Βιολογία Γενικής Παιδείας Γ Λυκείου 1ο#Κεφάλαιο#Άνθρωπος#και#Υγεία# # Ερωτήσεις# #Απαντήσεις# 1.#α)#Τι#είναι#η#ομοιόσταση;##

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Βιολογία Γενικής Παιδείας Γ Λυκείου 1ο#Κεφάλαιο#Άνθρωπος#και#Υγεία# # Ερωτήσεις# #Απαντήσεις# 1.#α)#Τι#είναι#η#ομοιόσταση;##"

Transcript

1 1 ο ΚεφάλαιοΆνθρωποςκαιΥγεία Ερωτήσεις Απαντήσεις 1.α)Τιείναιηομοιόσταση; Ηικανότητατουοργανισμούναδιατηρείσταθερέςτιςσυνθήκεςτου εσωτερικούπεριβάλλοντος(θερμοκρασία,συγκεντρώσειςδιαφόρων συστατικώνκ.λ.π.),παράτιςεξωτερικέςμεταβολές,ονομάζεταιομοιόσταση. (σελ9σχολικού) β)νααναφέρειςπαραδείγματαομοιοστατικώνμηχανισμώνστον άνθρωπο. Θερμοκρασίατουσώματος(δέρμα). Συγκέντρωσηγλυκόζηςστοαίμα. phαίματος,σταθερόστο7,4. ΕπίπεδαCO2στοαίμα 2.α)Τιμπορείναπροκαλέσειηδιαταραχήτηςομοιόστασης; Κάθεδιαταραχήτηςομοιόστασηςμπορείναπροκαλέσειτηνεκδήλωση διαφόρωνασθενειών.ηαδυναμίααποκατάστασηςτηςομοιόστασηςμπορεί ναοδηγήσεισεανεπανόρθωτηβλάβητουοργανισμού,ακόμακαιστο θάνατο. β)νααναφέρειςπαράγοντεςπουεπηρεάζουντηνομοιόσταση. Ακραίεςμεταβολέςτουπεριβάλλοντος: Θερμοκρασία, Ακτινοβολίες, Διαθεσιμότηταοξυγόνουκ.λ.π. Παράγοντεςπουείναιαπόρροιατουτρόπουζωής: Κάπνισμα, Αλκοόλ,κ.λ.π Παθογόνοιμικροοργανισμοί. 3.Ποιοιοργανισμοίχαρακτηρίζονταιμικροοργανισμοί; Γενικά,ωςμικροοργανισμοίήμικρόβιαχαρακτηρίζονταιεκείνοιοι οργανισμοίτουςοποίουςδενμπορούμεναδιακρίνουμεμεγυμνόμάτι,γιατί έχουνμέγεθοςμικρότεροαπό0,1mm. 4.Ποιοιμικροοργανισμοίχαρακτηρίζονταιπαράσιτα; Παράσιταχαρακτηρίζονταιορισμένοιμικροοργανισμοί,οιοποίοι προκειμένουναεπιβιώσουνκαινααναπαραχθούν,περνούνέναμέροςή ολόκληρητηζωήτουςστοεσωτερικόκάποιουάλλουοργανισμού,που χαρακτηρίζεταιωςξενιστής. 1

2 5.Νααναφέρειςχαρακτηριστικάπρωτόζωα,τουςτρόπους μετάδοσήςτουςκαιτιςασθένειεςπουπροκαλούν. Τοπλασμώδιομεταδίδεταιμετοκουνούπικαιπροκαλείελονοσία. Τοτρυπανόσωμαμεταδίδεταιμετημύγατσε[τσεκαιπροκαλείτην ασθένειατουύπνου. Ηαμοιβάδαμεταδίδεταιμετηντροφήκαιτονερόκαιπροκαλεί αμοιβαδοειδήδυσεντερία. Τοτοξόπλασμαμεταδίδεταιμετακατοικίδιαζώακαιπροσβάλειβασικά όργαναόπωςτουςπνεύμονες,τοήπαρκαιτοσπλήνακαιπροκαλεί αποβολέςστιςεγκύους. Σημείωση:Ηλοίμωξηαπότριχομομονάδαείναισεξουαλικώς μεταδιδόμενονόσημα. 6.Τιείναιταδερματόφυτα; Ταδερματόφυτααποτελούνμιαειδικήκατηγορίαμυκήτωνπου προσβάλουντοδέρμα,ιδιαίτερατοτριχωτότηςκεφαλής,αλλάκαιτις μεσοδακτύλιεςπεριοχέςτωνποδιώνπροκαλώνταςερυθρότητα (κοκκίνισμα)καιέντονοκνησμό(φαγούρα). 7.Τιείναιταενδοσπόρια; Σχηματίζονταιαπόμερικάβακτήριαότανβρεθούνσεαντίξοες συνθήκες(π.χ.ακραίεςθερμοκρασίες,ακτινοβολίεςκ.λ.π.) Είναιαφυδατωμένακύτταρα Έχουνανθεκτικάτοιχώματακαι Χαμηλούςμεταβολικούςρυθμούς «Βλαστάνουν»καιδίνουντοκαθένααπόέναβακτήριοότανοι συνθήκεςγίνουνξανάευνοϊκές. 8.Γιαποιολόγοχαρακτηρίζονταιοιιοίυποχρεωτικάενδοκυτταρικά παράσιτα; Οιιοίχαρακτηρίζονταιωςυποχρεωτικάενδοκυτταρικάπαράσιταγιατί εξασφαλίζουναπότονξενιστήτουςμηχανισμούς: αντιγραφής μεταγραφής μετάφρασης μεσκοπότονπολλαπλασιασμότους. 9.Τιείναιημόλυνσηκαιτιηλοίμωξη; Μόλυνσηείναιηείσοδοςενόςμικροοργανισμούστονοργανισμότου ανθρώπου. 2

3 Λοίμωξηείναιηεγκατάστασηκαιοπολλαπλασιασμόςενός μικροοργανισμούστονοργανισμότουανθρώπου. 10.Μεποιουςτρόπουςμεταδίδονταιοιπαθογόνοιμικροοργανισμοί; Μετηντροφή. Μετονερό. Μετηνεπαφήμεμολυσμέναζώα. Μετασταγονίδιατουβήχαασθενούςατόμου. Μετηνάμεσηεπαφήμεμολυσμένοάτομο Μετηνέμμεσηεπαφήμεαντικείμεναπουέχουνχρησιμοποιηθείαπό μολυσμένοάτομο. 11.Τιείναιτααντιβιοτικά; Χημικέςουσίεςμεαντιμικροβιακήδράσηπου Παράγονταιαπό:βακτήρια,μύκητες,φυτάκαι Δρουνεναντίον:βακτηρίων,μυκήτων,πρωτοζώων 12.ΠωςμεταδίδεταιηηπατίτιδαC;(ήοποιοδήποτεάλλο ΣεξουαλικώςΜεταδιδόμενοΝόσημα]ΣΜΝ;) Μετησεξουαλικήεπαφή. Μέσωτουαίματοςήτωνπαραγώγωντου μεταγγίσειςή χρήσημολυσμένηςσύριγγας Απότημολυσμένημητέραστοέμβρυο. 13.Ποιοιμηχανισμοίπαρεμποδίζουντηνείσοδοτων μικροοργανισμώνστονανθρώπινοοργανισμό; Οιμηχανισμοίπουπαρεμποδίζουντηνείσοδοτωνμικροοργανισμώνείναιτο δέρμα,πουκαλύπτειτηνεξωτερικήεπιφάνειακαιοιβλεννογόνοι,που καλύπτουντιςκοιλότητεςτουοργανισμού.στηνάμυνασυμμετέχουντόσοη δομήτουκάθεσχηματισμούόσοκαιοιουσίεςπουπαράγονται. 14.Μεποιοτρόποσυμμετέχειστηνάμυνατουανθρώπινουσώματος οπυρετός; Οπυρετόςείναιημηφυσιολογικήθερμοκρασίατουσώματοςκατάτη διάρκειαμιαςγενικευμένηςμικροβιακήςμόλυνσης.οπυρετός: Εμποδίζειτηνανάπτυξηκαιτονπολλαπλασιασμότωνβακτηρίων Παρεμποδίζειτηλειτουργίατωνενζύμωντωνκυττάρων,ηοποία, σεπεριπτώσειςιώσεωνέχειωςαποτέλεσματηναναστολήτου πολλαπλασιασμούτωνιών 3

4 Επιπλέονοπυρετόςενισχύειτηδράσητωνφαγοκυττάρων. 15.Τιείναιηανοσία; Ανοσίαείναιηικανότητατουανθρώπινουοργανισμούνααναγνωρίζει οποιαδήποτεξένηπροςαυτόνουσίακαινααντιδράπαράγοντας εξειδικευμένακύτταρακαικυτταρικάπροϊόντα(π.χ.αντισώματα),ώστενα τηνεξουδετερώσει. 16.Τιείναιτααντιγόνα;Ποιοιπαράγοντεςμπορούνναδράσουνως αντιγόνα; Αντιγόνοείναικάθεουσίαξένηπροςτονανθρώπινοοργανισμό,που προκαλείτηναντίδρασητουανοσοβιολογικούσυστήματος,δηλαδήτην ανοσοβιολογικήαπόκριση. Ωςαντιγόναμπορούνναδράσουν: Έναςολόκληροςμικροοργανισμός, Ένατμήμααυτούή Τοξικέςουσίεςπουπαράγονταιαπόαυτόν. Ηγύρη, Διάφορεςφαρμακευτικέςουσίες, Συστατικάτροφών, Κύτταραή Ορόςαπόάλλαάτομαήζώα. 17.Ποιαείναιταχαρακτηριστικάτωνμηχανισμώνειδικήςάμυνας πουτουςκάνουνναδιαφέρουναπότουςμηχανισμούςτηςμηειδικής άμυνας; Ταχαρακτηριστικάτωνμηχανισμώνειδικήςάμυναςπουτουςκάνουννα διαφέρουναπότουςμηχανισμούςτηςμηειδικήςάμυναςείναι: Ηεξειδίκευση,πουσημαίνειότιταπροϊόντατηςανοσοβιολογικής απόκρισηςθαδράσουνμόνοεναντίοντηςουσίαςπουπροκάλεσετην παραγωγήτουςκαι Ημνήμη,πουείναιηικανότητατουοργανισμούνα«θυμάται»τα αντιγόναμεταοποίαέχειέρθεισεεπαφή,έτσιώστεμετάαπόμια πιθανήδεύτερηέκθεσήτουςσεαυτάνααντιδράγρηγορότερα. 4

5 2 ο ΚεφάλαιοΆνθρωποςκαιΠεριβάλλον 18.Τιείναιτοοικοσύστημα; Είναισύστημαμελέτηςπουπεριλαμβάνει: Τουςβιοτικούςπαράγοντες: Όλουςτουςοργανισμούς Τουςαβιοτικούςπαράγοντες: Κλίμα, Έδαφος, Διαθεσιμότηταθρεπτικώνκ.λ.π. Τιςμεταξύτουςαλληλεπιδράσεις. 19.α)Τιείναιοπληθυσμός; Πληθυσμόςείναιοιοργανισμοίενόςοικοσυστήματοςπουανήκουνστοίδιο είδος(π.χ.οισκύλοιτουπειραιά). β)τιείναιηβιοκοινότητα; Βιοκοινότηταείναιτοσύνολοτωνδιαφορετικώνπληθυσμώνπουζουνσε έναοικοσύστημακαιοιμεταξύτουςσχέσεις(π.χ.οισκύλοι,οιγάτες,οι άνθρωποι,οικατσαρίδεςκ.λ.π.τουπειραιά).βιοκοινότηταείναι,πρακτικά, όλοιοιοργανισμοίενόςοικοσυστήματος,δηλαδή,οιβιοτικοίπαράγοντες. γ)τιείναιοβιότοπος; Βιότοποςείναιηπεριοχήστηνοποίαζειέναςπληθυσμόςήμιαβιοκοινότητα. 20.Ποιοιοργανισμοίχαρακτηρίζονταικαταναλωτέςκαιπώς διακρίνονταισετάξεις; Καταναλωτέςείναιόσοιτρέφονταιμεάλλουςφυτικούςήζωικούς οργανισμούς.διακρίνονται,ανάλογαμετοναριθμότων«βημάτων»από τουςπαραγωγούς,σε: Καταναλωτές1ηςτάξης(φυτοφάγαζώα). Καταναλωτές2ηςτάξης(σαρκοφάγαπουτρέφονταιμε φυτοφάγα). Καταναλωτές3ηςτάξης(σαρκοφάγαπουτρέφονταιμε σαρκοφάγα). 21.Γιαποιουςλόγουςείναιδύσκοληηκατάταξητωνκαταναλωτών σετροφικάεπίπεδα; Υπάρχουνοργανισμοίπουείναιταυτόχρονακαισαρκοφάγοικαι φυτοφάγοι. 5

6 Υπάρχουνοργανισμοίπουμεταβάλλουντιςδιατροφικέςσυνήθειες ανάλογαμετηνεποχήτουέτους. Υπάρχουνοργανισμοίπουμεταβάλλουντιςδιατροφικέςσυνήθειες ανάλογαμετοστάδιοτηςζωήςτους. 22.Μεποιουςτρόπουςμπορείναερημοποιηθείέναοικοσύστημα; Ερημοποιημέναοικοσυστήματα(τεχνητά)μπορείναέχουνπροκύψει: Απόκαταστροφήτουςλόγωτηςόξινηςβροχής Απότηναποψίλωση(κυρίωςστατροπικάδάση) Απότιςπυρκαγιές(μεσογειακάοικοσυστήματα) Απότηνυπερβόσκηση(μεσογειακάοικοσυστήματα) 23.Ποιοιπαράγοντεςείναιυπεύθυνοιγιατοφαινόμενοτου θερμοκηπίου; Τοφαινόμενοτουθερμοκηπίουοφείλεταιστηδέσμευσητηςυπέρυθρης αντινοβολίαςαπότοco2καιτουςυδρατμούςτηςατμόσφαιρας. 24.Πουοφείλεταιηκαταστροφήτηςστοιβάδαςτουόζοντοςκαι ποιεςείναιοιεπιπτώσειςαπότηνκαταστροφήτης; Τοόζονκαταστρέφεταιαπόχημικέςενώσειςπουανήκουνστους χλωροφθοράνθρακες. Ηκαταστροφητηςστοιβάδαςτουόζοντοςθαέχειωςαποτέλεσματην αύξησητηςυπεριώδουςακτινοβολίαςπουφτάνειστηγηκαιηοποία: Έχειθανατηφόροδράσηστουςμονοκύτταροςοργανισμούς. ΠροκαλείμεταλλάξειςστοDNA. Προκαλείκαταρράκτη. Καρκίνοτουδέρματος. 25.Άσκηση:Σεέναχερσαίοοικοσύστημαοιδιάφοροιπληθυσμοί σχηματίζουντοπαρακάτωτροφικόπλέγμα: 6

7 α)ναγράψειςτιςτροφικέςαλυσίδες.(υπάρχουν8τροφικέςαλυσίδες) β)ποιοιοργανισμοίανήκουνσεδυοτουλάχιστοντροφικάεπίπεδα; (αρουραίοι2 ο και3 ο,κουνάβια3 ο και4 ο,αλεπούδες3 ο,4 ο και5 ο ) γ)ανστοσυγκεκριμένοοικοσύστημαέγινεαύξησητουαριθμούτων αρουραίων,εξαιτίαςμιαςμετανάστευσηςαπόγειτονικόοικοσύστημα,τιθα συμβείστουςπληθυσμούςτωναλεπούδωνκαιτωνβολβών;(αύξησητων αλεπούδων,μείωσητωνβολβών) δ)ανηβιομάζατωνακρίδωνείναι1.000kgποιαθαείναιηβιομάζατων φιδιών;(100kg[θυμήσουτηναιτιολόγηση:μεταφοράτου10%,απώλειες, πράξεις)ανηβιομάζακάθεφιδιούείναι100gπόσαφίδιαθαυπάρχουνστο οικοσύστημα;( gσυνολικήβιομάζαφιδιών/100gβιομάζαενός φιδιού=1000φίδια) ε)ανηενέργειαστοτροφικόεπίπεδοτωνακρίδωνείναι40kj/kgπόσηείναι ησυνολικήενέργειατουεπιπέδουτωνφιδιών;(40kj/kgx1.000kg=40.000kj ησυνολικήενέργειαστιςακρίδες.μεταφέρεταιτο10%σταφίδιαάρα /10=4.000kJησυνολικήενέργειασταφίδια.)Πόσεςείναιοιαπώλειες ενέργειαςκατάτημεταφοράαπότιςακρίδεςσταφίδια;(απώλειες=90% ενέργειαςακρίδων=90%x40.000kj=36.000kj) 7

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. γ 2. α 3. β 4. δ 5. δ Β. Ερωτήσεις σωστού - λάθους 1. Σωστό 2. Λάθος 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr OΙΚΟΛΟΓΙΑ 1. Όσο το ποσό της ενέργειας: α) μειώνεται προς τα ανώτερα

Διαβάστε περισσότερα

ΑΝΑΝΕΩΣΙΜΕΣΠΗΓΕΣΕΝΕΡΓΕΙΑΣ ΚΡΟΥΣΤΑΛΛΑΚΗ ΜΑΡΙΑ

ΑΝΑΝΕΩΣΙΜΕΣΠΗΓΕΣΕΝΕΡΓΕΙΑΣ ΚΡΟΥΣΤΑΛΛΑΚΗ ΜΑΡΙΑ ΑΝΑΝΕΩΣΙΜΕΣΠΗΓΕΣΕΝΕΡΓΕΙΑΣ ΚΡΟΥΣΤΑΛΛΑΚΗ ΜΑΡΙΑ ΟιΑνανεώσιμεςΠηγέςΕνέργειας (ΑΠΕ) είναι πηγέςτααποθέματατωνοποίωνανανεώνονται φυσικά, καιοιοποίεςσυνεπώςθεωρούνται πρακτικάανεξάντλητες. Στηνκατηγορίααυτή,

Διαβάστε περισσότερα

Βιολογία. Γ λυκειου ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

Βιολογία. Γ λυκειου ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Βιολογία Γ λυκειου ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Σειρά: Γενικό Λύκειο Θετικές Επιστήμες Νότα Λαζαράκη, Βιολογία Γ Λυκείου Γενικής Παιδείας Υπεύθυνος έκδοσης: Αποστόλης Αντωνόπουλος Θεώρηση κειμένου: Κυριάκος Εμμανουηλίδης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ - ΙΟΡΔΑΝΗΣ ΣΑΡΑΝΤΟΣ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Αθήνα 2007 3 4 Π Ρ Ο Λ Ο Γ Ο Σ Η μελέτη των αλληλεπιδράσεων του ανθρώπινου οργανισμού με τον περιβάλλοντα

Διαβάστε περισσότερα

Πέµπτη, 26 Μαΐου 2005 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ

Πέµπτη, 26 Μαΐου 2005 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ Πέµπτη, 26 Μαΐου 2005 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση που συμπληρώνει

Διαβάστε περισσότερα

Η ΕΞΕΛΙΣΣΟΜΕΝΗ ΚΛΙΜΑΤΙΚΗ ΑΛΛΑΓΗ. ηµήτρης Μελάς Αριστοτέλειο Πανε ιστήµιο Θεσσαλονίκης Τµήµα Φυσικής - Εργαστήριο Φυσικής της Ατµόσφαιρας

Η ΕΞΕΛΙΣΣΟΜΕΝΗ ΚΛΙΜΑΤΙΚΗ ΑΛΛΑΓΗ. ηµήτρης Μελάς Αριστοτέλειο Πανε ιστήµιο Θεσσαλονίκης Τµήµα Φυσικής - Εργαστήριο Φυσικής της Ατµόσφαιρας Η ΕΞΕΛΙΣΣΟΜΕΝΗ ΚΛΙΜΑΤΙΚΗ ΑΛΛΑΓΗ ηµήτρης Μελάς Αριστοτέλειο Πανε ιστήµιο Θεσσαλονίκης Τµήµα Φυσικής - Εργαστήριο Φυσικής της Ατµόσφαιρας Το φαινόµενο του θερµοκηπίου είναι ένα φυσικό φαινόµενο µε ευεργετικά

Διαβάστε περισσότερα

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 Στις ερωτήσεις 1-5 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Οι ιοί είναι :

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Τα κύτταρα που παράγουν

Διαβάστε περισσότερα

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Οι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΑΠΟΦΟΙΤΟΙ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΑΠΟΦΟΙΤΟΙ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ 01-02-2015 ΑΠΟΦΟΙΤΟΙ ΘΕΜΑ 1Ο Α. Να επιλέξετε τη σωστή απάντηση: (Μονάδες 10) 1. Το ινώδες είναι ένα πλέγµα πρωτεϊνικής σύστασης που: α. Η δηµιουργία του σταµατά την

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ).

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Αθήνα, 30/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Η

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο ΜΑΪΟΥ ΒΙΟΛΟΓΙΑ. Θέμα Α.. Α.1. δ Α.2. β Α.3. γ Α.4. β Α.5. α. Θέμα Β. ασθενειών. ν. περιβάλλον. βλαπτικές

ΕΞΕΤΑΣΕΙΣ. σύγχρονο ΜΑΪΟΥ ΒΙΟΛΟΓΙΑ. Θέμα Α.. Α.1. δ Α.2. β Α.3. γ Α.4. β Α.5. α. Θέμα Β. ασθενειών. ν. περιβάλλον. βλαπτικές Θέμα Α.. Α.1. δ Α.2. β Α.3. γ Α.4. β Α.5. α Θέμα Β. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 30 ΜΑΪΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

Διαβάστε περισσότερα

4. Ως αυτότροφοι οργανισμοί χαρακτηρίζονται α. οι καταναλωτές Α τάξης. β. οι παραγωγοί. γ. οι αποικοδομητές. δ. οι καταναλωτές Β τάξης.

4. Ως αυτότροφοι οργανισμοί χαρακτηρίζονται α. οι καταναλωτές Α τάξης. β. οι παραγωγοί. γ. οι αποικοδομητές. δ. οι καταναλωτές Β τάξης. ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Γ Λυκείου 2001

Βιολογία Γενικής Παιδείας Γ Λυκείου 2001 Βιολογία Γενικής Παιδείας Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Γ' ΤΑΞΗ ΓΕΝ. ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΤΑΞΗ ΓΕΝ. ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 0 Γ' ΤΑΞΗ ΓΕΝ. ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ ο ΕΚΦΩΝΗΣΕΙΣ Α. Στις ερωτήσεις -5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΖΩΟΛΟΓΙΑ Δ. ΜΑΤΘΟΠΟΥΛΟΣ 1 ΠΑΡΑΓΟΝΤΕΣ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗΝ ΕΞΕΛΙΞΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΔΙΑΔΙΚΑΣΙΑ

Διαβάστε περισσότερα

Φαινόµενο του Θερµοκηπίου

Φαινόµενο του Θερµοκηπίου Φαινόµενο του Θερµοκηπίου Αλεξάνδρου Αλέξανδρος, Κυριάκου Λίντα, Παυλίδης Ονήσιλος, Χαραλάµπους Εύη, Χρίστου ρόσος Φαινόµενο του θερµοκηπίου Ανακαλύφθηκε το 1824 από τον Γάλλο µαθηµατικό Fourier J. (1768)

Διαβάστε περισσότερα

Σάββατο, 24 Μαϊου 2003 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ

Σάββατο, 24 Μαϊου 2003 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ Σάββατο, 24 Μαϊου 2003 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Σενάριο 10: Οργάνωση και λειτουργίες του οικοσυστήματος - Ο ρόλος ενέργειας

Σενάριο 10: Οργάνωση και λειτουργίες του οικοσυστήματος - Ο ρόλος ενέργειας Σενάριο 10: Οργάνωση και λειτουργίες του οικοσυστήματος - Ο ρόλος ενέργειας Φύλλο Εργασίας 1 (Εισαγωγικό) Τίτλος: Οργάνωση και λειτουργίες του οικοσυστήματος Ο ρόλος της ενέργειας Γνωστικό Αντικείμενο:

Διαβάστε περισσότερα

Πρόλογος...11. 1. Οργανισμοί...15

Πρόλογος...11. 1. Οργανισμοί...15 Περιεχόμενα Πρόλογος...11 1. Οργανισμοί...15 1.1 Οργανισμοί και είδη...15 1.1.1 Ιδιότητες των οργανισμών...15 1.1.2 Φαινότυπος, γονότυπος, οικότυπος...17 1.1.3 Η έννοια του είδους και ο αριθμός των ειδών...19

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Χριστίνα Αδαλόγλου Βαγγέλης Μαρκούδης Ευαγγελία Σκρέκα Γιώργος Στρακίδης Σωτήρης Τσολακίδης

Χριστίνα Αδαλόγλου Βαγγέλης Μαρκούδης Ευαγγελία Σκρέκα Γιώργος Στρακίδης Σωτήρης Τσολακίδης Χριστίνα Αδαλόγλου Βαγγέλης Μαρκούδης Ευαγγελία Σκρέκα Γιώργος Στρακίδης Σωτήρης Τσολακίδης Οι ανεπανόρθωτες καταστροφές που έχουν πλήξει τον πλανήτη μας, έχουν δημιουργήσει την καθυστερημένη άλλα αδιαμφισβήτητα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2005

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2005 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1 Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

Πέµπτη, 22 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ

Πέµπτη, 22 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ Πέµπτη, 22 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Συγκρίνατε την πρωτογενή µε τη δευτερογενή ανοσοβιολογική απόκριση και απεικονίστε αυτές στο ίδιο διάγραµµα αξόνων. Πρωτογενή ανοσοβιολογική απόκριση ονοµάζουµε την απόκριση του

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2008 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή στη

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΤΕΧΝΟΛΟΓΙΑ (Ι) ΠΡΑΚΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Μάθημα: Εισαγωγή στη Γεωργία Λαχανοκομία

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

2. Τι ονομάζομε μετεωρολογικά φαινόμενα, μετεωρολογικά στοιχεία, κλιματολογικά στοιχεία αναφέρατε παραδείγματα.

2. Τι ονομάζομε μετεωρολογικά φαινόμενα, μετεωρολογικά στοιχεία, κλιματολογικά στοιχεία αναφέρατε παραδείγματα. ΘΕΜΑΤΑ ΜΕΤΕΩΡΟΛΟΓΙΑΣ-ΚΛΙΜΑΤΟΛΟΓΙΑΣ 1. Διευκρινίστε τις έννοιες «καιρός» και «κλίμα» 2. Τι ονομάζομε μετεωρολογικά φαινόμενα, μετεωρολογικά στοιχεία, κλιματολογικά στοιχεία αναφέρατε παραδείγματα. 3. Ποιοι

Διαβάστε περισσότερα

Μικροοργανισμοί: είναι οι οργανισμοί ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΙ που δεν μπορούμε να Η τους ΜΙΚΡΟΒΙΑ διακρίνουμε με γυμνό μάτι (μέγεθος < 0,1 mm)

Μικροοργανισμοί: είναι οι οργανισμοί ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΙ που δεν μπορούμε να Η τους ΜΙΚΡΟΒΙΑ διακρίνουμε με γυμνό μάτι (μέγεθος < 0,1 mm) Μικροοργανισμοί: είναι οι οργανισμοί ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΙ που δεν μπορούμε να Η τους ΜΙΚΡΟΒΙΑ διακρίνουμε με γυμνό μάτι (μέγεθος < 0,1 mm) Πού και πώς ζουν 1. στο φυσικό περιβάλλον (νιτροποιητικά βακτήρια)

Διαβάστε περισσότερα

Επιλέξτε τη σωστή απάντηση, βάζοντας σε κύκλο το αντίστοιχο γράμμα:

Επιλέξτε τη σωστή απάντηση, βάζοντας σε κύκλο το αντίστοιχο γράμμα: ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Γ ΛΥΚΕΙΟΥ Κυριακή 10 Οκτωβρίου 2010 ΘΕΜΑ 1 ο: Επιλέξτε τη σωστή απάντηση, βάζοντας σε κύκλο το αντίστοιχο γράμμα: 1. Ανήκουν στους ευκαρυωτικούς οργανισμούς Α. το τοξόπλασμα

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΑΠΑΝΤΗΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΣΑΒΒΑΤΟ 26 ΟΚΤΩΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) Θέμα Α Μονάδες 25 Α1.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2010 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΓΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2010 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΓΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΓΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

2. ΚΩΔΙΚΑΣ ΗΘΙΚΗΣ ΔΕΟΝΤΟΛΟΓΙΑΣ ΤΗΣ ΧΡΗΣΙΜΟΠΟΙΗΣΗΣ ΖΩΩΝ ΣΕ ΠΕΙΡΑΜΑΤΙΣΜΟΥΣ 9

2. ΚΩΔΙΚΑΣ ΗΘΙΚΗΣ ΔΕΟΝΤΟΛΟΓΙΑΣ ΤΗΣ ΧΡΗΣΙΜΟΠΟΙΗΣΗΣ ΖΩΩΝ ΣΕ ΠΕΙΡΑΜΑΤΙΣΜΟΥΣ 9 ΠΕΡΙΕΧΟΜΕΝΑ ΕΙΣΑΓΩΓΗ Α. ΓΕΝΙΚΟ ΜΕΡΟΣ 1. Η ΧΡΗΣΗ ΤΩΝ ΖΩΩΝ ΣΤΗ ΒΙΟΪΑΤΡΙΚΗ ΕΡΕΥΝΑ 3 1.1. ΙΣΤΟΡΙΚΗ ΑΝΑΣΚΟΠΗΣΗ 3 1.2. ΣΤΑΤΙΣΤΙΚΑ ΣΤΟΙΧΕΙΑ 4 1.3. ΚΑΤΗΓΟΡΙΕΣ ΖΩΩΝ 4 1.3.1. Τρωκτικά 4 1.3.2. Λαγόμορφα 6 1.3.3.

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΥΠΗΡΕΣΙΑ ΣΠΟΥΔΩΝ ΚΑΙ ΦΟΙΤΗΤΙΚΗΣ ΜΕΡΙΜΝΑΣ ΤΟΜΕΑΣ ΦΟΙΤΗΤΙΚΗΣ ΜΕΡΙΜΝΑΣ ΜΕΤΑΠΤΥΧΙΑΚΕΣ ΣΠΟΥΔΕΣ ΣΥΧΝΕΣ ΕΡΩΤΗΣΕΙΣ ΧΡΗΣΙΜΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΥΠΗΡΕΣΙΑ ΣΠΟΥΔΩΝ ΚΑΙ ΦΟΙΤΗΤΙΚΗΣ ΜΕΡΙΜΝΑΣ ΤΟΜΕΑΣ ΦΟΙΤΗΤΙΚΗΣ ΜΕΡΙΜΝΑΣ ΜΕΤΑΠΤΥΧΙΑΚΕΣ ΣΠΟΥΔΕΣ ΣΥΧΝΕΣ ΕΡΩΤΗΣΕΙΣ ΧΡΗΣΙΜΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΥΠΗΡΕΣΙΑ ΣΠΟΥΔΩΝ ΚΑΙ ΦΟΙΤΗΤΙΚΗΣ ΜΕΡΙΜΝΑΣ ΤΟΜΕΑΣ ΦΟΙΤΗΤΙΚΗΣ ΜΕΡΙΜΝΑΣ Γ Ρ Α Φ Ε Ι Ο Σ Τ Α Δ Ι Ο Δ Ρ Ο Μ Ι Α Σ ΜΕΤΑΠΤΥΧΙΑΚΕΣ ΣΠΟΥΔΕΣ ΣΥΧΝΕΣ ΕΡΩΤΗΣΕΙΣ ΧΡΗΣΙΜΕΣ ΑΠΑΝΤΗΣΕΙΣ ΟΚΤΩΜΒΡΙΟΣ 2008

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΜΕ ΜΕΤΑΛΛΑΓΕΣ Μεταλλαγή ή Μετάλλαξη Οποιαδήποτε αλλαγή του γενετικού υλικού που δεν οφείλεται σε ανασυνδυασµό ή σε διάσχιση των γονιδίων και η οποία

Διαβάστε περισσότερα

1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Οι ομοιοστατικοί

Διαβάστε περισσότερα

Οδηγίες (ενδείξεις και διευκρινήσεις) Σηµασία ή Σκοπός. Γεωµετρικό Σχήµα. e-mail: thessaloniki@enetate.com. e-mail: info@e-meleti.

Οδηγίες (ενδείξεις και διευκρινήσεις) Σηµασία ή Σκοπός. Γεωµετρικό Σχήµα. e-mail: thessaloniki@enetate.com. e-mail: info@e-meleti. Η χρήση Σχηµάτων και Χρωµάτων στην Σήµανση Ασφαλείας Γεωµετρικό Σχήµα Σηµασία ή Σκοπός Οδηγίες (ενδείξεις και διευκρινήσεις) Απαγορευτικό σήµα Αποφύγετε επικίνδυνες πράξεις Προειδοποιητικό σήµα Προσοχή,

Διαβάστε περισσότερα

ΠΑΘΗΤΙΚΑ ΗΛΙΑΚΑ ΣΥΣΤΗΜΑΤΑ

ΠΑΘΗΤΙΚΑ ΗΛΙΑΚΑ ΣΥΣΤΗΜΑΤΑ ΕΦΑΡΜΟΓΕΣ νέες κατασκευές ανακαίνιση και µετασκευή ιστορικών κτιρίων αναδιαµόρφωση καινούριων κτιρίων έργα "εκ του µηδενός" σε ιστορικά πλαίσια 2 Ο ενεργειακός σχεδιασµός του κτιριακού κελύφους θα πρέπει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1 ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση: Α1. Το

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΘΕΜΑ Α. Μονάδες 5. Α2. Από νηματοειδείς δομές (υφές) αποτελούνται α. τα βακτήρια. β. τα πρωτόζωα. γ. οι μύκητες. δ. οι ιοί.

ΘΕΜΑ Α. Μονάδες 5. Α2. Από νηματοειδείς δομές (υφές) αποτελούνται α. τα βακτήρια. β. τα πρωτόζωα. γ. οι μύκητες. δ. οι ιοί. ΘΕΜΑ Α ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΣΑΒΒΑΤΟ 14 MAΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

Εργασία στο μάθημα «Οικολογία για μηχανικούς» Θέμα: «Το φαινόμενο του θερμοκηπίου»

Εργασία στο μάθημα «Οικολογία για μηχανικούς» Θέμα: «Το φαινόμενο του θερμοκηπίου» Εργασία στο μάθημα «Οικολογία για μηχανικούς» Θέμα: «Το φαινόμενο του θερμοκηπίου» Επιβλέπουσα καθηγήτρια: κ.τρισεύγενη Γιαννακοπούλου Ονοματεπώνυμο: Πάσχος Απόστολος Α.Μ.: 7515 Εξάμηνο: 1 ο Το φαινόμενο

Διαβάστε περισσότερα

ΘΕΟΔΩΡΟΣ Σ. ΚΑΡΑΚΩΣΤΑΣ

ΘΕΟΔΩΡΟΣ Σ. ΚΑΡΑΚΩΣΤΑΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ, ΤΜΗΜΑ ΓΕΩΛΟΓΙΑΣ ΤΟΜΕΑΣ ΜΕΤΕΩΡΟΛΟΓΙΑΣ ΚΑΙ ΚΛΙΜΑΤΟΛΟΓΙΑΣ ΘΕΟΔΩΡΟΣ Σ. ΚΑΡΑΚΩΣΤΑΣ ΚΑΘΗΓΗΤΗΣ Α. Π. Θ. ΔΙΑΚΥΒΕΡΝΗΤΙΚΗ ΕΠΙΤΡΟΠΗ ΓΙΑ ΤΗΝ ΚΛΙΜΑΤΙΚΗ

Διαβάστε περισσότερα

ΔΑΣΙΚΑ & ΥΔΑΤΙΝΑ ΟΙΚΟΣΥΣΤΗΜΑΤΑ ΠΡΟΣΤΑΣΙΑ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗ. ΕΡΓΑΣΤΗΡΙΟ 13/06/2013 Δήμος Βισαλτίας

ΔΑΣΙΚΑ & ΥΔΑΤΙΝΑ ΟΙΚΟΣΥΣΤΗΜΑΤΑ ΠΡΟΣΤΑΣΙΑ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗ. ΕΡΓΑΣΤΗΡΙΟ 13/06/2013 Δήμος Βισαλτίας ΔΑΣΙΚΑ & ΥΔΑΤΙΝΑ ΟΙΚΟΣΥΣΤΗΜΑΤΑ ΠΡΟΣΤΑΣΙΑ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗ ΕΡΓΑΣΤΗΡΙΟ 13/06/2013 Δήμος Βισαλτίας Τί είναι ένα Οικοσύστημα; Ένα οικοσύστημα είναι μια αυτο-συντηρούμενη και αυτορυθμιζόμενη κοινότητα ζώντων

Διαβάστε περισσότερα

Σάββατο, 22 Μαΐου 2004 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ

Σάββατο, 22 Μαΐου 2004 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ Σάββατο, 22 Μαΐου 2004 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Α3. Τα φυτοφάγα ζώα χαρακτηρίζονται ως α. καταναλωτές γ τάξης. β. αποικοδομητές φυτών. γ. παραγωγοί. δ. καταναλωτές α τάξης.

Α3. Τα φυτοφάγα ζώα χαρακτηρίζονται ως α. καταναλωτές γ τάξης. β. αποικοδομητές φυτών. γ. παραγωγοί. δ. καταναλωτές α τάξης. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΕΣΠΕΡΙΝΟΥ ΕΠΑΛ (ΟΜΑ ΑΣ Β ) ΤΡΙΤΗ 18 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

Α2. Οι ιστόνες είναι α. DNA β. RNA γ. πρωτεΐνες δ. υδατάνθρακες. Μονάδες 5

Α2. Οι ιστόνες είναι α. DNA β. RNA γ. πρωτεΐνες δ. υδατάνθρακες. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 3 ΜΑΪΟΥ 212 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 26 ΜΑΪΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Η ΖΩΗ ΣΤΑ ΤΡΟΠΙΚΑ ΔΑΣΗ

Η ΖΩΗ ΣΤΑ ΤΡΟΠΙΚΑ ΔΑΣΗ Η ΖΩΗ ΣΤΑ ΤΡΟΠΙΚΑ ΔΑΣΗ Οι περιοχές των τροπικών δασών όπως βλέπεις και στον παραπάνω παγκόσμιο χάρτη, βρίσκονται στη Νότια Αμερική(γύρω από τον ισημερινό), στη Βόρεια Αμερική(ανάμεσα από τον Τροπικό του

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2003 ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1.Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2003 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Η θερμική υπέρυθρη εκπομπή της Γης

Η θερμική υπέρυθρη εκπομπή της Γης Η θερμική υπέρυθρη εκπομπή της Γης Δορυφορικές μετρήσεις στο IR. Θεωρητική θεώρηση της τηλεπισκόπισης της εκπομπήςτηςγήινηςακτινοβολίαςαπό δορυφορικές πλατφόρμες. Μοντέλα διάδοσης της υπέρυθρης ακτινοβολίας

Διαβάστε περισσότερα

ΙΣΤΟΡΙΚΗ ΑΝΑΔΡΟΜΗ. έφθασε στην Ευρώπη από το περιβάλλον του Κολόμβου.

ΙΣΤΟΡΙΚΗ ΑΝΑΔΡΟΜΗ. έφθασε στην Ευρώπη από το περιβάλλον του Κολόμβου. ΚΑΠΝΙΣΜΑ ΙΣΤΟΡΙΚΗ ΑΝΑΔΡΟΜΗ Η είδηση περί καπνού και χρησιμοποιήσεώς του έφθασε στην Ευρώπη από το περιβάλλον του Κολόμβου. Αργότερα η χρήση του καπνού στην Ευρώπη ξεκινάει σαν ένα δώρο προς μια βασίλισσα

Διαβάστε περισσότερα

Η πρώιμη διάγνωση σώζει. Ο ειδικός θεραπεύει

Η πρώιμη διάγνωση σώζει. Ο ειδικός θεραπεύει Κλείσε ένα ραντεβού ζωής Αφιέρωσε 10 λεπτά στον εαυτό σου για μια μαστογραφία Όσα θα θέλατε να μάθετε για τον καρκίνο του μαστού Η πρώιμη διάγνωση σώζει. Ο ειδικός θεραπεύει Τι είναι ο καρκίνος του μαστού;

Διαβάστε περισσότερα

1 o Γυμνάσιο Τρίπολης Σχολ.έτος 2009-10

1 o Γυμνάσιο Τρίπολης Σχολ.έτος 2009-10 1 o Γυμνάσιο Τρίπολης Σχολ.έτος 2009-10 Το πρόγραμμα υλοποιήθηκε από την περιβαλλοντική ομάδα της Β τάξης του πρώτου Γυμνασίου Τρίπολης. Υπεύθυνοι καθηγητές: Τζερεφός Ιωάννης κλάδου ΠΕ 01 Σπηλιάδου Αφροδίτη

Διαβάστε περισσότερα

Παγκόσμια Κλιματική Αλλαγή. Global Change / Climate Change

Παγκόσμια Κλιματική Αλλαγή. Global Change / Climate Change Παγκόσμια Κλιματική Αλλαγή Global Change / Climate Change Ένα θέμα που καίει... Περιβάλλον και Ανάπτυξη, 2004-2005 Περιβάλλον και Ανάπτυξη, 2004-2005 Τι είναι Παγκόσμια Κλιματική Αλλαγή ; Η αργή και σταθερή

Διαβάστε περισσότερα

οµή, οργάνωση και λειτουργία οικοσυστηµάτων

οµή, οργάνωση και λειτουργία οικοσυστηµάτων ΕΥΤΕΡΟ ΚΕΦΑΛΑΙΟ οµή, οργάνωση και λειτουργία οικοσυστηµάτων Α. Ερωτήσεις πολλαπλής επιλογής Επιλέξετε τη σωστή από τις παρακάτω προτάσεις, θέτοντάς την σε κύκλο. 1. Τα φυτά αποκαλούνται ΠΑΡΑΓΩΓΟΙ επειδή

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Κεφάλαιο 2 ο : Άνθρωπος και Περιβάλλον

Βιολογία Γενικής Παιδείας Κεφάλαιο 2 ο : Άνθρωπος και Περιβάλλον Βιολογία Γενικής Παιδείας Κεφάλαιο 2 ο : Άνθρωπος και Περιβάλλον Οικολογία: η επιστήμη που μελετά τις σχέσεις των οργανισμών, και φυσικά του ανθρώπου, με τους βιοτικούς (ζωντανούς οργανισμούς του ίδιου

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΣΤΑ ΚΥΜΑΤΑ

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΣΤΑ ΚΥΜΑΤΑ ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΣΤΑ ΚΥΜΑΤΑ Θέμα 1 ο Στις ερωτήσεις 1-4 να γράψετε στην κόλλα σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή πρόταση, χωρίς δικαιολόγηση. 1. Α) Φορτία που κινούνται

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ÏÅÖÅ. 3. Ποιοι από τους παρακάτω οργανισµούς δεν παράγουν αντιβιοτικά: α. τα πρωτόζωα β. οι µύκητες γ τα φυτά δ. τα βακτήρια Μονάδες 5

ÏÅÖÅ. 3. Ποιοι από τους παρακάτω οργανισµούς δεν παράγουν αντιβιοτικά: α. τα πρωτόζωα β. οι µύκητες γ τα φυτά δ. τα βακτήρια Μονάδες 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΘΕΜΑ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συµπληρώνει

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Σχήμα 8(α) Σχήμα 8(β) Εργασία : Σχήμα 9

Σχήμα 8(α) Σχήμα 8(β) Εργασία : Σχήμα 9 3. Ας περιγράψουμε σχηματικά τις αρχές επί των οποίων βασίζονται οι καινοτόμοι σχεδιασμοί κτηρίων λόγω των απαιτήσεων για εξοικονόμηση ενέργειας και ευαισθησία του χώρου και του περιβάλλοντος ; 1. Τέτοιες

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΟΙΚΟΛΟΓΙΑΣ 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

ΘΕΜΑΤΑ ΟΙΚΟΛΟΓΙΑΣ 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. ΘΕΜΑΤΑ ΟΙΚΟΛΟΓΙΑΣ 1. Ποιος από τους παρακάτω οργανισμούς χαρακτηρίζεται ως αυτότροφος; 1. αλεπού 2. βάτραχος 3. βελανιδιά 4. ψύλλος. 2. Ποιος από τους παρακάτω παράγοντες χαρακτηρίζεται ως αβιοτικός; 1.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Θέρμανση θερμοκηπίων με τη χρήση αβαθούς γεωθερμίας γεωθερμικές αντλίες θερμότητας

Θέρμανση θερμοκηπίων με τη χρήση αβαθούς γεωθερμίας γεωθερμικές αντλίες θερμότητας Θέρμανση θερμοκηπίων με τη χρήση αβαθούς γεωθερμίας γεωθερμικές αντλίες θερμότητας Η θερμοκρασία του εδάφους είναι ψηλότερη από την ατμοσφαιρική κατά τη χειμερινή περίοδο, χαμηλότερη κατά την καλοκαιρινή

Διαβάστε περισσότερα

Βιοποικιλότητα & Αγροτικά Οικοσυστήματα

Βιοποικιλότητα & Αγροτικά Οικοσυστήματα ΑΝΑΠΤΥΞΗ ΚΑΙ ΕΦΑΡΜΟΓΗ ΜΕΘΟΔΟΥ ΠΡΟΣΔΙΟΡΙΣΜΟΥ ΤΟΥ ΠΕΡΙΒΑΛΛΟΝΤΙΚΟΥ ΑΠΟΤΥΠΩΜΑΤΟΣ ΓΙΑ ΑΕΙΦΟΡΑ ΑΓΡΟ- ΟΙΚΟΣΥΣΤΗΜΑΤΑ: Η ΠΕΡΙΠΤΩΣΗ ΤΟΥ ΜΕΣΟΓΕΙΑΚΟΥ ΕΛΑΙΩΝΑ Χρονική Διάρκεια: Οκτώβριος 2010 Ιούνιος 2014 Προϋπολογισμός:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 30 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 22 ΜΑΪΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4). Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΕΞΟΙΚΟΝΟΜΗΣΗ ΕΝΕΡΓΕΙΑΣ ΚΑΙ ΑΠΕ ΣΤΑ ΚΤΗΡΙΑ

ΕΞΟΙΚΟΝΟΜΗΣΗ ΕΝΕΡΓΕΙΑΣ ΚΑΙ ΑΠΕ ΣΤΑ ΚΤΗΡΙΑ ΕΞΟΙΚΟΝΟΜΗΣΗ ΕΝΕΡΓΕΙΑΣ ΚΑΙ ΑΠΕ ΣΤΑ ΚΤΗΡΙΑ ΤΕΧΝΙΚΗ ΗΜΕΡΙΔΑ ΓΙΑ ΕΝΕΡΓΕΙΑΚΟΥΣ ΕΠΙΘΕΩΡΗΤΕΣ Εύη Τζανακάκη Αρχιτέκτων Μηχ. MSc ΚΑΤΑΝΑΛΩΣΗ ΕΝΕΡΓΕΙΑΣ Κ ΠΕΡΙΒΑΛΛΟΝΤΙΚΕΣ ΕΠΙΠΤΩΣΕΙΣ ΚΑΤΑΝΑΛΩΣΗ ΕΝΕΡΓΕΙΑΣ Κ ΠΕΡΙΒΑΛΛΟΝΤΙΚΕΣ

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΒΙΟΚΛΙΜΑΤΙΚΟΣ ΣΧΕΔΙΑΣΜΟΣ ΚΤΗΡΙΩΝ. Εύη Τζανακάκη Αρχιτέκτων Μηχ. MSc

ΒΙΟΚΛΙΜΑΤΙΚΟΣ ΣΧΕΔΙΑΣΜΟΣ ΚΤΗΡΙΩΝ. Εύη Τζανακάκη Αρχιτέκτων Μηχ. MSc ΒΙΟΚΛΙΜΑΤΙΚΟΣ ΣΧΕΔΙΑΣΜΟΣ ΚΤΗΡΙΩΝ Εύη Τζανακάκη Αρχιτέκτων Μηχ. MSc Αρχές ενεργειακού σχεδιασμού κτηρίων Αξιοποίηση των τοπικών περιβαλλοντικών πηγών και τους νόμους ανταλλαγής ενέργειας κατά τον αρχιτεκτονικό

Διαβάστε περισσότερα

Σενάριο 9: Ισορροπία στα Βιολογικά Συστήματα - Σχέσεις μεταξύ των οργανισμών

Σενάριο 9: Ισορροπία στα Βιολογικά Συστήματα - Σχέσεις μεταξύ των οργανισμών Σενάριο 9: Ισορροπία στα Βιολογικά Συστήματα - Σχέσεις μεταξύ των οργανισμών Φύλλο Εργασίας 1 (Εισαγωγικό) Τίτλος: Ισορροπία στα Βιολογικά Συστήματα Σχέσεις μεταξύ των οργανισμών Γνωστικό Αντικείμενο:

Διαβάστε περισσότερα

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί Κεφαλαίο 3 ο Μεταβολισμός Ενέργεια και οργανισμοί Η ενέργεια είναι απαρέτητη σε όλους τους οργανισμούς και την εξασφαλίζουν από το περιβάλλον τους.παρόλα αυτά, συνήθως δεν μπορούν να την χρησιμοποιήσουν

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 1 ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς

Διαβάστε περισσότερα

Η οµαδοποίηση των ζώων

Η οµαδοποίηση των ζώων ΣΧΕ ΙΟ ΜΑΘΗΜΑΤΟΣ Η οµαδοποίηση των ζώων ENOTHTA: Η οµαδοποίηση των ζώων ΜΑΘΗΜΑ: Επιστήµη ΤΑΞΗ: Β ΣΚΟΠΟΣ Οι µαθητές καλούνται να οργανώσουν µε βάση διαφορετικά κριτήρια κάθε φορά, πληροφορίες που είδη γνωρίζουν.

Διαβάστε περισσότερα

ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ Β ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ Β ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ Β ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. ΛΥΣΙΑΣ, Υπέρ Μαντιθέου: Εισαγωγή (σ.σ. 9-13, 15-20) Εισαγωγή (σ.σ. 79-80) Πρωτότυπο Κείμενο 1-3, 4-8, 9-13, 18-19, 20-21 2. ΔΗΜΟΣΘΕΝΗΣ, Υπέρ της Ροδίων

Διαβάστε περισσότερα

ΛΑΧΑΝΟΚΟΜΙΑ. Ελληνική ΟΧΙ

ΛΑΧΑΝΟΚΟΜΙΑ. Ελληνική ΟΧΙ ΛΑΧΑΝΟΚΟΜΙΑ 1. ΓΕΝΙΚΑ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΩΝ ΓΕΩΠΟΝΩΝ ΕΠΙΠΕΔΟ ΣΠΟΥΔΩΝ Προπτυχιακό ΚΩΔΙΚΟΣ ΜΑΘΗΜΑΤΟΣ FGF450 ΕΞΑΜΗΝΟ ΣΠΟΥΔΩΝ 4 ο ΤΙΤΛΟΣ ΜΑΘΗΜΑΤΟΣ

Διαβάστε περισσότερα

θθθθθ 2ο ΓΥΜΝΑΣΙΟ ΑΓ. ΙΩΑΝ. ΡΕΝΤΗ Σχολικό Έτος :2012-2013 ΤΑΞΗ-ΤΜΗΜΑ: Α2 Μάθημα: Τεχνολογία

θθθθθ 2ο ΓΥΜΝΑΣΙΟ ΑΓ. ΙΩΑΝ. ΡΕΝΤΗ Σχολικό Έτος :2012-2013 ΤΑΞΗ-ΤΜΗΜΑ: Α2 Μάθημα: Τεχνολογία θθθθθ 2ο ΓΥΜΝΑΣΙΟ ΑΓ. ΙΩΑΝ. ΡΕΝΤΗ Σχολικό Έτος :2012-2013 ΤΑΞΗ-ΤΜΗΜΑ: Α2 Μάθημα: Τεχνολογία ΑΤΟΜΙΚΟ ΕΡΓΟ Του μαθητή Αντώνη Μαμάκου ΤΙΤΛΟΣ ΘΕΜΑΤΟΣ Ηλιακός θερμοσίφωνας Καθηγητής: ΗΡ. ΝΤΟΥΣΗΣ ΠΕΡΙΕΧΟΜΕΝΑ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΠΕΙΡΑΜΑΤΙΚΟ ΟΛΟΗΜΕΡΟ ΔΗΜΟΤΙΚΟ ΣΧΟΛΕΙΟ ΠΟΡΤΑΡΙΑΣ

ΠΕΙΡΑΜΑΤΙΚΟ ΟΛΟΗΜΕΡΟ ΔΗΜΟΤΙΚΟ ΣΧΟΛΕΙΟ ΠΟΡΤΑΡΙΑΣ ΠΕΙΡΑΜΑΤΙΚΟ ΟΛΟΗΜΕΡΟ ΔΗΜΟΤΙΚΟ ΣΧΟΛΕΙΟ ΠΟΡΤΑΡΙΑΣ ΤΑΞΗ ΣΤ Στα πλαίσια του προγράμματος «Οικολογικά σπίτια» οι μαθήτριες Αλιώρη Βιολέτα και Κοντοβά Σταυρούλα ανέλαβαν να συγκεντρώσουν, από διάφορες πηγές,

Διαβάστε περισσότερα

6. Τα αλογόνα. Επιμέλεια παρουσίασης Παναγιώτης Αθανασόπουλος Δρ - Χημικός

6. Τα αλογόνα. Επιμέλεια παρουσίασης Παναγιώτης Αθανασόπουλος Δρ - Χημικός 6. Τα αλογόνα Επιμέλεια παρουσίασης Παναγιώτης Αθανασόπουλος Δρ - Χημικός Σκοπός του μαθήματος: Να εντοπίζουμε τη θέση των αλογόνων στον περιοδικό πίνακα Να αναφέρουμε τις κυριότερες ιδιότητες των αλογόνων

Διαβάστε περισσότερα

Κεφάλαιο 1 Η ΠΡΑΚΤΙΚΗ ΣΗΜΑΣΙΑ ΤΩΝ ΕΝΤΟΜΩΝ

Κεφάλαιο 1 Η ΠΡΑΚΤΙΚΗ ΣΗΜΑΣΙΑ ΤΩΝ ΕΝΤΟΜΩΝ Κεφάλαιο 1 Η ΠΡΑΚΤΙΚΗ ΣΗΜΑΣΙΑ ΤΩΝ ΕΝΤΟΜΩΝ 1.1 Ο άνθρωπος και τα έντοµα Από τις τρεις κύριες οµάδες ζωικών οργανισµών που προσβάλλουν γεωργικές καλλιέργειες, τα Έντοµα, τα Ακάρεα και τους Νηµατώδεις, η

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΠΙΜΕΛΕΙΑ: Κ. ΔΗΜΗΤΡΙΟΣ ΤΜΗΜΑ:Β 1 ΚΕΦΑΛΑΙΟ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Είναι γνωστό πως οποιοσδήποτε οργανισμός, για να λειτουργήσει χρειάζεται ενέργεια. Η ενέργεια αυτή βρίσκεται

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Ληξιαρχείο Δήμο Λαρισαίων

Ληξιαρχείο Δήμο Λαρισαίων Ληξιαρχείο Δήμο Λαρισαίων 1. Ληξιαρχική πράξη Γέννησης (Δήλωση εντός 10 ημερών, αλλιώς απαιτούνται παράβολα) Υπόχρεοι προς δήλωση: Ο πατέρας ή η μητέρα, ο γιατρός, η μαία ή οποιοσδήποτε παραστάς κατά τον

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Να συμπληρωθεί το παρακάτω φυλλάδιο με βάση τις οδηγίες σε κάθε θέμα. Να απαντήσετε σε όλες τις ερωτήσεις. Σας ευχόμαστε επιτυχία!

Να συμπληρωθεί το παρακάτω φυλλάδιο με βάση τις οδηγίες σε κάθε θέμα. Να απαντήσετε σε όλες τις ερωτήσεις. Σας ευχόμαστε επιτυχία! Διαγώνισμα ΒΙΟΛΟΓΙΑΣ Γενικής Παιδείας ΗΜΕΡΟΜΗΝΙΑ 15/3/2015 Να συμπληρωθεί το παρακάτω φυλλάδιο με βάση τις οδηγίες σε κάθε θέμα. Να απαντήσετε σε όλες τις ερωτήσεις. Σας ευχόμαστε επιτυχία! ΘΕΜΑ Α Να αντιγράψετε

Διαβάστε περισσότερα