7KH VHQVLWLYLW\ RI UDGLRWKHUDS\ WR WLVVXH FRPSRVLWLRQ DQG LWV HVWLPDWLRQ XVLQJ QRYHO GXDO HQHUJ\ &7 PHWKRGV Guillaume Landry
|
|
- Ίρις Γιάγκος
- 7 χρόνια πριν
- Προβολές:
Transcript
1 Guillaume Landry
2
3 UUNIVERSITAIRE PERS MAASTRICHT P M
4
5
6
7 1
8
9 ρ
10
11
12
13 2
14
15
16
17 60 "Monte Carlo" AND brachytherapy Number of publications Publication year
18
19 μ ρ μ ρ μ ρ μ ρ μ ρ μ ρ μ ρ μρ μρ
20
21
22
23 μ ρ μ ρ μ μ μρμ ρ
24 ( μ ρ)
25
26
27
28
29 3
30
31 ρ
32 = = μ ( ρ) ρ
33 σ σ σ ( ) =
34
35 ρ ρ ρ ρ ρ ρ
36 ρ μ ρ ρ
37 ρ
38 μρ Δ Δ Δ =
39 φ φ τρ φ τρ φ
40
41
42 ρ ρ Δ Δ =
43 Δ ρ ρ ρ ρ Δ ρ ρ ρ ρ Δ = ρ ρ ρ
44 ρ ρ Δ Δ ρ ρ ρ ρ Δ ρ ρ
45 ρ ρ ρ Δ = ρ Δ ρ
46
47
48
49
50
51 4
52
53
54 μ ( μ ρ) = ( ) ρ = ( μ ) μ ρ ( ) μ ( ρ) μ ρ ( ) μ ρ
55 ( ) = = μ ρ ρ ρ ρ ρ
56 σσ
57 ρ
58 μ ρ μ ρ
59
60 μ ρ ( μ ρ) ( μ ρ) Ψ Ψ ( μ ρ)
61 ( μ ρ) μ ρ σδ
62 Δ = ( ) ( ) ( ) Δ
63 μ ρ
64 μ ρ
65
66
67
68
69 5
70 ρ ρ
71 ρ
72 = ( ) ( ) ( ) μ ( ) ( ) μ ρ
73 ρ 1.0 normalized number of photons / a.u kv 120 kv 140 kv photon energy / kev
74
75 ρρ ρ ρ
76 ρρ
77 ρ ρρ ρ ρ ρ ρ ρ ρ = ρ ρ
78 ρ ρ ρ ρ ρ ρ ρ ρ = ( ) ( ) ρ ρ ρ ρ
79 μμ μμ
80 ρ ρ ρ ρ ρ ρ relative electron density Calibration phantom theory simulation effective atomic number ρ ρ ρ ρ ρ ρ ρ ρ ρ ρ
81 relative electron density Breast and prostate phantoms theory simulation corrected simulation effective atomic number ρ ρ ρ ρ ρ ρ ρ ρ
82 ρ ρ
83
84 Pd D seg w,m /Dref w,m TG43 SECT 3 tissues SECT 7 tissues DECT ideal DECT noise adipose hi Z adipose m Z adipose lo Z breast A30G70 breast A70G30 female tissue gland hi Z gland m Z gland lo Z lung muscle hi Z muscle m Z muscle lo Z rib skin hi Z skin m Z skin lo Z Pd TG43 SECT 3 tissues SECT 7 tissues DECT ideal DECT noise D seg m,m /Dref m,m adipose hi Z adipose m Z adipose lo Z breast A30G70 breast A70G30 female tissue gland hi Z gland m Z gland lo Z lung muscle hi Z muscle m Z muscle lo Z rib skin hi Z skin m Z skin lo Z
85
86
87 I 1.00 D seg w,m /Dref w,m TG43 SECT 3 tissues SECT 7 tissues DECT ideal DECT noise I water adipose hi Z adipose m Z adipose lo Z bladder full bladder empty lung male soft tissue muscle hi Z muscle m Z muscle lo Z prostate A prostate C rectum rib D seg m,m /Dref m,m water adipose hi Z adipose m Z adipose lo Z bladder full bladder empty lung male soft tissue ρ ρ ρ ρ ρ ρ ρ ρ muscle hi Z muscle m Z muscle lo Z prostate A prostate C rectum rib
88 1.10 tissue separation with noise skin lo Z, m Z, hi Z gl. hi Z, muscle lo Z, m Z, hi Z relative electron density adip. m Z br. a30g70 adip. hi Z br. a70g30 fem. tis. gl. m Z gl. lo Z adip. hi Z effective atomic number ρ ρ
89 ρ ρ
90 μ ρ μ( )= ρ ( )+ ( ) τρ σ ρσ ρ τρ σ ρ σ ρ μ μ ( ρ )= ρ ω ( ) ( )+ ( ) ω ( ( ) ( ) )= ( ) ( ) ρ μ μ μ = μ μ μ μ = μ μ = ρ ω ( ) ( )+ ( ) = ω ( ) ( ) = ω ( ) ( )
91 μ μ μ = μ μ μ ρ μ ρ ρ μ ρ = +
92
93
94
95 6
96 ρ ρ ρ ρ ρ
97 μ μ ρ ρ
98 = ρ ρ ρ ρ ρ
99 A B ρ ρ
100 μ = + μ μ
101 μμ ρ ρ ρ ρ ρ ρ ρ ρ ρ ρ ρ
102 relative electron density atomic number measured simulated ρ ρ Z Z A Z Z Z B Z ρ ρ ρ ρ ρ ρ C Z 6 Z
103 μμ ρ ρ ρ ρ ρ ρ ρ ρ ρ ρ ρ ρ
104 ρ ρ ρ ρ ρ ρ
105
106
107
108
109 7
110 ρ ρ ρ ρ ρ
111 ρ ρ ρ
112 ρ ρ
113 μρ ρ ρ ρ ρ ρ ρ ρ
114 ρ ρ ρ ρ ρ ρ
115 ρ Z
116 A standard deviation of muscle insert muscle Z eff half dose 1mm stand. dose 1mm double dose 1mm max dose 1mm D30f Q30f\1 Q30f\3 Q30f\5 D30f Q30f\1 Q30f\3 Q30f\5 reconstruction method reconstruction method ρ ρ ρ ρ ρ B standard deviation of muscle insert e half dose 1mm stand. dose 1mm double dose 1mm max dose 1mm
117 ρ ρ ρ ρ
118 ρ ρ
119
120
121 8
122 ρ ρ μ μ
123 ρ ρ ρ ρ ρ μρ μ = ρ ( )+ ( )+ ( )
124 μ ρ + + ( ) μ μ μ μ μ μ ( ) ( μ μ ) μ μ μ μ μ μ = + ω = β ω β ω β μ
125 μ μ
126 ρρ β ρ ρ ρρ β ρ ρ = = μ ( μ ) + μ ( μ )= ρ + + = ( ) ρ ( + + )+ ( + + ) ρ
127 μ ρ β μ β β
128 TSM RTM SPECTRAL METHOD DECT Gammex Scan HU inserts 80kVp and HU inserts 140kVp DECT Gammex Scan HU inserts 80kVp and HU inserts 140kVp CT Scanner Spectra Detector response NIST X-ray linear attenuation coefficients Correction for attenuation through phantom Stoichiometric parameters k 1,kVp and k 2,kVp HU tissues 80kVp and HU tissues 140kVp Model parameters A kvp,b kvp,c kvp,m + HU measured 80kVp and HU measured 140kVp } {{ } Z eff Model parameters A kvp,b kvp,c kvp,m + HU measured 80kVp and HU measured 140kVp } {{ } Z eff HU measured 80kVp and HU measured 140kVp } {{ } Z eff μ μ + +
129 μ
130 μ μ μ μ
131 R RTM TSM β β β β β β β β β
132 μ μ
133 μ μ
134
135
136 μ μ μ 80kVp /μ 140kVp Gammex 467 CIRS phantom reference tissues TSM incl. lungs TSM excl. lung RTM Z eff
137
138 μ μ
139 μ
140
141 9
142 ρ ρ ρ ρ
143 β
144 ρ ρ = ω ω ω ρ ρ ρ
145 ρ soft tissues skeletal tissues 80 soft tissues skeletal tissues % weight C O P Ca % weight Z eff Z eff
146 1.1 soft tissues 1.8 skeletal tissues Z eff /Z eff,water 1 Z eff /Z eff,water head abdomen thorax e / e,water e / e,water
147 σ
148 fits table ρ μ μ μ μ
149 Z eff human tissues skeletal tissues 8 soft tissues μ /μ 80kVp 140kVp ρ ρ ρ
150 ρ ρ ρ ρ ρ ρ ρ ρ
151 σ σ σ
152
153 Z
154 ρ ρ ρ
155 ρ ρ
156 RMS error on %C assignment RMS error on %C assignment RMS error on %C assignment Adipose lo Z Adipose mean Z CTDI vol =20 mgy Adipose lo Z Adipose mean Z Adipose hi Z bone marrow yellow Adipose lo Z Adipose mean Z Adipose hi Z bone marrow yellow yellow/red marrow CTDI vol =20 mgy Gland lo Z yellow/red marrow Gland mean Z bone marrow red brain fluid CTDI vol =20 mgy Adipose hi Z bone marrow yellow yellow/red marrow bone marrow red brain fluid adrenal gland small intestine wall bone marrow red brain fluid lymph brain, white Muscle lo Z brain, grey thyroid Muscle mean Z Muscle hi Z blood whole Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage whole column C4 incl cart C4 excl cart cranium mandible cortical bone ρ head thorax lymph Muscle lo Z heart1 heart2 aorta Muscle mean Z Muscle hi Z Gland hi Z heart3 trachea blood whole herart blood filled abdomen Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage sternum urine bile lymph pancreas Prostate A testis Muscle lo Z stomach kidney1 liver1 kidney2 Muscle mean Z Muscle hi Z ovary kidney3 liver2 spleen blood whole liver3 Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage Bladder full Bladder empty SECT DECT SECT DECT D6 inc cart whole column D6 excl cart humerus sphe head humerus whole spec ribs 2 6 clavicle humerus total humerus cyl shaft ribs 10 cortical bone SECT DECT sacrum male whole column femur sph head femur con troch sacrum female innominate male femur total innominate female femur cyl shaft cortical bone
157 RMS error on %C assignment RMS error on %C assignment RMS error on %C assignment Adipose lo Z Adipose mean Z CTDI vol =80 mgy Adipose lo Z Adipose mean Z Adipose hi Z bone marrow yellow Adipose lo Z Adipose mean Z Adipose hi Z bone marrow yellow yellow/red marrow CTDI vol =80 mgy Gland lo Z yellow/red marrow Gland mean Z bone marrow red brain fluid CTDI vol =80 mgy Adipose hi Z bone marrow yellow yellow/red marrow bone marrow red brain fluid adrenal gland small intestine wall bone marrow red brain fluid lymph brain, white Muscle lo Z brain, grey thyroid Muscle mean Z Muscle hi Z blood whole Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage whole column C4 incl cart C4 excl cart cranium mandible cortical bone ρ head thorax lymph Muscle lo Z heart1 heart2 aorta Muscle mean Z Muscle hi Z Gland hi Z heart3 trachea blood whole herart blood filled abdomen Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage sternum urine bile lymph pancreas Prostate A testis Muscle lo Z stomach kidney1 liver1 kidney2 Muscle mean Z Muscle hi Z ovary kidney3 liver2 spleen blood whole liver3 Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage Bladder full Bladder empty SECT DECT SECT DECT D6 inc cart whole column D6 excl cart humerus sphe head humerus whole spec ribs 2 6 clavicle humerus total humerus cyl shaft ribs 10 cortical bone SECT DECT sacrum male whole column femur sph head femur con troch sacrum female innominate male femur total innominate female femur cyl shaft cortical bone
158 RMS error on %O assignment RMS error on %O assignment RMS error on %O assignment Adipose lo Z Adipose mean Z CTDI vol =20 mgy Adipose lo Z Adipose mean Z Adipose hi Z bone marrow yellow Adipose lo Z Adipose mean Z Adipose hi Z bone marrow yellow yellow/red marrow CTDI vol =20 mgy Gland lo Z yellow/red marrow Gland mean Z bone marrow red brain fluid CTDI vol =20 mgy Adipose hi Z bone marrow yellow yellow/red marrow bone marrow red brain fluid adrenal gland small intestine wall bone marrow red brain fluid lymph brain, white Muscle lo Z brain, grey thyroid Muscle mean Z Muscle hi Z blood whole Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage whole column C4 incl cart C4 excl cart cranium mandible cortical bone ρ head thorax lymph Muscle lo Z heart1 heart2 aorta Muscle mean Z Muscle hi Z Gland hi Z heart3 trachea blood whole herart blood filled abdomen Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage sternum urine bile lymph pancreas Prostate A testis Muscle lo Z stomach kidney1 liver1 kidney2 Muscle mean Z Muscle hi Z ovary kidney3 liver2 spleen blood whole liver3 Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage Bladder full Bladder empty SECT DECT SECT DECT D6 inc cart whole column D6 excl cart humerus sphe head humerus whole spec ribs 2 6 clavicle humerus total humerus cyl shaft ribs 10 cortical bone SECT DECT sacrum male whole column femur sph head femur con troch sacrum female innominate male femur total innominate female femur cyl shaft cortical bone
159 RMS error on %O assignment RMS error on %O assignment RMS error on %O assignment Adipose lo Z Adipose mean Z CTDI vol =80 mgy Adipose lo Z Adipose mean Z Adipose hi Z bone marrow yellow Adipose lo Z Adipose mean Z Adipose hi Z bone marrow yellow yellow/red marrow CTDI vol =80 mgy Gland lo Z yellow/red marrow Gland mean Z bone marrow red brain fluid CTDI vol =80 mgy Adipose hi Z bone marrow yellow yellow/red marrow bone marrow red brain fluid adrenal gland small intestine wall bone marrow red brain fluid lymph brain, white Muscle lo Z brain, grey thyroid Muscle mean Z Muscle hi Z ρ blood whole Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage whole column C4 incl cart C4 excl cart cranium mandible cortical bone head thorax lymph Muscle lo Z heart1 heart2 aorta Muscle mean Z Muscle hi Z Gland hi Z heart3 trachea blood whole herart blood filled abdomen Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage sternum urine bile lymph pancreas Prostate A testis Muscle lo Z stomach kidney1 liver1 kidney2 Muscle mean Z Muscle hi Z ovary kidney3 liver2 spleen blood whole liver3 Skin lo Z Skin mean Z Skin hi Z connective tissue cartilage Bladder full Bladder empty SECT DECT SECT DECT D6 inc cart whole column D6 excl cart humerus sphe head humerus whole spec ribs 2 6 clavicle humerus total humerus cyl shaft ribs 10 cortical bone SECT DECT sacrum male whole column femur sph head femur con troch sacrum female innominate male femur total innominate female femur cyl shaft cortical bone
160 Carbon Carbon Oxygen Oxygen
161 Hydrogen Hydrogen Nitrogen Nitrogen
162 Oxygen ρ Oxygen
163 ρ ρ
164
165
166
167 10
168
169 ρ ρ
170 ρ ρ ρ ρ ρ ρ ρ = +ρ ρ = ρ e ρ ρ e ρρ
171 ω = = ω ( ) ω ( ) ω ω ω ω ω ω ω
172 2 D r Reference All H All C All O Muscle ρ = 1.05 g/cm r (mm) Muscle RMSE D r H = 5 % H = 6 % H = 7 % H = 8 % H = 9 % H = 10 % Reference [H] (%) r (mm) Muscle Adipose Skin Gland RMSE [H] %
173 ρ ρ β ( β ) = ρ β β ( β ) β β ρ ρ ρ
174
175
176
177
178
179
180 ρ ρ ρ
181 ρ
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
CT - Αξονική Τομογραφία Αποτελέσματα ελέγχων ΕΕΑΕ Δοσιμετρία Εφαρμογή Πρωτοκόλλων
CT - Αξονική Τομογραφία Αποτελέσματα ελέγχων ΕΕΑΕ Δοσιμετρία Εφαρμογή Πρωτοκόλλων Κ.Ι. Χουρδάκης Αθήνα 23.05.2009 Έλεγχοι Ακτινολογικών, 2008 900 800 700 600 Κιν Α/Σ; 31; 5% Ορθαπαν; 66; 11% Α/Λ; 91; 15%
Διαβάστε περισσότεραΠ Ο Λ Ι Τ Ι Κ Α Κ Α Ι Σ Τ Ρ Α Τ Ι Ω Τ Ι Κ Α Γ Ε Γ Ο Ν Ο Τ Α
Α Ρ Χ Α Ι Α Ι Σ Τ Ο Ρ Ι Α Π Ο Λ Ι Τ Ι Κ Α Κ Α Ι Σ Τ Ρ Α Τ Ι Ω Τ Ι Κ Α Γ Ε Γ Ο Ν Ο Τ Α Σ η µ ε ί ω σ η : σ υ ν ά δ ε λ φ ο ι, ν α µ ο υ σ υ γ χ ω ρ ή σ ε τ ε τ ο γ ρ ή γ ο ρ ο κ α ι α τ η µ έ λ η τ ο ύ
Διαβάστε περισσότεραΝέες απεικονιστικές μέθοδοι στην απεικόνιση του μυοσκελετικού συστήματος Υπολογιστική τομογραφία
Νέες απεικονιστικές μέθοδοι στην απεικόνιση του μυοσκελετικού συστήματος Υπολογιστική τομογραφία Κώστας Περισυνάκης Αναπληρωτής Καθηγητής Ιατρικής Φυσικής Εισαγωγή Κινητήρια δύναμη τεχνολογικής εξέλιξης
Διαβάστε περισσότεραΜελέτη έκφρασης των αντιγόνων των οικογενειών Survivin και MAGE-A στον καρκίνο του πνεύμονα
Μονάδα Ανοσολογίας Καρκίνου Εργαστήριο Ανοσολογίας-Ιστοσυμβατότητας Πανεπιστημιακό Νοσοκομείο Λάρισας Τμήμα Ιατρικής Πανεπιστήμιο Θεσσαλίας Μελέτη έκφρασης των αντιγόνων των οικογενειών Survivin και MAGE-A
Διαβάστε περισσότεραΔόση στην Αξονική Τομογραφία. Χρήστος Αντύπας, PhD ΕΔΙΠ Ακτινοφυσικός Ιατρικής Α Εργαστήριο Ακτινολογίας Αρεταίειο Νοσοκομείο
Δόση στην Αξονική Τομογραφία Χρήστος Αντύπας, PhD ΕΔΙΠ Ακτινοφυσικός Ιατρικής Α Εργαστήριο Ακτινολογίας Αρεταίειο Νοσοκομείο Εισαγωγή Παρουσίαση των παραμέτρων που επηρεάζουν την Δόση στις διαγνωστικές
Διαβάστε περισσότεραAppendix A3. Table A3.1. General linear model results for RMSE under the unconditional model. Source DF SS Mean Square
Appendix A3 Table A3.1. General linear model results for RMSE under the unconditional model. Source DF SS F Value Pr > F Model 107 374.68 3.50 8573.07
Διαβάστε περισσότεραΜέθοδοι και Εφαρµογές Πυρηνικής Επιστήµης και Ακτινοφυσικής
Μέθοδοι και Εφαρµογές Πυρηνικής Επιστήµης και Ακτινοφυσικής Οµάδα Εφαρµοσµένης Πυρηνικής Επιστήµης και Ακτινοφυσικής Σκοπός Έρευνα και Ανάπτυξη στις εφαρµογές της Πυρηνικής Επιστήµης και Ακτινοφυσικής
Διαβάστε περισσότερα15 A-NET ( ) 1 3 Mesoderm 2 4 Ectoderm 3 5 Mesoderm 4 6 endoderm. 1. Fe, s 2. Mg, N 3. Fe, N 4. Mg, S
122 15 A-NET ( ) 1. ก ก blood vessel ก 1 Mesoderm 2 4 Ectoderm 5 Mesoderm 4 6 endoderm 2. กก ก. ก. ก ก. ก. ก ก ก 1. ก 2.. ก, 4.,. ก 1. Fe, s 2. Mg, N. Fe, N 4. Mg, S 4. ก กก ก ก ก ก ก ก 1. ก ก ก ก กก 2.
Διαβάστε περισσότεραΗ επιβάρυνση του ελληνικού πληθυσμού από τις ιατρικές εφαρμογές ιοντιζουσών ακτινοβολιών
ΑΒΡ ΑΜΙ ΔΗΑ. eκλι ΝΙ ΚΗΕ ΝΔΟΚΡΙ ΝΟΛΟΓ Ι Α onl i nef RE E Όλ ηηκ λ ι ν ι κ ήε ν δοκ ρι ν ολ ογ ί α&θέ ματ απουε ν δι αφέ ρουνόλ ους σεδι αλ έ ξ ε ι ςαπόε κ λ ε κ τ ούςε πι στ ήμον ε ς Ηε πι βάρυν σητ ουε
Διαβάστε περισσότεραΑκτινοθεραπεία Ακτινοβιολογία
ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ - ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ - ΕΡΓΑΣΤΗΡΙΟ ΙΑΤΡΙΚΗΣ ΦΥΣΙΚΗΣ Εκπαιδευτικό Σεμινάριο Ακτινοβολίες & Ακτινοπροστασία Ακτινοθεραπεία Ακτινοβιολογία Κική Θεοδώρου Αναπληρώτρια
Διαβάστε περισσότεραΔΙΑΓΝΩΣΤΙΚΑ ΕΠΙΠΕΔΑ ΑΝΑΦΟΡΑΣ (ΔΕΑ): Βελτίωση πρωτοκόλλων ΥΤ & η συνεισφορά των ΔΕΑ
ΔΙΑΓΝΩΣΤΙΚΑ ΕΠΙΠΕΔΑ ΑΝΑΦΟΡΑΣ (ΔΕΑ): Ο ΡΟΛΟΣ ΤΟΥΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΑΠΕΙΚΟΝΙΣΗ Βελτίωση πρωτοκόλλων ΥΤ & η συνεισφορά των ΔΕΑ Γιάννης Αντωνάκος Ακτινοφυσικός, Β Εργαστήριο Ακτινολογίας, ΕΚΠΑ CT: Μία δημοφιλής
Διαβάστε περισσότεραSupporting Information
Supporting Information Wiley-VCH 27 69451 Weinheim, Germany Supplementary Figure 1. Synthetic results as detected by XRD (Cu-Kα). Simulation pattern of MCM-68 Relative Intensity / a.u. YNU-2P Conventional
Διαβάστε περισσότεραFused Bis-Benzothiadiazoles as Electron Acceptors
Fused Bis-Benzothiadiazoles as Electron Acceptors Debin Xia, a,b Xiao-Ye Wang, b Xin Guo, c Martin Baumgarten,*,b Mengmeng Li, b and Klaus Müllen*,b a MIIT Key Laboratory of ritical Materials Technology
Διαβάστε περισσότεραSi + Al Mg Fe + Mn +Ni Ca rim Ca p.f.u
.6.5. y = -.4x +.8 R =.9574 y = - x +.14 R =.9788 y = -.4 x +.7 R =.9896 Si + Al Fe + Mn +Ni y =.55 x.36 R =.9988.149.148.147.146.145..88 core rim.144 4 =.6 ±.6 4 =.6 ±.18.84.88 p.f.u..86.76 y = -3.9 x
Διαβάστε περισσότεραΑ Ρ Ι Θ Μ Ο Σ : 6.913
Α Ρ Ι Θ Μ Ο Σ : 6.913 ΠΡΑΞΗ ΚΑΤΑΘΕΣΗΣ ΟΡΩΝ ΔΙΑΓΩΝΙΣΜΟΥ Σ τ η ν Π ά τ ρ α σ ή μ ε ρ α σ τ ι ς δ ε κ α τ έ σ σ ε ρ ι ς ( 1 4 ) τ ο υ μ ή ν α Ο κ τ ω β ρ ί ο υ, η μ έ ρ α Τ ε τ ά ρ τ η, τ ο υ έ τ ο υ ς δ
Διαβάστε περισσότεραEnantioselective Synthesis of the Anti-inflammatory Agent ( )-Acanthoic Acid
Enantioselective Synthesis of the Anti-inflammatory Agent ( )-Acanthoic Acid Taotao Ling, a Chinmay Chowdhury, a Bryan A. Kramer, a Binh G. Vong, a Michael A. Palladino b and Emmanuel A. Theodorakis a
Διαβάστε περισσότεραΒΕΛΤΙΣΤΟΠΟΙΗΣΗ ΔΟΣΗΣ ΚΑΙ ΠΟΙΟΤΗΤΑ ΕΙΚΟΝΑΣ ΣΤΗΝ ΠΑΙΔΙΑΤΡΙΚΗ ΑΞΟΝΙΚΗ ΤΟΜΟΓΡΑΦΙΑ ΜΕΣΩ ΧΡΗΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΟΥ ΑΛΓΟΡΙΘΜΟΥ ΑΝΑΚΑΤΑΣΚΕΥΗΣ ΕΙΚΟΝΑΣ (ASIR)
ΒΕΛΤΙΣΤΟΠΟΙΗΣΗ ΔΟΣΗΣ ΚΑΙ ΠΟΙΟΤΗΤΑ ΕΙΚΟΝΑΣ ΣΤΗΝ ΠΑΙΔΙΑΤΡΙΚΗ ΑΞΟΝΙΚΗ ΤΟΜΟΓΡΑΦΙΑ ΜΕΣΩ ΧΡΗΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΟΥ ΑΛΓΟΡΙΘΜΟΥ ΑΝΑΚΑΤΑΣΚΕΥΗΣ ΕΙΚΟΝΑΣ (ASIR) Μακρή Τριανταφυλλιά, Σιργιαμιώτης Βασίλειος, Τζαμίχα Έλσα,
Διαβάστε περισσότεραΝ Κ Π 6Μ Θ 5 ϑ Μ % # =8 Α Α Φ ; ; 7 9 ; ; Ρ5 > ; Σ 1Τ Ιϑ. Υ Ι ς Ω Ι ϑτ 5 ϑ :Β > 0 1Φ ς1 : : Ξ Ρ ; 5 1 ΤΙ ϑ ΒΦΓ 0 1Φ ς1 : ΒΓ Υ Ι : Δ Φ Θ 5 ϑ Μ & Δ 6 6
# % & ( ) +, %. / % 0 1 / 1 4 5 6 7 8 # 9 # : ; < # = >? 1 :; < 8 > Α Β Χ 1 ; Δ 7 = 8 1 ( 9 Ε 1 # 1 ; > Ε. # ( Ε 8 8 > ; Ε 1 ; # 8 Φ? : ;? 8 # 1? 1? Α Β Γ > Η Ι Φ 1 ϑ Β#Γ Κ Λ Μ Μ Η Ι 5 ϑ Φ ΒΦΓ Ν Ε Ο Ν
Διαβάστε περισσότεραΥΤ παιδιών στην Ελλάδα
Καθορισμός τοπικών ΔΕΑ σε εξετάσεις ΥΤ παιδιών στην Ελλάδα Συργιαμιώτης Βασίλης BSc,MSc Υποψήφιος διδάκτορας Ιατρικής Φυσικής Β Εργαστήριο Ακτινολογίας, Ιατρική Σχολή ΕΚΠΑ Περιεχόμενα Εισαγωγή Σκοπός Υλικά
Διαβάστε περισσότεραGS3. A liner offset equation of the volumetric water content that capacitance type GS3 soil moisture sensor measured
J. Jpn. Soc. Soil Phys. No. 130, p.19 25 (2015) GS3 1 2 A liner offset equation of the volumetric water content that capacitance type GS3 soil moisture sensor measured Shoichi MITSUISHI 1 and Masaru MIZOGUCHI
Διαβάστε περισσότεραμ μ μ s t j2 fct T () = a() t e π s t ka t e e j2π fct j2π fcτ0 R() = ( τ0) xt () = α 0 dl () pt ( lt) + wt () l wt () N 2 (0, σ ) Time-Delay Estimation Bias / T c 0.4 0.3 0.2 0.1 0-0.1-0.2-0.3 In-phase
Διαβάστε περισσότερα2. Α ν ά λ υ σ η Π ε ρ ι ο χ ή ς. 3. Α π α ι τ ή σ ε ι ς Ε ρ γ ο δ ό τ η. 4. Τ υ π ο λ ο γ ί α κ τ ι ρ ί ω ν. 5. Π ρ ό τ α σ η. 6.
Π Ε Ρ Ι Ε Χ Ο Μ Ε Ν Α 1. Ε ι σ α γ ω γ ή 2. Α ν ά λ υ σ η Π ε ρ ι ο χ ή ς 3. Α π α ι τ ή σ ε ι ς Ε ρ γ ο δ ό τ η 4. Τ υ π ο λ ο γ ί α κ τ ι ρ ί ω ν 5. Π ρ ό τ α σ η 6. Τ ο γ ρ α φ ε ί ο 1. Ε ι σ α γ ω
Διαβάστε περισσότεραData sheet Thick Film Chip Resistor 5% - RS Series 0201/0402/0603/0805/1206
Data sheet Thick Film Chip Resistor 5% - RS Series 0201/0402/0603/0805/1206 Scope -This specification applies to all sizes of rectangular-type fixed chip resistors with Ruthenium-base as material. Features
Διαβάστε περισσότεραΗ συμβολή του νερού στη διατήρηση της καλής σωματικής & πνευματικής υγείας και την ενυδάτωση
Η συμβολή του νερού στη διατήρηση της καλής σωματικής & πνευματικής υγείας και την ενυδάτωση Αντώνης Ζαμπέλας Kαθηγητής Διατροφής του Ανθρώπου Μονάδα Διατροφής του Ανθρώπου Τμήμα Επιστήμης και Τεχνολογίας
Διαβάστε περισσότεραΕΚΦΡΑΣΗ ΕΥΡΕΩΣ ΕΚΦΡΑΖΟΜΕΝΩΝ ΣΤΟΝ ΚΑΡΚΙΝΟ ΤΟΥ ΠΝΕΥΜΟΝΑ
Μονάδα Ανοσολογίας Καρκίνου Εργαστήριο Ανοσολογίας-Ιστοσυμβατότητας Πνευμονολογική Κλινική, Εργαστήριο Παθολογικής Ανατομικής, Θωρακοχειρουργική Κλινική, Τμήμα Ιατρικής, Πανεπιστημιακό Νοσοκομείο Λάρισας
Διαβάστε περισσότεραIV. ANHANG 179. Anhang 178
Anhang 178 IV. ANHANG 179 1. Röntgenstrukturanalysen (Tabellen) 179 1.1. Diastereomer A (Diplomarbeit) 179 1.2. Diastereomer B (Diplomarbeit) 186 1.3. Aldoladdukt 5A 193 1.4. Aldoladdukt 13A 200 1.5. Aldoladdukt
Διαβάστε περισσότεραTGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Διαβάστε περισσότεραΒελτιστοποίηση της ακτινοπροστασίας στην ενδοαγγειακή θεραπεία των περιφερικών αγγείων.
ΕΛΛΗΝΙΚΗ ΚΑΡ ΙΟΛΟΓΙΚΗ ΕΤΑΙΡΕΙΑ Σεμινάριο ομάδων εργασίας Θεσσαλονίκη,, 18 20 Φεβρουαρίου 2010 Βελτιστοποίηση της ακτινοπροστασίας στην ενδοαγγειακή θεραπεία των περιφερικών αγγείων. ΑΛΕΞΑΝΔΡΟΣ Π. ΣΑΜΑΡΤΖΗΣ
Διαβάστε περισσότεραX-Y COUPLING GENERATION WITH AC/PULSED SKEW QUADRUPOLE AND ITS APPLICATION
X-Y COUPLING GENERATION WITH AC/PULSED SEW QUADRUPOLE AND ITS APPLICATION # Takeshi Nakamura # Japan Synchrotron Radiation Research Institute / SPring-8 Abstract The new method of x-y coupling generation
Διαβάστε περισσότεραLaboratory Studies on the Irradiation of Solid Ethane Analog Ices and Implications to Titan s Chemistry
Laboratory Studies on the Irradiation of Solid Ethane Analog Ices and Implications to Titan s Chemistry 5th Titan Workshop at Kauai, Hawaii April 11-14, 2011 Seol Kim Outer Solar System Model Ices with
Διαβάστε περισσότεραSTANDARD LED LAMPS (ROUND TYPES)
Package 3 3 3 1.0 Lead High 3.4 Part No. Chip Material/Emitted Color Wave Length p Lens Appearance Absolute Maximum Ratings Pd (mw) If Electro-optical Data (At ma) Vf (V) Iv (mcd) Typ Max Typ. BL-B4541
Διαβάστε περισσότεραΚώστας Παλέτας. Μη Φαρµακευτικές Παρεµβάσεις στην υπέρταση. Παχυσαρκία και Υπέρταση. Καθηγητής Παθολογίας ΑΠΘ
Μη Φαρµακευτικές Παρεµβάσεις στην υπέρταση Παχυσαρκία και Υπέρταση Κώστας Παλέτας Καθηγητής Παθολογίας ΑΠΘ ιευθυντής Γ Παθολογικής Κλινικής ΑΠΘ Νοσοκοµείο Παπαγεωργίου Θεσσαλονίκης Ταξινόµηση Αρτηριακής
Διαβάστε περισσότεραΓΛΩΣΣΑΡΙ. Αρθρική κοτύλη. Εμπρόσθιο χείλος. Μικρή κεφαλή. Κοιλότητα Αυχενικοί σπόνδυλοι. Κορωνοειδής απόφυση. Μετωποβρεγματική ραφή.
ΓΛΩΣΣΑΡΙ Αγγλικός όρος Acetabulum Acromial process Anterior crest Arch Body of Sternum Calcaneus Capitate Capitulum Carpals Cavity Cervical Clavicle Coccyx Coracoid process Coronal suture Coronoid process
Διαβάστε περισσότερα(a) What causes the pressure represented by the arrow labelled A? (1)
Q1. Tissue fluid is formed when water and small molecules pass out of capillaries at their arterial end. The diagram shows some pressures involved in tissue fluid formation. The relative lengths of the
Διαβάστε περισσότεραElectronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information (ESI) CPh 3 as a functional group in P-heterocyclic
Διαβάστε περισσότεραCONSULTING Engineering Calculation Sheet
E N G I N E E R S Consulting Engineers jxxx 1 Structure Design - EQ Load Definition and EQ Effects v20 EQ Response Spectra in Direction X, Y, Z X-Dir Y-Dir Z-Dir Fundamental period of building, T 1 5.00
Διαβάστε περισσότεραSupplemental Table S1. Tumor specific networks are enriched with somatically mutated genes (taken from the database COSMIC)
Additional file 1 Supplemental Table S1. Tumor specific networks are enriched with somatically mutated genes (taken from the database COSMIC) COSMIC genes in tumor network COSMIC genes not in tumor network
Διαβάστε περισσότεραAn experimental and theoretical study of the gas phase kinetics of atomic chlorine reactions with CH 3 NH 2, (CH 3 ) 2 NH, and (CH 3 ) 3 N
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2015 An experimental and theoretical study of the gas phase kinetics of atomic chlorine
Διαβάστε περισσότεραSupplementary figures
A Supplementary figures a) DMT.BG2 0.87 0.87 0.72 20 40 60 80 100 DMT.EG2 0.93 0.85 20 40 60 80 EMT.MG3 0.85 0 20 40 60 80 20 40 60 80 100 20 40 60 80 100 20 40 60 80 EMT.G6 DMT/EMT b) EG2 0.92 0.85 5
Διαβάστε περισσότεραMean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O
Q1. (a) Explain the meaning of the terms mean bond enthalpy and standard enthalpy of formation. Mean bond enthalpy... Standard enthalpy of formation... (5) (b) Some mean bond enthalpies are given below.
Διαβάστε περισσότεραCycloaddition of Homochiral Dihydroimidazoles: A 1,3-Dipolar Cycloaddition Route to Optically Active Pyrrolo[1,2-a]imidazoles
X-Ray crystallographic data tables for paper: Supplementary Material (ESI) for Organic & Biomolecular Chemistry Cycloaddition of Homochiral Dihydroimidazoles: A 1,3-Dipolar Cycloaddition Route to Optically
Διαβάστε περισσότερα( ( ξ π ) & = ξ % ' $ # π θ $ # = $ θ + # θ!!"
( ) ( % + " H A R D W A R E C-arm with flat panel detector 3D scanner Navigation platform The MI3 project Minimal Invasive Interventional Imaging 3D reconstruction based on deformable models and a priori
Διαβάστε περισσότεραEnhancing σ/π-type Copper(I) thiophene Interactions by Metal Doping (Metal = Li, Na, K, Ca, Sc)
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Material (ESI) for Dalton Transactions This journal is The
Διαβάστε περισσότεραvibrational Supplementary density of the Beyer-
Supplementary Figure 1 Vibrational ion distributions and density of vibrational states (per cm -1 ). a, picene +, b, pentacene +. Thermal ion fraction distributions of picene and pentacene cations calculated
Διαβάστε περισσότεραΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ ΣΤΗΝ ΙΑΤΡΙΚΗ ΦΥΣΙΚΗ
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ ΣΤΗΝ ΙΑΤΡΙΚΗ ΦΥΣΙΚΗ ΥΠΟΛΟΓΙΣΤΙΚΗ ΤΟΜΟΓΡΑΦΙΑ ΙΠΛΗΣ ΕΝΕΡΓΕΙΑΣ : ΦΥΣΙΚΕΣ ΑΡΧΕΣ ΚΑΙ ΜΕΘΟ ΟΙ Κοντογιάννη Λουκία Μεταπτυχιακή ιπλωµατική
Διαβάστε περισσότεραΕ Κ Θ Ε Σ Η Δ Ο Κ Ι Μ Ω Ν
Αριθμός έκθεζης δοκιμών / Test report number Σειριακός αριθμός οργάνοσ / Instrument serial No T Πελάηης / Customer TOTAL Q Επγαζηήπια Διακπιβώζεων A.E. Κοπγιαλενίος 20, Τ.Κ. 11526 Αθήνα 20 Korgialeniou
Διαβάστε περισσότεραΔήμητρα Σηφάκη-Πιστόλλα
ΠΟΙΕΣ ΕΙΝΑΙ ΟΙ ΠΕΡΙΟΧΕΣ ΚΑΙ ΟΙ ΠΛΗΘΥΣΜΙΑΚΕΣ ΟΜΑΔΕΣ ΚΙΝΔΥΝΟΥ ΓΙΑ ΕΜΦΑΝΙΣΗ ΚΑΡΚΙΝΟΥ ΣΤΗΝ ΚΡΗΤΗ? ΜΙΑ ΜΕΛΕΤΗ ΤΟΥ ΠΕΡΙΦΕΡΕΙΑΚΟΥ ΚΕΝΤΡΟΥ ΚΑΤΑΓΡΑΦΗΣ ΚΑΡΚΙΝΟΥ ΚΡΗΤΗΣ ΑΠΟ ΤΟ 1992-2013 17 Ο Παγκρήτιο Ιατρικό Συνέδριο,
Διαβάστε περισσότεραω α β χ φ() γ Γ θ θ Ξ Μ ν ν ρ σ σ σ σ σ σ τ ω ω ω µ υ ρ α Coefficient of friction Coefficient of friction 1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 0 5 10 15 20 0.90 0.80 0.70 0.60 0.50 0.40 0.30
Διαβάστε περισσότεραApplications Water distribution
1 FH Series Centrifugal electric pumps according to EN 733 (ex DIN 24255). Electric pumps with pump casing in cast iron designed to pump clean, chemically non-aggressive water and liquids. Available versions:
Διαβάστε περισσότεραΔεδομένα ασφάλειας του certolizumab pegol από τα αρχεία της UCB
Click to edit Master title style 1 Δεδομένα ασφάλειας του certolizumab pegol από τα αρχεία της UCB cut-off date of 31st October 2010 Κων/να Χουχούλη Ρευματολόγος Medical Advisor Immunology Δεδομένα Click
Διαβάστε περισσότεραΚαθοδηγητικά Επίπεδα Δόσης (ΚΕΔ) στις πρακτικές της Πυρηνικής Ιατρικής
Καθοδηγητικά Επίπεδα Δόσης (ΚΕΔ) στις πρακτικές της Πυρηνικής Ιατρικής Θεόδωρος Δ. Σκούρας, Φυσικός Ιατρικής Ακτινοφυσικός Εργ. Ιατρικής Φυσικής Π.Γ.Ν.Π Υπεύθυνος Ακτινοπροστασίας εργ. Πυρηνικής Ιατρικής
Διαβάστε περισσότεραP = E /c. p γ = E /c. (p) 2 = (p γ ) 2 + (p ) 2-2 p γ p cosθ E γ. (pc) (E γ ) (E ) 2E γ E cosθ E m c Eγ
Σκέδαση Compton Το φαινόμενο Compton περιγράφει ργρ τη σκέδαση ενός φωτονίου από ένα ελεύθερο ατομικό ηλεκτρόνιο: γ + e γ + e. To φωτόνιο δεν εξαφανίζεται μετά τη σκέδαση αλλά αλλάζει κατεύθυνση και ενέργεια.
Διαβάστε περισσότεραTissue Expression Profile of Human MAGE2D1, the Ne w Member of Melanoma Antigen2encoding Gene Family
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :165 171 MAGE2D1, (, 100850) 3 MAGE2D1 (MAGE) MAGE2D, Northern blot Dot blot, 48,, 13, 7 MAGE2A 2B 2C Π,
Διαβάστε περισσότεραΙΑΤΡΙΚΗ ΑΠΕΙΚΟΝΙΣΗ ΥΠΕΡΗΧΟΓΡΑΦΙΑ
ΙΑΤΡΙΚΗ ΑΠΕΙΚΟΝΙΣΗ ΥΠΕΡΗΧΟΓΡΑΦΙΑ Γενικές Αρχές Απεικόνισης 2 Κ. Χατζημιχαήλ ΙΑΤΡΙΚΗ ΑΠΕΙΚΟΝΙΣΗ ΥΠΕΡΗΧΟΓΡΑΦΙΑ Καλώς ήλθατε..δεν ξεχνώ Ιατρική Απεικόνιση-Υπερηχογραφία Υπέρηχοι Για τη διάδοση απαιτείται
Διαβάστε περισσότεραT : g r i l l b a r t a s o s Α Γ Ί Α Σ Σ Ο Φ Ί Α Σ 3, Δ Ρ Α Μ Α. Δ ι α ν ο μ έ ς κ α τ ο ί κ ο ν : 1 2 : 0 0 έ ω ς 0 1 : 0 0 π μ
Α Γ Ί Α Σ Σ Ο Φ Ί Α Σ 3, Δ Ρ Α Μ Α g r i l l b a r t a s o s Δ ι α ν ο μ έ ς κ α τ ο ί κ ο ν : 1 2 : 0 0 έ ω ς 1 : 0 π μ Δ ι α ν ο μ έ ς κ α τ ο ί κ ο ν : 1 2 : 0 0 έ ω ς 0 1 : 0 0 π μ T ortiyas Σ ο υ
Διαβάστε περισσότεραΠΡΑΚΤΙΚΕΣ ΜΕΙΩΣΗΣ ΔΟΣΗΣ ΣΤΗΝ ΑΞΟΝΙΚΗ ΤΟΜΟΓΡΑΦΙΑ. Α. ΤΑΒΕΡΝΑΡΑΚΗ Επιμ. Α, τμήμα Αξονικού Μαγνητικού Τομογράφου ΓΝΑ <<Ο ΕΥΑΓΓΕΛΙΣΜΟΣ>>
ΠΡΑΚΤΙΚΕΣ ΜΕΙΩΣΗΣ ΔΟΣΗΣ ΣΤΗΝ ΑΞΟΝΙΚΗ ΤΟΜΟΓΡΑΦΙΑ Α. ΤΑΒΕΡΝΑΡΑΚΗ Επιμ. Α, τμήμα Αξονικού Μαγνητικού Τομογράφου ΓΝΑ ΓΕΝΙΚΑ Η ολική δόση ακτινοβολίας στο γενικό πληθυσμό έχει αυξηθεί κατά
Διαβάστε περισσότεραEnantioselective Organocatalytic Michael Addition of Isorhodanines. to α, β-unsaturated Aldehydes
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2016 Enantioselective Organocatalytic Michael Addition of Isorhodanines to α,
Διαβάστε περισσότεραΕΝΤΥΠΟ 1 Τεχνικές Προδιαγραφές
ΕΝΤΥΠΟ 1 Τεχνικές Προδιαγραφές Το παρόν έγγραφο παρουσιάζει τα τεχνικά χαρακτηριστικά των Φορητών Αισθητήρων Μέτρησης της Ποιότητας του Αέρα (IOT Wireless Nodes) που απαιτούνται για το έργο AIRTHINGS.
Διαβάστε περισσότεραSpatiotemporal footprint of the WNV in Greece 2010 2012: Analysis & Risk Αssessment in a GIS Εnvironment
Integrated surveillance and control programme for West Nile virus and malaria in Greece (MIS 365280) Spatiotemporal footprint of the WNV in Greece 2010 2012: Analysis & Risk Αssessment in a GIS Εnvironment
Διαβάστε περισσότεραElectronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information (ESI) Cyclopentadienyl iron dicarbonyl (CpFe(CO) 2 ) derivatives
Διαβάστε περισσότερα5- CACGAAACTACCTTCAACTCC-3 beta actin-r 5- CATACTCCTGCTTGCTGATC-3 GAPDH-F GAPDH-R
Table S1 Primers used in this work LncPPARδ-F 5- AGGATCCCAAGGCAGAAGTT -3 LncPPARδ-R 5- GAATAGAAAGGCGGGAAAGG -3 PPARδ-F 5- CACCCAGTGTCCTTCCATCT -3 PPARδ-R 5- CAGAATTGGGTGTGCTGCTT -3 ADRP-F 5- ACAACCGAGTGTGGTGACTC
Διαβάστε περισσότεραHours Monday Tuesday Wednesday Thursday Friday. Physics of Diagnostic Radiology. Physics of Diagnostic Radiology. Physics of Diagnostic Radiology
Second Term, Week 1 11 15 January 2010 EXAMS Physiology EXAMS Physiology EXAMS Physiology (16h): G. Panayiotakis, G. Kandarakis Lectures will be given at Computer Lab, 1 st floor, building of the School
Διαβάστε περισσότεραSupplemental tables and figures
Supplemental tables and figures Supplemental Table S1. Demographic and clinical parameters by quartiles of white Variables blood cell count. WBC quartiles( 1 9 cells/l) Q1(.6-5.3, n=2587) Q2(5.4-6.3, n=263)
Διαβάστε περισσότεραSupplementary Materials for. Kinetic and Computational Studies on Pd(I) Dimer- Mediated Halogen Exchange of Aryl Iodides
Supplementary Materials for Kinetic and Computational Studies on Pd(I) Dimer- Mediated Halogen Exchange of Aryl Iodides Indrek Kalvet, a Karl J. Bonney, a and Franziska Schoenebeck a * a Institute of Organic
Διαβάστε περισσότερα0.635mm Pitch Board to Board Docking Connector. Lead-Free Compliance
.635mm Pitch Board to Board Docking Connector Lead-Free Compliance MINIDOCK SERIES MINIDOCK SERIES Features Specifications Application.635mm Pitch Connector protected by Diecasted Zinc Alloy Metal Shell
Διαβάστε περισσότεραchlorostibine Iou-Sheng Ke and François P. Gabbai Department of Chemistry, Texas A&M University, College Station, TX
σ-donor/acceptor confused ligands: The case of a chlorostibine Iou-Sheng Ke and François P. Gabbai Department of Chemistry, Texas A&M University, College Station, TX 77843-3255. *To whom correspondence
Διαβάστε περισσότεραΚΑΡΠΟΥΖΙ / WATERMELON a b
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ REPUBLIC OF GREECE ΥΠΟΥΡΓΕΙΟ AΓΡΟΤΙΚΗΣ ΑΝΑΠΤΥΞΗΣ ΠΕΡΙΓΡΑΦΙΚΟ ΔΕΛΤΙΟ MINISTRY OF RURAL DEVELOPMENT ΚΑΙ ΤΡΟΦΙΜΩΝ DESCRIPTION FORM AND FOOD ΙΝΣΤΙΤΟΥΤΟ ΕΛΕΓΧΟΥ ΠΟΙΚΙΛΙΩΝ VARIETY RESEARCH
Διαβάστε περισσότεραENSINGER High-temperature plastics. Material standard values.
NINGR High-temperature plastics. aterial standard values. P1 PI brown 300 1,43 8 (a) 7,5 (a) 3275 3100 0,35 P21 PI C 15 black 300 1,51 (a) 4,5 (a) 3790 0,30 P1 P21 molybdenum disulphide P3 PI anthracite,
Διαβάστε περισσότεραNickel and Platinum PCP Pincer Complexes Incorporating an Acyclic Diaminoalkyl Central Moiety Connecting Imidazole or Pyrazole Rings
ickel and Platinum PCP Pincer Complexes Incorporating an Acyclic Diaminoalkyl Central Moiety Connecting Imidazole or Pyrazole Rings Braulio M. Puerta Lombardi, Rudy M. Braun, Chris Gendy, Chia Yun Chang,
Διαβάστε περισσότεραBiostatistics for Health Sciences Review Sheet
Biostatistics for Health Sciences Review Sheet http://mathvault.ca June 1, 2017 Contents 1 Descriptive Statistics 2 1.1 Variables.............................................. 2 1.1.1 Qualitative........................................
Διαβάστε περισσότερα± 20% ± 5% ± 10% RENCO ELECTRONICS, INC.
RL15 RL16, RL17, RL18 MINIINDUCTORS CONFORMALLY COATED MARKING The nominal inductance is marked by a color code as listed in the table below. Color Black Brown Red Orange Yellow Green Blue Purple Grey
Διαβάστε περισσότεραAudio Engineering Society. Convention Paper. Presented at the 120th Convention 2006 May Paris, France
Audio Engineering Society Convention Paper Presented at the 1th Convention May 3 Paris, France! " ")*)+, A System for Head Related Impulse Responses Rapid Measurement and Direct Customization Simone Fontana
Διαβάστε περισσότεραSynthesis of New Heteroscorpionate Iridium(I) and Iridium(III) Complexes
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2015 ELECTRONIC SUPPORTING INFORMATION For Synthesis of New Heteroscorpionate Iridium(I)
Διαβάστε περισσότεραFigure 1: Map of Kagera Region Tables Table 1: Percent of individual reporting illness and injury in the four weeks prior to survey, by age and gender Age Total Male Female 0-2 63.63 64.02 63.17 3-5 48.48
Διαβάστε περισσότερα5.1 logistic regresssion Chris Parrish July 3, 2016
5.1 logistic regresssion Chris Parrish July 3, 2016 Contents logistic regression model 1 1992 vote 1 data..................................................... 1 model....................................................
Διαβάστε περισσότεραSUPPORTING INFORMATION. Diastereoselective synthesis of nitroso acetals from (S,E)- -aminated
SUPPORTING INFORMATION for Diastereoselective synthesis of nitroso acetals from (S,E)- -aminated nitroalkenes via multicomponent [4 + 2]/[3 + 2] cycloadditions promoted by LiCl or LiClO 4 Leandro Lara
Διαβάστε περισσότεραΔΕΑ ΣΤΗ ΜΑΣΤΟΓΡΑΦΙΑ. Π. Κηπουρός Ακτινοφυσικός ΓΝΑ «ΑΛΕΞΑΝΔΡΑ»
Π. Κηπουρός Ακτινοφυσικός ΓΝΑ «ΑΛΕΞΑΝΔΡΑ» Η ΜΑΣΤΟΓΡΑΦΙΑ ΣΗΜΕΡΑ Film Screen (ελάχιστα σε χρήση) Computed Radiography (CR) Full Field Digital Mammography (FFDM) Digital Breast Tomosynthesis (DBT) Contrast
Διαβάστε περισσότερα22 .5 Real consumption.5 Real residential investment.5.5.5 965 975 985 995 25.5 965 975 985 995 25.5 Real house prices.5 Real fixed investment.5.5.5 965 975 985 995 25.5 965 975 985 995 25.3 Inflation
Διαβάστε περισσότερα[2] T.S.G. Peiris and R.O. Thattil, An Alternative Model to Estimate Solar Radiation
References [1] B.V.R. Punyawardena and Don Kulasiri, Stochastic Simulation of Solar Radiation from Sunshine Duration in Srilanka [2] T.S.G. Peiris and R.O. Thattil, An Alternative Model to Estimate Solar
Διαβάστε περισσότεραEulerian Simulation of Large Deformations
Eulerian Simulation of Large Deformations Shayan Hoshyari April, 2018 Some Applications 1 Biomechanical Engineering 2 / 11 Some Applications 1 Biomechanical Engineering 2 Muscle Animation 2 / 11 Some Applications
Διαβάστε περισσότεραLowara APPLICATIONS MATERIALS. General Catalogue
FH Series Centrifugal electric pumps according to EN 733 (ex DIN 24255). Electric pumps with pump casing in cast iron and impeller in AISI 36* stainless steel, designed to pump hot, cold and moderately
Διαβάστε περισσότεραPhoto-Induced Self-Assembly of Pt(II)-Linked Rings and Cages via the Photolabilization of a Pt(II) Pyridine Bond
Photo-Induced Self-Assembly of Pt(II)-Linked Rings and Cages via the Photolabilization of a Pt(II) Pyridine Bond Ken-ichi Yamashita, Kei-ichi Sato, Masaki Kawano and Makoto Fujita* Contents; Figure S1.
Διαβάστε περισσότεραSupporting Information
Supporting Information Montmorillonite KSF-Catalyzed One-pot, Three-component, Aza-Diels- Alder Reactions of Methylenecyclopropanes With Arylaldehydes and Aromatic Amines Li-Xiong Shao and Min Shi* General
Διαβάστε περισσότεραTECHNICAL DATA Date 12/22/15 Series 50GF22.2
TECHNICAL DATA Date 12/22/15 Series 50GF22.2 GF MOTOR SPECIFICATIONS Motor Design Applications Insulation Class Maximum Liquid Temp Frequency RPM Air Filled Waste Water Class B 0-40 C ( 32-104 F ) 60 HZ
Διαβάστε περισσότεραl 0 l 2 l 1 l 1 l 1 l 2 l 2 l 1 l p λ λ µ R N l 2 R N l 2 2 = N x i l p p R N l p N p = ( x i p ) 1 p i=1 l 2 l p p = 2 l p l 1 R N l 1 i=1 x 2 i 1 = N x i i=1 l p p p R N l 0 0 = {i x i 0} R
Διαβάστε περισσότεραElectronic Supplementary Information
Electronic Supplementary Information Cucurbit[7]uril host-guest complexes of the histamine H 2 -receptor antagonist ranitidine Ruibing Wang and Donal H. Macartney* Department of Chemistry, Queen s University,
Διαβάστε περισσότεραThe Echellograms and Response Functions from zj to M bands Calculated by Echelle Simulator V0.9 for IRCS
The Echellograms and Response Functions from zj to M bands Calculated by Echelle Simulator V0.9 for IRCS Tae-Soo Pyo pyo@subaru.naoj.org Subaru Telescope National Astronomical Observatory of Japan April
Διαβάστε περισσότεραΔΕΑ στην MDCT: Διεθνής βιβλιογραφία και τα πρώτα στοιχεία από την Ελλάδα
ΔΕΑ στην MDCT: Διεθνής βιβλιογραφία και τα πρώτα στοιχεία από την Ελλάδα Γιώργος Σημαντηράκης Τμήμα Αδειών & Ελέγχων Ελληνική Επιτροπή Ατομικής Ενέργειας www.eeae.gr Εισαγωγή Διαγνωστικά Επίπεδα Αναφοράς
Διαβάστε περισσότεραLowara SPECIFICATIONS
SH Series Centrifugal pumps entirely made of AISI 36 stainless steel according to EN 733 (ex DIN 24255). Designed to pump hot, cold and moderately aggressive liquids. Available versions: SHE Close-coupled
Διαβάστε περισσότεραSupplementary Information
Electronic upplementary Material (EI) for Photochemical & Photobiological ciences. This journal is The Royal ociety of Chemistry and wner ocieties 214 upplementary Information elective and sensitive fluorescence-shift
Διαβάστε περισσότεραChin J Osteoporos April 2011 Vol 17 No. 4 Published online www. wanfangdate. com. cn doi / j. issn
312 Published online www. wanfangdate. com. cn doi 10. 3969 / j. issn. 1006-7108. 2011. 04. 007 R681 A 1006-7108 2011 04-0312-05 fat mass lean mass 414 1020 Hologic Delphi A X fat mass lean mass 1 2 Lean
Διαβάστε περισσότεραΟΞΕΙΕΣ ΥΠΕΡΓΛΥΚΑΙΜΙΚΕΣ ΚΑΤΑΣΤΑΣΕΙΣ
ΟΞΕΙΕΣ ΥΠΕΡΓΛΥΚΑΙΜΙΚΕΣ ΚΑΤΑΣΤΑΣΕΙΣ ΚΑΛΛΙΟΠΗ ΚΩΤΣΑ ΛΕΚΤΟΡΑΣ ΕΝΔΟΚΡΙΝΟΛΟΓΙΑΣ ΤΜΗΜΑ ΕΝΔΟΚΡΙΝΟΛΟΓΙΑΣ, ΔΙΑΒΗΤΗ, ΜΕΤΑΒΟΛΙΣΜΟΥ Α ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΝΟΣΟΚΟΜΕΙΟ ΑΧΕΠΑ ΔΙΑΒΗΤΙΚΗ ΚΕΤΟΞΕΩΣΗ ΥΠΕΡΓΛΥΚΑΙΜΙΚΟ ΥΠΕΡΩΣΜΩΤΙΚΟ
Διαβάστε περισσότεραExperimental Study of Dielectric Properties on Human Lung Tissue
32 2 2013 4 Chinese Journal of Biomedical Engineering Vol. 32 No. 2 April 2013 1 1* 2 1 300072 2 300052 Agilent 4294A 100 Hz ~ 100 MHz Cole-Cole 3 ~ 5 1. 6 ~ 3. 3 R α τ f c P < 0. 05 EIT R318 A 0258-8021
Διαβάστε περισσότεραΆσκηση 10, σελ. 119. Για τη μεταβλητή x (άτυπος όγκος) έχουμε: x censored_x 1 F 3 F 3 F 4 F 10 F 13 F 13 F 16 F 16 F 24 F 26 F 27 F 28 F
Άσκηση 0, σελ. 9 από το βιβλίο «Μοντέλα Αξιοπιστίας και Επιβίωσης» της Χ. Καρώνη (i) Αρχικά, εισάγουμε τα δεδομένα στο minitab δημιουργώντας δύο μεταβλητές: τη x για τον άτυπο όγκο και την y για τον τυπικό
Διαβάστε περισσότεραEstimation, Evaluation and Guarantee of the Reverberant Speech Recognition Performance based on Room Acoustic Parameters
Vol.21-SLP-83 No.9 21/1/29 1 Estimation, Evaluation and Guarantee of the Reverberant Speech Recognition Performance based on Room Acoustic Parameters Takanobu Nishiura 1 We study on estimation, evaluation
Διαβάστε περισσότεραSAW FILTER - RF RF SAW FILTER
FEATURES - Frequencies from 0MHz to 700MHz - Custom specifications available - Industry standard package configurations - Low-loss saw component - Low amplitude ripple - RoHS compliance - Electrostatic
Διαβάστε περισσότεραΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΛΕΩΝΙΔΑΣ Α. ΣΠΥΡΟΥ. 2004 2009 Διδακτορικό σε Υπολογιστική Εμβιομηχανική, Τμήμα Μηχανολόγων Μηχανικών, Πανεπιστήμιο Θεσσαλίας.
ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΛΕΩΝΙΔΑΣ Α. ΣΠΥΡΟΥ ΔΙΕΥΘΥΝΣΗ Ινστιτούτο Έρευνας και Τεχνολογίας Θεσσαλίας (ΙΕΤΕΘ) Εθνικό Κέντρο Έρευνας και Τεχνολογικής Ανάπτυξης (ΕΚΕΤΑ) Δημητριάδος 95 και Παύλου Μελά 38333 Βόλος
Διαβάστε περισσότεραSelf-Lubricating Rod End > Spherical Bearings Product Overview
Self-Lubricating Product Overview Table of Contents FMW3E_.4 / NSA8143 FMW3F_.4 / NSA8149 REM REF EN6056 Page IV-3-4 IV-5-6 IV-7-8 IV-9-10 IV-11-12 FMW3E_.4 / NSA8143 NSA8143-04 X R F P FMW3E 4 4 X R K
Διαβάστε περισσότεραBALL VALVE NP - LEVE 754. Range of application: Temperature range: Perform standard: Order information: Paint: Soft seal Ball valve.
Soft seal Ball valve Unilateral spring washer Seat Float ball valve Flange PN16-40 DN15-200 Range of application: In industrial facilities, oil and chemical industry and related manufacturing industries
Διαβάστε περισσότεραRECIPROCATING COMPRESSOR CALCULATION SHEET
Gas properties, flowrate and conditions 1 Gas name Air RECIPRCATING CMPRESSR CALCULATIN SHEET WITH INTERCLER ( Sheet : 1. f 4.) Item or symbol Quantity Unit Item or symbol Quantity Unit 2 Suction pressure,
Διαβάστε περισσότερα