ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)"

Transcript

1 ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή»

2 ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΒΙΟΧΗΜΕΙΑΣ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ Τεχνικές μελέτης γονιδιακής έκφρασης: Real- Time PCR Νικόλαος Μπαλατσός

3 Το κεντρικό δόγμα Πυρήνας DNA AAAAAAAAΑΑΑ mrna ΠρωτεΪνη Κυτταρόπλασμα

4 PCR σε πραγματικό χρόνο ή Real- Time PCR

5 PCR, Polymerase Chain Reacdon Primers d. NTPs Thermal Stable DNA Polymerase Add to Reaction Tube Annealing Denaturation h"p:// %2F2007%2F8_real:me_pcr ppt&ei=EHtsU9m6De_Q7AaFh4GADw&usg=AFQjCNEkOX8tuLk1BSIvRDu1AyrrPIRr6g&sig2=l_- - zwd8qoluujvqhsrkvg&bvm=bv ,d.bgq

6 PCR, Polymerase Chain Reacdon Extension Taq Taq Extension Continued Taq Taq Repeat

7 Amplicon το προϊόν της PCR Τμήμα DNA ή RNA εκμαγείο ή προϊόν αντίδρασης ενίσχυσης ή αντιγραφής συνήθως, ο όρος χρησιμοποιείται αδιακρίτως ως «προϊόν PCR», ή PCR product. h"p://en.wikipedia.org/wiki/file:amplicon.png

8 PCR, Polymerase Chain Reacdon Cycle 2 4 Copies Cycle 3 8 Copies

9 8

10 PCR, θεωρητικός και πειραματικός διπλασιασμός Γραμμική απεικόνιση

11 PCR, θεωρητικός και πειραματικός διπλασιασμός Λογαριθμική απεικόνιση

12 11

13 Διάγραμμα φάσεων μιας PCR Fraga et al 2008 Curr Prot Essent Techniques

14 PCR Real Time PCR Η Real- Time PCR 1. μετρά την ποσότητα των προϊόντων (amplicons) σε κάθε κύκλο της ενίσχυσης μετρώντας ένταση φθορισμού 2. Μετρά την παραγωγή προϊόντων (amplicons) κατά την εκθετική φάση (expotenbal phase) σε αντίθεση με την απλή PCR που μετρά το προϊόν στο τέλος της αντίδρασης

15 PCR Real Time PCR

16 Real Time PCR 1. Δείγμα RNA υψηλής ποιότητας και καθαρότητας 2. Μετατροπή RNA σε cdna 3. Ευαίσθητη και ακριβής ανίχνευση προϊόντων PCR σε πραγματικό χρόνο

17 Real Time PCR 1 ο ΒΗΜΑ: σύνθεση cdna από δείγμα RNA απομόνωση RNA σύνθεση cdna από RNA 2 ο ΒΗΜΑ: βελτίωση συνθηκών για ανάλυση σε πραγματικό χρόνο σχεδιασμός εκκινητών θερμοκρασία υβριδισμού (annealing temperature) συγκέντρωση εκκινητών συγκέντρωση [Mg 2+ ] και εκμαγείων 3 ο ΒΗΜΑ: Ανίχνευση προϊόντων PCR από τον κυκλοποιητή Φθορίζουσες χρωστικές για παρακολούθηση της αντίδρασης Μη ειδικοί φθορίζοντες ιχνηθέτες Ειδικοί (συμπληρωματικοί) φθορίζοντες ιχνηθέτες Ανάλυση θ/σιών αποδιάταξης (melbng points) για ειδική ενίσχυση 4 ο ΒΗΜΑ: Ανάλυση και ποσοτικοποίηση Real Time- PCR

18 PCR Real Time PCR

19 1 ο βήμα: σύνθεση cdna από RNA Fraga et al 2008 Curr Prot Essent Techniques

20 Σχεδιασμός εκκινητών Real Time PCR Fraga et al 2008 Curr Prot Essent Techniques

21 Φθορίζουσες χρωστικές, SYBR Green I Μετά τον πολυμερισμό, η χρωστική (SYBR Green) δένεται στο DNA και φθορίζει absorbs blue light (λ max = 497 nm) emits green light (λ max = 520 nm) SYBR family Molecular Probes,Inc., (Life Technologies Corpora:on) h"p://

22 PCR Real Time PCR Η ενταση του φθορισμού αυξάνει φορές όταν δεθεί στη μικρή αύλακα του DNA Fraga et al 2008 Curr Prot Essent Techniques

23 Συμπληρωματικά ειδικοί φθορίζοντες ιχνηθέτες: (strand- specific probes) TaqMan Fraga et al 2008 Curr Prot Essent Techniques

24 Real Time PCR Ποιοτικός έλεγχος μάρτυρες (controls) Αρνητικοί μάρτυρες 1. Δείγμα χωρίς εκμαγείο 2. Δείγμα χωρίς αντίστροφη μεταγραφάση Θετικοί μάρτυρες 1. DNA (γνωστό δείγμα με την αλληλουχία στόχο) 2. RNA (γνωστό δείγμα με την αλληλουχία στόχο)

25 C T Κατώφλι ανίχνευσης, cycle threshold Το επίπεδο σήματος του φθορισμού που είναι ικανοποιητικά πάνω από το θόρυβο ώστε να θεωρηθεί αξιόπιστο Δίνει το μέτρο σύγκρισης μεταξύ διαφορετικών δειγμάτων

26 PCR Real Time PCR Αντίδραση PCR, κύκλος 25

27 PCR Real Time PCR Κύκλος 25 Νουκλεοτίδια, εκκινητές, υποστρώματα Πολυμεράση, amplicons, κλπ. 1,000,000 αντίγραφα amplicon Ας υποθέσουμε πως τα amplicons είναι η ελάχιστη ποσότητα που ανιχνεύεται ικανοποιητικά, χωρίς θόρυβο

28 PCR Real Time PCR Κύκλος 24; Περίπου τα ίδια, με αντίγραφα του amplicon. Κύκλος 23; Περίπου τα ίδια, με αντίγραφα του amplicon. Κύκλος 22; Περίπου τα ίδια, με αντίγραφα του amplicon.

29 PCR Real Time PCR Απεικόνιση ποσότητας DNA στο σωλήνα µέχρι τον κύκλο 25 Ποσότητα DNA Κύκλοι ενίσχυσης

30 PCR Real Time PCR ; Κύκλος 26; Ποσότητα DNA Κύκλοι ενίσχυσης

31 PCR Real Time PCR Μετά τον κύκλο 26; amplicons. Κύκλος 27; amplicons. Κύκλος 200; ( amplicons

32 PCR Real Time PCR Μετά τον κύκλο 25 Ποσότητα DNA Κύκλοι ενίσχυσης

33 PCR Real Time PCR Αν ξεκινήσω με 4πλάσιο DNA ( 4)... Κύκλος ΠΡΙΝ DNA

34 PCR Real Time PCR...φτάνω στο amplicons δύο κύκλους νωρίτερα Κύκλος ΠΡΙΝ DNA Ποσότητα DNA Κύκλοι ενίσχυσης

35 PCR Real Time PCR Αν ξεκινήσω με 1/8 DNA (DNA/8)... Φτάνουμε το amplicons 3 κύκλους αργότερα Κύκλος ΠΡΙΝ DNΑ/ Ποσότητα DNA Κύκλοι ενίσχυσης

36 C T Οι καμπύλες των προϊόντων τέμνουν ένα (αυθαίρετο) κατώφλι. Αυτό το κατώφλι είναι το C T Οι τιμές C T σχετίζονται άμεσα με την αρχική ποσότητα DNA: Ποσότητα DNA = 2 C T C Τ

37

38 Ποσότητα DNA C T Γραμμική απεικόνιση

39 Ποσότητα DNA C T Λογαριθμική απεικόνιση

40 h"ps://

POLYMERASE CHAIN REACTION (PCR) ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΤΗΣ ΠΟΛΥΜΕΡΑΣΗΣ

POLYMERASE CHAIN REACTION (PCR) ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΤΗΣ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΤΗΣ ΠΟΛΥΜΕΡΑΣΗΣ Kary Mullis (Nobel Χημείας, 1993) in vitro τεχνική ( molecular photocopying ) Εφαρμογή σε όλους τους τομείς της Βιολογίας Στις περισσότερες

Διαβάστε περισσότερα

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc Εισαγωγή στη Real Time PCR Καραπέτσας Θανάσης PhD, MSc Μειονεκτήματα της κλασικής PCR Ανάλυση ύστερα από ηλεκτροφόρηση(συνήθως αγαρόζης) Τεχνική τελικού σημείου(end-point detection), Σύγκριση της έντασης

Διαβάστε περισσότερα

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR)

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) Α. ΘΕΩΡΗΤΙΚΟ ΜΕΡΟΣ Σταμάτης Κουσίσης, Δημοσθένης Κίζης, Δήμητρα Χούχουλα Βασική αρχή της Αλυσιδωτής Αντίδρασης της Πολυμεράσης

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Department of Biochemistry

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

PCR Εφαρμογές-2. RACE Site directed mutagenesis

PCR Εφαρμογές-2. RACE Site directed mutagenesis PCR Εφαρμογές-2 RACE Site directed mutagenesis Σκοπός της αντίδρασης PCR (Polymerase Chain Reaction) είναι το να φτιάξει ένα μεγάλο αριθμό αντιγράφων. BHMATA 1. ΑΠΟΔΙΑΤΑΞΗ 2. ΥΒΡΙΔΙΣΜΟΣ 3. ΕΠΙΜΗΚΥΝΣΗ Επειδή

Διαβάστε περισσότερα

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

Βιολογία. Θετικής Κατεύθυνσης

Βιολογία. Θετικής Κατεύθυνσης Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 4ο ΤΕΧΝΟΛΟΓΊΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΈΝΟΥ DNA Γενετική Μηχανική 3 Είναι ο κλάδος της Βιολογίας που περιλαμβάνει τις τεχνικές με τις οποίες ο άνθρωπος επεμβαίνει στο γενετικό

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Η ΧΡΗΣΗ ΤΗΣ REAL TIME PCR (RT- PCR) ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΩΝ ΣΤΕΛΕΧΩΝ ΒΑΚΤΗΡΙΟΥ

Διαβάστε περισσότερα

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ 1 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Ηράκλειο, 10.06.013 Αρ. πρωτ. 4868 Ο Ειδικός Λογαριασμός του Πανεπιστημίου Κρήτης

Διαβάστε περισσότερα

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Τεχνικές Μοριακής Ενδοκρινολογίας Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Εισαγωγή σε μεταβολικά νοσήματα της Παιδιατρικής

Διαβάστε περισσότερα

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Γενετική Βακτηρίων Κατανόηση μηχανισμών λειτουργίας ευκαρυωτικών κυττάρων Ταξινόμηση βακτηρίων Διάγνωση λοιμωδών νοσημάτων Επιδημιολογική μελέτη

Διαβάστε περισσότερα

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ - - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα

Πρόχειρος διαγωνισμός για την προμήθεια

Πρόχειρος διαγωνισμός για την προμήθεια ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΕΠΙΤΡΟΠΗ ΕΡΕΥΝΩΝ 26504 ΡΙΟ ΠΑΤΡΩΝ Τηλ. 2610/996660 Fax 2610/996677 http://research.upatras.gr Πάτρα, 05./07./13 Πρόχειρος διαγωνισμός για την προμήθεια ΣΥΣΤΗΜΑΤΟΣ

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η Συμβολή της Μοριακής Βιολογίας

Διαβάστε περισσότερα

PCR quantitative PCR (qpcr)

PCR quantitative PCR (qpcr) PCR quantitative PCR (qpcr) Ε. Λιανίδου, Ph.D. Καθηγήτρια Εργαστήριο Αναλυτικής Χημείας, Τμήμα Χημείας, Πανεπιστήμιο Αθηνών lianidou@chem.uoa.gr DNA A:T (2 δεσμοί Η), C:G (3δεσμοί Η) Αλυσιδωτή αντίδραση

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (2/2), 2ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

Σύντομη Περιγραφή Συνολικής Προόδου Φυσικού Αντικειμένου από την έναρξη του έργου μέχρι τις 30/06/2015

Σύντομη Περιγραφή Συνολικής Προόδου Φυσικού Αντικειμένου από την έναρξη του έργου μέχρι τις 30/06/2015 Σύντομη Περιγραφή Συνολικής Προόδου Φυσικού Αντικειμένου από την έναρξη του έργου μέχρι τις 30/06/2015 Δ1: Συντονισμός του έργου. Προκηρύξεις και επιλογή εξωτερικών επιστημονικών συνεργατών. Ολοκλήρωση

Διαβάστε περισσότερα

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 2 Θεωρία (4 Ο Κεφάλαιο) 3 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 1 2 3 ΚΛΩΝΟΠΟΙΗΣΗ 4 5 6 ορισμός:

Διαβάστε περισσότερα

Αλυσιδωτή αντίδραση πολυμεράσης

Αλυσιδωτή αντίδραση πολυμεράσης Κεφάλαιο 7 Αλυσιδωτή αντίδραση πολυμεράσης Δ. Παλαιολόγου, Ε. Κατσαρέλη και Γ. Παπανικολάου Περίληψη Η αλυσιδωτή αντίδραση πολυμεράσης είναι η μέθοδος που έφερε πραγματική επανάσταση στη μοριακή βιολογία

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Θέση περιορισμού συμμετρική ως προς τον άξονα που περνά από το μέσο της. Στην εικόνα φαίνεται η θέση αναγνώρισης της EcoRI RI. Η αλληλουχία είναι παλίνδρο- μη: είναι

Διαβάστε περισσότερα

Εγχειρίδιο κιτ ipsogen BCR-ABL1 Mbcr

Εγχειρίδιο κιτ ipsogen BCR-ABL1 Mbcr Μαρτιος 2015 Εγχειρίδιο κιτ ipsogen BCR-ABL1 Mbcr Έκδοση 1 24 Ποσοτική in vitro διάγνωση Για χρήση με τα όργανα Rotor-Gene Q, ABI PRISM, LightCycler και SmartCycler 670123 QIAGEN GmbH, QIAGEN Strasse 1,

Διαβάστε περισσότερα

Κεφάλαιο 4: Ανασυνδυασμένο DNA

Κεφάλαιο 4: Ανασυνδυασμένο DNA Κεφάλαιο 4: Ανασυνδυασμένο DNA 1. Η ανάπτυξη της γενετικής μηχανικής επέτρεψε: α. την κατανόηση των μηχανισμών αντιγραφής του γενετικού υλικού β. την απομόνωση των πλασμιδίων από τα βακτήρια γ. την πραγματοποίηση

Διαβάστε περισσότερα

ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR)

ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) Σκοπός της άσκησης Η εκμάθηση των βασικών σταδίων και συστατικών

Διαβάστε περισσότερα

Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ

Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ DNA ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Τεχνολογία ανασυνδυαζόμενου DNA ή Γενετική Μηχανική Κατασκευή τεχνητών μορίων DNA (ανασυνδυασμένο DNA) Τροποποίηση γονιδιωμάτων Μεταφορά γονιδίου/ων

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

EΘΝΙΚΟN ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟN ΠΑΝΕΠΙΣΤΗΜΙΟN ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ ΓΡΑΜΜΑΤΕΙΑ ΕΠΙΤΡΟΠΗΣ ΕΡΕΥΝΩΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ

EΘΝΙΚΟN ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟN ΠΑΝΕΠΙΣΤΗΜΙΟN ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ ΓΡΑΜΜΑΤΕΙΑ ΕΠΙΤΡΟΠΗΣ ΕΡΕΥΝΩΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ EΘΝΙΚΟN ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟN ΠΑΝΕΠΙΣΤΗΜΙΟN ΑΘΗΝΩΝ Έχοντας υπόψη ότι : ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ ΓΡΑΜΜΑΤΕΙΑ ΕΠΙΤΡΟΠΗΣ ΕΡΕΥΝΩΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ Πρόσκληση εκδήλωσης ενδιαφέροντος 15221/2013

Διαβάστε περισσότερα

Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών

Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών Ζώων για Παραγωγή Προϊόντων Ποιότητας» 1 Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών Ζώων για Παραγωγή Προϊόντων Ποιότητας Γεωπονικό Πανεπιστήμιο Αθηνών Εργαστήριο Ζωοτεχνίας MIS 380231

Διαβάστε περισσότερα

Φύλλο πρωτοκόλλου QIAsymphony RGQ

Φύλλο πρωτοκόλλου QIAsymphony RGQ Φύλλο πρωτοκόλλου QIAsymphony RGQ Ρυθμίσεις για την εκτέλεση των κιτ artus QS- RGQ (λογισμικό Rotor-Gene Q 2.1 ή μεταγενέστερο) artus BK Virus QS-RGQ Kit Έκδοση 1, 4514363 artus CMV QS-RGQ Kit Έκδοση 1,

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

Βασικές Αρχές Μοριακής Βιολογίας

Βασικές Αρχές Μοριακής Βιολογίας Βασικές Αρχές Μοριακής Βιολογίας Χριστίνα Κοτταρίδη, Βιολόγος, MSc, PhD Εργαστήριο Διαγνωστικής Κυτταρολογίας, ΠΓΝ ATTIKON Εκπαιδευτικό Πρόγραμμα, Α εξάμηνο 28 Απριλίου 2014 Το Κυτταρολογικό εργαστήριο

Διαβάστε περισσότερα

DNA MICROARRAYS. Σελίδα 1 ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Τ. Θηραίου

DNA MICROARRAYS. Σελίδα 1 ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Τ. Θηραίου DNA MICROARRAYS Σελίδα 1 Μελέτη του γονιδιώματος Ποια είναι τα γονίδια και που βρίσκονται; Ποιοι μηχανισμοί ρυθμίζουν την έκφραση κάθε γονιδίου; Σε τι επίπεδα εκφράζονται τα γονίδια υπό διαφορετικές συνθήκες;

Διαβάστε περισσότερα

5 GTG CAC CTG ACT CCT GAG GAG 3 3 CAC GTG GAC TGA GGA CTC CTC 5

5 GTG CAC CTG ACT CCT GAG GAG 3 3 CAC GTG GAC TGA GGA CTC CTC 5 Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις διαγωνίσματος στο Κεφάλαιο 4 ο ΘΕΜΑ Α Α1. β Α2. β Α3. γ Α4. β Α5. β ΘΕΜΑ B B1. Ο κλώνος είναι μια ομάδα πανομοιότυπων μορίων, κυττάρων, ή οργανισμών. B2. Η υβριδοποίηση

Διαβάστε περισσότερα

Εγχειρίδιο κιτ ipsogen BCR-ABL1 mbcr

Εγχειρίδιο κιτ ipsogen BCR-ABL1 mbcr Ιανουάριος 2013 Εγχειρίδιο κιτ ipsogen BCR-ABL1 mbcr Έκδοση 1 24 Ποσοτική in vitro διάγνωση Για χρήση με τα όργανα Rotor-Gene Q, ABI PRISM, LightCycler και SmartCycler 670023 QIAGEN GmbH, QIAGEN Strasse

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Βιοτεχνολογία. Τεχνολογία ανασυνδυασμένου DNA Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Βιοτεχνολογία. Τεχνολογία ανασυνδυασμένου DNA Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιοτεχνολογία Τεχνολογία ανασυνδυασμένου DNA Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

ΔΙΗΜΕΡΙΔΑ «Το σύγχρονο εργαστήριο ποιότητας νερού» Ξενοδοχείο Classical Athens Imperial, 22-23 Μαρτίου 2010

ΔΙΗΜΕΡΙΔΑ «Το σύγχρονο εργαστήριο ποιότητας νερού» Ξενοδοχείο Classical Athens Imperial, 22-23 Μαρτίου 2010 ΔΙΗΜΕΡΙΔΑ «Το σύγχρονο εργαστήριο ποιότητας νερού» Ξενοδοχείο Classical Athens Imperial, 22-23 Μαρτίου 2010 Συνδιοργανωτές: Εταιρεία Μελέτης της Μικροβιολογικής Ποιότητας των Υδάτων, Ε.Δ.Ε.Υ.Α. «Προσδιορισμός

Διαβάστε περισσότερα

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ 1 ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ Οι δύο πολυνουκλεοτιδικές αλυσίδες του DNA αποτελούνται από νουκλεοτίδια τα οποία ενώνονται με φωσφοδιεστερικούς δεσμούς. Πιο συγκεκριμένα

Διαβάστε περισσότερα

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση

Διαβάστε περισσότερα

Πολυμορφισμοί Ανρώπινου DNA. Νικόλαος Δάβανος, MSc PhD

Πολυμορφισμοί Ανρώπινου DNA. Νικόλαος Δάβανος, MSc PhD Πολυμορφισμοί Ανρώπινου DNA Νικόλαος Δάβανος, MSc PhD Πολυμορφισμοί ανθρώπινου DNA Το ανθρώπινο DNA διαφέρει σε συγκεκριμένες θέσεις μεταξύ των ατόμων ενός πληθυσμού (εξαίρεση αποτελούν οι μονοωογενείς

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Φύλλο πρωτοκόλλου QIAsymphony RGQ

Φύλλο πρωτοκόλλου QIAsymphony RGQ Φύλλο πρωτοκόλλου QIAsymphony RGQ Ρυθμίσεις για την εκτέλεση του κιτ artus CT/NG QS-RGQ (λογισμικό Rotor-Gene Q.) Ελέγξτε την διαθεσιμότητα νέων ηλεκτρονικών αναθεωρήσεων επισήμανσης στη διεύθυνση www.qiagen.com/products/artusctngqsrgqkitce.aspx

Διαβάστε περισσότερα

EΦΑΡΜΟΣΜΕΝΗ ΒΙΟΤΕΧΝΟΛΟΓΙΑ

EΦΑΡΜΟΣΜΕΝΗ ΒΙΟΤΕΧΝΟΛΟΓΙΑ EΦΑΡΜΟΣΜΕΝΗ ΒΙΟΤΕΧΝΟΛΟΓΙΑ Πώς αλλάζουν οι κυτταρικές πληροφορίες q Μεταλλάξεις q Φυσικοί Μηχανισµοί Μεταφοράς Γονιδίων Μετασχηµατισµός Μεταγωγή Επισώµατα και Σύζευξη Εσωτερική Mεταφορά Γονιδίων q Γενετική

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

ΣΥΣΤΟΙΧΙΕΣ ΜΙΚΡΟΚΗΛΙ ΩΝ ΟΛΙΓΟΝΟΥΚΛΕΟΤΙ ΙΩΝ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΜΕΤΑΛΛΑΞΕΩΝ

ΣΥΣΤΟΙΧΙΕΣ ΜΙΚΡΟΚΗΛΙ ΩΝ ΟΛΙΓΟΝΟΥΚΛΕΟΤΙ ΙΩΝ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΜΕΤΑΛΛΑΞΕΩΝ ΣΥΣΤΟΙΧΙΕΣ ΜΙΚΡΟΚΗΛΙ ΩΝ ΟΛΙΓΟΝΟΥΚΛΕΟΤΙ ΙΩΝ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΜΕΤΑΛΛΑΞΕΩΝ ρ. Παναγιώτα Πέτρου Εργαστήριο Ανοσοαναλύσεων/Ανοσοαισθητήρων Ινστιτούτο Ραδιοϊσοτόπων Ραδιοδιαγνωστικών Προϊόντων ΕΚΕΦΕ «ηµόκριτος»

Διαβάστε περισσότερα

Η συμβολή της μοριακής εργαστηριακής διάγνωσης στην κλινική πράξη Α ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΔΙΠ, ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΕΚΠΑ

Η συμβολή της μοριακής εργαστηριακής διάγνωσης στην κλινική πράξη Α ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΔΙΠ, ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΕΚΠΑ Η συμβολή της μοριακής εργαστηριακής διάγνωσης στην κλινική πράξη Α ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΔΙΠ, ΙΑΤΡΙΚΗΣ ΣΧΟΛΗΣ ΕΚΠΑ Δηλώνω ότι δεν έχω σύγκρουση συμφερόντων Χαρτογράφηση του ανθρώπινου γονιδιώματος- Ημερομηνίες

Διαβάστε περισσότερα

Διάκριση ποικιλιών ελαιολάδου μέσω μεθόδου γονοτύπησης βασιζόμενης σε φθορίζοντα μικροσφαιρίδια

Διάκριση ποικιλιών ελαιολάδου μέσω μεθόδου γονοτύπησης βασιζόμενης σε φθορίζοντα μικροσφαιρίδια Διάκριση ποικιλιών ελαιολάδου μέσω μεθόδου γονοτύπησης βασιζόμενης σε φθορίζοντα μικροσφαιρίδια Δέσποινα Π. Καλογιάννη Τμήμα Χημείας Πανεπιστήμιο Πατρών Ανάπτυξη μεθόδου ελέγχου αυθεντικότητας του ελαιολάδου

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση:

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Α1. Στη μεταγραφή δεν χρειάζονται:

Διαβάστε περισσότερα

Εγχειρίδιο κιτ ipsogen PML-RARA bcr1

Εγχειρίδιο κιτ ipsogen PML-RARA bcr1 Μάρτιος 2015 Εγχειρίδιο κιτ ipsogen PML-RARA bcr1 24 Έκδοση 1 Ποσοτική in vitro διάγνωση Για χρήση με το σύστημα Rotor-Gene Q, ABI PRISM, Applied Biosystems 7500 Real-Time PCR και τα όργανα LightCycler

Διαβάστε περισσότερα

ΕΞΕΤΑΣΤΕΑ ΥΛΗ για τη ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΕΞΕΤΑΣΤΕΑ ΥΛΗ για τη ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΕΞΕΤΑΣΤΕΑ ΥΛΗ για τη ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κεφ. 1 : σελ. 17-21 Κεφ. 2 : σελ. 31-42 Κεφ. 5: σελ. 73-85 Κεφ. 6 : σελ. 98-105 (από την ενότητα «ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ )

Διαβάστε περισσότερα

EΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ ΓΡΑΜΜΑΤΕΙΑ ΕΠΙΤΡΟΠΗΣ ΕΡΕΥΝΩΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ

EΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ ΓΡΑΜΜΑΤΕΙΑ ΕΠΙΤΡΟΠΗΣ ΕΡΕΥΝΩΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ EΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ ΓΡΑΜΜΑΤΕΙΑ ΕΠΙΤΡΟΠΗΣ ΕΡΕΥΝΩΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ Πρόσκληση εκδήλωσης ενδιαφέροντος 00745/203 στο πλαίσιο διενέργειας

Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα

Βιοπληροφορική II. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015

Βιοπληροφορική II. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 Βιοπληροφορική II Παντελής Μπάγκος Αναπληρωτής Καθηγητής Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 Μικροσυστοιχίες Γυάλινο πλακίδιο που αποτελείται από συγκεκριμένες αλληλουχίες οι οποίες είναι ειδικές για συγκεκριμένα

Διαβάστε περισσότερα

Μοριακή Διαγνωστική Λοιμώξεων Ειρήνη Γρίσπου Βιολόγος Υπεύθυνη Τμήματος Μοριακής Διαγνωστικής Μικροβιολογικό Εργαστήριο ΓΝΑ Ο Ευαγγελισμός

Μοριακή Διαγνωστική Λοιμώξεων Ειρήνη Γρίσπου Βιολόγος Υπεύθυνη Τμήματος Μοριακής Διαγνωστικής Μικροβιολογικό Εργαστήριο ΓΝΑ Ο Ευαγγελισμός Μοριακή Διαγνωστική Λοιμώξεων Ειρήνη Γρίσπου Βιολόγος Υπεύθυνη Τμήματος Μοριακής Διαγνωστικής Μικροβιολογικό Εργαστήριο ΓΝΑ Ο Ευαγγελισμός Τεχνικές που χρησιμοποιούνται στην Μοριακή Μικροβιολογία Πέψη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Α. Μεντής ιαγνωστικό Εργαστήριο Λοιμωδών Νοσημάτων Εθνικό Εργαστήριο Αναφοράς Γρίπης Νοτίου Ελλάδος Εθνικό Εργαστήριο Αναφοράς Ερυθράς/Ιλαράς Ελλάδος, Εθνικό

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Άσκηση Φαρμακευτικής Βιοτεχνολογίας

Άσκηση Φαρμακευτικής Βιοτεχνολογίας Άσκηση Φαρμακευτικής Βιοτεχνολογίας Χαρακτηρισμός Φαρμακογενετικών δεικτών με PCR-ARMS Θεωρητικό μέρος 1. Αλυσιδωτή αντίδραση Πολυμεράσης (PCR) Η αλυσιδωτή αντίδραση πολυμεράσης (polymerase chain reaction,

Διαβάστε περισσότερα

Εγχειρίδιο κιτ ipsogen WT1 ProfileQuant (ELN*)

Εγχειρίδιο κιτ ipsogen WT1 ProfileQuant (ELN*) Μάρτιος 2015 Εγχειρίδιο κιτ ipsogen WT1 ProfileQuant (ELN*) 24 Έκδοση 1 Ποσοτική in vitro διάγνωση Για χρήση με το σύστημα Rotor-Gene Q, ABI PRISM 7900HT SDS, Applied Biosystems 7500 Real-Time PCR και

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Department of Biochemistry

Διαβάστε περισσότερα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Το γονιδίωμα περιλαμβάνει τόσο τα γονίδια όσο και τις μη κωδικοποιούσες ακολουθίες DNA. Ο όρος προτάθηκε το 1920 από τον καθηγητή Hans

Διαβάστε περισσότερα

1. Αντικείµενο του ιαγωνισµού Αντικείµενο του διαγωνισµού είναι η ανάδειξη µειοδότη για την προµήθεια των αναφεροµένων στο Παράρτηµα Α της παρούσας, υ

1. Αντικείµενο του ιαγωνισµού Αντικείµενο του διαγωνισµού είναι η ανάδειξη µειοδότη για την προµήθεια των αναφεροµένων στο Παράρτηµα Α της παρούσας, υ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ (Τ.Ε.Ι.) ΑΜΘ ΕΙ ΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝ ΥΛΙΩΝ ΕΡΕΥΝΑΣ Ταχ. δ/νση: Άγιος Λουκάς, Καβάλα Τηλέφωνο: 2510 462203 FAX: 2510 462352 E-mail: ipantel@teikav.edu.gr Καβάλα 20/08/2014

Διαβάστε περισσότερα

ΚΕΝΤΡΟ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΘΕΣΣΑΛΙΑΣ Ενημερωτικός οδηγός εκπαιδευτικού προγράμματος:

ΚΕΝΤΡΟ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΘΕΣΣΑΛΙΑΣ Ενημερωτικός οδηγός εκπαιδευτικού προγράμματος: ΚΕΝΤΡΟ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΘΕΣΣΑΛΙΑΣ Ενημερωτικός οδηγός εκπαιδευτικού προγράμματος: «Εξειδικευμένο Πρόγραμμα Επιμόρφωσης σε Μοριακές Τεχνικές» 2016-2017 ΚΕΝΤΡΟ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ (ΚΔΒΜ) ΠΑΝΕΠΙΣΤΗΜΙΟΥ

Διαβάστε περισσότερα

Οργάνωση των NA σε ιούς. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Οργάνωση των NA σε ιούς. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Οργάνωση των NA σε ιούς 09/04/2014 1 Η οργάνωση των ιών γίνεται µε βάση το εύρος των ξενιστών που µπορούν να µολύνουν και συµπεριφέρονται σαν παράσιτα: Μόνο βακτήρια: βακτηριοφάγος ή φάγος (phage) Ζωϊκά

Διαβάστε περισσότερα

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Οι περιοριστικές ενδονουκλεάσες

Διαβάστε περισσότερα

ΤΕΧΝΙΚΕΣ ΠΡΟ ΙΑΓΡΑΦΕΣ ΓΙΑ ΤΟ ΙΑΓΩΝΙΣΜΟ ΜΕ ΑΡΙΘ. ΠΡΩΤ. 3476/

ΤΕΧΝΙΚΕΣ ΠΡΟ ΙΑΓΡΑΦΕΣ ΓΙΑ ΤΟ ΙΑΓΩΝΙΣΜΟ ΜΕ ΑΡΙΘ. ΠΡΩΤ. 3476/ ΤΕΧΝΙΚΕΣ ΠΡΟ ΙΑΓΡΑΦΕΣ ΓΙΑ ΤΟ ΙΑΓΩΝΙΣΜΟ ΜΕ ΑΡΙΘ. ΠΡΩΤ. 3476/19-02-2013 Οµάδα 1: Αναλώσιµα Eργαστηρίου Μοριακής Βιολογίας Προϋπολογισµός µε ΦΠΑ: 7000,00 Ευρώ Τόπος προορισµού των ειδών: Πανεπιστήµιο υτικής

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΕΠΙΤΡΟΠΗ ΕΡΕΥΝΩΝ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΕΠΙΤΡΟΠΗ ΕΡΕΥΝΩΝ ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΕΠΙΤΡΟΠΗ ΕΡΕΥΝΩΝ 26504 ΡΙΟ ΠΑΤΡΩΝ Τηλ. 2610/996660 Fax 2610/996677 http://research.upatras.gr Πάτρα, 25/05/2011 Πρόχειρος διαγωνισµός για την προµήθεια Θερµικών Κυκλοποιητών

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ Β ΤΡΙΜΗΝΟΥ Γ 4 23.1.12 ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΕΡΓΑΣΤΗΚΑΝ: ΑΛΕΞΑΝΔΡΟΣ ΔΕΛΗΜΙΧΑΛΗΣ ΑΡΤΕΜΗΣ ΑΝΑΣΤΑΣΙΑΔΗΣ 1 ΕΙΣΑΓΩΓΗ Το δεοξυριβονουκλεϊκό οξύ (Deoxyribonucleic acid -

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 4 ΙΟΥΛΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Να γράψετε στο

Διαβάστε περισσότερα

Εφαρµοσµένη Βιοτεχνολογία Σηµειώσεις. Νίκος Τσουκιάς, Ευάγγελος Τόπακας Σχολή Χηµικών Μηχανικών ΕΜΠ

Εφαρµοσµένη Βιοτεχνολογία Σηµειώσεις. Νίκος Τσουκιάς, Ευάγγελος Τόπακας Σχολή Χηµικών Μηχανικών ΕΜΠ Εφαρµοσµένη Βιοτεχνολογία Σηµειώσεις Νίκος Τσουκιάς, Ευάγγελος Τόπακας Σχολή Χηµικών Μηχανικών ΕΜΠ για την παραγωγή μιας ενεργής πρωτεΐνης υπάρχουν ρυθμιστικοί μηχανισμοί σε πολλαπλά επίπεδα ιδιαίτερα

Διαβάστε περισσότερα

Γονιδιωματική. G. Patrinos

Γονιδιωματική. G. Patrinos Γονιδιωματική Η μεταγονιδιωματική εποχή... Σημαντικότερα επιτεύγματα POST GENOME ERA Ολοκλήρωση της αποκρυπτογράφησης της αλληλουχίας των γονιδιωμάτων πολλών οργανισμών. Προτύπωση μεθοδολογιών για προσδιορισμό

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΚΑΙ ΜΟΡΙΑΚΗ ΒΙΟΛΟΓΙΑ ΣΤΗΝ ΚΛΙΝΙΚΗ ΠΡΑΞΗ

ΓΕΝΕΤΙΚΗ ΚΑΙ ΜΟΡΙΑΚΗ ΒΙΟΛΟΓΙΑ ΣΤΗΝ ΚΛΙΝΙΚΗ ΠΡΑΞΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΜΟΡΙΑΚΗ ΒΙΟΛΟΓΙΑ ΣΤΗΝ ΚΛΙΝΙΚΗ ΠΡΑΞΗ 10-1-2018 Βασιλική Καλότυχου, PhD, Ε.ΔΙ.Π ΔΙΑΓΝΩΣΗ ΤΕΧΝΙΚΕΣ ΓΕΝΕΤΙΚΗΣ ΚΑΙ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΣΤΗΝ ΚΛΙΝΙΚΗ ΠΡΑΞΗ Ποιες είναι οι γενετικές και μοριακές αναλύσεις

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΣΠΕΡΙΝΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΧΗΜΕΙΑΣ ΚΑΙ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΧΗΜΕΙΑΣ ΚΑΙ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΧΗΜΕΙΑΣ ΚΑΙ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΚΛΙΝΙΚΗ ΑΞΙΟΛΟΓΗΣΗ ΚΑΙ ΜΕΛΕΤΗ ΙΣΟΜΟΡΦΩΝ ΤΗΣ L-DOPA ΑΠΟΚΑΡΒΟΞΥΛΑΣΗΣ ΚΑΙ ΤΟΥ

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ 1 ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ άμεση πρόσβαση στο γενετικό υλικό εφαρμογές στην υγεία, βελτίωση φυτών και ζώων, προστασία

Διαβάστε περισσότερα

Νέα Οπτικά Μικροσκόπια

Νέα Οπτικά Μικροσκόπια Νέα Οπτικά Μικροσκόπια Αντίθεση εικόνας (contrast) Αντίθεση πλάτους Αντίθεση φάσης Αντίθεση εικόνας =100 x (Ι υποβ -Ι δειγμα )/ Ι υποβ Μικροσκοπία φθορισμού (Χρησιμοποιεί φθορίζουσες χρωστικές για το

Διαβάστε περισσότερα

Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ

Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Η ΑΝΑΓΚΗ ΓΙΑ ΠΟΣΟΤΙΚΟΠΟΙΗΣΗ ΣΤΗΝ ΕΝΟΡΓΑΝΗ ΑΝΑΛΥΣΗ Οι Ενόργανες Μέθοδοι Ανάλυσης είναι σχετικές μέθοδοι και σχεδόν στο σύνολο τους παρέχουν την αριθμητική τιμή μιας φυσικής ή φυσικοχημικής ιδιότητας, η

Διαβάστε περισσότερα

ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΑΤΡΙΒΗ. Ταυτοποίηση ειδών σε τυποποιημένα κρέατα με ανάλυση γενετικών δεικτών

ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΑΤΡΙΒΗ. Ταυτοποίηση ειδών σε τυποποιημένα κρέατα με ανάλυση γενετικών δεικτών ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΒΙΟΧΗΜΕΙΑΣ & ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑ-ΠΟΙΟΤΗΤΑ ΔΙΑΤΡΟΦΗΣ ΚΑΙ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΕΤΙΚΗΣ, ΣΥΓΚΡΙΤΙΚΗΣ ΚΑΙ ΕΞΕΛΙΚΤΙΚΗΣ

Διαβάστε περισσότερα

Πανεπιστήμιο Πατρών Πληροφορική Επιστημών Ζωής Σπύρος Βερναρδής 1270 Βιολόγος

Πανεπιστήμιο Πατρών Πληροφορική Επιστημών Ζωής Σπύρος Βερναρδής 1270 Βιολόγος Πανεπιστήμιο Πατρών Πληροφορική Επιστημών Ζωής Σπύρος Βερναρδής 1270 Βιολόγος Χρήση μικροσυστοιχιών DNA για την ανάλυση του μεταγραφικού προφίλ γενετικά τροποποιημένων εμβρυικών ινοβλαστών ποντικού. Πάτρα

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ AΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ AΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ AΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» 22/12/2015 Δ.Δ. Λεωνίδας 1

Διαβάστε περισσότερα

Εργαστηριακή ιάγνωση Γρίπης Μοριακή διάγνωση ή όχι?

Εργαστηριακή ιάγνωση Γρίπης Μοριακή διάγνωση ή όχι? Εργαστηριακή ιάγνωση Γρίπης Μοριακή διάγνωση ή όχι? Εθνικόν και Καποδιστριακόν Πανεπιστήμιον Αθηνών ΣΠΑΝΑΚΗΣ ΝΙΚΟΛΑΟΣ Αναπλ. Καθηγητής ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ, ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΟΜΗ ΙΩΝ ΓΡΙΠΗΣ ΓΟΝΙ ΙΑ ΙΩΝ ΓΡΙΠΗΣ Μέθοδοι

Διαβάστε περισσότερα

ΕΘΝΙΚΗ ΣΧΟΛΗ ΔΗΜΟΣΙΑΣ ΥΓΕΙΑΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ Λ. Αλεξάνδρας 196, Αθήνα ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ

ΕΘΝΙΚΗ ΣΧΟΛΗ ΔΗΜΟΣΙΑΣ ΥΓΕΙΑΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ Λ. Αλεξάνδρας 196, Αθήνα ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Αρ. Πρωτ.: ΕΛΚΕ-ΕΣΔΥ: 2295 Ημερομηνία: 30/11/2015 ΕΘΝΙΚΗ ΣΧΟΛΗ ΔΗΜΟΣΙΑΣ ΥΓΕΙΑΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ Λ. Αλεξάνδρας 196, Αθήνα ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Ο Ειδικός Λογαριασμός Κονδυλίων

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΣΗ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΥΡΙΑΚΗ 22 ΑΠΡΙΛΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΣΟΜΟΙΩΣΗ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΥΡΙΑΚΗ 22 ΑΠΡΙΛΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΣΟΜΟΙΩΣΗ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΥΡΙΑΚΗ 22 ΑΠΡΙΛΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1.γ, Α2.β, Α3.γ, Α4.δ, Α5.α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Τα

Διαβάστε περισσότερα