Kυτταρική Bιολογία ΣΥΝΘΕΣΗ, ΑΝΑΔΙΠΛΩΣΗ, ΤΡΟΠΟΠΟΙΗΣΕΙΣ & ΑΠΟΙΚΟΔΟΜΗΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 8, 9 & 10 (15, 17 & 20/3/2017)

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Kυτταρική Bιολογία ΣΥΝΘΕΣΗ, ΑΝΑΔΙΠΛΩΣΗ, ΤΡΟΠΟΠΟΙΗΣΕΙΣ & ΑΠΟΙΚΟΔΟΜΗΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 8, 9 & 10 (15, 17 & 20/3/2017)"

Transcript

1 Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 8, 9 & 10 (15, 17 & 20/3/2017) ΣΥΝΘΕΣΗ, ΑΝΑΔΙΠΛΩΣΗ, ΤΡΟΠΟΠΟΙΗΣΕΙΣ & ΑΠΟΙΚΟΔΟΜΗΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ

2 Τα κύρια σημεία της σημερινής διάλεξης είναι τα παρακάτω: Aποκωδικοποίηση του mrna, γενετικός κώδικας, Κωδικόνια-αντικωδικόνια & το μεταφορικό RNA Ριβοσωμάτιο-ο χώρος αποκωδικοποίησης. Ριβοσωμικά RNA & βιοσύνθεση ριβοσωματίων. Η Διαδικασία και η Ρύθμιση της Μετάφρασης Συνοδοί Πρωτεΐνες και Αναδίπλωση Πρωτεϊνών Μετα-μεταφραστικές τροποποιήσεις & αποδόμηση Πρωτεϊνών

3 Το βασικό δόγμα της μοριακής βιολογίας Γονιδιακή έκφραση Mεταγραφή Aγγελιαφόρο RNA (mrna) Kωδικόνιο Mετάφραση Πρωτεΐνη (πολυπεπτιδική αλυσίδα)

4 Πως επιτυγχάνεται η μεταφορά της γενετικής πληροφορίας από τα νουκλεϊνικά οξέα στις πρωτεΐνες; 1. Τα αμινοξέα έχουν τελείως διαφορετική σύσταση από το mrna. Πως λοιπόν θα μπορέσουν να συνταχθούν με το mrna κατά τη μετάφραση για να γίνει η αποκωδικοποίηση; 2. Πως είναι δυνατόν μια αλληλουχία τεσσάρων βάσεων να κωδικοποιεί 20 αμινοξέα; Ποιος είναι ο κώδικας; 3. Πως έσπασε ο κώδικας;

5 Ο γενετικός κώδικας

6 Πως έσπασε ο γενετικός κώδικας;

7 Αποκωδικοποίηση πολυριβονουκλεοτιδίων με γνωστές επαναλαμβανόμενες ακολουθίες

8 Πλαίσια ανάγνωσης στην πρωτεϊνοσύνθεση

9 Για τη μετατροπή της γενετικής πληροφορίας (αλληλουχία νουκλεοτιδικών βάσεων) σε πρωτεΐνες (αλληλουχία αμινοξέων) απαιτείται ένα ενδιάμεσο μόριο ΤΟ ΜΕΤΑΦΟΡΙΚΟ RNA (trna)

10 Η δομή του μεταφορικού RNA (trna)

11 To μεταφορικό RNA δρα ως προσαρμογέας His trna His Συνθετάση του ιστιδυλο-trna His Φορτισμένο trna His His Συμπληρωματικές βάσεις mrna

12 Η λειτουργία των μορίων προσαρμογέων

13 Δεσμοί υδρογόνου καθορίζουν το επιλεκτικό «ζευγάρωμα» κωδικονίου-αντικωδικονίου

14 Η πρόσδεση του αμινοξέως στο trna

15 Η εκλεκτικότητα της μετάφρασης απαιτεί τη μεσολάβηση δύο μορίων προσαρμογής αμινοξύ (τρυπτοφάνη) δεσμός υψηλής ενέργειας συνθετάση (τρυπτοφάνυλο trna συνθετάση) Σύνδεση του αμινοξέως στο RNA το trna συνδέεται στο κωδικόνιο του στο mrna ζευγάρωμα βάσεων ΚΑΘΑΡΟ ΑΠΟΤΕΛΕΣΜΑ: Η ΕΠΙΛΟΓΗ ΤΟΥ ΑΜΙΝΟΞΕΩΣ ΚΑΘΟΡΙΖΕΤΑΙ ΑΠΟ ΤΟ ΚΩΔΙΚΟΝΙΟ ΤΟΥ

16 Ριβοσωμάτια: Οι χώροι αποκωδικοποίησης της γενετικής πληροφορίας

17 Το βακτηριακό ριβοσωμάτιο

18 Το ευκαρυωτικό ριβοσωμάτιο

19 Το ενδοπλασματικό δίκτυο στο ηλεκτρονικό μικροσκόπιο

20 Απομόνωση μικροσωματίων

21 Θέσεις σύνδεσης trna στο ριβοσωμάτιο Θέση Ε Θέση P Θέση Α Θέση πρόσδεσης mrna Μεγάλη ριβοσωμική υπομονάδα Μικρή ριβοσωμική υπομονάδα

22 Τα στάδια της πρωτεϊνοσύνθεσης

23 Η διαφορετική οργάνωση προκαρυωτικών & ευκαρυωτικών mrnas υπαγορεύει διαφορετικές στρατηγικές πρωτεϊνοσύνθεσης

24 Ειδικές αλληλουχίες βάσεων στα προκαρυωτικά mrnas καθορίζουν τα σημεία έναρξης της μετάφρασης Θέσεις πρόσδεσης ριβοσωματίου Πρωτεΐνη Α Πρωτεΐνη Β Πρωτεΐνη Γ

25 Προκαρυωτικά & ευκαρυωτικά σήματα έναρξης της μετάφρασης

26 Η έναρξη της μετάφρασης στα βακτήρια

27 Η έναρξη της μετάφρασης στους ευκαρυώτες RNA καλύπτρα εναρκτήριο trna μικρή υπομονάδα μαζί με παράγοντες έναρξης (δεν δείχνονται στο σχήμα) σύνδεση mrna mrna το σύμπλοκο μικρής υπομονάδας/εναρκτή ριου trna ψάχνει το πρώτο AUG του mrna Απομάκρυνση των παραγόντων έναρξης Σύνδεση της μεγάλης ροβοσωμικής υπομονάδας Σύνδεση αμινοακυλο-trna (Βήμα 1) Σχηματισμός πρώτου πεπτιδικού δεσμού (Βήμα 2)

28 συντιθέμενη ολυπεπτιδική αλυσίδα Η διαδικασία της επιμήκυνσης

29 Το τέλος της μετάφρασης Πρόσδεση παράγοντα απελευθέρωση ς ΤΕΡΜΑΤΙΣΜΟΣ

30 Το πολυριβοσωμάτιο: ένα mrna που μεταφράζεται ταυτόχρονα από πολλά ριβοσωμάτια Κωδικόνιο τερματισμού Εναρκτήριο κωδικόνιο Αγγελιοφόρο RNA (mrna) Πολυπεπτιδική αλυσίδα

31 Μεταφραστική ρύθμιση της γονιδιακής έκφρασης: Το παράδειγμα της φερριτίνης

32 Ρύθμιση της μετάφρασης από το σωματίδιο αναγνώρισης σήματος (ΣΑΣ ή SRP)

33 H πληροφορία αναδίπλωσης μιας πρωτεΐνης εμπεριέχεται στην πρωτοταγή της δομή H δομή της Pιβονουκλεάσης I (RNαση I, 124 αμινοξέα), σταθεροποιείται από τέσσερις ενδομοριακούς δισουλφιδικούς δεσμούς (Oι μπλέ κύκλοι= μόρια του αμινοξέος κυστεΐνη που συμμετέχουν στους δισουλφιδικούς δεσμούς).

34 Οι νεοσυντιθέμενες πρωτεΐνες χρειάζονται συνοδούς-πρωτεΐνες για να αναδιπλωθούν σωστά αναδιπλωμένη πρωτεΐνη Συνοδός πρωτεΐνη (σαπερόνη) Απελευθέρωση ολοκληρωμένου πολυπεπτιδίου

35 ΓΙΑΤΙ ΕΙΝΑΙ ΤΟΣΟ ΑΠΑΡΑΙΤΗΤΕΣ ΟΙ ΣΥΝΟΔΟΙ-ΠΡΩΤΕΪΝΕΣ ΣΤΗΝ ΑΝΑΔΙΠΛΩΣΗ ΤΩΝ ΝΕΟΣΥΝΤΙΘΕΜΕΝΩΝ ΠΡΩΤΕΪΝΩΝ;

36 Το πρόβλημα του συνωστισμού των μακρομορίων <0.1 mg/ml in vitro κυτταρόπλασμα E. coli ~340 mg/ml Ellis and Hartl (1996) FASEB J. 10:20-26 ριβόσωμα πρωτεΐνες συνοδός-πρωτεΐνη νουκλεϊνικά οξέα Άλλα μακρομόρια

37 Αναδίπλωση ή συσσωμάτωση; Σωστές αλληλεπιδράσεις μεταξύ των πλευρικών αλυσίδων της πρωτεΐνης Λάθος αλληλεπιδράσεις μεταξύ πλευρικών αλυσίδων διαφορετικών πρωτεϊνών

38 ΕΠΟΜΕΝΩΣ Ο ρόλος των συνοδών-πρωτεϊνών ή πρωτεϊνών της θερμικής καταπόνησης (Heat-shock proteins, HSPs) ΕΙΝΑΙ:

39 Οι συνοδοί-πρωτεΐνες εμπλέκονται στην αναδίπλωση των πρωτεϊνών Eμποδίζουν τα υδρόφοβα τμήματα των πρωτεϊνών να έρθουν σε επαφή με άλλα υδρόφοβα μόρια ΚΑΝΟΝΙΚΟ ΜΟΝΟΠΑΤΙ ΑΝΑΔΙΠΛΩΣΗΣ ΕΝΑΛΛΑΚΤΙΚΟ ΜΟΝΟΠΑΤΙ ΑΝΑΔΙΠΛΩΣΗΣ ΑΝΕΠΑΝΩΡΘΩΤΑ (ΚΑΤΑΣΤΡΟΦΙΚΑ) ΛΑΘΗ Βοηθούν στη σωστή αναδίπλωση λιωμένο σφαιρίδιο Eπάγονται από έκθεση των κυττάρων σε υψηλές θερμοκρασίες Oι δύοκύριες οικογένειες των συνοδών-πρωτεϊνών αυτών είναι οι Hsp70 και οι Hsp60 Ορθά αναδιπλωμένη πρωτεΐνη συνοδοί πρωτεΐνες συνοδοί πρωτεΐνες πρωτεάσες/απ οικοδόμηση

40 Οι συνοδοί-πρωτεΐνες δρουν διαδοχικά Hsp70 (DnaK) Μεταφορά στη σαπερονίνη (Hsp60, GroEL) Μη αναδιπλωμένη πρωτεΐνη Aναδιπλωμένη πρωτεΐνη

41 Οι πρωτεΐνες μοριακοί-συνοδοί βοηθούν στη πρωτεϊνική αναδίπλωση Αποσυσσωμάτωση J K TF 3' 5' ClpB GrpE ATP ADP J K ATP Μερικώς αναδιπλωμένη πρωτεΐνη GrpE Αναδίπλωση ADP Αναδιπλωμένη πρωτεΐνη ADP IbpA/B ATP Αναδίπλωση Κατακράτηση Hsp31 GroEL GroES Hsp33

42 Συνοδοί πρωτεΐνες εμπλέκονται στη μεταφορά σε μεμβρανικά οργανίδια Το παράδειγμα του μιτοχονδρίου Πολυπεπτιδική αλυσίδα Κυτταροπλασματική συνοδός πρωτεΐνη Μιτοχονδριακή συνοδός πρωτεΐνη Αναδιπλωμένη πρωτεΐνη Μιτοχόνδριο

43 Η είσοδος των πρωτεϊνών στο ΕΔ γίνεται ταυτόχρονα με τη μετάφραση σηματοδοτική αλληλουχία Σωματίδιο αναγνώρισης σήματος (ΣΑΣ) κυτταρόπλασμα αυλός του ΕΔ Υποδοχέας του ΣΑΣ σύμπλοκο μεταφοράς Sec61 (=κανάλι μετατόπισης) σηματοδοτική πεπτιδάση 2000 by Geoffrey M. Cooper

44 Συνοδοί-πρωτεΐνες αναδιπλώνουν αλλά και συγκρατούν τις πρωτεΐνες στον αυλό του ΕΔ Αυλός του ΕΔ 2000 by Geoffrey M. Cooper

45 Συνοδοί πρωτεΐνες εμπλέκονται και στον ποιοτικό έλεγχο των πρωτεϊνών του ΕΔ EΔ Λάθος αναδιπλωμένη πρωτείνη Σωστά αναδιπλωμένη πρωτείνη Συνοδός πρωτείνη Eκβλαστάνον κυστίδιο μεταφοράς

46 Ρύθμιση της πρωτεϊνικής αναδίπλωσης στο ΕΔ μεταφορά έξω από το ΕΔ Ουβικιτινωση πρωτεασωμική αποικοδόμηση Προϊόντα αποικοδόμησης Golgi ριβοσωμάτιο λάθος αναδίπλωση κυστίδιο Είσοδος στο ΕΔ Μετατροπή & αναδίπλωση Ορθή αναδίπλωση ΕΔ CM Dobson, Protein folding and misfolding, Nature, 426, (2003) Πολλές νεοσυντιθέμενες πρωτεΐνες μεταφέρονται στο ΕΔ όπου και αποκτούν τις ανώτερες δομές τους με τη βοήθεια συνοδώνπρωτεϊνών ή άλλων παραγόντων που προάγουν την πρωτεϊνική αναδίπλωση. Οι σωστά αναδιπλωμένες πρωτεΐνες μεταφέρονται κατόπιν στη συσκευή Golgi και στη συνέχεια κατευθύνονται (με κυστιδιακή μεταφορά) στο σωστό μεμβρανικό οργανίδιο ή στον εξωκυττάριο χώρο. Πρωτεΐνες που δεν έχουν αναδιπλωθεί σωστά ανιχνεύονται από τους μηχανισμούς ποιοτικού ελέγχου της πρωτεϊνικής αναδίπλωσης και ανακατευθύνονται με διαφορετικό μηχανισμό (unfolded protein response, απόκριση σε μη αναδιπλωμένες πρωτεΐνες). Ο μηχανισμός αυτός οδηγεί στην ουβικιτίνωση των λάθος αναδιπλωμένων πρωτεϊνών και στην αποικοδόμηση τους από τα πρωτεασωμάτια.

47 Μετά τη σύνθεση τους πολλές πρωτεΐνες συνδέονται μη ομοιοπολικά με μικρά μόρια Ρετινάλη Αίμη

48 Η φωσφορυλίωση των πρωτεϊνών είναι μία από τις σημαντικότερες ομοιοπολικές τροποποιήσεις ØΗ φωσφορυλίωσητων πρωτεϊνών έχει ως αποτέλεσμα την μεταβολή των φυσικοχημικών τους ιδιοτήτων και κατα συνέπεια της δομής τους. ØΟι παραπάνω δομικές αλλαγές μπορεί να επηρεάσουν την ενεργότητα της πρωτεΐνης ή/και τις αλληλεπιδράσεις της με άλλα βιομόρια. ΑΝΕΝΕΡΓΟ Πλευρική αλυσίδα σερίνης Κινάση πρωτεϊνών Κινάση Φωσφατάση πρωτεϊνών φωσφατάση ΕΝΕΡΓΟ ΕΝΕΡΓΟ Κινάση φωσφατάση ΑΝΕΝΕΡΓΟ

49 Η φωσφορυλίωση των πυρηνικών λαμινών οδηγεί σε αποσυναρμολόγηση του πυρηνικού υμένα Σύντηξη των κυστιδίων του πυρηνικού φακέλου Πυρηνικός πόρος λαμίνες εσωτερική πυρηνική μεμβράνη εξωτερική πυρηνική μεμβράνη Πυρηνικός φάκελλος Φωσφορυλίωση των λαμινών ΜΕΣΟΦΑΣΙΚΟΣ ΠΥΡΗΝΑΣ χρωματίδη χρωμόσωμ α κυστίδιο πυρηνικού φακέλου ΤΕΛΟΦΑΣΗ Αποφωσφορυλίωση των λαμινών φωσφορυλιωμένες λαμίνες ΠΡΟΦΑΣΗ

50 Σύνδεση υδατανθρακικών αλυσίδων στις γλυκοπρωτεΐνες Ν-Δεσμός Ασπαραγίνη Ν-ακετυλογλυκοζαμίνη συνδεδεμένη με ασπαραγίνη Ο-Δεσμός Σερίνη Ν-ακετυλογαλακτοζαμίνη συνδεδεμένη με σερίνη

51 Σύνδεση πρωτεϊνών με μεμβρανικά γλυκολιπίδια κυτταρόπλασμα Αλυσίδες λιπαρών οξέων αιθανολαμίνη ολιγοσακχαρίτης Αυλός ενδοπλασματικού δικτύου

52 Τοπολογίας μιάς μεμβρανικής πρωτεΐνης συνδεδεμένης με γλυκολιπιδική «άγκυρα»

53 Προσθήκη λιπαρών οξέων σε πρωτεΐνες

54 Ωρίμανση πρωτεϊνών με μερική πρωτεόλυση και με σχηματισμό δισουλφιδικών δεσμών Πρε-προϊνσουλίνη Οσχηματισμός των δισουλφιδικών δεσμών απαιτεί οξειδωτικό περιβάλλον και επιταχύνεται από εξειδικευμένα ένζυμα (π.χ. την ισομεράση των δισουλφιδικών δεσμών, PDI) Σηματοδοτική αλληλουχία Αποκοπή σηματοδοτικής αλληλουχίας Σχηματισμός δισουλφιδικών δεσμών Ενδιάμεσο (συνδετικό) πολυπεπτίδιο Αποκοπή συνδετικού πολυπεπτιδίου προϊνσουλίνη ϊνσουλίνη

55 Επιτάχυνση του σχηματισμού δισουλφιδικών δεσμών από εξειδικευμένα ένζυμα

56 Πολλά οργανίδια και πρωτεΐνες αποδομούνται στα λυσοσωμάτια βακτήριο φαγόσωμα φαγοκυττάρωση Kυτταρική Mεμβράνη Πρώιμο ενδόσωμα ενδοκυττάρωση Όψιμο ενδοσωμάτιο Λυσοσωμάτιο Eνδοπλασματικό δίκτυο Mιτοχόνδριο αυτοφαγοσωμάτιο αυτοφαγία

57 Η αποδόμηση των πρωτεϊνών των ευκαρυωτών επιτελείται κυρίως στα πρωτεοσωμάτια Μηχανισμός εισόδου εξαρτώμενος από την ουβικιτίνη Πρωτεΐνη που προορίζεται για αποικοδόμηση πεπτίδια Πρωτεολυτική μηχανή

58 Αποδόμηση ευκαρυωτικών πρωτεϊνών στα πρωτεοσωμάτια

59 Οι λιγάσες της ουβικιτίνης «μαρκάρουν» τις πρωτεΐνες για αποικοδόμηση ουβικιτίνη Πρωτεΐνη στόχος Πολυουβικιτίνωση Πρωτεάσωμα πεπτίδιο

60 Ο μηχανισμός της ουβικιτίνωσης Ε1 ενεργοποιητής της ουβικιτίνης Ε2 μεταφορέας της ουβικιτίνης Ε3 λιγάση της ουβικιτίνης Πρωτεϊνικά υποστρώματα ουβικιτίνη Ενεργοποίηση Εξειδικευμένη ουβικιτίνωση Αναγνώριση υποστρώματος

61 Σας Ευχαριστώ για την Προσοχή σας

Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ(

Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( ( Τα(κύρια(σημεία(της(σημερινής( διάλεξης(είναι(τα(παρακάτω:( Aποκωδικοποίηση(του(mRNA,(γενετικός(κώδικας,((

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Aναδίπλωση και επεξεργασία των πρωτεϊνών

Aναδίπλωση και επεξεργασία των πρωτεϊνών Aναδίπλωση και επεξεργασία των πρωτεϊνών Aναδίπλωση και επεξεργασία των πρωτεϊνών Πρωτεϊνοσύνθεση: τελευταίο στάδιο της ροής της γενετικής πληροφορίας * Αλληλουχία νουκλεοτιδίων DNA Μεταγραφή - Μετάφραση

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης 2. Πρόσδεση πρωτεϊνικών καταστολέων σε αλληλουχίες της 3 περιοχής, στη μη-μεταφραζόμενη

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Φαρμακευτικής ΑΠΘ

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών Μετα-μεταφραστικές τροποποιήσεις των πρωτεϊνών Στερεοδιαμόρφωση των πρωτεϊνών Η δομή των πρωτεϊνών εξαρτάται από την αμινοξική τους αλληλουχία Η πρωτεϊνική δομή ξεκινάει από δημιουργία α-ελίκων και β-φύλλων.

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Το δίπλωμα των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Η πλειονότητα των πρωτεϊνών διπλώνει σε μία μοναδική τρισδιάστατη δομή βιολογικά

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

Γιατί διαιρούνται τα κύτταρα;

Γιατί διαιρούνται τα κύτταρα; Η κυτταροδιαίρεση Γιατί διαιρούνται τα κύτταρα; Για να αναπαραχθούν. Για να αυξηθεί το µέγεθος των οργανισµών. Για να αναπληρωθούν φθαρµένα ή κατεστραµµένα κύτταρα. ιαδικασία κυτταροδιαίρεσης µε εκβλάστηση

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Τρισδιάστατη δομή της ριβοσωμικής υπομονάδας 30S

Τρισδιάστατη δομή της ριβοσωμικής υπομονάδας 30S Κεφάλαιο 14 Γονιδιακή έκφραση: Μετάφραση Τρισδιάστατη δομή της ριβοσωμικής υπομονάδας 30S 1 2 Γενικευμένος τύπος αμινοξέος Οι δομές των 20 αμινοξέων που συναντώνται στη φύση, ταξινομημένες σύμφωνα με το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ : 1. Αντιγραφή: Η διαδικασία της αντιγραφής γίνεται με τον ημισυντηρητικό τρόπο, δηλαδή κάθε νέο μόριο αποτελείται

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Kυτταρική Bιολογία. Μιτοχόνδρια & Χλωροπλάστες - Τα Ενεργειακά Κέντρα των Ευκαρυωτικών Κυττάρων ΔIAΛEΞΕΙΣ 24 & 25 (27 /5/2016)

Kυτταρική Bιολογία. Μιτοχόνδρια & Χλωροπλάστες - Τα Ενεργειακά Κέντρα των Ευκαρυωτικών Κυττάρων ΔIAΛEΞΕΙΣ 24 & 25 (27 /5/2016) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 24 & 25 (27 /5/2016) Μιτοχόνδρια & Χλωροπλάστες - Τα Ενεργειακά Κέντρα των Ευκαρυωτικών Κυττάρων Τα κύρια σημεία των διαλέξεων 24 & 25 Αποικοδόμηση & οξείδωση μακρομορίων,

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΜΗΜΑΤΟΣ ΦΑΡΜΑΚΕΥΤΙΚΗΣ Α.Π.Θ. ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΤΩΝ ΚΑΤΑΤΑΚΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ ΠΤΥΧΙΟΥΧΩΝ Α.Ε.Ι. ΤΜΗΜΑΤΟΣ ΦΑΡΜΑΚΕΥΤΙΚΗΣ

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΜΗΜΑΤΟΣ ΦΑΡΜΑΚΕΥΤΙΚΗΣ Α.Π.Θ. ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΤΩΝ ΚΑΤΑΤΑΚΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ ΠΤΥΧΙΟΥΧΩΝ Α.Ε.Ι. ΤΜΗΜΑΤΟΣ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΜΗΜΑΤΟΣ ΦΑΡΜΑΚΕΥΤΙΚΗΣ Α.Π.Θ. Το ποσοστό των κατατάξεων των πτυχιούχων Πανεπιστημίου, Τ.Ε.Ι. ή ισοτίμων προς αυτά, Α.Σ.ΠΑΙ.Τ.Ε., της Ελλάδος ή του εξωτερικού (αναγνωρισμένα από

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Η κυτταρική μετατόπιση των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από μόνο ένα τύπο ριβοσώματος

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ

ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ Σε ποιες κατηγορίες κατατάσσονται οι ορµόνες µε βάση τη χηµική τους φύση. Αναφέρετε από ένα παράδειγµα Περιγράψτε πως γίνεται η επικοινωνία των κυττάρων µε µηνυµατοφόρα

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

Μοριακή Bιολογία ΔIAΛEΞΕΙΣ 5 & 6

Μοριακή Bιολογία ΔIAΛEΞΕΙΣ 5 & 6 Μοριακή Bιολογία ΔIAΛEΞΕΙΣ 5 & 6 EIΣAΓΩΓH ΣTHN METAΓPAΦH Χρήστος Παναγιωτίδης, Ph.D. Καθηγητής Κυτταρικής/Μοριακής Βιολογίας Εργαστήριο Φαρμακολογίας, Τομέας Φαρμακογνωσίας/Φαρμακολογίας Τμήμα Φαρμακευτικής,

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά Μετάφραση του mrna mrna Translation Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων 1 Γενικά χαρακτηριστικά A. Μετάφραση της αλληλουχίας νουκλεοτιδίων του mrna σε αλληλουχία αμινοξέων- Γενικές έννοιες 1. Γενετικός

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2015-2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ 1. Πώς επηρεάζεται ο κυτταρικός κύκλος και η επιβίωση του κυττάρου από τον παράγοντα p53; Ο κυτταρικός

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα ΣτονΣτον ρόλο των διαφόρων οµάδων των ριβοσωµικών πρωτεινών. Κατά πόσο δηλαδή υπάρχει ετερογένεια στις

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

Από το γονίδιο στην πρωτεΐνη

Από το γονίδιο στην πρωτεΐνη Κεφάλαιο 17 Από το γονίδιο στην πρωτεΐνη Original Slides by Erin Barley Kathleen Fitzpatrick Γρηγόρης Παπαγρηγορίου 1 Η ροή της γενετικής πληροφορίας Η πληροφορία που περιέχεται στα γονίδια έχει την μορφή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που κωδικοποιούν για τις πρωτεϊνες που επάγονται από το θερµικό

Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1 ΚΕΦΑΛΑΙΟ 1 Ο Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Οι επιστήµονες αρχικά πίστευαν ότι το γενετικό υλικό ήταν οι πρωτεΐνες και

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ. Αρχαία Βακτήρια. Προκαρυωτικό κύτταρο: πυρηνοειδές. Πρώτιστα Μύκητες Φυτά Ζώα. Ευκαρυωτικό κύτταρο: πυρήνας

ΤΟ ΚΥΤΤΑΡΟ. Αρχαία Βακτήρια. Προκαρυωτικό κύτταρο: πυρηνοειδές. Πρώτιστα Μύκητες Φυτά Ζώα. Ευκαρυωτικό κύτταρο: πυρήνας ΤΟ ΚΥΤΤΑΡΟ Προκαρυωτικό κύτταρο: πυρηνοειδές Αρχαία Βακτήρια Ευκαρυωτικό κύτταρο: πυρήνας Δομή: μεμβρανικά οργανίδια Παραγωγή ενέργειας Δομή γενετικού υλικού Διαίρεση / Αναπαραγωγή Γενετικός ανασυνδυασμός

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα