Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα."


1 ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και Βιοτεχνολογίας (ΙΜΒΒ), Ίδρυµα Τεχνολογίας και Έρευνας (ΙΤΕ) Ζαχαρίας Κονταράκης Ινστιτούτο Μοριακής Βιολογίας και Βιοτεχνολογίας (ΙΜΒΒ), Ίδρυµα Τεχνολογίας και Έρευνας (ΙΤΕ) Νικόλαος Κωνσταντινίδης Ινστιτούτο Μοριακής Βιολογίας και Βιοτεχνολογίας (ΙΜΒΒ), Ίδρυµα Τεχνολογίας και Έρευνας (ΙΤΕ) Δεκέµβριος 2011

2 1.Εισαγωγή Στόχοι Η γήρανση εκδηλώνεται ως μια σταδιακή μείωση της ικανότητας του οργανισμού για αυτο συντήρησηκαιανταπόκρισησεεξωτερικέςπροκλήσειςκαθώςαυξάνειηηλικία.το φαινόμενο της γήρανσης έχει συσχετισθεί με τη συσσώρευση γενετικών και επιγενετικών τροποποιήσεων και τοξικών παραπροϊόντων του μεταβολισμού (π.χ. πρωτεϊνικά συσσωματώματα) τα οποία τα κύτταρα δεν μπορούν να αποβάλλουν. Ορισμένοιτύποικυττάρων,όπωςαυτάτηςγαμετικήςσειράς,μπορούννααποφεύγουν τη γήρανση ή να μηδενίζουν το "ηλικιακό ρολόι" κατά την αναπαραγωγή του οργανισμού. Οι μηχανισμοί με τους οποίους τα κύτταρα αυτά επαναφέρουν τις επιγενετικές τροποποιήσεις και απαλάσσονται από τα συσσωρευμένα μεταβολικά παραπροϊόνταέχουνμόλιςαρχίσειναδιερευνώνται 1 2. Δεν είναι ακόμα σαφές αν και άλλοι πληθυσμοί κυττάρων, όπως αδιαφοροποίητα ή αρχέγονα βλαστικά κύτταρα, έχουν επίσης την ικανότητα να αποφεύγουν ή να καθυστερούν τη γήρανση. Για παράδειγμα, οι αναπτυξιακοί δίσκοι της Δροσίφιλας (αδιαφοροποίητακύτταραπουμαςδίνουντουςιστούςτηςενήλικηςμύγας)μπορούννα διατηρηθούν για πολλά χρόνια με διαδοχικές μεταμοσχεύσεις από μύγα σε μύγα, και κατόπινναδιαφοροποιηθούνσεφυσιολογικούςιστούς 3,ενώοκανονικόςχρόνοςζωής μιαςδροσόφιλαςείναιπερίπουέναςμήνας.παρόμοια,ποντίκιαπουέχουνγεννηθείαπό κλωνοποιημένασωματικάκύτταραδενδείχνουνσυμπτώματαπρόωρηςγήρανσηςακόμα καιμετά απόέξιγενιέςδιαδοχικώνκλωνοποιήσεων 4.Ταπαραδείγματααυτάδείχνουν ότι, κάτω από ορισμένες συνθήκες, τα σωματικά κύτταρα μπορούν να διατηρηθούν σε «νεανική»κατάσταση,ενώτοάτομοπουταφιλοξενείσυνεχίζειναγερνάει. Ορισμένα ζώα έχουν τη δυνατότηνα να αναγεννούν ολόκληρες περιοχές του σώματος μετά από ακρωτηριασμό. Η διαδικασία της αναγέννησης χρησιμοποιεί βλαστικά κύτταρα ή διαφοροποιημενα κύτταρα που αποδιαφοροποιούνται, πολλαπλασιάζονται καιεπαναδιαφοροποιούνταιγιαναπαράγουντουςνέουςιστούς 5.Στημελέτηαυτήμας ενδιαφέρει να διερευνήσουμε κατά πόσο αυτή η διαδικασία "κυτταρικού επαναπρογραμματισμού"επηρεάζειτοβαθμόγήρανσηςτωναναγεννημένωνιστών. Η μελέτη μας επικεντρώνεται στην αναγέννηση των άκρων στο καρκινοειδές Parhyale hawaiensis 6. Τα άκρα του Pahyale αναγεννώνται πλήρως περίπου μία εβδομάδα μετά τονακρωτηριασμότους.ηδιάρκειαζωήςτουparhyaleείναιπερίπου1,5με2χρόνια.στο

3 εργαστήριοδιατηρούμεαναπαραγωγικούςπληθυσμούςπουπεριλαμβάνουνάτομααπό όλεςτιςηλικίες. Στόχος της μελέτης μας είναι η ταυτοποίηση ενός αξιόπιστου δείκτη κυτταρικής γήρανσης και η χρήση του για τη μέτρηση της κυτταρικής γήρανσης σε αναγεννημένα άκρα, στον οργανισμό Parhyale hawaiensis. Για την ταυτοποίηση του δείκτη γήρανσης ακολουθήσαμε δύο συμπληρωματικές προσεγγίσεις:(α) ελέγξαμε υποψήφιους δείκτες κυτταρικής γήρανσης που έχουν χρησιμοποιηθεί σε άλλους οργανισμούς 7 12, και (β) συγκρίναμε το μεταγραφικό προφίλ (transcriptome profile) άκρων από νεαρά και ηλικιωμέναάτομα. Πρινξεκινήσουμετημελέτηθελήσαμεεπίσηςνακαθιερώσουμεμιαμέθοδοπουθαμας επιτρέπει να εκτιμήσουμε την ηλικία ενός ατόμου στον Parhyale, όταν δεν γνωρίζουμε την ημερομηνία γέννησής του. Όπως συμβαίνει στα περισσότερα καρκινοειδή, ο Parhyaleεξακολουθείναμεγαλώνεισεμέγεθοςκαθ'ολητηδιάρκειατηςζωήςτου,μέσα απόδιαδοχικέςεκδύσεις ταηλικιωμέναάτομαέχουνπάνταμεγαλύτερομέγεθοςαπό τα νεαρά.τομέγεθοςεξαρτάταιεπίσηςσεκάποιοβαθμό από τηδιατροφήκαι από το φύλο (τα αρσενικά είναι συνήθως μεγαλύτερα). Στο παρακάτω γράφημα φαίνεται η σχέσημεγέθους(μήκοςτουσώματοςστηραχιαίαπλευρά)καιηλικίαςσεαρσενικάκαι θηλυκά άτομα, από ένα δείγμα 37 ατόμων των οποίων η ημερομηνία εκκόλαψης ήταν γνωστή.βασιζόμενοισεαυτήτησυσχέτιση,χρησιμοποιήσαμετομήκοςτουσώματοςγια νακατατάξουμεταάτομαενόςπληθυσμούσεδιαφορετικέςηλικιακέςκατηγορίες.

4 2.Υποψήφιοιδείκτεςκυτταρικήςγήρανσης Εστιάσαμε την προσοχή μας σε τρία χαρακτηριστικά που έχουν χρησιμοποιηθεί ως δείκτεςκυτταρικήςγήρανσηςσεάλλουςοργανισμούς τηνικανότητατωνκυττάρωννα αποκρίνονται σε θερμικό σοκ 7 9, τη συσσώρευση κατεστραμμένων μακρομορίων μέσα στο κύταρο 10, και την ενεργότητα λυσοσωμικής β γαλακτοσιδάσης και ελέγξαμε κατάπόσοθαμπορούσαννααποτελέσουναξιόπιστουςδείκτεςγήρανσηςστονparhyale. Μάρτυραςθερμικούσοκ:ΣτοεργαστήριοδιαθέτουμεδιαγονιδιακέςσειρέςParhyaleπου φέρουν την κατασκευή PhHS DsRed, η οποία επάγει έκφραση της φθορίζουσας πρωτεΐνης DsRed μετά από θερμικό σοκ 13. Η ρυθμιστική αλληλουχίαphhs προέρχεται από γονίδιο hsp70 του Parhyale και περιλαμβάνει θέσεις πρόσδεσης για τον μεταγραφικόπαράγονταhsf,ο οποίοςρυθμίζειτην απόκρισηστοθερμικόσοκ.γιανα ελέγξουμε την ικανότητα απόκρισης στο θερμικό σοκ σε συνάρτηση με την ηλικία επιλέξαμε τη διαγονιδιακή σειρά h1a, η οποία εγκαθιδρύθηκε από ένα διαγονιδιακό άτομο (G0) και περιλαμβάνει άτομα διαφόρων ηλικιών. Υποβάλλαμε 24 άτομα διαφόρων ηλικιών σε θερμικό σοκ (1h στους 37 C) και μετρήσαμε την αύξηση στην ένταση φθορισμού της DsRed μετά από 1 ημέρα. Όπως φαίνεται στο παρακάτω γράφημα,δενπαρατηρήσαμεσημαντικήδιαφοράστηναύξησητηςέντασηςφθορισμού μεταξύ νεαρών (μικρών) και ηλικιωμένων (μεγάλων) ατόμων στο δείγμα μας, με εξαίρεση3νεαράάτομαπουεμφάνισανπολύμεγαλύτερηαύξηση.συμπεραίνουμεότιη έντασητηςαπόκρισηςστοθερμικόσοκδεναποτελείαξιόπιστομάρτυραγήρανσης,αλλά ίσωςνασυσχετίζεταιμετη γήρανσησεειδικέςπεριπτώσεις(κρατήσαμετατρίαάτομα πουπαρουσίασαναυξημένηαπόκρισηγιαναταεξετάσουμεσεμεγαλύτερηηλικία).

5 Λυσοσωμική β γαλακτοσιδάση: Ιστοχημική χρώση για την ανίχνευση λυσοσωμικής β γαλακτοσιδάσηςέγινεσενεαράκαιηλικιωμέναάτομα,χρησιμοποιώνταςx galσεόξινες συνθήκες(ph=6.0).μετάαπόπολλέςώρεςαντίδρασης,παρατηρήσαμεμόνομηειδική χρώση στην εξωτερική επιφάνεια του εξωσκελετού. Δεν παρατηρήσαμε διαφορά στην έντασητηςχρώσηςανάμεσασενεαράκαισεηλικιωμέναάτομα. Συσσώρευση κατεστραμμένων μακρομορίων: Η συσσώρευση κατεστραμμένων μακρομορίων με τη μορφή καρβονυλιωμένων πρωτεϊνών ή lipofuscin στο κυτταρόπλασμαέχειχρησιμοποιηθείστοπαρελθόνωςδείκτηςγήρανσης 10.Ηανίχνευση αυτώντωνμακρομορίωνγίνεταισυνήθωςμεβιοχημικέςμεθόδουςήμεπαρατήρησητου αυτοφθορισμού της lipofuscin στο μικροσκόπιο. Επιλέξαμε τη μέθοδο του αυτοφθορισμού γιατί θα μας επέτρεπε να παρατηρήσουμε άμεσα τον εντοπισμό της lipofuscin σε συγκεκριμένους ιστούς και κυτταρικούς τύπους, που θα ήταν ιδιαίτερα χρήσιμη για μετέπειτα παρατηρήσεις στα αναγεννημένα άκρα. Οι μετρήσεις αυτοφθορισμούέγινανσε42άτομαδιαφορετικώνηλικιώνμεδιέγερσηστα nm καιπαρατήρησηστα>420nm.όπωςφαίνεταιστοπαρακάτωγράφημα,παρατηρήθηκε μόνομιαασθενήςσυσχέτισημεταξύτουαυτοφθορισμούκαιτουμεγέθους(ηλικίας)των ζώων. Συμπεραίνουμε ότι η μέθοδος αυτή δεν αποτελεί ευαίσθητο ή αξιόπιστο δείκτη γήρανσηςστονparhyale.

6 3.Μεταγραφικόπροφίλτηςγήρανσης(RNA seq) Για να διακρίνουμε αν υπάρχει ένα αξιόπιστο "μοριακό προφίλ" κυτταρικής γήρανσης ακολουθήσαμε τη στρατηγική της αλληλούχισης και ποσοτικής σύγκρισης μεγάλου αριθμούμεταγράφων(rna seq 14 )απόταάκρανεαρώνκαιηλικιωμένωνατόμων. Sample N o ofanimals Size Inferredage RNAquantity Young 109 4,5 6,0mm 4,5 6,5mm 3 6μήνες 15μg Old 53 7,5 9,0mm 9,0 11,5mm >12μήνες 45μg ΣτοολικόRNAπουαπομονώσαμεαπόκάθεδείγμαέγινεπέψημεDNAaseI,απομόνωση τουπολυαδενυλιωμένουrna(mrna)καιαλληλούχισηστηνπλατφόρμαabisolid4του CentreforGeneticsandGenomics(Univ.Nottingham).Ηαπόδοσηήταν και readsγιαταδείγματααπόνεαράκαιηλικιωμέναάτομααντίστοιχα. Οι αλληλουχίες του RNA seq χαρτογραφήθηκαν στο transcriptome του Parhyale, χρησιμοποιώνταςμιαβάσηδεδομένωνπουπεριλαμβάνει πιθανάδιαφορετικά μετάγραφα (isotigs), οι οποίοι αντιστοιχούν σε πιθανούς γενετικούς τόπους (isogroups) στον Parhyale. Πάνω από το 40% των reads αντιστοιχήθηκαν σε isogroups, και πάνω από 20% αντιστοιχήθηκαν σε ένα μόνο isogroup. Κατόπιν έγινε στατιστική ανάλυσηγιαναταυτοποιηθούνοιπιοσημαντικέςδιαφορέςανάμεσαστανεαράκαιστα γηρασμένα άκρα, χρησιμοποιώντας το πρόγραμμα DEGseq 15. Για την ταυτοποίηση αυτών των διαφορών επικεντρωθήκαμε στις αλληλουχίες που αντιστοιχήθηκαν σε ένα μόνο isogroup (uniquely mapped reads). Η ανάλυση αυτή έγινε απο τον Martin Blythe στοcentreforgeneticsandgenomics(nottingham). Sample Reads ExcludedReads (rrna,artifacts) Young (2%) Old (1%) MappedReads (42%) (42%) Uniquely MappedReads (22%) (22%)

7 Από την ανάλυση προέκυψαν 73 διαφορετικοί γενετικοί τόποι (isogroups) που παρουσιάζουνστατιστικάσημαντικήδιαφοράσταεπίπεδαέκφρασήςτουςσενεαράκαι ηλικιωμέναάτομα(λόγοςέκφρασης>4). 4.Επιβεβαίωσημοριακώνδεικτώνγήρανσης(qPCR) Από αυτά τα 73 isogroups επιλέξαμε δέκα για επιβεβαίωση και περαιτέρω μελέτη με qpcr. Συγκεκριμένα, επιλέξαμε τους δέκα γενετικούς τόπους που παρουσίαζαν τις υψηλότερες διαφορές μεταξύ των δύο δειγμάτων πέντε με υψηλότερη έκφραση στα νεαρά και πέντε στα γηρασμένα άκρα με την προϋπόθεση αυτά τα isogroups να αντιπροσωπεύονταιαπότουλάχιστον100readsσταδύοδείγματα. Isogroup ReadsinYoung ReadsinOld log2difference ig ,1 ig ,8 ig ,6 ig ,2 ig ig ,6 ig ,3 ig ,1 ig ,3 ig ,4 Ταυτόχρονα, από τα δεδομένα του RNA seq επιλέξαμε και δύο γονίδια αναφοράς για κανονικοποίηση των δειγμάτων στα qpcrs: τα isogroups ig07133 και ig08602, που κωδικοποιούν προϊόντα που εμφανίζουν σημαντική ομοιότητα με τον ευκαρυωτικό παράγοντα έναρξης της μετάφρασης eif3 και με τον παράγοντα ματίσματος U3, αντίστοιχα.σύμφωναμεταδεδομένατουrna seq,ταεπίπεδάέκφρασήςτουςσενεαρά καιηλικιωμέναάκραπαρουσιάζουνδιαφορέςμικρότερεςτου0.35%(log2<0,005). ΤαqPCRsσταδέκαεπιλεγμέναisogroupsέδωσανταεξήςαποτελέσματα: i) Τέσσερα isogroups (ig25990, ig44123, ig47225, ig16642) εκφράζονται και στα δύο δείγματα δίνοντας το αναμενόμενο προϊόν. Η ποσοτική ανάλυση με qpcr

8 επιβεβαίωσεκαιστις4περιπτώσειςότι αυτά τα isogroups παρουσιάζουν σημαντικές διαφορές στα επίπεδα εκφρασής τους σε νεαρά και ηλικιωμένα άτομα. Οι λόγοι έκφρασης ήταν διαφορετικοί από αυτούς που παρατηρήσαμε με RNAseq, αλλά σε όλες τις περιπτώσεις παρατηρήθηκαν διαφορέςπροςτηνίδιακατεύθυνση.ηπαραπάνωεικόνααπεικονίζειτιςδιαφορέςστα επίπεδαέκφρασηςανάμεσασενεαράκαισεηλικιωμέναάκρα. ii) Δύο isogroups (ig30705, ig41884) εμφανίζουν προϊόν σε ένα από τα δύο δείγματα αλλά όχι στο άλλο, δίνοντας πληροφορία πάνω στην έκφραση ή μη της αλληλουχίας.τααποτελέσματασυμφωνούνμε τηδιαφοράπουβλέπουμεστο RNAseq (βλ.παρακάτω). iii)δύοisogroups(ig11643,ig24095)εμφανίζουνδιαφορετικάπροϊόντασταδύο δείγματα, που ενδεχομένως αντιστοιχούν σε διαφορετικές ισομορφές του ίδιου μεταγράφου (βλ. παρακάτω). Στην περίπτωση του ig24095 αυτό επιβεβαιώθηκε με κλωνοποίηση και αλληλούχιση του προϊόντος, αποκαλύπτοντας μια ενδιαφέρουσα περίπτωσηδιαφορετικούματίσματοςστανεαράκαιηλικιωμέναάκρα. v) Δύο isogroups (ig14190, ig03206) δίνουν παραπροϊόντα που καθιστούν τα qpcrsμηαξιόπιστα. 5.Εκτίμησητηςγήρανσηςσεαναγεννημέναάκρα ΟσυνδυασμόςRNA seqκαιqpcrμαςεπέτρεψενααπομονώσουμεοκτώγονίδια δείκτες και να χαρακτηρίσουμε τις τιμές (ποσοτικές ή ποιοτικές) που αντιστοιχούν στη γηρασμένη και νεαρή κατάσταση. Τώρα μπορούμε επομένως να προσεγγίσουμε το αρχικόμαςερώτημα πώςηαναγέννησηεπηρεάζειτηνηλικίατωνάκρων ελέγχοντας πώςσυμπεριφέρονταιαυτοίοιδείκτεςστααναγεννημέναάκρα. Από τα 56 ηλικιωμένα άτομα που χρησιμοποιήσαμε αρχικά για την απομόνωση του υλικού για RNA seq, 16 επιβίωσαν και αναγέννησαν όλα τους τα άκρα. Απομονώσαμε αυτά τα αναγεννημένα άκρα και ακολουθήσαμε την ίδια διαδικασία για την εξαγωγή

9 πολυαδενυλιωμένου RNA (mrna) και τον έλεγχο των επιπέδων έκφρασης για τον καθένααπό τους οκτώδείκτες,μεqpcr.ηπαρακάτωεικόναδείχνει τα αποτελέσματα πουπαίρνουμεμεpcrγιατονκαθένααπότουςοκτώδείκτες,απόγηρασμένα,νεανικά καιγηρασμένααλλάαναγεννημέναάκρα(απόαριστεράπροςταδεξιά). Στα αναγεννημένα άκρα, από τους τέσσερις ποσοτικούς δείκτες, ο ένας (ig16642) εμφανίζειεπίπεδαέκφρασηςπουείναιχαρακτηριστικάτωνηλικιωμένωνάκρων,ενώοι άλλοι τρεις (ig259901, ig441231, ig472251) εμφανίζουν επίπεδα έκφρασης που βρίσκονταιπιοκοντάστιςτιμέςτωννεανικώνάκρων(καιστιςτρειςπεριπτώσειςοιτιμές είναιακόμηπιοχαμηλέςαπόαυτέςπουπαρατηρούμεστανεανικάάκρα).μεβάσητους δείκτες ig30705 και ig41884 ο αναγεννημένος ιστός ακολουθεί την νεαρή κατάσταση. Τέλος, με βάση τις διαφορετικές ισομορφές που παρατηρούμε στα isotigs ig11643 και ig24095, τα αναγεννημένα άκρα φαίνεται να διατηρούν τις ιδιότητες των ηλικιωμένων άκρων. Μπορούμε δηλαδή να πούμε πως τα αναγέννημένα παρουσιάζουν χαρακτηριστικά ηλικιωμένου ιστού με βάση τους τρεις από τους οκτώ δείκτες, και χαρακτηριστικάνεανικούιστούμεβάσηάλλουςπέντεδείκτες. Isotig Young Old RegeneratedOld ig ig ig ig ig30705 OFF ON OFF ig41884 ON OFF ON ig11643 isoformα isoformsa+b isoformsa+b ig24095 isoformα isoformβ isoformβ 1 Valuesrepresentlog2differenceofexpressionlevelsrelativetothe'Old'sample.

10 6.Συμπεράσματα Στην προσπάθειά μας να ταυτοποιήσουμε δείκτες κυτταρικής γήρανσης στον Parhyale εξετάσαμευποψήφιουςδείκτεςγήρανσηςπουέχουν χρησιμοποιηθείσεάλλαείδηστο παρελθόν,καισυγκρίναμετομοριακό(μεταγραφικό)προφίλτωνάκρωναπόνεαράκαι ηλικιωμέναζώα.ηπρώτηπροσέγγισηδεναπέδωσεικανοποιητικάαποτελέσματα,όμως η δεύτερη αποκάλυψε ένα μεγάλο αριθμό αλληλουχιών που εμφανίζουν διαφορετικά επίπεδαέκφρασηςανάλογαμετηνηλικία.τουλάχιστονοκτώαπόαυτέςτηςαλληλουχίες φαίνεται να αποτελούν αξιόπιστους δείκτες της ηλικίας των άκρων: τα επίπεδα έκφρασής τουςή οι ισομορφές τους παρουσιάζουν σημαντικές διαφορές ανάμεσα στα άκρανεαρώνκαιηλικιωμένωνάτομων. Χρησιμοποιώντας αυτούς τους οκτώ δείκτες, εξετάσαμε τον "ηλικιακό χαρακτήρα" αναγεννημένωνάκρων.ηανάλυσηαυτήέδειξε: i) Τα άκρα ηλικιωμένων ατόμων που έχουν υποστεί αναγέννηση διατηρούν, για ορισμένους από τους δείκτες μας (ig16642, ig11643, ig24095), τα χαρακτηριστικά που είχανπριντηναναγέννηση.ηπαρατήρησηαυτήυποδηλώνειότιτααναγεννημέναάκρα δεν είναι όμοια με τα νεανικά άκρα ως προς το μεταγραφικό τους προφίλ, αλλά διατηρούν τουλάχιστον κάποια από τα χαρακτηριστικά των γηρασμένων άκρων. Μας δείχνει επίσης ότι τα συγκεκριμένα γονίδια δείκτες αποτελούν ιδιαίτερα αξιόπιστους δείκτεςτηςηλικίαςτουζώου,καθώςδεφαίνεταιναεπηρεάζονταιαπότιςαλλαγέςπου συμβαίνουνκατάτηδιαδικασίατηςανάπλασηςτωνάκρων. ii) Ως προς τους άλλους πέντε δείκτες, το προφίλ των αναγεννημένων άκρων φαίνεται να αλλάζει σημαντικά και να βρίσκεται πιο κοντά στις τιμές των άκρων από νεαρά άτομα. Αυτό μπορεί να σημαίνει ότι τα αναγεννημένα άκρα αποκτούν κάποια "νεανικά" χαρακτηριστικά. Μπορεί όμως να οφείλεται και στο ότι κάποιοι από τους δείκτες αυτούς σχετίζονται με λειτουργίες που ενεργοποιούνται από τη ίδια τη διαδικασίααναγέννησης(π.χ.τονκυτταρικόπολλαπλασιασμό,τηναύξησηιστικήςμάζας ήτηνέκδυση)καιδεναποτελούνμόνοχαρακτηριστικόνεανικούιστού.θαεξετάσουμε αυτότοενδεχόμενομελετώνταςτισυμβαίνειστααναγεννημέναάκρανεαρώνατόμων. Για την περειτέρω διερεύνηση αυτού του θέματος θα μελετήσουμε το μεταγραφικό προφίλ αναγεννημένων άκρων (από νεαρά και από ηλικιωμένα ζώα) σε μεγαλύτερη

11 κλίμακα,χρησιμοποιώνταςrna seq.ηπροσέγγισηαυτήθαμαςδώσειμιαπληρέστερη εικόνα της ηλικιακής ταυτότητας των αναγεννημένων ποδιών, με βάση το σύνολο των μεταγράφωνπουπαρουσιάζουνδιαφορέςέκφρασηςσενεαράκαισεγηρασμέναάτομα. Βιβλιογραφία AguilaniuH,GustafssonL,RigouletMandNyströmT(2003)Asymmetricinheritanceof oxidativelydamagedproteinsduringcytokinesis.science299: LiuB,LarssonL,CaballeroA,HaoX,OlingD,GranthamJandNyströmT(2010)The polarisomeisrequiredforsegregationandretrogradetransportofproteinaggregates. Cell140: HadornE(1968)Transdeterminationincells.SciAm.219: WakayamaT,ShinkaiY,TamashiroKL,NiidaH,BlanchardDC,BlanchardRJ,OguraA, TanemuraK,TachibanaM,PerryAC,ColganDF,MombaertsPandYanagimachiR (2000)Cloningofmicetosixgenerations.Nature407: BrockesJPandKumarA(2002)Plasticityandreprogrammingofdifferentiatedcellsin amphibianregeneration.natrevmolcellbiol3: PavlopoulosAandAverofM(2005)Establishinggenetictransformationfor comparativedevelopmentalstudiesinthecrustaceanparhyalehawaiensis.pnas102: HeydariAR,YouS,TakahashiR,Gutsmann ConradA,SargeKDandRichardsonA (2000)Age relatedalterationsintheactivationofheatshocktranscriptionfactor1in rathepatocytes.expcellres256: ReaSL,WuD,CypserJR,VaupelJWandJohnsonTE(2005)Astress sensitivereporter predictslongevityinisogenicpopulationsofcaenorhabditiselegans.natgenet37: WesterheideSD,AnckarJ,StevensSMJr,SistonenLandMorimotoRI(2009)Stressinducibleregulationofheatshockfactor1bythedeacetylaseSIRT1.Science323: TermanAandBrunkUT(2004)Lipofuscin.IntJBiochemCellBiol36:

12 11 LeeBY,HanJA,ImJS,MorroneA,JohungK,GoodwinEC,KleijerWJ,DiMaioDand KishiS,BaylissPE,UchiyamaJ,KoshimizuE,QiJ,NanjappaP,ImamuraS,IslamA, NeubergD,AmsterdamAandRobertsTM(2008)Theidentificationofzebrafish mutantsshowingalterationsinsenescence associatedbiomarkers.plosgenet4: e PavlopoulosA,KontarakisZ,LiubicichD,SeranoJ,AkamM,PatelNHandAverofM (2009)ProbingtheevolutionofappendagespecializationbyHoxgenemis expression inanemergingmodelcrustacean.pnas106: WilhelmBTandLandryJR(2009)RNA Seq quantitativemeasurementofexpression throughmassivelyparallelrna sequencing.methods48: WangL,FengZ,WangX,WangXandZhangX(2010)DEGseq:anRpackagefor HwangES(2006)Senescence associatedbeta galactosidaseislysosomalbetagalactosidase.agingcell5: identifyingdifferentiallyexpressedgenesfromrna seqdata.bioinformatics26:


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Σαγρή Χ.Ευθυμία. Department of Biochemistry and Biotechnology University of Thessaly

Σαγρή Χ.Ευθυμία. Department of Biochemistry and Biotechnology University of Thessaly Department of Biochemistry and Biotechnology University of Thessaly Laboratory of Molecular Biology and Genomics ΤΡΑΝΣΚΡΙΠΤΟΜΙΚΗ ΚΑΙ ΠΡΩΤΕΟΜΙΚΗ ΑΝΑΛΥΣΗ ΤΟΥ ΣΗΜΑΝΤΙΚΟΤΕΡΟΥ ΠΑΡΑΣΙΤΟΥ ΤΗΣ ΕΛΙΑΣ, ΤΟΥ ΕΝΤΟΜΟΥ

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέμα 1 ο : Να επιλέξετε τη σωστή απάντηση: 1. Το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης δεν περιλαμβάνει α. το mrna β. τη μεγάλη ριβοσωμική υπομονάδα γ.

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Ανασυνδυασμένο DNA. Γονίδια και Γονιδιώματα Μία Συνοπτική Παρουσίαση. Richard M. Myers Jan A. Witkowski. James D. Watson Amy A.

Ανασυνδυασμένο DNA. Γονίδια και Γονιδιώματα Μία Συνοπτική Παρουσίαση. Richard M. Myers Jan A. Witkowski. James D. Watson Amy A. Ανασυνδυασμένο DNA Γονίδια και Γονιδιώματα Μία Συνοπτική Παρουσίαση James D. Watson Amy A. Caudy Richard M. Myers Jan A. Witkowski Κεφάλαιο 8 Επιγενετικές τροποποιήσεις του γονιδιώματος 2 Το πρόβλημα της

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Σ. Κυρτόπουλος Ινστιτούτο Βιολογικών Ερευνών & Βιοτεχνολογίας Εθνικό Ίδρυμα Ερευνών Συμβολή περιβαλλοντικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η Συμβολή της Μοριακής Βιολογίας

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

γενετικά αίτια της γήρανσης και της μακροβιότητας

γενετικά αίτια της γήρανσης και της μακροβιότητας γενετικά αίτια της γήρανσης και της μακροβιότητας Ευστάθιος Γκόνος Διευθυντής Ερευνών, Ινστιτούτο Βιολογικών Ερευνών και Βιοτεχνολογίας (ΙΒΕΒ), Εθνικό Ίδρυμα Ερευνών ας καλωσορίζω κι εγώ με τη σειρά μου.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 15 Ιουνίου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Επαναληπτικών Πανελλαδικών Εξετάσεων Εσπερινών Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Α Α.1 β Α.2 γ Α.3 δ Α.4 α Α.5

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα


ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα


ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ Α ΕΞΑΜΗΝΟΥ ΤΜΗΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ Α ΕΞΑΜΗΝΟΥ ΤΜΗΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ 2016-17 Εισαγωγή στη Γενική Χημεία Γενική Χημεία Ζωολογία Εισαγωγή στη Ζωολογία Αγγλικά Ι 12.00-13.00 13.00-14.00 (Εργ. Β) (Εργ. Β) (Εργ. Β) Φυσική Φυσική Γενική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα


ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα


AYΞΗΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΤΩΝ ΦΥΤΩΝ AYΞΗΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΤΩΝ ΦΥΤΩΝ ΕΡΓΑΣΤΗΡΙΟ ΦΥΣΙΟΛΟΓΙΑΣ ΚΑΙ ΜΟΡΦΟΛΟΓΙΑΣ ΦΥΤΩΝ Χ.Κ. ΚΙΤΣΑΚΗ 2008 1 Αντικείμενα της ενότητας Ορισμοί και έννοιες Σκοπός των διεργασιών της ανάπτυξης Πού και πώς πραγματοποιούνται

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος

Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος MOPIAKH BIOΛOΓIA ΦAPMAKEYTIKHΣ ΔIAΛEΞΕΙΣ 10-12 Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος (Πως γίνονται αντιληπτά τα μηνύματα και πως δίδονται οι απαντήσεις) Δρ. Xρήστος Παναγιωτίδης, Tµήµα Φαρµακευτικής

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: ΜΑΘΗΜΑ: 3 η ΤΑΞΗ ΕΠΑ.Λ. (Β ΟΜΑ Α) ΒΙΟΛΟΓΙΑ ΙΙ Ηµεροµηνία: Παρασκευή 19 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1-β, Α2-γ, Α3-γ, Α4-α, Α5-α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Με τη µέθοδο της επιλογής

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

Γκύζη 14-Αθήνα Τηλ :


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα