Νεο-Δαρβινικής θεωρίας (Selectionists) υποστηρίζουν ότι μόνο ένα πολύ μικρό ποσοστό μεταλλαγών είναι επιλεκτικά ουδέτερο, ενώ οι οπαδοί της θεωρίας της ουδετερότητας υποστηρίζουν ότι οι περισσότερες μη επιβλαβείς μεταλλαγές είναι επιλεκτικά ουδέτερες.

41 Επιλογή διαφόρων κατηγοριών Neutral theory does not contradict natural selection, nor does it deny that selection occurs. Hughes writes: "Evolutionary biologists typically distinguish two main types of natural selection: purifying selection, which acts to eliminate deleterious mutations; and positive (Darwinian) selection, which favors advantageous mutations. Positive selection can, in turn, be further subdivided into directional selection, which tends toward fixation of an advantageous allele, and balancing selection, which maintains a polymorphism. The neutral theory of molecular evolution predicts that purifying selection is ubiquitous, but that both forms of positive selection are rare, whereas not denying the importance of positive selection in the origin of adaptations.«in another essay, Hughes writes: "Purifying selection is the norm in the evolution of protein coding genes. Positive selection is a relative rarity but of great interest, precisely because it represents a departure from the norm."

42 Συνεχιζόμενη διαμάχη Graur & Li (2000), go as far as to say: "There are only two predictions we are willing to make about the future of molecular evolution. The first concerns old controversies. Issues such as the neutralist-selectionist controversy or the antiquity of introns, will continue to be debated with varying degrees of ferocity, and roars of "The Neutral Theory Is Dead" and "Long Live the Neutral Theory" will continue to reverberate, sometimes in the title of a single article."

43 Ορισμός Ισοενζύμων-Αλλοενζύμων Ισοένζυμα (Πολλαπλές μορφές ενός γονιδίου) Αλλοένζυμα (αλληλόμορφα γονιδίων που κωδικοποιούν πρωτεΐνες)


45 Συγκλίνουσα και αποκλίνουσα εξέλιξη Παράτροπα γονίδια (Paralogous genes - ανεξάρτητα γονίδια που εξελίχθηκαν στον ίδιο οργανισμό από κοινό πρόγονο). Ορθότροπα γονίδια (Orthologous genes - διαφοροποίηση μετα την διάσπαση του φορέα τους σε διαφορετικά είδη).


47 Ομόλογες ακολουθίες (προέρχονται από κοινό πρόγονο). Ανάλογες ακολουθίες (συγκλίνουσα εξέλιξη).

48 Μέθοδοι εντοπισμού Χαρτες και πρότυπα περιορισμού

49 Υβριδοποίηση του DNA Θερμοσταθερότητα του DNA (αποδιάταξη βάσεων)

50 Μοριακοί δείκτες RFLPs AFLPs cdna-aflps RAPDs SNPs Αλληλούχιση DNA ( τεχνολογίες 1 ης και 2 ης γενιάς)

51 Το μοριακό ρολόι Μέχρι το 1960 η μόνη πηγή πληροφοριών για τη μελέτη της ιστορίας των ειδών αποτελούσε η μελέτη των απολιθωματικών καταγραφών. Οι μελέτες που προέκυψαν κατά τη διάρκεια της δεκαετίας του 60 με βάση τη μοριακή γενετική οδήγησαν σ ένα εξελικτικό μοντέλο το οποίο ονομάζουμε ως σήμερα μοριακό ρολόι.

52 Η έννοια του μοριακού ρολογιού σχετίζεται με την εκτίμηση της εξελικτικής ιστορίας καθώς και του χρόνου διαχωρισμού των οργανισμών. Το μοριακό ρολόι είναι ιδιαιτέρως χρήσιμο στην περίπτωση των ζωντανών οργανισμών τα οποία παρουσιάζουν φτωχό απολιθωματικό αρχείο.

53 Το μοριακό ρολόι βασίζεται στην υπόθεση ότι οι βασικές βιολογικές διαδικασίες όπως η αντιγραφή του DNA, η μεταγραφή, η πρωτεϊνοσύνθεση καθώς και ο μεταβολισμός είναι αξιοσημείωτα παρόμοιες σε όλους τους ζωντανούς οργανισμούς καθώς επίσης ότι οι πρωτεΐνες και τα μόρια RNA τα οποία είναι υπεύθυνα για αυτές τις λειτουργίες, παρουσιάζουν ένα μεγάλο βαθμό συντηρητικότητας. Βέβαια κατά τη διάρκεια του εξελικτικού χρόνου νουκλεοτιδικές αλλαγές λαμβάνουν χώρα σε όλους αυτούς τους γόνους. Οι αλλαγές αυτές τείνουν κυρίως προς την κατεύθυνση διατήρησης της λειτουργίας των αντίστοιχων γόνων παρά στη μετατροπή ή στη βελτίωσή τους. Κάτω από το πρίσμα αυτό οι αλλαγές οι οποίες συντελούνται έχουν μικρή ή καμία επίδραση στην αντίστοιχη λειτουργία των γόνων. Για παράδειγμα αλλαγές στην αλληλουχία του DNA μπορούν να λαμβάνουν χώρα αλλά, λόγω του εκφυλισμού του γενετικού κώδικα η κωδικοποιημένη πρωτεϊνη να παραμένει αμετάβλητη. Επίσης, αλλαγές στην αλληλουχία του DNA είναι δυνατόν να αλλάζουν την αμινοξική αλληλουχία της αντίστοιχης πρωτεϊνης, αλλά η αλλαγή να εντοπίζεται σε περιοχές του μορίου οι οποίες δε μεταβάλλουν τη λειτουργικοτητά της (συντηρημένη

54 Όσον αφορά σχετικά μεγάλα χρονικά διαστήματα, η μοριακή εξέλιξη είναι δυνατόν να χαρακτηρίζεται από ένα φαινομενικά σταθερό ρυθμό ακόμα και αν η φυσική επιλογή προκαλεί σημαντικές διακυμάνσεις του ρυθμού που χαρακτηρίζει μικρότερα χρονικά διαστήματα. Η θεωρία της γενετικής παρέκκλισης προβλέπει πως αυστηρά ουδέτερες μεταλλαγές αντικαθίστανται με ένα ρυθμό ίσο με το ρυθμό μεταλλαγής ανά γενιά (Kimura 1983). Γενικά η υπόθεση του μοριακού ρολογιού θεωρεί ότι οι νουκλεοτιδικές υποκαταστάσεις, όσον αφορά τις αλληλουχίες των γόνων οι οποίοι καλύπτουν κοινές λειτουργίες στο σύνολο των οργανισμών, λαμβάνουν χώρα με ένα σταθερό ρυθμό, έτσι ώστε με βάση το σύνολο των διαφορών να είμαστε σε θέση να προσδιορίσουμε και τον αντίστοιχο εξελικτικό χρόνο. Παρόλο που η υπόθεση του σταθερού ρυθμού υποκαταστάσεων έχει αποτελέσει αντικείμενο διαφωνίας στον επιστημονικό χώρο, η χρήση της στην εκτίμηση του χρόνου διαχωρισμού κατά τη μελέτη των φυλογενετικών δέντρων είναι ευρέως διαδεδομένη(nei 1975, Wilson 1977).


56 Ο ρυθμός αμινοξικής υποκατάστασης είναι ο ίδιος για συγκεκριμένες πρωτεΐνες στα θηλαστικά. Είναι εμπειρικό Είναι στοχαστικό Υπάρχουν πολλές εξαιρέσεις Ανακριβής υπολογισμός του απόλυτου ρυθμού αμ. υποκατάστασης. Έλεγχος του σχετικού ρυθμού Ο ρυθμός αμινοξικής υποκατάστασης ποικίλει μεταξύ των οργανισμών (και των λειτουργιών) αλλά για μεγάλους εξελικτικούς χρόνους μπορεί να θεωρηθεί σταθερός.

57 Νουκλεοτιδική σύνθεση Πολλά γονιώματα συμπεριλαμβανομένων των προκαρυωτικών, του πυρηνικού DNA των σπονδυλωτών και του μιτοχονδριακού DNA των εντόμων παρουσιάζουν μια απόκλιση ως προς την ισόποση συμμετοχή των 4 βάσεων στη σύνθεση του γενετικού υλικού. Αυτή η απόκλιση είναι συνήθως ανομοιογενώς κατανεμημένη μεταξύ και εντός των γόνων και τείνει να συσσωρεύεται στις πιο μεταβλητές περιοχές. Για παράδειγμα το μιτοχονδριακό γονίωμα των εντόμων γενικά παρατηρείται να παρουσιάζει ένα μεγάλο ποσοστό Α+Τ βάσεων. Ο προσδιορισμός της νουκλεοτιδικής αλληλουχίας ολόκληρου του μιτοχονδριακού DNA στo έντομο της D.yakuba έδειξε ότι το ποσοστό βάσεων Α+Τ είναι 78,6% ενώ στη μέλλισσα (A.melifera) το αντίστοιχο ποσοστό είναι της τάξης του 84,9%. Για άλλα έντομα, ο προσδιορισμός της νουκλεοτιδικής αλληλουχίας μεμονομένων γενετικών τόπων στο mtdna παρουσιάζει μια αντίστοιχη εικόνα αυξημένου ποσοστού βάσεων Α+Τ. Αυτές οι πρώτες ενδείξεις τείνουν στο συμπέρασμα ότι υπάρχει μια τάση αύξησης του ποσοστού Α+Τ βάσεων στο μιτοχονδριακό γονίωμα των εντόμων στις νεότερες τάξεις. Επειδή οι δεσμοί μεταξύ Α-Τ είναι ασθενέστεροι των δεσμών G-C, το ανώτατο όριο σύστασης Α+Τ θα πρέπει καθορίζεται από λειτουργικούς και δομικούς περιορισμούς. Ανεξάρτητα αν το αποτέλεσμα του αυξημένου ποσοστού Α+Τ στην περίπτωση του mtdna των εντόμων είναι τυχαίο ή οφείλεται σε επιλογή, τα γονιώματα αυτά είναι προσαρμοσμένα σε αυτή την κατάσταση, ενώ η επιλογή λειτουργεί προς την κατεύθυνση της διατήρησής της.

58 Ισοκατανομή της πιθανότητας αλλαγής σε κάθε θέση Η πιθανότητα υποκατάστασης ενός συγκεκριμένου νουκλεοτιδίου στην αλυσίδα του DNA εξαρτάται από τη δομική και τη λειτουργική μεταβολή που προκύπτει από την αλλαγή αυτή στο συγκεκριμένο γόνο. Τα σχέδια των υποκαταστάσεων σε ριβοσωμικούς, πρωτεϊνικούς και trna γόνους ακολουθούν αυτόν τον περιορισμό με αποτέλεσμα οι εξελικτικοί ρυθμοί να ποικίλλουν σημαντικά, τόσο εντός όσο και μεταξύ των γόνων σε νουκλεοτιδικό ή πρωτεϊνικό επίπεδο. Μεγάλες τιμές γενετικών αποστάσεων μπορεί να οφείλονται σε κακή εκτίμηση λόγω της παραδοχής ότι όλες οι θέσεις στην αλληλουχία του DNA έχουν τη δυνατότητα να εξελιχθούν με τον ίδιο ρυθμό (Golding 1983).


60 ΜΙΤΟΧΟΝΔΡΙΑKO DNA Το μιτοχονδριακό DNA των πολυκύτταρων οργανισμών παρουσιάζει μοναδικά χαρακτηριστικά τα οποία το καθιστούν χρήσιμο εργαλείο για τη μελέτη της μοριακής εξέλιξης των οργανισμών. Το μιτοχονδριακό γονιδίωμα είναι μικρό και απλό σε σχέση με το μεγάλο μέγεθος και τη πολύπλοκη οργάνωση που παρουσιάζει το πυρηνικό γονιδίωμα. Μεταξύ των πολυκύτταρων οργανισμών το διπλοειδές πυρηνικό γονιδίωμα ποικίλλει σημαντικά σε μέγεθος έχοντας ένα εύρος από 4x108 μέχρι 4x1011 ζεύγη βάσεων τα οποία είναι οργανωμένα σε 4 έως 250 ευδιάκριτα χρωματοσώματα. Το μιτοχονδρικό γονιδίωμα σε σύγκριση με το πυρηνικό είναι περίπου φορές μικρότερο ενώ το μέγεθός του παρουσιάζει σχετικά πολύ μικρές διαφοροποιήσεις μεταξύ των οργανισμών. Το mtdna αποτελείται από ένα απλό διπλό κυκλικό μόριο DNA, που σε αντίθεση με το πυρηνικό περιέχει κωδικές αλληλουχίες οι οποίες απαντούν μόνο μία φορά στο γονιδίωμα του. Χαρακτηριστική επίσης είναι η έλλειψη νουκλεοτιδικών αλληλουχίων μεταξύ των γόνων καθώς και η απουσία ιντρονίων και ψευδογόνων.

61 Όλες οι γενετικές μεταβολές που είναι αποτέλεσμα της σεξουαλικής κληρονομικότητας δε λαμβάνουν χώρα στην περίπτωση του μιτοχονδριακoύ γονιδιώματος δεδομένου ότι αυτό κληρονομείται κυτοπλασματικά κυρίως μόνο από το θηλυκό άτομο. Αρκετές εξαιρέσεις ως προς την αυστηρή μητρική κληρονομικότητα του mtdna έχουν αναφερθεί, όπως για παράδειγμα στην περίπτωση του θαλάσσιου μυδιού Mytilus όπου η πατρική συμμετοχή φαίνεται να είναι πολύ συχνή. Ακόμα όμως και σε αυτή την περίπτωση τα μακρομόρια της πατρικής και της μητρικής προέλευσης δεν είναι γνωστό να υφίστανται γενετικό ανασυνδυασμό στους απογόνους. Ετσι οι γονότυποι του mtdna αντιπροσωπεύουν μη ανασυνδυασμένους χαρακτήρες οι οποίοι μεταφέρονται κατά πλειοψηφία μητρικά στις επόμενες γενιές και για λόγους απλότητας οι γονότυποι αυτοί αναφέρονται ως κλώνοι ή απλότυποι και τα συμπεράσματα των φυλογενετικών τους σχέσεων εξηγούνται με βάση την μητριαρχική φυλογένεια.

62 Ο ρυθμός εξέλιξης του mtdna Ο ρυθμός εξέλιξης του mtdna στην περίπτωση των θηλαστικών υπολογίζεται ότι είναι μεγαλύτερος από το ρυθμό εξέλιξης του πυρηνικού DNA κυρίως λόγω της έλλειψης επιδιορθωτικού μηχανισμού μεταλλάξεων οι οποίες λαμβάνουν χώρα κατά τη διάρκεια της αντιγραφής. Ο ρυθμός εξέλιξης του ανθρώπινου mtdna είναι πέντε με δέκα φορές μεγαλύτερος από τον αντίστοιχο ρυθμό εξέλιξης του πυρηνικού DNA. Παρόμοια αποτελέσματα προέκυψαν από την μελέτη του νηματώδους C.elegans στην περίπτωση του πυρηνικού γόνου της καλμοντουλίνης και του μιτοχονδριακού γόνου COII. Στις περίπτωσεις όμως της δροσόφιλας και του θαλάσσιου αχινού βρέθηκε ότι ο μέσος ρυθμός εξέλιξης του mtdna είναι παρόμοιος με τον αντίστοιχο του πυρηνικού DNA. Οι Sharp & Li μελετώντας υπάρχουσες αλληλουχίες DNA βρήκαν ότι ο ρυθμός εξέλιξης του πυρηνικού DNA στην περίπτωση της δροσόφιλας ήταν μεγαλύτερος από τον αντίστοιχο ρυθμό εξέλιξης των θηλαστικών και ότι ο ρυθμός αντικαταστάσεων σε συνώνυμες θέσεις στην περίπτωση γόνων του πυρηνικού DNA της δροσόφιλας ήταν τρεις φορές μεγαλύτερος από τον αντίστοιχο ρυθμό σε γόνους του πυρήνα των θηλαστικών.

63 Η γενετική δομή του μιτοχονδριακού DNA Το μιτοχονδριακό DNA περιλαμβάνει τους γόνους 12S και 16S, οι οποίοι κωδικοποιούν τη μικρή και τη μεγάλη υπομονάδα του ριβοσώματος που λαμβάνει μέρος στο μεταφραστικό σύστημα του μιτοχονδρίου, καθώς επίσης και από 22 trna και 13 αγγελιοφόρα RNA τα οποία μεταφράζονται σε πρωτεϊνες οι οποίες συμμετέχουν στο σύστημα της αναπνοής. Ο γενετικός κώδικας στην περίπτωση του μιτοχονδριακού DNA δεν είναι ο ίδιος με τον γενετικό κώδικα του πυρηνικού DNA, ενώ διαφορές προκύπτουν και μεταξύ των διαφόρων οργανισμών. Aπό το σύνολο του μιτοχονδριακού γονιδιώματος στην περίπτωση του εντόμου D.yakuba το 90 % δίνει προιόντα μεταγραφής. Από την έρευνα της νουκλεοτιδικής ανάλυσης του μιτοχονδριακού γονιώματος προκύπτει επίσης ότι οι περιοχές μεταξύ των γόνων είτε είναι κενές είτε αυτές αποτελούνται από ένα έως μερικά νουκλεοτίδια. Το υπόλοιπο ποσοστό το οποίο δε μεταγράφεται αποτελεί μια διακριτή ρυθμιστική περιοχή πλούσια σε αδενίνη και θυμίνη, η οποία είναι υπεύθυνη για την αντιγραφή του γονιδιώματος.

64 Μέγεθος mtdna Το μέγεθος του γονιώματος του mtdna των πολυκύτταρων οργανισμών έχει συνήθως ένα εύρος μεταξύ ζεύγη βάσεων. Το μέγεθος των βάσεων θεωρείται ότι αποτελεί το μικρότερο δυνατό ως προς τη λειτουργικότητα του mtdna ενώ έχει αναφερθεί η περίπτωση τριών σκαθαριών (Pissodes strobi, P.nemorensis, και P.terminalis) τα οποία βρέθηκε να έχουν μέγεθος mtdna σχεδόν διπλάσιου του κανονικού. Aπό τα έως τώρα ερευνητικά δεδομένα δεν προκύπτει η ύπαρξη συσχέτισης μεταξύ μεγέθους του mtdna γονιδιώματος και της αντίστοιχης ταξινόμησης των ομάδων. Αυτό ισχύει κυρίως στο γένος Drosophila, όπου το μέγεθος του mtdna ποικίλλει σημαντικά μεταξύ των διαφόρων ειδών. Παρόλο που μικρές διαφορές στο μέγεθος του μιτοχονδριακού γονιδιώματος (σε επίπεδο μερικών ζευγών βάσεων) μπορεί να παρατηρούνται τόσο μεταξύ ατόμων διαφορετικών ειδών όσο και μεταξύ ατόμων του ίδιου είδους αλλά διαφορετικών πληθυσμών, το μέγεθος του μιτοχονδριακού γονιδιώματος είναι σχετικά σταθερό σε επίπεδο ειδών και σε μερικές περιπτώσεις παραμένει σταθερό και μεταξύ ανώτερων ταξινομικών βαθμίδων.

65 Σε ορισμένες περιπτώσεις αλλαγές ως προς το μέγεθος του mtdna μπορεί να λαμβάνουν χώρα τόσο μεταξύ στενά συγγενικών ειδών, όσο και μεταξύ ατόμων τα οποία προέρχονται από διαφορετικούς πληθυσμούς. Στενά συγγενικά είδη σαύρας του γένους Cnemidophorus παρουσιάζουν ένα εύρος μεταξύ ζευγών βάσεων. Επίσης άτομα από έναν πληθυσμό του Cnemidophorus sexclineatus παρουσιάζουν μέγεθος mtdna το οποίο είναι μεγαλύτερο κατά 1200 βάσεις περίπου σε σχέση με το αντίστοιχο μέγεθος του γονιδιώματος το οποίο κατέχουν άτομα άλλων έξι διαφορετικών πληθυσμών. Στην περίπτωση της δροσόφιλας το μέγεθος του γονιδιώματος του mtdna, από τα εώς τώρα στοιχεία, παρουσιάζει μια μικρή διακύμανση ( ± 500 βάσεις) με μόνη εξαίρεση στην περίπτωση των ειδών της υποομάδος melanogaster. Συγκεκριμένα σε μερικά είδη δροσόφιλας (D.melanogaster, D.simulans, D.mauritiana) το mtdna ατόμων από διαφορετικούς πληθυσμούς μπορεί να διαφέρει σε μέγεθος έως και 700 ζεύγη βάσεων.

66 Η παρουσία διαφορετικών μεγεθών mtdna υποδηλώνει σαφέστατα την ταυτόχρονη ύπαρξη μηχανισμών οι οποίοι είναι υπεύθυνοι για τη δημιουργία ενθέσεων ή ελλείψεων στο γονιδίωμα. Μικρές διαφορές στο μέγεθος του γονιδιώματος του mtdna εμφανίζονται ως αποτέλεσμα ενθέσεων ή ελλείψεων μερικών ζευγών βάσεων. Παρόλο που αυτές οι μεταβολές λαμβάνουν χώρα σε όλες τις περιοχές του γονιδιώματος, η συχνότητα εμφάνισής τους ποικίλλει μεταξύ των διαφόρων περιοχών, με τη μικρότερη συχνότητα στις περιοχές εκείνες στις οποίες κωδικοποιούνται πρωτεϊνες. Μεγάλες διαφορές στο μέγεθος του γονιδιώματος του mtdna εμφανίζονται ως αποτέλεσμα ενθέσεων ή ελλείψεων μεγάλων τμημάτων DNA. Αυτά τα γεγονότα φαίνεται να λαμβάνουν χώρα αποκλειστικά στη μή μεταγραφόμενη περιοχή D-loop στην περίπτωση των σπονδυλωτών και στην αντίστοιχη Α+Τ ρυθμιστική περιοχή της δροσόφιλας. Τα αποτελέσματα αυτά εξάγονται από παρατηρήσεις ηλεκρονικού μικροσκοπίου σε μακρομόρια τα οποία προκύπτουν από τον υβριδισμό μιας Η και L αλυσίδας από διαφορετικά συγγενικά είδη (heteroduplex) τα οποία παρουσιάζουν διαφορετικό μέγεθος γονιδιώματος. Αντίστοιχες μελέτες μεταξύ πολλών ειδών δροσόφιλας έδειξαν ότι το ποσοστό υβριδισμού ήταν πολύ μεγάλο για τις περιοχές του mtdna πέραν της ρυθμιστικής περιοχής Α+Τ, ενώ για τη ρυθμιστική περιοχή Α+Τ κανένας υβριδισμός δεν παρατηρήθηκε εκτός από μερικές περιπτώσεις στενά συγγενικών ειδών με ποσοστό 35%. Τα αποτελέσματα αυτά δείχνουν ότι γεγονότα ενθέσεων ή ελλείψεων στη ρυθμιστική περιοχή Α+Τ είναι συχνά και επίσης ότι η νουκλεοτιδική αλληλουχία της ρυθμιστικής αυτής περιοχής αλλάζει με μεγάλο ρυθμό. Αντίστοιχα συμπεράσματα έχουν προκύψει από την άμεση σύγκριση των νουκλεοτιδικών αλληλουχιών της ρυθμιστικής περιοχής Α+Τ μεταξύ διαφόρων ειδών.

67 Διάταξη γόνων στο mtdna mtdna, των οποίων η λειτουργία των προιόντων τους είναι γνωστή (trna, rrna, και πρωτεϊνες) φαίνεται να είναι κοινή όχι μόνο στο mtdna των ζώων αλλά και στο mtdna των κατώτερων ευκαρυωτικών. Η σειρά με την οποία διατάσσονται οι γόνοι του μιτοχονδρίου φαίνεται να είναι σχετικά σταθερή. Μεταξύ των θηλαστικών ο πλήρης προσδιορισμός του mtdna του ανθρώπου, του ποντικού και της αγελάδας τα οποία ανήκουν σε τρεις διαφορετικές τάξεις έδειξε πλήρη ταύτιση ως προς τη σειρά των γόνων υποδεικνύοντας ότι η σταθερότητα αυτή έχει διατηρηθεί για πάνω από 80 εκατομμύρια χρόνια, όσος είναι δηλαδή και ο εκτιμώμενος χρόνος απόκλισης των τριών αυτών γενεαλογικών κλάδων. Η πρώτη ένδειξη ότι η σειρά των γόνων στο μιτοχόνδριο δεν είναι σταθερή για όλους τους οργανισμούς προέκυψε από τη μελέτη του mtdna σε έντομα δροσόφιλας. Προηγούμενες μελέτες είχαν αποκαλύψει την παρουσία της πλούσιας σε Α+Τ περιοχής στο mtdna σε έντομα δροσόφιλας, μιας περιοχής η οποία δεν έχει βρεθεί μέχρι σήμερα σε κανένα άλλο mtdna σπονδυλωτών. Η περιοχή αυτή για τη D.melanogaster όπως και για άλλα είδη δροσόφιλας βρέθηκε ότι αποτελεί την έναρξη της αντιγραφής του mtdna με φορά προς την κατεύθυνση των ριβοσωμικών γόνων. Η φορά της αντιγραφής είναι όμοια με τη φορά της μεταγραφής των ριβοσωματικών υπομονάδων, ενώ στην περίπτωση του mtdna των θηλαστικών η φορά της αντιγραφής είναι αντίθετη με τη φορά της μεταγραφής των αντίστοιχων γόνων. Περαιτέρω έρευνες με τη βοήθεια ηλεκτρονικού μικροσκοπίου έδειξαν ότι ο μηχανισμός έναρξης της αντιγραφής από την πλούσια σε Α+Τ περιοχή δεν ακολουθεί το μηχανισμό σχηματισμού D-loop όπως στην περίπτωση των σπονδυλωτών. Στα εντόμα η θέση των γόνων τα οποία κωδικοποιούν trna διαφέρει τόσο μεταξύ των τάξεων των διπτέρων και των υμενοπτέρων, όσο και εντός της τάξης των διπτέρων. Ο προσδιορισμός και η σύγκριση της πλήρης αλληλουχίας του mtdna των εντόμων της μέλισσας Apis melifera και της D.yakuba έδειξε ότι η θέση 11 trna είναι διαφορετική στα δύο γονιδιώματα.

68 Mιτοχονδριακό DNA των φυτών Ιδιαίτερη κατηγορία αποτελεί η περίπτωση των φυτών, το μιτοχονδριακό DNA των οποίων παρουσιάζει μια σύνθετη αρχιτεκτονική στο γονιδίωμά του. Το μέγεθος του mtdna της κατηγορίας αυτής παρουσιάζει ένα μεγάλο εύρος το οποίο κυμαίνεται από 184 kb (Marchantia polymorpha) έως και 2400kb (Cucumis melo). To φυτικό μιτοχονδριακό γονιδίωμα είναι κατά βάση κυκλικό, ενώ έχουν παρατηρηθεί δύο περιπτώσεις οι οποίες αφορούν τα είδη Marchantia polymorpha και Brassica hitra, των οποίων το mtdna είναι γραμμικό. Οι μεγάλες διαφορές ως προς το μέγεθος του mtdna των φυτών σε σχέση με το αντίστοιχο των ζώων οφείλεται κυρίως σε ένα μεγάλο ποσοστό (70%) στην ύπαρξη μεγάλων αλληλουχιών DNA μεταξύ των γενετικών θέσεων και σε μικρότερο ποσοστό στην ύπαρξη ιντρονίων και διαφορετικών γόνων. Στην περίπτωση των αγγειοσπέρμων το μεγάλο μέγεθος του mtdna οφείλεται σε φαινόμενα ανασυνδυασμού τα οποία έχουν σαν αποτέλεσμα το διπλασιασμό κωδικών και μη κωδικών περιοχών, καθώς και στην ενσωμάτωση αλληλουχιών μη μιτοχονδριακής προέλευσης, όπως αλληλουχιών πλαστιδίων. Η δυνατότητα ανασυνδυασμού στο μιτοχονδριακό γονιδίωμα των φυτών είναι επίσης υπεύθυνη για την αλλαγή της θέσης των γόνων στο γονιδίωμα μεταξύ διαφόρων ειδών.


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα



Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα


Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α. συνεπικρατή

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) Σχόλια Τα θέματα καλύπτουν το μεγαλύτερο μέρος της ύλης που εξεταζόταν. Απαιτούσαν πολύ καλή κατανόηση της θεωρίας και αρκετό χρόνο για την επίλυση των ασκήσεων. Στο ερώτημα Γ1 υπήρχε ασάφεια στο ζητούμενο

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα


ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα