Το ώριμο m-rna που προκύπτει μετά την απομάκρυνση του εσωνίου από το πρόδρομο m-rna είναι :

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Το ώριμο m-rna που προκύπτει μετά την απομάκρυνση του εσωνίου από το πρόδρομο m-rna είναι :"


1 ΑΠΑΝΤΗΣΕΙΣ ΑΣΚΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ 2 ΟΥ ΚΕΦΑΛΑΙΟΥ ΑΠΟ ΤΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΕΞΕΤΑΣΕΙΣ 2000 Έστω ένα τμήμα μεταγραφόμενου κλώνου DNA με την ακόλουθη αλληλουχία βάσεων : 5 -TCA-CGG-AAT-TTC-TAG-CAT-3. Α) Με δεδομένο ότι δε μεσολαβεί στάδιο ωρίμανσης, να γράψετε το mrna που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος DNA, σημειώνοντας ταυτόχρονα τη θέση 5 και 3 άκρου του mrna. Β) Να γραφούν τα αντικωδικόνια των trna με τη σειρά που συμμετέχουν στη μετάφραση του παραπάνω mrna. Α) Το m-rna που θα παραχθεί, θα είναι συμπληρωματικό και αντιπαράλληλο με το τμήμα του μεταγραφόμενου κλώνου. Δεδομένου ότι δεν μεσολαβεί ωρίμανση, δεν θα απομακρυνθεί κανένα νουκλεοτίδιο του mrna, το οποίο θα είναι : 3 AGU-GCC-UUA-AAG-AUG-GUA-5 Β) To πρώτο κωδικόνιο από το άκρο 5 είναι το κωδικόνιο έναρξης, ενώ το τελευταίο κωδικόνιο, από δεξιά προς τα αριστερά, είναι το κωδικόνιο λήξης. Τα μεταφραζόμενα κωδικόνια είναι 5, ενώ δεν μεταφράζεται το κωδικόνιο λήξης. Η σειρά που μεταφράζονται τα κωδικόνια είναι : 5 AUG 3 5 GUA 3 5 GAA 3 5 AUU 3 5 CCG 3 Tα αντικωδικόνια θα είναι συμπληρωματικά και αντιπαράλληλα των κωδικονίων. Επομένως θα είναι κατά σειρά: 3 UAC 5 3 CAU 5 3 CUU 5 3 UAA5 3 GGC 5 ΕΞΕΤΑΣΕΙΣ 2005 Δίνεται τμήμα μορίου DNA ευκαρυωτικού κυττάρου που περιέχει ασυνεχές γονίδιο, το οποίο είναι υπεύθυνο για τη σύνθεση του παρακάτω πεπτιδίου, που δεν έχει υποστεί καμιά τροποποίηση: H2N -Μεθειονίνη - φαινυλαλανίνη - βαλίνη.-cooh Να γράψετε, την κωδική και τη μη κωδική αλυσίδα του γονιδίου, το πρόδρομο και το ώριμο m-rna (Μονάδες 4) και να ορίσετε τα 3 και 5 άκρα των παραπάνω νουκλεοτιδικών αλυσίδων αιτιολογώντας την απάντησή σας. (Μονάδες 8). Να αναφέρετε τις διαδικασίες κατά την πορεία από το γονίδιο στο πεπτίδιο και τις περιοχές του κυττάρου τις οποίες πραγματοποιούνται ( Μονάδες 6 ). Δίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων από το γενετικό κώδικα: Μεθειονίνη ΑUG Φαινυλαλανίνη UUU Βαλίνη GUU 5 GAA TTC ATG TTT CCCCAG GTT TAA GAATTC 3 Ι κωδική αλυσίδα 3 CT T AAG TAC AAA GGGGTC CAA AT T CT T AAG 5 ΙΙ μη κωδική αλυσίδα Η κωδική αλυσίδα του DNA και το m-rna είναι συµπληρωµατικά προς τη µεταγραφόµενη αλυσίδα του DNA, µε τη διαφορά ότι, όπου στην κωδική αλυσίδα υπάρχει Τ στο m-rna υπάρχει U. Επιπλέον, η κωδική αλυσίδα του DNA και το m-rna είναι αντιπαράλληλες προς τη µεταγραφόµενη αλυσίδα του DNA. Για να κωδικοποιεί η κωδική αλυσίδα ένα τριπεπτίδιο, θα πρέπει να έχει κωδικόνιο έναρξης (ATG) και να μεσολαβούν δύο κωδικόνια μέχρι να εμφανισθεί κάποιο από τα κωδικόνια λήξης, χωρίς να συμπεριλαμβάνουμε τα νουκλεοτίδια του εσωνίου. Η αλυσίδα Ι, είναι η κωδική γιατί έχει αυτές τις προϋποθέσεις, δηλαδή υπάρχει σε αυτήν η αλληλουχία : 5 ATG TTT CCCCAG GTT TAA 3 στην οποία εμπεριέχονται τα κωδικόνια που κωδικοποιούν τα τρία αμινοξέα, το και ένα από τα κωδικόνια λήξης. Κάτι τέτοιο δεν υπάρχει στην αλυσίδα ΙΙ που είναι η μη κωδική. Το πρόδρομο m- RNA προκύπτει από τη μεταγραφή της μη κωδικής αλυσίδας και είναι : 5 GAA UUC AUG UUU CCCCAG GUU UAA GAAUUC 3 πρόδρομο m-rna Το ώριμο m-rna που προκύπτει μετά την απομάκρυνση του εσωνίου από το πρόδρομο m-rna είναι : 5 GAA UUC AUG UUU GUU UAA GAAUUC 3 ώριμο m-rna Οι παραπάνω διαδικασίες, δηλαδή η μεταγραφή και η ωρίμανση πραγματοποιούνται στον πυρήνα του ευκαρυωτικού κυττάρου. Το πεπτίδιο θα σχηματισθεί με την μετάφραση του ώριμου m-rna, που γίνεται στα ριβοσώματα του κυτταροπλάσματος.

2 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2006 Δίνεται το πεπτίδιο H2N Μεθειονίνη Αλανίνη Τυροσίνη Προλίνη Σερίνη COOH, που κωδικοποιείται από το παρακάτω τμήμα μορίου DNA ευκαρυωτικού κυττάρου : 5 C A A A T G G C C T A T A A C T G G A C A C C C A G C T G A C G A 3 3 G T T T A C C G G A T A T T G A C C T G T G G G T C G A C T G C T 5 Να γράψετε την αλληλουχία του πρόδρομου mrna, την αλληλουχία του ώριμου mrna που προκύπτει, μετά την μεταγραφή του παραπάνω τμήματος DNA και να αιτιολογήσετε την απάντησή σας (μονάδες 9). Να γράψετε την αλληλουχία του εσωνίου που βρίσκεται στο παραπάνω τμήμα του μορίου DNA (μονάδες 8). Δίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων: Αλανίνη GCC Μεθειονίνη AUG Προλίνη CCC Σερίνη AGC Τυροσίνη UAU Το πρόδρομο m-rna είναι : 5 C A A A U G G C C U A U A A C U G G A C A C C C A G C U G A C G A 3 H κωδική αλυσίδα του DNA και το m-rna είναι αντιπαράλληλες προς τη µη κωδική αλυσίδα του DNA, επομένως θα έχουν τον ίδιο προσανατολισμό. Η κωδική αλυσίδα του DNA και το m-rna είναι συµπληρωµατικά προς τη µεταγραφόµενη αλυσίδα του DNA, µε τη διαφορά ότι, όπου στην κωδική αλυσίδα υπάρχει Τ στο m-rna υπάρχει U. Η κωδική αλυσίδα θα πρέπει κατά την κατεύθυνση 5 3 να έχει κωδικόνιο έναρξης (ATG) τις ακολουθίες που κωδικοποιούν τα 5 αμινοξέα και είναι κατά σειρά : AΤG, GCC, ΤAΤ, CCC, AGC, την αλληλουχία του εσωνίου και ένα από τα κωδικόνια λήξης ( TAA, TAG, TGA ) Τις προϋποθέσεις αυτές έχει μόνο η πάνω αλυσίδα. Το τμήμα του ώριμου m-rna που μεταφράζεται θα πρέπει να περιέχει την ακολουθία : 5 A U G G C C U A U C C C A G C κωδικόνιο λήξης 3 Συγκρίνοντας την παραπάνω ακολουθία με το πρόδρομο m-rna βγάζουμε το συμπέρασμα ότι το είναι: A A C U G G A C A Το ώριμο m-rna επομένως θα είναι : 5 C A A A U G G C C U A U C C C A G C U G A C G A 3 ΕΞΕΤΑΣΕΙΣ 2009 Δίνεται δίκλωνο μόριο DNA, το οποίο περιέχει τμήμα ασυνεχούς γονιδίου που μεταγράφεται σε mrna. GAAGGAGGTTGCTTAA GGGGCC CTACCAAT ελεύθερο -OH CTTCCTCCAACGAATT CCCCGG GATGGTTA κατεύθυνση μεταγραφής α. Πού συναντάμε ασυνεχή γονίδια ; ( μονάδες 2 ). β. Να προσδιορίσετε τα 3 και 5 άκρα του παραπάνω μορίου DNA. ( μονάδες 2 ) Nα αιτιολογήσετε την απάντηση σας. ( μονάδες 4 ) γ. Να γράψετε το τμήμα του πρόδρομου rnrνα και του ώριμου m-rνα που προκύπτουν από τη μεταγραφή του παραπάνω μορίου DNA, χωρίς αιτιολόγηση. ( μονάδες 2 ). α. Ασυνεχή γονίδια υπάρχουν μόνο στα ευκαρυωτικά κύτταρα. β. Ελεύθερο -ΟΗ υπάρχει στο άκρο 3, κάθε αλυσίδας του DNA. Με δεδομένο ότι οι δύο αλυσίδες είναι αντιπαράλληλες, οι προσανατολισμοί θα είναι : 5 GAAGGAGGTTGCTTAA GGGGCC CTACCAAT 3 ελεύθερο -OH 3 CTTCCTCCAACGAATT CCCCGG GATGGTTA 5 γ. H κωδική αλυσίδα του DNA και το m-rna είναι αντιπαράλληλες προς τη µη κωδική αλυσίδα του DNA, επομένως θα έχουν τον ίδιο προσανατολισμό. Αν πάρουμε υπόψη μας και την κατεύθυνση της μεταγραφής καταλήγουμε στο συμπέρασμα ότι κάτω είναι η μη κωδική αλυσίδα και πάνω η κωδική. ( Σχόλια : 1. Η αιτιολόγηση θα μπορούσε και θα έπρεπε να έχει ζητηθεί. 2. Η αλληλουχία που δίνεται είναι τμήμα ενός γονιδίου και επομένως είναι δυνατόν να μην περιέχει κωδικόνιο έναρξης και κωδικόνιο λήξης. ) 5 GAAGGAGGUUGCUUAA GGGGCC CUACCAAU 3 πρόδρομο m-rna 5 GAAGGAGGUUGCUUCC CUACCAAU 3 πρόδρομο m-rna

3 ΕΞΕΤΑΣΕΙΣ 2011 Δίνεται το παρακάτω τμήμα DNA, το οποίο αντιγράφεται. Στον κλώνο ΖΗ, η αντιγραφή γίνεται με ασυνεχή τρόπο. Τα σημεία Δ και Η υποδεικνύουν τη θέση έναρξης της αντιγραφής. Δ1. Να σχεδιάσετε τα συνεχή και ασυνεχή τμήματα των νέων κλώνων με βέλη υποδεικνύοντας τους προσανατολισμούς των νέων και των μητρικών κλώνων. (μονάδες 2) Να αιτιολογήσετε την απάντηση σας. (μονάδες 3) Δ2. Στον κλώνο που αντιγράφεται με συνεχή τρόπο, να γράψετε την αλληλουχία των νουκλεοτιδίων και τον προσανατολισμό του πρωταρχικού τμήματος, το οποίο αποτελείται από 8 (οκτώ) νουκλεοτίδια (μονάδες 2). Να αιτιολογήσετε την απάντηση σας (μονάδες 3). Δ1. Με βάση το γεγονός ότι ασυνεχής αντιγραφή γίνεται στον κλώνο ΖΗ : Ο λόγος για τον οποίο γίνεται ασυνεχής αντιγραφή του κλώνου ΖΗ είναι ότι κάθε νεοσυντιθέμενη αλυσίδα έχει προσανατολισμό 5 3 και επιπλέον είναι αντιπαράλληλη της μητρικής. Το ξεκίνημα λοιπόν της αντιγραφής δεν θα ξεκινήσει ακριβώς από το σημείο Η, αλλά το πρώτο από τα ασυνεχή τμήματα θα καταλήξει εκεί όπου και θα έχει άκρο 3. Συνεπώς στο Η, υπάρχει άκρο 5 και φυσικά στο Ζ άκρο 3. Η συνεχής αλυσίδα ξεκινά απέναντι από το Δ και αντιγράφεται προς την κατεύθυνση αυτή, ώστε να καταλήξει σε άκρο 3. Το τμήμα ΓΔ που είναι αντιπαράλληλο θα έχει 5 άκρο στο Γ και 3 άκρο στο Δ. Δ2. Το πρωταρχικό τμήμα θα είναι : 5 UCAGAUCU 3 Το παραπάνω τμήμα είναι συμπληρωματικό με τον κλώνο ΔΓ άρα θα έχει την ίδια αλληλουχία με τον ΗΖ, με τη διαφορά ότι θα αποτελείται από ριβονουκλεοτίδια, επομένως αντί της Τ θα υπάρχει U. ΕΞΕΤΑΣΕΙΣ 2012 Δίνεται το παρακάτω τμήμα βακτηριακού DNA, το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο. Αλυσίδα 1: GTTGAATTCTTAG CTTAAGTCGGGCATGAATTCTC Αλυσίδα 2: CAACTTAAGAATCGAATTCAGCCCGTACTTAAGAG Δ1. Να προσδιορίσετε την κωδική και τη μη κωδική αλυσίδα του παραπάνω τμήματος DNA, επισημαίνοντας τα 5 και 3 άκρα των αλυσίδων του (μονάδες 1). Να αιτιολογήσετε την απάντησή σας. (μονάδες 5) Δ2. Το παραπάνω τμήμα DNA αντιγράφεται, και κατά τη διαδικασία της αντιγραφής δημιουργούνται τα παρακάτω πρωταρχικά τμήματα: i) 5 -GAGAAUUC-3 ii) 5 -UUAAGCUA-3 iii) 5 -GUUGAAUU-3 Να προσδιορίσετε ποια αλυσίδα αντιγράφεται, με συνεχή και ποια με ασυνεχή τρόπο (μονάδες 1). Να αιτιολογήσετε την απάντησή σας (μονάδες 5). 1. Γνωρίζουµε ότι τόσο η κωδική αλυσίδα του DNA όσο και το m-rna, είναι συµπληρωµατικά προς τη µεταγραφόµενη αλυσίδα του DNA, µε τη διαφορά ότι όπου στην κωδική αλυσίδα υπάρχει Τ στο m-rna υπάρχει U. Εφόσον το κωδικόνιο έναρξης του m-rna είναι το AUG µε κατεύθυνση 5 AUG 3, το αντίστοιχο κωδικόνιο στην κωδική αλυσίδα του DNA θα είναι το ATG και θα έχει κατεύθυνση 5 ATG 3. Επίσης, εφόσον τα κωδικόνια λήξης του m-rna είναι τα 5 UAG 3 ή 5 UGA 3 ή 5 UAA 3, τα αντίστοιχα κωδικόνια στην κωδική αλυσίδα του DNA θα είναι τα 5 ΤAG 3 ή 5 ΤGA 3 ή 5 ΤAA 3. Το γονίδιο ανήκει σε προκαρυωτικό κύτταρο συνεπώς δεν περιέχει.

4 Oι βάσεις ανάµεσα στο κωδικόνιο έναρξης και το κωδικόνιο λήξης, θα πρέπει να διαβάζονται ανά τριάδες ( κώδικας τριπλέτας ), συνεχόµενα χωρίς να παραλείπεται κάποιο νουκλεοτίδιο (συνεχής), καθώς κάθε νουκλεοτίδιο ανήκει σε µία µόνο τριπλέτα (µη επικαλυπτόµενος). Σε κάθε διπλή έλικα οι δύο αλυσίδες είναι αντιπαράλληλες άρα αν απέναντι από το 5 άκρο της κωδικής θα βρίσκεται το 3 άκρο της µη κωδικής αλυσίδας και αντίστροφα. Αλυσίδα 1 η : 5 GTTGAATTCTTAGCTTAAGTCGGGCATGAATTCTC 3 Αλυσίδα 2 η : 3 CAACTTAAGAATCGAATTCAGCCCGTACTTAAGAG 5 2. Με συνεχή τρόπο αντιγράφεται η 2 η αλυσίδα και µε ασυνεχή τρόπο η 1 η. Οι DΝΑ πολυµεράσες λειτουργούν µόνο προς καθορισµένη κατεύθυνση και τοποθετούν τα νουκλεοτίδια στο ελεύθερο 3' άκρο της δεοξυριβόζης του τελευταίου νουκλεοτιδίου κάθε αναπτυσσόµενης αλυσίδας, επιµηκύνοντας τα πρωταρχικά τµήµατα RNA. Έτσι, λέµε ότι αντιγραφή γίνεται µε προσανατολισµό 5' 3'. Κάθε νεοσυντιθέµενη αλυσίδα θα έχει προσανατολισµό 5' 3'. Έτσι, σε κάθε διπλή έλικα που παράγεται οι δύο αλυσίδες θα είναι αντιπαράλληλες. Για να ακολουθηθεί αυτός ο κανόνας σε κάθε τµήµα DΝΑ που γίνεται η αντιγραφή, η σύνθεση του DΝΑ είναι συνεχής στη µια αλυσίδα και ασυνεχής στην άλλη. Επειδή οι DNA πολυµεράσες, δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύµπλοκο που αποτελείται από πολλά ένζυµα, το πριµόσωµα, το οποίο συνθέτει στις θέσεις έναρξης της αντιγραφής µικρά τµήµατα RNA, συµπληρωµατικά προς τις µητρικές αλυσίδες, τα οποία ονοµάζονται πρωταρχικά τµήµατα. Αφού η αντιγραφή γίνεται µε φορά 5 3 και το πρωταρχικό τµήµα τοποθετείται στη θέση έναρξης της αντιγραφής, συνεπώς και αυτό θα έχει κατεύθυνση 5 3. Τα πρωταρχικά τµήµατα (i) και (ii) έχουν συµπληρωµατικές αλληλουχίες στην 1 η αλυσίδα ενώ στη 2 η αλυσίδα, υπάρχει µόνο µία συµπληρωµατική αλληλουχία πρωταρχικού τµήµατος (iii), έτσι συµπεραίνουµε ότι η 1 η αλυσίδα αντιγράφεται µε ασυνεχή και η 2 η αλυσίδα µε συνεχή τρόπο. ΕΞΕΤΑΣΕΙΣ 2014 Δίνεται τμήμα DNA το οποίο κωδικοποιεί τα οκτώ πρώτα αμινοξέα, του πρώτου δομικού γονιδίου του οπερονίου της λακτόζης. AGCTATGACCATGATTACGGATTCACTG TCGATACTGGTACTAATGCCTAAGTGAC αλυσίδα Ι αλυσίδα ΙΙ Δ1. Να εντοπίσετε τη κωδική αλυσίδα. (μονάδα 1) Να σημειώσετε τον προσανατολισμό των αλυσίδων. (μονάδα 1) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) Δ2. Να γράψετε το τμήμα του m-rna που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος του γονιδίου και να ορίσετε τα 5 και 3 άκρα του. (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 3) Δ3. Να γράψετε το τμήμα του mrna στο οποίο θα συνδεθεί η μικρή ριβοσωμική υπομονάδα κατά την έναρξη της μετάφρασης. Μονάδες 2 Δ1. Η κωδική αλυσίδα είναι η αλυσίδα I. Ο προσανατολισμός των αλυσίδων είναι ο παρακάτω: 5 AGCTATGACCATGATTACGGATTCACTG 3 αλυσίδα Ι. 3 TCGATACTGGTACTAATGCCTAAGTGAC 5 αλυσίδα ΙΙ Η μεταγραφή έχει προσανατολισμό 5' 3'. Tο m-rna που κωδικοποιεί τα 8 πρώτα αμινοξέα με προσανατολισμό 5' 3' θα έχει κωδικόνιο έναρξης, το ΑUG. Ο όρος κωδικόνιο δεν αφορά μόνο το m-rna αλλά και το γονίδιο από το οποίο παράγεται. Το κωδικόνιο έναρξης AUG αντιστοιχεί στο κωδικόνιο έναρξης της κωδικής αλυσίδα του γονιδίου ATG. Στο παραπάνω τμήμα DNA η αλυσίδα Ι που με προσανατολισμό 5' 3' έχει κωδικόνιο έναρξης ATG και ακολουθούν 7 κωδικόνια που κωδικοποιούν αμινοξέα, είναι η κωδική αλυσίδα. Δ2. Το μόριο RNA που συντίθεται και η κωδική αλυσίδα, είναι συμπληρωματικά και αντιπαράλληλα προς τη μη κω-δική αλυσίδα της διπλής έλικας του DNA του γονιδίου. Επομένως, το RNA θα έχει τον ίδιο προσανατολισμό με την κωδική αλυσίδα του DNA του γονιδίου και την ίδια αλληλουχία βάσεων, με τη διαφορά, ότι όπου υπάρχει Τ στο DNA, θα υπάρχει U στο RΝΑ. Το γονίδιο ανήκει σε προκαρυωτικό κύτταρο, άρα είναι συνεχές. Η αλληλουχία βάσεων του m-rna που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος του γονιδίου είναι η εξής: 5' AGCUAUGACCAUGAUUACGGAUUCACUG 3' Δ3. Κατά την έναρξη της μετάφρασης το m-rna προσδένεται μέσω μιας αλληλουχίας που υπάρχει στην 5' αμετάφραστη περιοχή του, με το ριβοσωμικό RNA της μικρής υπομονάδας του ριβοσώματος, σύμφωνα με τον κανόνα συμπληρωματικότητας των αζωτούχων βάσεων. Άρα, το τμήμα του m-rna στο οποίο θα συνδεθεί η μικρή ριβοσωμική υπομονάδα κατά την έναρξη της μετάφρασης, είναι η 5' αμετάφραστη περιοχή του, δηλαδή η αλληλουχία πριν το κωδικόνιο έναρξης που είναι η 5' AGCU 3'.

5 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2015 Στην εικόνα 2 απεικονίζεται ένα ασυνεχές γονίδιο ανθρώπινου ηπατικού κυττάρου. Το γονίδιο αυτό είναι υπευθύνο για την παραγωγή του ολιγοπεπτιδίου της εικόνας 3. Δ1. Να εντοπίσετε και να γράψετε την αλληλουχία βάσεων του εσωνίου του γονιδίου της εικόνας 2 (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Δ2. Να γράψετε το πρόδρομο μόριο του m-rna που δημιουργείται από την μεταγραφή του γονιδίου της εικόνας 2 (μονάδα 1). Να γράψετε το ώριμο m-rna που προκύπτει από τη διαδικασία της ωρίμανσης (μονάδες 2). Δίνονται : Κωδικόνια 5 UGG 3 5 CCC 3 5 UGC 3 5 AAG 3 5 UAC 3 Αμινοξέα trp pro cys lys tyr Δ1 Το κάθε πεπτίδιο που δημιουργείται έχει σαν πρώτο αμινοξύ την μεθειονίνη, η οποία όμως στη συνέχεια απόκόπτεται κατά κανόνα, από το πεπτίδιο. Η μεθειονίνη έχει ελεύθερο αμινικό άκρο και το τελευταίο αμινοξύ του πεπτιδίου ελεύθερο καρβοξύλιο. Αν απομακρυνθεί η μεθειονίνη (ενδεχομένως και άλλα αμινοξέα) τότε ελεύθερο αμινικό άκρο θα έχει το πρώτο από τα αμινοξέα που θα μείνουν. Συνεπώς, με βάση την εικόνα 3, το πρώτο αμινοξύ του πεπτιδίου που συντέθηκε και έχει μείνει στο πεπτίδιο είναι η τρυπτοφάνη και τελευταίο η κυστεΐνη. Σύμφωνα με τα παραπάνω τα κωδικόνια του ώριμου mrna που κωδικοποιούν το συγκεκριμένο πεπτίδιο είναι τα εξής: 5' UGG AAG CCC UAC UGC 3' Η κωδική αλυσίδα του DNA και το m-rna είναι συµπληρωµατικά προς τη µεταγραφόµενη αλυσίδα του DNA, µε τη διαφορά ότι, όπου στην κωδική αλυσίδα υπάρχει Τ στο m-rna υπάρχει U. Επιπλέον, η κωδική αλυσίδα του DNA και το m-rna είναι αντιπαράλληλες προς τη µεταγραφόµενη αλυσίδα του DNA. Με βάση αυτά, στο συγκεκριμένο γονίδιο τα παραπάνω κωδικόνια αντιστοιχούν στο τμήμα: 3' ACC TTC GGG ATG ACG 5' (μη κωδική αλυσίδα) 5' ΤGG AAG CCC ΤAC ΤGC 3' (κωδική αλυσίδα) Συγκρίνοντας το παραπάνω τμήμα με αυτό που μας δίνεται στην εκφώνηση, διαπιστώνουμε ότι στο γονίδιο αποτελεί το τμήμα: 5' AGAATTG 3' 3' TCTTAAC 5' Δ2 Το πρόδρομο mrna που προκύπτει από τη μεταγραφή του συγκεκριμένου γονιδίου είναι το εξής: 5' AGAUGUGGAAG C AGAAUUG CCUACUGCUGAGC 3' Το ώριμο mrna που προκύπτει μετά την αφαίρεση του εσωνίου είναι το εξής: 5' AGAUGUGGAAGCCCUACUGCUGAGC 3' Κωδικόνιο έναρξης Κωδικόνιο λήξης ΕΞΕΤΑΣΕΙΣ 2016 Στην εικόνα 2, το τμήμα του DNA περιλαμβάνει ασυνεχές γονίδιο ευκαρυωτικού κυττάρου, που κωδικοποιεί μικρό πεπτίδιο. Μέσα στην αγκύλη, φαίνεται η αλληλουχία της αμετάφραστης περιοχής, που ενώνεται με το r-rna της μικρής υπομονάδας του ριβοσώματος. Τα t-rnas που χρησιμοποιήθηκαν κατά σειρά στην παραγωγή του πεπτιδίου, είχαν τα αντικωδικώνια 5 CAU 3, 5 CCA 3, 5 AAA 3, 5 AGG 3, 5 CAU 3, 5 CCA 3, 5 AAC 3. Δ1. Να σημειώσετε ποια από τις αλυσίδες Α ή Β είναι η κωδική αλυσίδα του γονιδίου (μονάδες 3). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Να χαρακτηρίσετε ως 5 ή 3 τα άκρα στα σημεία I, II, III, IV (μονάδες 2). Δ2. Να γράψετε τo που υπάρχει στο παραπάνω γονίδιο. Μονάδα 1 Δ3. Να γράψετε, την αλληλουχία των βάσεων του m-rna, που θα χρησιμοποιηθεί κατά τη μετάφραση της πληροφορίας του γονιδίου της εικόνας 2.

6 Δ4. Στην εικόνα 3, η αλληλουχία είναι τμήμα του γονιδίου που μεταγράφεται στο r-rna της μικρής υπομονάδας του ριβοσώματος, που χρησιμοποιείται στη μετάφραση του ευκαρυωτικού γονιδίου της εικόνας 2 Ποια είναι η μεταγραφόμενη αλυσίδα του γονιδίου που μεταγράφεται στο r-rna; (μονάδα 1) Να γραφεί ο προσανατολισμός της (μονάδα 1). Να αιτιολογήσετε τις απαντήσεις σας (μονάδες 2). Δ1. Διαπίστωση : Σύμφωνα με την εκφώνηση, το κύτταρο είναι ευκαρυωτικό και το ασυνεχές γονίδιο, κωδικοποιεί πεπτίδιο συνεπώς κατά τη μεταγραφή παράγεται πρόδρομο m-rna που υφίσταται ωρίμανση. Σχέση κωδικής αλυσίδας πρόδρομου m-rνα. Οι αλυσίδες Α και Β ( κωδική και μη κωδική ) του DNA, είναι συμπληρωματικές και αντιπαράλληλες. Το πρόδρομο m-rna που παράγεται από την μεταγραφή του γονιδίου, είναι συμπληρωματικό και αντιπαράλληλο, της μη κωδικής αλυσίδας. Συνεπώς, η κωδική αλυσίδα και το πρόδρομο m-rna θα έχουν τον ίδιο προσανατολισμό και την ίδια αλληλουχία βάσεων, με τη διαφορά ότι στο m-rna αντί της θυμίνης (Τ) θα υπάρχει ουρακίλη (U). (μονάδα 1) To άκρο 5 της κωδικής αλυσίδας βρίσκεται αριστερά Η μικρή υπομονάδα του ριβοσώματος, συνδέεται στην 5 αμετάφραστη περιοχή, του ώριμου m-rna. Επομένως στην εικόνα 2, τo άκρο 5 της κωδικής αλυσίδας βρίσκεται αριστερά. (μονάδα 1) Ποια αλυσίδα έχει κωδικόνιο έναρξης κωδικόνιο λήξης Στο ώριμο m-rna θα έχει κωδικόνιο έναρξης (AUG) και ένα από τα κωδικόνια λήξης (UAA, UGA, UAG), συνεπώς η κωδική αλυσίδα θα έχει αντίστοιχα ως κωδικόνιο έναρξης το ATG και ως κωδικόνιο λήξης ένα από τα : ΤAA, ΤGA, ΤAG. Ακόμα το ώριμο m-rna πρέπει να περιέχει 7 κωδικόνια ( όσα και τα αντικωδικόνια ). Ελέγχοντας την αλυσίδα Β με κατεύθυνση από αριστερά προς τα δεξιά δεν βρίσκουμε τίποτα από τα παραπάνω. Αντίθετα η αλυσίδα Α κατά την ίδια κατεύθυνση έχει το κωδικόνιο ΑΤG (δύο φορές) και τα TAG και ΤΑΑ. [ACAGT ] ATG TGAATCATAGTTTCCTATGTGGGTT TAA GCAT (μονάδες 2) Επομένως κωδική αλυσίδα είναι η Α και μη κωδική η Β. (μονάδες 3) Σχόλιο Δεν είναι απαραίτητο, ο αριθμός των νουκλεοτιδίων μεταξύ κωδικονίου έναρξης και κωδικονίου λήξης, να είναι πολλαπλάσιο του 3, δεδομένου ότι υπάρχει και. Επειδή υπάρχουν 6 κωδικόνια μεταξύ κωδικονίου έναρξης και κωδικονίου λήξης, το πρώτο ΑΤG είναι κωδικόνιο έναρξης και το ΤΑΑ κωδικόνιο λήξης. Τα σημεία I και ΙV είναι τα άκρα 5, ενώ τα ΙΙ και ΙΙΙ τα άκρα 3 (επειδή οι δύο αλυσίδες είναι αντιπαράλληλες). (μονάδες 2) Τα t-rnas που χρησιμοποιήθηκαν κατά σειρά, στην παραγωγή του πεπτιδίου, είχαν τα αντικωδικώνια : 5 CAU 3, 5 CCA 3, 5 AAA 3, 5 AGG 3, 5 CAU 3, 5 CCA 3, 5 AAC 3. Επειδή τα αντικωδικόνια αυτά, είναι συμπληρωματικά και αντιπαράλληλα, των κωδικονίων του ώριμου m-rna που μεταφράσθηκαν συμπεραίνουμε ότι το τμήμα του ώριμου m-rna που μεταφράσθηκε είναι: 5 AUGUGGUUUCCUAUGUGGGUU λήξη 3. Τα κωδικόνια της κωδικής που κωδικοποιούν το πεπτίδιο είναι: 5 ATGTGGTTTCCTATGTGGGTT λήξη 3. Συγκρίνοντας το παραπάνω τμήμα, με το μόριο DNA βρίσκω ότι το τμήμα περιέχεται στην αλυσίδα Α 5 ATG TGAATCATAGTTTCCTATGTGGGTT 3 που είναι η κωδική και προφανώς το μη υπογραμμισμένο τμήμα είναι το. Δ2. Το που υπάρχει στο γονίδιο είναι : 5' AATCATA 3' 3' TTAGTAT 5' Δ 3. Το mrna που θα χρησιμοποιηθεί κατά τη μετάφραση της πληροφορίας του γονιδίου, υπολογίζοντας και τη 5 αμετάφραστη περιοχή είναι: 5 ACAGU AUGUGGUUUCCUAUGUGGGUUUAAGCAU 3 Δ4. Η μεταγραφόμενη αλυσίδα του γονιδίου που μεταγράφεται στο rrna είναι η Γ. Ο προσανατολισμός της είναι 5 ACAGT 3. Το r-rna της μικρής υπομονάδας του ριβοσώματος είναι συμπληρωματικό και αντιπαράλληλο με την 5 αμετάφραστη περιοχή του mrna. Άρα το rrna θα έχει προσανατολισμό 3 UGUCA 5. Το rrna είναι συμπληρωματικό και αντιπαράλληλο με τη μεταγραφόμενη αλυσίδα του γονιδίου, που την παράγει. Άρα μεταγραφόμενη αλυσίδα είναι η 5 ACAGT 3.

7 ΕΠΑΝΑΛΗΠΤΙΚΕΣ 2016 ΘΕΜΑ Γ Γ3. Στην Εικόνα 1 δίνεται ένα τμήμα δίκλωνου DNA που περιέχει δύο ( 2 ) γονίδια (χωρίς εσώνια) τα οποία έχουν την πληροφορία για τη σύνθεση δύο (2) μικρών πεπτιδίων. TATGCAATGGTACACCCATATATGGAGTACCAGCATTCTTGG Γ ATACGTTACCATGTGGGTATATACCTCATGGTCGTAAGAACC Εικόνα 1 i) Να γράψετε, την αλληλουχία των βάσεων της κωδικής αλυσίδας αυτών των γονιδίων, οι οποίες αντιστοιχούν στις 5 αμετάφραστες περιοχές των μορίων m-rna τα οποία προκύπτουν, από την μεταγραφή αυτών των γονιδίων. Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) ii) Να δηλώσετε σε ποια από τις θέσεις Γ, Δ της Εικόνας 1, θα προσδεθεί η RNA πολυμεράση, με τη βοήθεια μεταγραφικών παραγόντων κατά τη μεταγραφή της γενετικής πληροφορίας αυτών των γονιδίων (μονάδες 2) και να αιτιολογήσετε τις επιλογές σας. (μονάδες 2) i) Εφόσον το τμήμα που δίνεται κωδικοποιεί το σύνολο της γενετικής πληροφορίας του γονιδίου, θα πρέπει, διαβάζοντας τον κωδικό κλώνο με κατεύθυνση 5 3 να ανιχνεύουμε την τριπλέτα 5 - ΑTG -3 απέναντι από την αντίστοιχη τριπλέτα 3 ΤΑC 5 μεταγραφόμενου κλώνου η οποία θα μεταγραφεί στο κωδικόνιο έναρξης 5 ΑUG 3 του ώριμου m-rna που κωδικοποιεί το αμινοξ ύ μεθειονίνη. Eπιπλέον, με βήμα τριπλέτας από την τριπλέτα 5 ΑTG 3, θα πρέπει να συναντούμε και κάποια από τις τριπλέτες 5 ΤGA 3, 5 -TAG 3, 5 TAA 3, απέναντι από τις συμπληρωματικές τους 3 ΑCT 5, 5 ATC 3, 5 ATT 3 στη μεταγραφόμενη μη κωδική αλυσίδα, οι οποίες θα μεταγραφούν σε ένα από τα κωδικόνια λήξης της μετάφρασης 5 UGA 3, 5 UAG 3 ή 5 UAA 3 αντίστοιχα. Επειδή δεν γνωρίζουμε τα άκρα της αλληλουχίας, θα πρέπει να ψάξουμε για τις αλληλουχίες αυτές και στις δύο αλυσίδες και με τις δύο πιθανές φορές, ώστε να βρούμε, σε ποια περίπτωση άκρων ανιχνεύονται οι κωδικές άλληλουχίες και των δύο γονιδίων. Έτσι προκύπτει ότι οι κωδικές αλυσίδες των δυο γονιδίων θα είναι: 1: 5 -ΑΤΑCGTTACC -ATG -TGG -GTA -TAT -ACC -TCA -TGG -TCG -TAA -GAACC -3 και 2: 5 -GGTTCTTACGACC -ATG -AGG -TAT -ATA -CCC -ACA -TGG -TAA -CGTAT -3 Η 5 αμετάφραστη περιοχή της κωδικής αλυσίδας του κάθε γονιδίου θα αποτελεί την αλληλουχία από το 5 άκρο της κωδικής αλυσίδας, μέχρι αμέσως πριν την τριπλέτα 5 ΑΤG 3 που αντιστοιχεί στο m-rna, στο κωδικόνιο έναρξης 5 - ΑUG -3 και σηματοδοτεί την αρχή της κωδικής περιοχής, των εξωνίων δηλαδή του ώριμου m-rna. Έτσι για το κάθε γονίδιο θα είναι: Γονίδιο 1: 5 -ΑΤΑCGTTACC-3 Γονίδιο 2: 5 - GGTTCTTACGACC-3 ii) H RNA πολυμεράση πραγματοποιεί την μεταγραφή του μεταγραφόμενου, μη κωδικού κλώνου του γονιδίου με κατεύθυνση 5 3 στο παραγόμενα m-rna. Εφόσον το m-rna, είναι συμπληρωματικό και αντιπαράλληλο με τον μεταγραφόμενο κλώνο η RNA πολυμεράση προσδένεται με τη βοήθεια μεταγραφικών παραγόντων στον υποκινητή του γονιδίου ο οποίος εντοπίζεται στο 3 άκρο, του μεταγραφόμενου κλώνου. Με βάση τις κωδικές αλυσίδες που ταυτοποιήθηκαν και γράφηκαν παραπάνω, τα άκρα της δοθείσας αλληλουχίας θα είναι: 3 -TATGCAATGGTA CCAGCATTCTTGG-5 ( Κλώνος1 ) 5 -ATACGTTACC GTCGTAAGAACC-3 ( Κλώνος 2 ) Ο κλώνος 2, θα είναι ο κωδικός κλώνος του γονιδίου 1, ενώ ο κλώνος 1, ο κωδικός κλώνος του γονιδίου 2. Αντίστοιχα, ο κλώνος 1, θα είναι ο μεταγραφόμενος κλώνος του γονιδίου 1 και ο κλώνος 2, ο μεταγραφόμενος κλώνος του γονιδίου 2. Έτσι, για τη μεταγραφή του γονιδίου 1, η RNA πολυμεράση θα πρέπει να προσδεθεί στο 3 άκρο του κλώνου 1, δηλαδή στη θέση Γ, ενώ για τη μεταγραφή του γονιδίου 2 στο 3 άκρο του κλώνου 2, δηλαδή στη θέση Δ. Δ


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα


BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα



Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΟΜΑΔΑ Α 1. Μόριο DΝΑ αποτελείται από 8.000 αζωτούχες βάσεις με 14 Ν. Το μόριο μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφεται δύο φορές.

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα


Διαβάστε περισσότερα

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών Φ ρ ο ν τ ι σ τ ή ρ ι α δ υ α δ ι κ ό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Θ Ε Μ Α Α Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς 2 0 1 6 Βιολογία Γ λυκείου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 15 Ιουνίου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Επαναληπτικών Πανελλαδικών Εξετάσεων Εσπερινών Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Α Α.1 β Α.2 γ Α.3 δ Α.4 α Α.5

Διαβάστε περισσότερα

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών.

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. (σελ. 24) Κάθε φυσιολογικό μεταφασικό... τον καρυότυπο. Δύο συμπεράσματα που μπορούν να

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Θέμα A A1: β A2: β A3: γ A4: β A5: α. Θέμα Β Β1. ΠΝΤΗΣΕΙΣ ΜΘΗΜ: ΙΟΛΟΓΙ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Θέμα A A1: β A2: β A3: γ A4: β A5: α Θέμα 1. Για να εκφράζονται και τα δυο αλληλόμορφα σε ετερόζυγα άτομα, τα γονίδια αυτά θα πρέπει να έχουν μεταξύ τους σχέση ατελών

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 15 Ιουνίου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Επαναληπτικών Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Α Α.1 β Α.2 γ Α.3 γ Α.4 α Α.5

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) Σχόλια Τα θέματα καλύπτουν το μεγαλύτερο μέρος της ύλης που εξεταζόταν. Απαιτούσαν πολύ καλή κατανόηση της θεωρίας και αρκετό χρόνο για την επίλυση των ασκήσεων. Στο ερώτημα Γ1 υπήρχε ασάφεια στο ζητούμενο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή στη

Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή στη ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα


ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. σελ. 24 σχ. βιβλίου «Κάθε φυσιολογικό μεταφασικό χρωμόσωμα...η απεικόνιση αυτή αποτελεί τον καρυότυπο». «Ο αριθμός και η μορφολογία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 8 ΜΑΪΟΥ 2 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α. α Α2. δ Α3 γ Α4 β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Δ Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ 27/05/2016 ΘΕΜΑ Α Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Δ Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 6 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ 27/05/2016 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής. 1. Ο πρώτος νόμος του Mendel περιγράφει: α. τον ελεύθερο συνδυασμό των

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική t-rna που να αντιστοιχούν σε αυτά. ( ) 2.5.45. Η μετακίνηση των ριβοσωμάτων στο mrna γίνεται προς το 3 άκρο του mrna. ( ) 2.5.46. Πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. ( ) 2.5.47.

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού (Παλαιό και νέο σύστημα)

Βιολογία Προσανατολισμού (Παλαιό και νέο σύστημα) ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Βιολογία Προσανατολισμού (Παλαιό και νέο σύστημα) 27-5-2016 Β1. 1: Α 2: Γ 3: Α 4: Β 5: Α 6: Α 7: Γ Β2. Σελ 20: «Τα μεταφασικά χρωμοσώματα κάθε είδους.» Συμπεράσματα:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα