Οταν επώασαν σε Ιn vitro σύστηµα πρωτεϊνοσυνθέσεως

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Οταν επώασαν σε Ιn vitro σύστηµα πρωτεϊνοσυνθέσεως"

Transcript

1 Οι Ενδείξεις οι οποίες υποστηρίζουν οτι η αναστολή της πρωτεϊνοσυνθέσεως από τους αναστολείς HCR και DAI εξασφαλίζεται µέσω της αντεπίδρασης µε τον eif-2 είναι πολλές η σηµαντικότερη οµως είναι µία Οταν επώασαν σε Ιn vitro σύστηµα πρωτεϊνοσυνθέσεως τον eif-2 µε τον HCR παρουσία σηµασµένου ΑΤΡ και στην συνέχεια ανέλυσαν τις σηµασµένες πρωτεΐνες µε ηλεκτροφόρηση και αυτοραδιογραφία διαπίστωσαν Οτι µόνο η daltons υποµονάδα του παράγοντα έναρξης eif-2 ήταν ραδιενεργός ένδειξη που υπεδείκνυε ότι στην διαδικασία αναστολής εµπλέκεται η φωσφορυλίωση του συγκεκριµένου παράγοντα

2 Για την διερεύνηση των αποτελεσµάτων αυτών οι διάφορες ερευνητικές οµάδες χρησιµοποίησαν δύο διαφορετικές προσεγγίσεις Στην πρώτη προσέγγιση Επώασαν τον HCR σε In vitro σύστηµα πρωτεϊνοσυνθέσεως στο οποίο υπήρχε πλήρως καθαρισµένος παράγοντας έναρξης eif-2. 2.Τα αποτελέσµατα από ένα τέτοιο πείραµα δείχνουν ότι ο HCR δεν έχει την ικανότητα να επηρεάσει τον σχηµατισµό τετραµερούς συµπλέγµατος Στην δεύτερη προσέγγιση.επώασαν HCR µέσα σε ένα σύστηµα πρωτεϊνοσυνθέσεως το οποίο περιείχε µερικά µόνο παράγοντα έναρξης eif-2.τα αποτελέσµατα από τέτοια πειράµατα δείχνουν ότι στην περίπτωση αυτή ο παράγοντας αναστολής παρεµποδίζει τον σχηµατισµό τετραµερούς συµπλέγµατος

3 Οι απαντήσεις πού πήραν οι διάφορες ερευνητικές οµάδες από τα πειράµατα που έγιναν µε την χρησιµοποίηση του eif-2 ηταν συχνά αντικρουόµενες Κοινό χαρακτηριστικό όλων των πειραµατικών προσεγγίσεων η αναστολή της πρωτεινοσύνθεσης όταν χρησιµοποιείται φωσφορυλιωµένος παράγοντας έναρξης αλλά µόνο όταν οι αντιδράσεις γινόταν παρουσία διαφορων παραγόντων πού αποµονωνόταν από τα ριβοσώµατα Πράγµα πού µε άλλα λόγια σηµαίνει ότι µόνο στις περιπτώσεις πού για τις διάφορες αντιδράσεις της πρωτεϊνοσυνθέσεως χρησιµοποιούντο µη καθαρά ριβοσώµατα µπορεί κανείς να παρατηρήσει ξεκάθαρα την ανασταλτική ικανότητα του φωσφορυλιωµένου παράγοντα έναρξης

4 Για να δειχθεί ότι µόνο η φωσφορυλίωση του παράγοντα έναρξης 2 (eif-2) ήταν υπεύθυνη για την αναστολή έπρεπε να γίνουν δύο πειράµατα ελέγχου Να δειχθεί ότι ο φωσφορυλιωµένος παράγοντας έναρξης 2 (eif-2) είναι ανενεργός σε In vitro συστήµατα ως πρός µια από τις λειτουργίες του Η αποµάκρυνση µε µια φωσφατάση της φωσφορικής οµάδας από τον παράγοντα έναρξης 2 (eif-2) να έχει σαν συνέπεια την επαναφορά της πρωτεινοσύνθεσης στα κανονικά επίπεδα

5 Ρυθµιση της Φωσφορυλίωσης του eif-2 Μέχρι σήµερα πιστευόταν οτι µία ή περισσότερες πρωτεινικές κινάσες υπάρχουν σε αδρανή µορφή στα ζωικά κύτταρα και ενεργοποιούνται υπο ωρισµένας συνθήκας για να φωσφορυλιώσουν τον eif-2 και να αδρανοποιήσουν την πρωτεινοσύνθεση Εχει δειχθεί οτι στα δικτυοκύτταρα υπάρχουν κινάσες που ενεργοποιούνται µε τον HCR και τον DAI Σήµερα εχει βρεθεί µια 67Kda πρωτείνη η οποία προστρατευει τον eif-2 απο την φωσφορυλίωση Σήµερα πιστευεται οτι η κινάση του eif-2 είναι πάντα ενεργός εξαρταται οµως αν λειτουργεί ή οχι από την παρουσία της p67 στο σύστηµα Υπό ωρισµένας συνθήκας οπως κατά την διάρκεια ελλειψης αίµης στα δικτυοκύτταρα η p67 αποικοδοµείται αφήνοντας ευπρόσβλητο τον eif-2 στην φωσφορυλίωση

6 Έγινε έλεγχος της Ενεργότητος του φωσφορυλιωµένου και µη φωσφορυλιωµένου eif-2 στις παρακάτω αντιδράσεις ΚαταΚατα τον σχηµατισµό τού διµερούς συµπλέγµατος µε GTP ή GDP Κατά Κατά τον σχηµατισµό του τετραµερούς συµπλεγµατος eif-2 2 Met-t-RNAf GTP

7 Κατά την φωσφορυλίωση του eif-2 σύµφωνα µε το µοντέλο υποστηρίζεται οτι επισυµβαίνουν οι εξής µεταβολές Παρεµποδίζεται η αποµάκρυνση του GDP από το σύµπλεγµα eif-2 2 GDP Η Η παρουσία GDP στο σύµπλεγµα πιθανά να επηρεάζει την τριτοταγή διαµόρφωση µε συνέπεια του υπεύθυνου για την ανταλλαγή παράγοντος eif-2b να γίνεται προβληµατική

8

9 Το 1958 για πρώτη φορά δηµοσιεύεται οτι όταν κάποιος ιός µολύνει µια σειρά κυττάρων είτε αυτά ανήκουν σε ζώα ή σε κυτταρικές καλλιέργειες η πρώτη µόλυνση επηρεάζει την ικανότητα άλλων ασχέτων ιών να επιµολύνουν τα ίδια τα κύτταρα Με άλλα λόγια µπορεί κανείς να υποστηρίξει ότι µετά την επίδραση του πρώτου ιού τα κύτταρα αποκτούν ενα ανοσοποιητικό σύστηµα µε το οποίο µπορούν να ανθίστανται στις µετέπειτα µολύνσεις Τα κύτταρα το κατορθώνουν αυτό µε την έκκριση από τα µολυσµένα κύτταρα µιας ουσίας πού ονοµάζεται Ιντερφερόνη Η Ιντερφερόνη απλά παρεµβαίνει στα αλλα κύτταρα και µέσα από την επαγωγή της σύνθεσης κάποιων πρωτεινών παρεµβαίνει στην µετάφραση των µηνυµάτων των ιών

10 Λειτουργίες των Ιντερφερονών ΟιΟι Ιντερφερόνες ανήκουν στην µεγάλη υπεροµάδα των κυτοκινών οι οποίες έχουν ως λειτουργία να µεταφέρουν το µήνυµα από το ένα κύτταρο στο άλλο Οι Οι ιντερφερόνες φαίνεται να τροποποιούν τις ενεργότητες των διαφόρων στοιχείων του ανοσοποιητικού συστήµατος και κατ αυτό τον τρόπο να αυξάνουν την ικανότητα του συστήµατος να αµύνεται στις προσβολές τις οποίες υφίσταται από τους περισσότερους παράγοντες που προκαλούν τις διάφορες ασθένειες Οι Οι Ιντερφερόνες φαίνεται να προωθούν ή να καταστέλλουν την διαφοροποίηση µπορούν να αναστέλλουν την κυτταρική διαίρεση που µπορεί εν µέρει τουλάχιστον να ερµηνεύσει την παρέµβαση στο διπλασιασµό των καρκινικών κυττάρων

11 Κύριο Ερώτηµα όσον Αφορά την δράση των Ιντερφερονών Πώς µε την δέσµευση των διαφόρων τύπων Ιντερφερονών στους αντιστοίχους υποδοχείς τα κύτταρα καθίστανται ικανά να ανθίστανται στούς ιούς να προωθούν την κυτταροδιαφοροποίση ή να αναστέλλουν την κυτταρική διαίρεση Είναι εδώ και αρκετά καιρό γνωστό ότι οι Ιντερφερόνες σε συνεργασία µε άλλες πρωτείνες οι οποίες παίρνουν οδηγίες επίσης από τα κύτταρα εστιάζουν την ενεργότητα τους στην ενεργοποίηση των δρόµων µεταγωγής

12 Σύµφωνα µε τις απόψεις του Darnell ακολουθείται η παρακάτω πορεία Η δέσµευση του τυπου Ι της Ιντερφερόνης στους υποδοχείς καταλήγει στην ενεργοποίηση ενός ενζύµου πού ονοµάζεται κινάση της τυροσίνης 2 (Tyr( K2).H κινάση της τυροσίνης είναι προσκολληµένη στο ενδοκυτταρικό τµήµα του υποδοχέα Σύγχρονα µε την κινάση της τυροσίνης φαίνεται να ενεργοποιείται η Janus kinase Οι κινάσες αυτές µαζί η χωριστά φωσφορυλιώνουν τρεις πρωτεϊνες που ονοµάζονται stat (Signal Transducers) 113,91 και 84 Με την φωσφορυλίωση οι παράγοντες επάγονται και ενώνονται ο ένας µε τον άλλο και µε µια πρωτεΐνη 48 Kda και σχηµατίζουν ένα πλέγµα Τα γονίδια στα οποία δεσµεύεται το πλέγµα και τα οποία είναι εκείνα τα οποία στην συνέχεια ενεργοποιούνται περιέχουν ειδικές ακολουθίες βάσεων στην περιοχή του προµότορα

13 Τρόπος δράσης της Ιντερφερόνης Υπάρχουν δύο τρόποι µε τους οποίους η Ιντερφερόνη ρυθµίζει την µετάφραση των διαφόρων µηνυµάτων Με επαγωγή της πρωτεϊνικής κινάσης η οποία φωσφορυλιώνει την µικρή υποµονάδα του eif-2 Με επαγωγή του ενζύµου Ολιγοισοαδενυλικής συνθετάσης αυτή παρουσία ΑΤΡ µετατρέπει ΑΤΡ σε ολιγοαδενυλικό νουκλεοτίδιο το οποίο µε την σειρά του ενεργοποιεί µια ριβονουκλεάση F Η Η προσθήκη της Ριβονουκλεάσης µαζί µε το ολιγονουκλεοτίδιο ενεργοποιητή σε εκχύλισµα L κυττάρων πού δεν έχουν κατεργασθεί µε Ιντερφερόνη προκαλεί µια ελάττωση στο σχηµατισµό των πολυριβοσωµάτων και στην συνέχεια µια συσσώρευση στο σύµπλεγµα έναρξης

14 Θεωρίες µε τις οποίες γίνεται προσπάθεια να απαντηθεί το ερώτηµα Πως µη ειδικοί αναστολείς µπορούν να επηρεάζουν ειδικά την µετάφραση των µηνυµάτων των ιών ΜεΜε την δράση της νουκλεάσης το 2,5 ολιγοαδενυλικό το οποίο απαιτείται για την ενεργοποίηση αποικοδοµείται πάρα πολύ γρήγορα στην θέση που συντίθεται υπό την επίδραση του δίκλωνου RNA. Έτσι η δράση της νουκλεάσης περιορίζεται στ ο δίκλωνο RNA του ιού και δεν επεκτείνεται σε άλλα RNA του κυττάρου Το Το κύτταρο µπορεί να είναι ικανό να ανταποκρίνεται στην δράση της νουκλεάσης αυξάνοντας την σύνθεση του RNA που αποικοδοµείται και έτσι µπορεί να επαναλαµβάνει την πρωτεινοσύνθεση µετά την καταστροφή των ιών

15

16 Συστήµατα µεταφραστικού ελέγχου έχουν εντοπισθεί και σε κύτταρα τα οποία µολύνονται από διάφορους ιούς Μόλυνση του Κυττάρου από Πολυιό Το Το mrna τού ιού δεν φέρει καπέλο στο 5 άκρο και κατά συνέπεια δεν χρειάζεται να σχηµατίσει λειτουργικό σύµπλεγµα µε τον eif-4f για να µεταφρασθεί Στην Στην συνέχεια ο ιός ανενεργοποιεί το σύµπλεγµα µε τον eif-4f που σχηµατίζουν τα µηνύµατα τού κυττάρου ξενιστού αποικοδοµώντας την daltons του eif-4f

17 Ιός Εγκεφαλοµυοκαρδίτιδος ΤοΤο mrna του ιού δεν φέρει κάλυµµα στο 5 άκρο όπως και το µήνυµα του πολυιού Το Το mrna του ιού έχει µεγαλύτερη συγγένεια να δεσµεύει τον παράγοντα eif-4b από ότι έχουν τα κυτταρικά mrna έτσι κατορθώνει και παρεµποδίζει την µετάφραση των µηνυµάτων του κυττάρου ξενιστού Το Το mrna του ιού της εγκεφαλοµυοκαρδίτιδος µπορεί να µεταφράζεται σε κύτταρα πού έχουν µολυνθεί από πολυιό. Αυτό είναι µια επιπλέον ένδειξη ότι το µήνυµα του ιού δεν εχει κάλυµµα και κατά συνέπεια δεν εχει ανάγκη τον παράγοντα έναρξης eif-4f

18 Στο σύστηµα Ανάπτυξης του Αχινού Εγιναν οι παρακάτω διαπιστωσεις που σχετίζονται µε τον Μεταφραστικό Ελεγχο Τα µη γονιµοποιηµένα αυγά έδειχναν πάρα πολύ χαµηλή πρωτεινοσυνθετική ικανότητα σε σύγκριση µε εκείνη την οποία δείχνουν όταν γονιµοποιηθούν Στα µη γονιµοποιηµένα αυγά υπάρχει µεγάλη ποσότητα καλυµµένου RNA το οποίο αποκαλύπτεται µετά την γονιµοποίηση Η Η πρωτεινοσύνθεση σε οµογενοποίηµα µη γονιµοποιηµένων αυγών διεγείρεται οταν προστεθεί ο eif-2 ή ο GEF o οποίος καταλύει την ανακύκλωση του eif-2 µεταξύ δύο διαδοχικών κύκλων έναρξης Πρέπει να σηµειωθεί ότι και οι δύο αυτοί παράγοντες καµµία σχέση δεν εχουν µε αποκάλυψη του µηνύµατος

19 Ο παράγοντας eif-4f και eif-4e επάγουν την µετάφραση σ αυτό το σύστηµα και η δράση τους είναι προσθετική µε εκείνη του GEF Μετά την γονιµοποίηση των αυγών παρατηρειται φωσφορυλίωση της Daltons υποµονάδας του eif-4f και αποφωσφορυλίωση της Daltons υποµονάδας του eif-2

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα ΣτονΣτον ρόλο των διαφόρων οµάδων των ριβοσωµικών πρωτεινών. Κατά πόσο δηλαδή υπάρχει ετερογένεια στις

Διαβάστε περισσότερα

Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία

Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία Στην μελέτη του ριβοσώματος, των στοιχείων που το συγκροτούν αλλά και του τρόπου με τον οποίο αυτά

Διαβάστε περισσότερα

Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από

Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από Τα επίπεδα του mrna πού είναι διαθέσιμα για την μετάφραση προσδιορίζονται Από την ταχύτητα σύνθεσης του μηνύματος κατά την πορεία της μεταγραφής Από την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης Από

Διαβάστε περισσότερα

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που κωδικοποιούν για τις πρωτεϊνες που επάγονται από το θερµικό

Διαβάστε περισσότερα

ΜΟΝΟΠΑΤΙΑ ΕΝΔΟΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΓΩΓΗΣ ΣΗΜΑΤΟΣ

ΜΟΝΟΠΑΤΙΑ ΕΝΔΟΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΓΩΓΗΣ ΣΗΜΑΤΟΣ ΜΟΝΟΠΑΤΙΑ ΕΝΔΟΚΥΤΤΑΡΙΚΗΣ ΜΕΤΑΓΩΓΗΣ ΣΗΜΑΤΟΣ Το ένζυμο Αδενυλική κυκλάση, υπεύθυνο για τη βιοσύνθεση του camp. Το camp είναι ένα παράδειγμα μορίου «αγγελιοφόρου» καθοδικά των G πρωτεινών Αύξηση του camp

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012 ÓÕÍÅÉÑÌÏÓ. Ηµεροµηνία: Κυριακή 1 Απριλίου 2012

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012 ÓÕÍÅÉÑÌÏÓ. Ηµεροµηνία: Κυριακή 1 Απριλίου 2012 ΤΑΞΗ: ΜΑΘΗΜΑ: ΘΕΜΑ A Α1-δ, Α2-δ, Α3-γ, Α4-β, Α5-δ ΘΕΜΑ B Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ / ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Ηµεροµηνία: Κυριακή 1 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ Β1. Οι µεταβολές της θερµοκρασίας του εξωτερικού περιβάλλοντος

Διαβάστε περισσότερα

Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος

Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος MOPIAKH BIOΛOΓIA ΦAPMAKEYTIKHΣ ΔIAΛEΞΕΙΣ 10-12 Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος (Πως γίνονται αντιληπτά τα μηνύματα και πως δίδονται οι απαντήσεις) Δρ. Xρήστος Παναγιωτίδης, Tµήµα Φαρµακευτικής

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

ΘΕΩΡΙΑ 3 η ΠΑΡΟΥΣΙΑΣΗ. ΚΥΤΤΑΡΟΚΙΝΕΣ ή ΚΥΤΤΟΚΙΝΕΣ Dr ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ

ΘΕΩΡΙΑ 3 η ΠΑΡΟΥΣΙΑΣΗ. ΚΥΤΤΑΡΟΚΙΝΕΣ ή ΚΥΤΤΟΚΙΝΕΣ Dr ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ ΘΕΩΡΙΑ 3 η ΠΑΡΟΥΣΙΑΣΗ ΚΥΤΤΑΡΟΚΙΝΕΣ ή ΚΥΤΤΟΚΙΝΕΣ Dr ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ Είδαμε ότι οι ΜΗΧΑΝΙΣΜΟΙ ΜΗ ΕΙΔΙΚΗΣ ΑΝΟΣΙΑΣ είναι 1. Ανατομικοί φραγμοί - Δέρμα - Βλεννώδεις

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: Α1. Η φαγοκυττάρωση

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΑ «ΟΜΟΚΕΝΤΡΟ» Α. ΦΛΩΡΟΠΟΥΛΟΥ

ΦΡΟΝΤΙΣΤΗΡΙΑ «ΟΜΟΚΕΝΤΡΟ» Α. ΦΛΩΡΟΠΟΥΛΟΥ Τ λεµφοκύτταρα µνήµης (βοηθητικά Τ λεµφοκύτταρα µνήµης και κυτταροτοξικά Τ λεµφοκύτταρα µνήµης). Ο τερµατισµός της δευτερογενούς ανοσοβιολογικής απόκρισης γίνεται µε την βοήθεια των κατασταλτικών Τ λεµφοκυττάρων.

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 22 (+κεφ. 17 Hartwell) Γενετική του καρκίνου Η πρωτεΐνη p53 προσδένεται στο DNA. 2 ΕΙΚΟΝΑ 22.1 Μαστογραφία που απεικονίζει έναν όγκο. Όγκος 3 Κύρια σημεία: Καρκίνος

Διαβάστε περισσότερα

Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ. Βιολογία

Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ. Βιολογία Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ Βιολογία ΘΕΜΑ 1 Στις ερωτήσεις 1 5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ποιο

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Τα κύτταρα που παράγουν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΒΛΗΜΑΤΑ ΣΤΗΝ ΕΙΔΙΚΗ ΑΜΥΝΑ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΒΛΗΜΑΤΑ ΣΤΗΝ ΕΙΔΙΚΗ ΑΜΥΝΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΒΛΗΜΑΤΑ ΣΤΗΝ ΕΙΔΙΚΗ ΑΜΥΝΑ 1. Σε ένα πειραματόζωο τη χρονική στιγμή t1 γίνεται ένεση με το αντιγόνο Α και τη χρονική στιγμή t2 γίνεται ένεση με τα αντιγόνα Α και Β

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: Α1. Η φαγοκυττάρωση

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 Στις ερωτήσεις 1-5 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Οι ιοί είναι :

Διαβάστε περισσότερα

2 Ο ΜΑΘΗΜΑ ΣΥΣΤΗΜΑ ΣΥΜΠΛΗΡΩΜΑΤΟΣ ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ

2 Ο ΜΑΘΗΜΑ ΣΥΣΤΗΜΑ ΣΥΜΠΛΗΡΩΜΑΤΟΣ ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ 2 Ο ΜΑΘΗΜΑ ΣΥΣΤΗΜΑ ΣΥΜΠΛΗΡΩΜΑΤΟΣ ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ ΜΗΧΑΝΙΣΜΟΙ ΜΗ ΕΙΔΙΚΗΣ ΑΝΟΣΙΑΣ 1. Ανατομικοί φραγμοί - Δέρμα - Βλεννώδεις μεμβράνες 2. Φυσιολογικοί φραγμοί

Διαβάστε περισσότερα

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Οι

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

ΡΥΘΜΙΣΗ ΤΗΣ ΓΛΥΚΟΛΥΣΗΣ, ΓΛΥΚΟΝΕΟΓΕΝΕΣΗ & ΟΜΟΙΟΣΤΑΣΙΑ ΤΗΣ ΓΛΥΚΟΖΗΣ

ΡΥΘΜΙΣΗ ΤΗΣ ΓΛΥΚΟΛΥΣΗΣ, ΓΛΥΚΟΝΕΟΓΕΝΕΣΗ & ΟΜΟΙΟΣΤΑΣΙΑ ΤΗΣ ΓΛΥΚΟΖΗΣ ΡΥΘΜΙΣΗ ΤΗΣ ΓΛΥΚΟΛΥΣΗΣ, ΓΛΥΚΟΝΕΟΓΕΝΕΣΗ & ΟΜΟΙΟΣΤΑΣΙΑ ΤΗΣ ΓΛΥΚΟΖΗΣ Σύνοψη: Ρύθμιση Γλυκόλυσης Στάδια γλυκόλυσης 1 ο Στάδιο: Δέσμευση & ενεργοποίηση γλυκόζης Εξοκινάση 6-Φωσφορική Γλυκόζη (-ΑΤΡ), Iσομεράση

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ (Γενετικό υλικό των βακτηρίων ρύθμιση της γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 Γενετικό υλικό των βακτηρίων Αποτελείται από ένα μόριο DNA σε υπερελιγμένη μορφή και τα άκρα του

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΕΦΑΛΑΙΟ 1(ΥΓΕΙΑ-ΑΝΘΡΩΠΟΣ)

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΕΦΑΛΑΙΟ 1(ΥΓΕΙΑ-ΑΝΘΡΩΠΟΣ) ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΕΦΑΛΑΙΟ 1(ΥΓΕΙΑ-ΑΝΘΡΩΠΟΣ) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: 1. Οι ιοί αποτελούνται

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Εικόνα 25.1 Το αυτο-µάτισµα του πρώιµου rrna 35S της Tetrahymena thermophila µπορεί να µελετηθεί µε ηλεκτροφόρηση σε πήκτωµα. Το αποδεσµευµένο ιντρόνιο σχηµατίζει

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ Ο μεταβολισμός (του υδατάνθρακα) γλυκογόνου (Gn) Gn μια ενδιάμεση και άμεσα κινητοποιούμενη πηγή ενέργειας Ποσότητα (ενέργειας) λίπη > γλυκογόνο > Γλυκόζη

Διαβάστε περισσότερα

προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

Ρύθµιση κυτταρικής λειτουργίας. Μεταγωγή σήµατος

Ρύθµιση κυτταρικής λειτουργίας. Μεταγωγή σήµατος Ρύθµιση κυτταρικής λειτουργίας Μεταγωγή σήµατος 1 Εισαγωγή Η διαδικασία εξέλιξης των πολυκύτταρων οργανισµών (πρίν 2.5 δις χρόνια) άρχισε πολύ πιο αργά από την ύπαρξη των µονοκύτταρων οργανισµών (πρίν

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ).

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Αθήνα, 30/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Η

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

ΘΕΜΑ Γ Ένας άνθρωπος μολύνεται από ιό. Το παρακάτω διάγραμμα απεικονίζει τις συγκεντρώσεις των αντιγόνων και των αντισωμάτων σε συνάρτηση με το χρόνο.

ΘΕΜΑ Γ Ένας άνθρωπος μολύνεται από ιό. Το παρακάτω διάγραμμα απεικονίζει τις συγκεντρώσεις των αντιγόνων και των αντισωμάτων σε συνάρτηση με το χρόνο. ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Ποιες είναι οι προϋποθέσεις που πρέπει να τηρούνται για την αποφυγή µετάδοσης ασθενειών που οφείλονται σε παθογόνους µικροοργανισµούς;

Ποιες είναι οι προϋποθέσεις που πρέπει να τηρούνται για την αποφυγή µετάδοσης ασθενειών που οφείλονται σε παθογόνους µικροοργανισµούς; ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Ποιες είναι οι προϋποθέσεις που πρέπει να τηρούνται για την αποφυγή µετάδοσης ασθενειών που οφείλονται σε παθογόνους µικροοργανισµούς; ΘΕΜΑ Β ίνεται το παρακάτω

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ. Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό

ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ. Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό Πείραμα Griffith (1928) o O Griffith ήταν Βρετανός βακτηριολόγος του οποίου το ερευνητικό ενδιαφέρον

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΑΠΟΦΟΙΤΟΙ ΗΜΕΡΟΜΗΝΙΑ: 24/01/2016 ΕΠΙΜΕΛΕΙΑ ΘΕΜΑΤΩΝ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Κεφάλαιο 3 ΜΕΤΑΒΟΛΙΣΜΟΣ

Κεφάλαιο 3 ΜΕΤΑΒΟΛΙΣΜΟΣ Κεφάλαιο 3 ΜΕΤΑΒΟΛΙΣΜΟΣ 3.1 Ενέργεια και οργανισμοί Όλοι οι οργανισμοί, εκτός από αυτούς από αυτούς που έχουν την ικανότητα να φωτοσυνθέτουν, εξασφαλίζουν ενέργεια διασπώντας τις θρεπτικές ουσιές που περιέχονται

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

Πρώτα μηνύματα: ορμόνες, νευροδιαβιβαστές, παρακρινείς/αυτοκρινείς παράγοντες που φθάνουν στηνκμαπότονεξωκυττάριοχώροκαιδεσμεύονται με ειδικούς

Πρώτα μηνύματα: ορμόνες, νευροδιαβιβαστές, παρακρινείς/αυτοκρινείς παράγοντες που φθάνουν στηνκμαπότονεξωκυττάριοχώροκαιδεσμεύονται με ειδικούς Πρώτα μηνύματα: ορμόνες, νευροδιαβιβαστές, παρακρινείς/αυτοκρινείς παράγοντες που φθάνουν στηνκμαπότονεξωκυττάριοχώροκαιδεσμεύονται με ειδικούς κυτταρικούς υποδοχείς Δεύτερα μηνύματα: μη-πρωτεϊνικές ουσίες

Διαβάστε περισσότερα

Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης

Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης Καθώς το οξυγόνο χρησιμοποιείται στους ιστούς παράγεται CO2 το οποίο πρέπει να μεταφερθεί πίσω στους πνεύμονες ή τα βράγχια

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Βασικοί μηχανισμοί προσαρμογής

Βασικοί μηχανισμοί προσαρμογής ΣΥΓΚΡΙΤΙΚΗ ΦΥΣΙΟΛΟΓΙΑ ΖΩΩΝ 23-24, 18/4/2016 Π.Παπαζαφείρη Βασικοί μηχανισμοί προσαρμογής Προσαρμογή σε μοριακό και γονιδιακό επίπεδο Επίπεδα ελέγχου 1. Πρωτεïνική δράση 2. Πρωτεïνοσύνθεση 3. Ρύθμιση της

Διαβάστε περισσότερα

Ανασυνδυασµένο DNA. Richard M. Myers Jan A. Witkowski. James D. Watson Amy A. Caudy. Γονίδια και Γονιδιώµατα Μία Συνοπτική Παρουσίαση

Ανασυνδυασµένο DNA. Richard M. Myers Jan A. Witkowski. James D. Watson Amy A. Caudy. Γονίδια και Γονιδιώµατα Μία Συνοπτική Παρουσίαση Ανασυνδυασµένο DNA Γονίδια και Γονιδιώµατα Μία Συνοπτική Παρουσίαση James D. Watson Amy A. Caudy Richard M. Myers Jan A. Witkowski Κεφάλαιο 9 Η παρεµβολή RNA ρυθµίζει τη λειτουργία των γονιδίων 2 Κλασσική

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Εικόνα 22.1 Η γονιδιακή έκφραση ελέγχεται κυρίως κατά την έναρξη της µεταγραφής και σπάνια στα επόµενα στάδια της γονιδιακής έκφρασης, παρόλο που ο έλεγχος

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. γ 2. α 3. β 4. δ 5. δ Β. Ερωτήσεις σωστού - λάθους 1. Σωστό 2. Λάθος 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μεταβολική ενεργοποίηση του αυγού ανακατατάξεις στα συστατικά του αυγού σχηματισμός του διπλοειδή πυρήνα του ζυγωτού

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΘΕΜΑ Α 1 δ 2 β 3 γ 4 β 5 α ΘΕΜΑ Β

ΘΕΜΑ Α 1 δ 2 β 3 γ 4 β 5 α ΘΕΜΑ Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 30 ΜΑΪΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α 1 δ 2 β 3 γ

Διαβάστε περισσότερα

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης 2. Πρόσδεση πρωτεϊνικών καταστολέων σε αλληλουχίες της 3 περιοχής, στη μη-μεταφραζόμενη

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1 ο : Άνθρωπος και Υγεία

KΕΦΑΛΑΙΟ 1 ο : Άνθρωπος και Υγεία KΕΦΑΛΑΟ 1 ο : Άνθρωπος και Υγεία Α. ΕΡΩΤΗΣΕΣ ΚΛΕΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: 1. Οι ιοί αποτελούνται από: α.

Διαβάστε περισσότερα

Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό με τα δεδομένα που λαμβάνονται από ανοσοχημικές

Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό με τα δεδομένα που λαμβάνονται από ανοσοχημικές Εν αντιθέσει με αυτά που έχουν βρεθεί για τους προκαρυωτικούς οργανισμούς, για τους ευκαρυωτικούς υπάρχουν διαθέσιμες μόνο λίγες ακολουθίες ριβοσωμικών πρωτεϊνών. Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

ÃËÕÖÁÄÁ - ÅËËÇÍÉÊÏ ÓÕÃ ÑÏÍÏ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΊΑΣ Γ ΛΥΚΕΙΟΥ 20 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α ΘΕΜΑ Β B1.

ÃËÕÖÁÄÁ - ÅËËÇÍÉÊÏ ÓÕÃ ÑÏÍÏ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΊΑΣ Γ ΛΥΚΕΙΟΥ 20 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α ΘΕΜΑ Β B1. ΘΕΜΑ Α Α1. Γ Α2. Α Α3. Β Α4. Β Α5. ΘΕΜΑ Β B1. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΊΑΣ Γ ΛΥΚΕΙΟΥ 20 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ Α (Λυσοζύµη): 2, 3, 6, 7 Β (Πενικιλίνη): 1, 4, 5, 8 Β2. Το γενετικό υλικό ενός ιού µπορεί

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝ.ΠΑΙΔΕΙΑΣ

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝ.ΠΑΙΔΕΙΑΣ σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

Απαραίτητη η ύπαρξη αυξητικών παραγόντων στην G1. Αν όμως απουσιάζουν τότε το κύτταρο μπαίνει σε μία φάση γνωστή ως G 0.

Απαραίτητη η ύπαρξη αυξητικών παραγόντων στην G1. Αν όμως απουσιάζουν τότε το κύτταρο μπαίνει σε μία φάση γνωστή ως G 0. Ο κυτταρικός κύκλος είναι τυπικά διαιρεμένος σε τέσσερις φάσεις Είναι το κύτταρο αρκετά μεγάλο; Σημείο ελέγχου Σημείο ελέγχου ατράκτου Μήπως η άτρακτος είναι κατεστραμμένη ; Απαραίτητη η ύπαρξη αυξητικών

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητής: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Ευκαρυωτικοί μικροοργανισμοί; α.

Διαβάστε περισσότερα

ΜΗΧΑΝΙΣΜΟΙ ΑΜΥΝΑΣ ΤΟΥ ΑΝΘΡΩΠΙΝΟΥ ΟΡΓΑΝΙΣΜΟΥ

ΜΗΧΑΝΙΣΜΟΙ ΑΜΥΝΑΣ ΤΟΥ ΑΝΘΡΩΠΙΝΟΥ ΟΡΓΑΝΙΣΜΟΥ ΜΗΧΑΝΙΣΜΟΙ ΑΜΥΝΑΣ ΤΟΥ ΑΝΘΡΩΠΙΝΟΥ ΟΡΓΑΝΙΣΜΟΥ ΜΗΧΑΝΙΣΜΟΙ ΑΜΥΝΑΣ Με βάση τη θέση στο ανθρώπινο σώμα Με βάση την ιδιότητα για γενικευμένη ή εξειδικευμένη δράση Εξωτερικοί εσωτερικοί μη ειδικοί μηχανισμοί ειδικοί

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 1 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 1 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Ε_3.Βλ3Γ(ε) ΤΑΞΗ: ΜΑΘΗΜΑ: ΘΕΜΑ A Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ / ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Ηµεροµηνία: Κυριακή 1 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς

Διαβάστε περισσότερα

εισέρχεται στο φυτό ως ενυδατωµένο κατιόν

εισέρχεται στο φυτό ως ενυδατωµένο κατιόν Κατιόν µαγνησίουmg 2+ εισέρχεται στο φυτό ως ενυδατωµένο κατιόν Θρέψη Φυτών. Μπουράνης, Σ. Χωριανοπούλου 1 Επίπεδο Μg για κανονική αύξηση 0,15 0,35% ή60 140 µmol Mg gξμ -1 ΤοMgκινείταιστοΞΑΣκαιστοΗΑΣ HΑΣ100

Διαβάστε περισσότερα

B ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ ΘΕΜΑ Α ΘΕΜΑ Β

B ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ ΘΕΜΑ Α ΘΕΜΑ Β Α.1 1.1 α Βιολογία ΘΕΜΑ Α γενιικής παιιδείίας 1.2 δ 1.3 ε 1.4 δ 1.5 β A.2 Οι αποικοδοµητές είναι ο πληθυσµός Ε, διότι βέλη από όλους τους υπόλοιπους οργανισµούς καταλήγουν στον πληθυσµό Ε. Τα βέλη υποδηλώνουν

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Γενική Μικροβιολογία Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ ΜΑΘΗΜΑΤΟΣ

Διαβάστε περισσότερα

Γενικές αρχές µεταβίβασης του ορµονικού σήµατος ΠΑΡΑΣΚΕΥΗ ΜΟΥΤΣΑΤΣΟΥ

Γενικές αρχές µεταβίβασης του ορµονικού σήµατος ΠΑΡΑΣΚΕΥΗ ΜΟΥΤΣΑΤΣΟΥ 26 Γενικές αρχές µεταβίβασης του ορµονικού σήµατος ΠΑΡΑΣΚΕΥΗ ΜΟΥΤΣΑΤΣΟΥ Αναπληρώτρια Καθηγήτρια Εργαστήριο Βιολογικής Χημείας Ιατρική Σχολή Πανεπιστημίου Αθηνών ΕΙΣΑΓΩΓΗ Η αλµατώδης ανάπτυξη στην διελεύκανση

Διαβάστε περισσότερα

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Αντιµεταλλαξιγόνο δράση ανίχνευση ουσιών που προστατεύουν το DNA από µεταλλαξιγόνα που προκαλούν µεταλλάξεις

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 4 ΙΟΥΛΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Να γράψετε στο

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογία ΙI Κυτταρική Επικοινωνία Διδάσκοντες: Σ. Γεωργάτος, Θ. Τζαβάρας, Π. Κούκλης, Χ. Αγγελίδης Υπεύθυνος μαθήματος: Σ. Γεωργάτος Άδειες Χρήσης Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

2/4/2015. ικοτυλήδονα. Έµβρυο. επικοτύλιο. υποκοτύλιο. Μονοκοτυλήδονα. ενδοσπέρµιο. κοτυληδόνα. επικοτύλιο. ριζίδιο. Περίβληµα.

2/4/2015. ικοτυλήδονα. Έµβρυο. επικοτύλιο. υποκοτύλιο. Μονοκοτυλήδονα. ενδοσπέρµιο. κοτυληδόνα. επικοτύλιο. ριζίδιο. Περίβληµα. Δηµοκρίτειο Πανεπιστήµιο Θράκης Τµήµα Αγροτικής Ανάπτυξης Δοµή σπέρµατος ικοτυλήδονα περίβληµα ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ «Δοµή και βλάστηση των σπερµάτων» Διδάσκων: Χρήστος Χατζησαββίδης κοτυληδόνα επικοτύλιο υποκοτύλιο

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ / Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΑΠΟΦΟΙΤΟΙ ΗΜΕΡΟΜΗΝΙΑ: 24/01/2016 ΕΠΙΜΕΛΕΙΑ ΘΕΜΑΤΩΝ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Σάββατο, 24 Μαϊου 2003 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ

Σάββατο, 24 Μαϊου 2003 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ Σάββατο, 24 Μαϊου 2003 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

13o Μεμβρανικοί υποδοχείς με εσωτερική δραστικότητα κινάσης Ser/Thr 1. Σηματοδότηση μέσω TGFβ

13o Μεμβρανικοί υποδοχείς με εσωτερική δραστικότητα κινάσης Ser/Thr 1. Σηματοδότηση μέσω TGFβ 13 o TGF-β Μεμβρανικοί υποδοχείς με εσωτερική δραστικότητα κινάσης Ser/Thr 1. Σηματοδότηση μέσω TGFβ Ωρίμανση του μορίου TGFβ Ενεργοποίηση των υποδοχέων TGFβ Οι μεταγραφικοί παράγοντες Smads Η ρύθμιση

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΘΕΩΡΗΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ

ΘΕΩΡΗΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ ΘΕΜΑ Α Α1. γ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. ΑΠΑΝΤΗΣΕΙΣ ΣΤΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 1 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ (ΝΕΟ ΣΥΣΤΗΜΑ)

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ(

Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( ( Τα(κύρια(σημεία(της(σημερινής( διάλεξης(είναι(τα(παρακάτω:( Aποκωδικοποίηση(του(mRNA,(γενετικός(κώδικας,((

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

Ευρωπαϊκή Επιτροπή, Ευρωπαϊκό Κοινοτικό Ταμείο. Ελληνική Δημοκρατία, Υπουργείο Ανάπτυξης Υγείας. Αναλυτική Περίληψη Διδακτορικής Διατριβής

Ευρωπαϊκή Επιτροπή, Ευρωπαϊκό Κοινοτικό Ταμείο. Ελληνική Δημοκρατία, Υπουργείο Ανάπτυξης Υγείας. Αναλυτική Περίληψη Διδακτορικής Διατριβής Ευρωπαϊκή Επιτροπή, Ευρωπαϊκό Κοινοτικό Ταμείο Ελληνική Δημοκρατία, Υπουργείο Ανάπτυξης Υγείας Γενική Γραμματεία Έρευνας και Τεχνολογίας Ιατρικής Πανεπιστήμιο Κρήτης Σχολή Επιστημών Τμήμα Πρόγραμμα Ενίσχυσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Κυτταρα ζυμομύκητα αποκρίνονται σε σήμα ζευγαρώματος

Κυτταρα ζυμομύκητα αποκρίνονται σε σήμα ζευγαρώματος Κυτταρα ζυμομύκητα αποκρίνονται σε σήμα ζευγαρώματος Στους πολυκύτταρους οργανισμούς οι θεμελιώδεις κυτταρικές λειτουργίες εξαρτώνται από σύνθετα σηματοδοτικά μονοπάτια Κυτταρική επικοινωνία Τύποι επικοινωνίας

Διαβάστε περισσότερα

ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ. Εξειδίκευση: προϊόντα (κύτταρα ή αντισώματα) ειδικά για το αντιγόνο. Μνήμη: κύτταρα

ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ. Εξειδίκευση: προϊόντα (κύτταρα ή αντισώματα) ειδικά για το αντιγόνο. Μνήμη: κύτταρα ΕΙΔΙΚΗ ΑΜΥΝΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ Εξειδίκευση: προϊόντα (κύτταρα ή αντισώματα) ειδικά για το αντιγόνο Μνήμη: κύτταρα ΑΝΤΙΓΟΝΟ ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΣ ΤΜΗΜΑ ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΥ ΤΟΞΙΚΕΣ ΟΥΣΙΕΣ ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΥ ΓΥΡΗ, ΦΑΡΜΑΚΕΥΤΙΚΕΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα