Φυλογενετικές µέθοδοι και Μοριακή εξέλιξη. Π. Πάσχου, PhD

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Φυλογενετικές µέθοδοι και Μοριακή εξέλιξη. Π. Πάσχου, PhD"

Transcript

1 Φυλογενετικές µέθοδοι και Μοριακή εξέλιξη Π. Πάσχου, PhD

2 Φυλογένεση Έχουµε τα«φύλλα» του δέντρου και προσπαθούµε να ανακατασκευάσουµε τα«κλαδιά» που τα συνδέουν...

3 Εξελικτικές σχέσεις Η αναζήτηση οµοιοτήτων ανάµεσα σε αλληλουχίες DNA και η στοίχιση πολλαπλών ακολουθιών οδηγουν στην ερώτηση: Πώς σχετίζονται εξελικτικά αυτές οι ακολουθίες» και γενικότερα: Πώς σχετίζονται εξελικτικά οι οργανισµοί από τους οποίους προέρχονται αυτές οι ακολουθίες?

4 Ταξινοµική Η µελέτη των εξελικτικών σχέσεων ανάµεσα σε οµάδες οργανισµών Η ταξινόµηση των οργανισµών σε οµάδες εδραιώθηκε ως επιστήµη απότονcarolus Linnaeus ( ).

5

6 Φυλογενετική Σύµφωνα µε την εξελικτική θεωρία, οι οµάδες οµοίων οργανισµών προέρχονται από έναν κοινό πρόγονο. Η φυλογενετική συστηµατική είναι η κατάταξη των οργανισµών σύµφωνα µε την εξελικτική τους ιστορία. Αναπτύχθηκε από τον Γερµανό εντοµολόγο Willi Hennig, το 1950.

7 Molecular Evolution Οι οµοιότητες ή οι διαφορές ανάµεσα στους οργανισµούς µπορούν να κωδικοποιηθούν µε τη µορφή αριθµητικών δεδοµένων (χαρακτήρες) συγκρίνοντας φαινότυπους ή ακολουθίες DNA ή πρωτεϊνών

8 Ποιές αλληλουχίες να µελετήσουµε? ιαφορετικές αλληλουχίες µεταβάλλονται µε διαφορετικούς ρυθµούς πρέπει να επιλέξουµε τον τύπο ποικιλότητας που είναι κατάλληλος για το ερώτηµα που θα θέσουµε. Οι πρωτεΐνες (και οι κωδικοποιούσες περιοχές του DNA) επηρεάζονται από τη φυσική επιλογή καλύτερες για τη µελέτη µακρινών σχέσεων Κάποιες ακολουθίες είναι πολύ πολυµορφικές (rrna spacer regions, immunoglobulin genes), ενώ άλλες πολύ συντηρηµένες (actin, rrna coding regions) Ακόµη καιµέσα στο ίδιο γονίδιο διαφορετικές περιοχές µπορεί να εξελίσσονται µε διαφορετικούς ρυθµούς (conserved vs. variable domains)

9 Το DNA είναι καλό εργαλείο για την ταξινοµική πλεονεκτήµατα από τους µορφολογικούς χαρακτήρες ταξινόµησης: Οι χαρακτήρες µπορούν να ονοµαστούν χωρίς αµφιβολία Μεγάλοι αριθµοί χαρακτήρων είναι διαθέσιµοι για κάθε άτοµο Υπάρχουν πληροφορίες σχετικά µε την έκταση και τη φύση της απόκλισης ανάµεσα σε νουκλεοτιδικές αλληλουχίες (αντικαταστάσεις, insertion/deletions, χρωµοσωµικές αναδιατάξεις)

10 Οι αλληλουχίες αντανακλούν τις εξελικτικές σχέσεις Για κάθε γονίδιο, οι συγγενείς οργανισµοί έχουν παρόµοιες αλληλουχίες ενώ περισσότερες διαφορές παρατηρούνται ανάµεσα σε µακρινούς οργανισµούς. Οι διαφορές αυτές µπορούν να ποσοτικοποιηθούν. Με δεδοµένο ένα σύνολο γονιδιακών αλληλουχιών για παράδειγµα, είναι δυνατό να ανακατασκευάσουµε τις εξελικτικές σχέσεις ανάµεσασεγονίδιακαι οργανισµούς.

11 Μέτρα γενετικής απόστασης Ηταξινόµησηκαιηφυλογένεσηβασίζεταισεπίνακες γενετικών αποστάσεων ανάµεσα στους οργανισµούς ή τις µοριακές αλληλουχίες που µελετάµε. Υπολογίζονται αποστάσεις ανάµεσα σε όλα τα πιθανά ζευγάρια αλληλουχιών που εξετάζουµε και δηµιουργούµε έναν πίνακα αποστάσεων (distance matrix). Με αυτό τον τρόπο παίρνουµε µια εκτίµηση του ποσοστού εξελικτικής µεταβολής ανάµεσα σε δύο αλληλουχίες από τη στιγµή που διαχωρίστηκαν από έναν κοινό πρόγονο.

12 Αποστάσεις DNA Το απλούστερο µέτρο είναι ο αριθµός όλων των παρατηρούµενων διαφορών ανάµεσα σε δύο αλληλουχίες που µπορούν να στοιχιστούν. Όλες οι αλλαγές βάσεων είναι ισότιµες Στις ενθέσεις/ελλείψεις δίνεται συνήθως µεγαλύτερο βάροςαπόότιστιςαντικαταστάσεις. Είναι επίσης δυνατό να διορθώσουµε για «κρυπτικές» µεταβολές.

13 Στοιχισµένες αλληλουχίες A aat tcg ctt cta gga atc tgc cta atc ctg B...a..g..a.t...t...a C...a..c..c...t...t.a D...a..a..g..g..t...t.t..tt.. Σε µια στοίχιση αλληλουχιών DNA, κάθε θέση είναι ένας «χαρακτήρας» µε τέσσερις πιθανές τιµές τα τέσσερα νουκλεοτίδια.

14

15

16 Αµινοπεπτιδικές αποστάσεις Πιο πολύπλοκος υπολογισµός. Μερικά αµινοξέα µπορούν να αντικαταστήσουν το ένα το άλλο µε πολύµικρή επίδραση στη δοµή και λειτουργία της τελικής πρωτείνης ενώ άλλες αντικαταστάσεις µπορεί να είναι καταστροφικές. Με βάση τον γενετικό κώδικα, κάποιες αλλαγές αµινοξέων µπορεί να οφείλονται σε µια µόνο µετάλλαξη ενώ άλλες µπορεί να απαιτούν δύο ή και τρεις µεταλλάξεις.

17 Κλαδιστές και Φαινετιστές ύο διαφορετικές φιλοσοφίες της ταξινοµικής για την κατασκευή φυλογενετικών δέντρων (cladistic - phenetic Οι φαινετικές µέθοδοι κατασκευάζουν δέντρα (phenograms) µε βάση την παρούσα κατάσταση των χαρακτήρων και χωρίς υποθέσεις σχετικά µε την εξελικτική ιστορία που παρήγαγε αυτούς τους φαινότυπους. Οι κλαδιστικές µέθοδοι βασίζονται σε υποθέσεις σχετικά µε τις προγονικές καταστάσεις των χαρακτήρων και τον τρόπο µε τον οποίο προέκυψαν.

18 Φαινετική Μεθοδολογία Βασίζεται σε µεθόδους απόστασης (Distance Methods) για την κατασκευή δέντρων από αλληλουχίες. Κάθε βάση στην οποία διαφέρουν οι αλληλουχίες µετράει προς την κατασκευή του δέντρου. Γρήγορότεροι αλγόριθµοι από ότι οι κλαδιστικοί. εν απαιτούνται υποθέσεις αλλά βασίζεται σε αντικειµενικές παρατηρήσεις.

19 Clustering Algorithms αλγόριθµοι οµαδοποίησης - Εισάγουµε τα δεδοµένα µε τη µορφή αποστάσεων κατασκευάζονται φυλογενετικά δέντρα µε βάση αποστάσεις. Τα δέντρα αυτά βασίζονται αποκλειστικά στον αριθµό οµοιοτήτων και διαφορών ανάµεσα σε ένα σύνολο ακολουθιών. Αφετηρία ένας πίνακας κατά ζεύγη γενετικών αποστάσεων Με τις µεθόδους αυτές ενώνονται διαδοχικά αρχικά τα πιο κοντινά τάξα και στη συνέχεια τα πιο µακρινά.

20 UPGMA Ηπιοαπλήµέθοδος - UPGMA (Unweighted Pair Group Method using Arithmetic averages) Το πρόγραµµα PHYLIP µε τις ρουτίνες DNADIST και PROTDIST υπολογίζει κατά ζεύγη αποστάσεις ανάµεσα σε οµάδες αλληλουχιών. Το πρόγραµµα GCG και το GROWTREE χρησιµοποιούν UPGMA για να φτιάξουν ένα δέντρο

21 Neighbor Joining Ηπιοδηµοφιλής µέθοδος (Saitou and Nei 1987, Mol. Biol. Evol. 4:406) Ο πιο αξιόπιστός και γρήγορος αλγόριθµός από αυτούς που βασίζονται σε αποστάσεις (N. Saitou and T. Imanishi, Mol. Biol. Evol. 6:514 (1989)

22 NEIGHBOR-JOINING

23

24 Κλαδιστική µεθοδολογία - Cladistic Methods Οι εξελικτικές σχέσεις καταγράφονται µε τηδηµιουργία µιας δοµής µε διακλαδώσεις που ονοµάζεται φυλογενετικό δέντρο, και αναδεικνύει τις σχέσεις ανάµεσασεοργανισµούς, είδη ή µοριακές ακολουθίες. Η κλαδιστική µεθοδολογία κατασκευάζει δέντρα (κλαδογράµµατα - cladogram) µε βάση όλα τα πιθανά µονοπάτια εξέλιξης και επιλέγει από αυτά το καλύτερο πιθανό δέντρο. Το φυλόγραµµα (phylogram) είναι ένα δέντρο στο οποίο τα κλαδιά είναι ανάλογα µε τις εξελικτικές αποστάσεις.

25

26 Κλαδιστικές µέθοδοι εισάγουµε τα δεδοµένα µε µορφή χαρακτήρων Βασίζονται στην υπόθεση ότι κάθε οµάδα αλληλουχιών έχει εξελιχτεί από έναν κοινό πρόγονο µέσω µετάλλαξης και επιλογής χωρίς υβριδισµό ανάµεσα στα είδη. ουλεύουν καλύτερα αν γνωρίζουµε την προγονική αλληλουχία.

27 Φειδωλότητα - Parsimony Η πιο δηµοφιλής µέθοδος εκτίµησης φυλογενετικών σχέσεων. Περιλαµβάνει την αξιολόγηση όλων των πιθανών δέντρων, δίνοντας στο καθένα ένα score ανάλογα µε τον αριθµό εξελικτικών βηµάτων που περιλαµβάνει προκειµένου να εξηγήσει τα δεδοµένα. Το καλύτερο δέντρο είναι αυτό που απαιτεί το µικρότερο αριθµό αλλαγών προκειµένου να παραχθούν όλες οι αλληλουχίες από έναν κοινό πρόγονο.

28 Parsimony example: Compare Tree #1 with one that first divides ATCC on its own branch, then splits off ATCG, and finally divides TTCG from TCCG (Tree #2). Trees #1 and #2 both have three nodes, but when all of the distances back to the root (# of nodes crossed) are summed, the total is equal to 8 for Tree #1 and 9 for Tree #2. ATCC ATGG TTCC TTGG Tree #1 ATCC ATGG TTCC TTGG Tree #2

29 Υπάρχουν σωστά δέντρα?? υστυχώς είναι αδύνατο να πούµε µε απόλυτη βεβαιότητα ότι ένα δέντρο είναι το «σωστό» για µια οµάδα αλληλουχιών ή µια οµάδα οργανισµών η ταξινοµική βρίσκεται συνέχεια σε επανεξέταση καθώς συγκεντρώνονται νέα δεδοµένα. Η χρησιµοποιήση πολλών διαφορετικών µεθόδων για την ανάλυση των δεδοµένων και την επαλήθευση των αποτελεσµάτων είναι απαραίτητη.

30 Προσοχή Καµιά από τις θεωρίες και τους υπάρχοντες αλγορίθµους φυλογένεσης δεν είναι συνολικά αποδεκτοί από ολόκληρη την επιστηµονική κοινότητα. Η εφαρµογή διαφορετικού λογισµικού µπορεί να δώσει διαφορετικές απαντήσεις για τα ίδια δεδοµένα. Επίσης µικρές αλλαγές στα δεδοµένα µπορεί να µεταβάλλουν σηµαντικά τα αποτελέσµατα.

31 Γονίδια και είδη Οι σχέσεις που υπολογίζονται από δεδοµένα αλληλουχιών αντιπροσωπεύουν τις σχέσεις ανάµεσα στα αντίστοιχα γονίδια όχι απαραίτητα και ανάµεσα στα είδη που τις φέρουν. Μια συγκεκριµένη αλληλουχία µπορεί να µην έχει την ίδια φυλογενετική ιστορία µε το είδος από το οποίο προέρχεται. ιαφορετικά γονίδια εξελίσσονται µε διαφορετικούς ρυθµούς.

32 Computer Software for Phylogenetics PHYLIP is a free package that includes 30 programs that compute various phylogenetic algorithms on different kinds of data. The GCG package (available at most research institutions) contains a full set of programs for phylogenetic analysis including simple distance-based clustering and the complex cladistic analysis program PAUP (Phylogenetic Analysis Using Parsimony) CLUSTALX is a multiple alignment program that includes the ability to create tress based on Neighbor Joining. MacClade is a well designed cladistics program that allows the user to explore possible trees for a data set.

33 Phylogenetics on the Web There are several phylogenetics servers available on the Web some of these will change or disappear in the near future these programs can be very slow so keep your sample sets small The Institut Pasteur, Paris has a PHYLIP server at: Louxin Zhang at the Natl. University of Singapore has a WebPhylip server: The Belozersky Institute at Moscow State University has their own "GeneBee" phylogenetics server: The Phylodendron website is a tree drawing program with a nice user interface and a lot of options, however, the output is limited to gifs at 72 dpi - not publication quality.

34 Other Web Resources Joseph Felsenstein (author of PHYLIP) maintains a comprehensive list of Phylogeny programs at: html Introduction to Phylogenetic Systematics, Peter H. Weston & Michael D. Crisp, Society of Australian Systematic Biologists University of California, Berkeley Museum of Paleontology (UCMP)

35 Software Hazards Πολλά προγράµµατα µπορεί να τρέχουν για ώρες ή και για µέρες ακόµη και για µικρό αριθµό αλληλουχιών ιαφορετικά προγράµµατα απαιτούν πολλές φορές διαφορετικό format αρχείων. Το γεγονός ότι ένα πρόγραµµα µπορεί να «τρέξει» δε σηµαίνει ότι είναι και το κατάλληλο για τα συγκεκριµένα δεδοµένα.

36 Χρήση των µοριακών πληροφοριών στις εξελικτικές µελέτες 1. Πολυµορφικοί δείκτες για µελέτες γενετικής πληθυσµών (αλληλόµορφα για τη µελέτη της γονιδιακής ροής, φυσικής επιλογής κτλ, ζώνες υβριδισµού) 2. Μελέτη φυλογενετικών σχέσεων των οργανισµών µε κατασκευή φυλογενετικών δένδρων 3. Εξέλιξη του γονιδιώµατος των οργανισµών 4. Οι αλλαγές στο επίπεδο των µακροµορίων προκαλούν εξελικτικές αλλαγές στη φυσιολογία, ανάπτυξη και τη µορφολογία των οργανισµών.

37 Η «αυστηρή» θεωρία της επιλογής πριν την εποχή της µοριακής γενετικής Τα άτοµα που φέρουν επιβαρυντικά αλληλόµορφα αποµακρύνονται από τον πληθυσµό (γενετικό φορτίο) Η υπερεπικρατής και η αρνητική επιλογή αυξάνουν το γενετικό φορτίο Ο αριθµός πολυµορφισµών που µπορεί να είναι συµβατός µε τη διατήρηση ενός πληθυσµού, είναι µικρός Πρόβλεψη του Muller: Μόνο ένα γονίδιο στα 1000 θα είναι πολυµορφικό

38 Η ουδέτερη θεωρία (neutral theory) Η εξέλιξη της µοριακής γενετικής αποκάλυψε την αυξηµένη ποικιλοµορφία του DNA Ασυµβατότητα µε την«αυστηρά» επιλεκτική θεωρία Kimura 1968: Ουδέτερη θεωρία της µοριακής εξέλιξης

39 Η ουδέτερη θεωρία (neutral theory) Οι πολυµορφισµοί και οι αντικαταστάσεις δεν είναι το προϊόν επιλογής αλλά αντιπροσωπεύουν το τυχαίο αποτέλεσµα της αλλαγής των συχνοτήτων διαφόρων ουδέτερων αλληλοµόρφων. Η αρνητική επιλογή µπορεί να αποµακρύνει επιβαρυντικά αλληλόµορφα αλλά η θετική και η εξισορροπητική επιλογή θεωρούνται γεγονότα πολύ σπάνια Έµφαση στο ρόλο της τυχαίας γενετικής παρέκκλισης (random genetic drift) και ανάπτυξη αναλυτικών µεθόδων ελέγχου για τη δράση ή όχι επιλογής

40 Ρυθµός εξέλιξης των αλληλουχιών Ορυθµός εξέλιξης (απόκλισης) των αλληλουχιών ταυτίζεται µε το ρυθµό εγκαθίδρυσης νέων µεταλλαγών. Για ουδέτερες µεταλλάξεις: εξελικτικός ρυθµός ισούται µε το µεταλλακτικό ρυθµό (θεωρία ουδετερότητας). Για µη ουδέτερες µεταλλάξεις: ηφυσικήεπιλογήαποµακρύνει τις επιβλαβείς, προωθεί εγκαθίδρυση ευνοϊκών. Η δράση της φυσικής επιλογής θα είναι πιο έντονη όσο περισσότεροι λειτουργικοί περιορισµοί υπάρχουν

41 Ρυθµός εξέλιξης των αλληλουχιών ιαφορετικός ρυθµός εξέλιξης µεταξύ διαφορετικών περιοχών του γονιδιώµατος: -Μεταγραφόµενες και µη-µεταγραφόµενες αλληλουχίες -Εντός των γονιδίων: - Ιντρόνια-Εξόνια - Λειτουργικές-µη λειτουργικές περιοχές πολυπεπτιδίων - ιαφορετικές θέσεις κωδικονίων (συνώνυµες-µη συνώνυµες µεταλλάξεις) (µεταπτώσεις- µεταστροφές) -Πυρηνικό-µιτοχονδριακό DNA

42 ιάφοροι τύποι αλληλουχιών εξελίσσονται µε διαφορετικούς ρυθµούς Substitutions per site per 1000,000,000 years Upstream regions Downstream regions Non-degenerate sites Twofold degenerate sites Fourfold degenerate sites Introns Pseudogenes Animal mtdna 0

43 Substitutionsper site per Οι συνώνυµες µεταλλάξεις εγκαθιδρύονται πιο συχνά στην εξέλιξη 1000,000,000years histone 3 Insulin myoglobin Synonymous mutations Nonsynonymous mutations albumin interleukin 1 apolipoprotein A-1 interferon B1 relaxin Ορυθµός εγκαθίδρυσης συνώνυµων µεταλλάξεων είναι παρόµοιος µεταξύ διαφορετικών γονιδίων και σχετικά ανεξάρτητος των δοµικών και λειτουργικών περιορισµών τους Για τις µησυνώνυµες µεταλλάξεις ο ρυθµός εγκαθίδρυσης εξαρτάται ευθέως από τους περιορισµούς αυτούς

44 Ρυθµοί συνώνυµων και µη συνώνυµων αντικαταστάσεων Γονίδιο Αριθµός κωδικονίων Μη συνώνυµος ρυθµός Συνώνυµος ρυθµός Ιστόνη ,00 ± 0,00 3,94 ± 0,81 Ακτίνη α 376 0,01 ± 0,01 2,92 ± 0,34 Ινσουλίνη 51 0,20 ± 0,10 3,03 ± 1,02 α-σφαιρίνη 141 0,56 ± 0,11 4,38 ± 0,77 Ig k 106 2,03 ± 0,30 5,56 ± 1,18 Ιντερφερόνη γ 136 3,06 ± 0,37 5,50 ± 1,45

45 Οµοπλασία και εξελικτικός ρυθµός Όσο µεγαλύτερος ο χρόνος διαχωρισµού δύο ειδών τόσο µεγαλώνει το ποσοστό πολλαπλών υποκαταστάσεων στην ίδια θέση (οµοπλασίες) παρατηρούµε λιγότερες αλλαγές απο όσες έχουν πραγµατικά συµβεί, Χρήση διαφορετικών περιοχών DNA (όσον αφορά το ρυθµό εξέλιξης) ανάλογα µε το πόσο παλιά έχουν διαχωριστεί τα είδη ή οι πληθυσµοί των οποίων την εξελικτική ιστορία θέλουµε να µελετήσουµε (π.χ περιοχή ελέγχου mtdna για εξελικτική ιστορία ανθρώπινων πληθυσµών, rrna γονίδια για εξέλιξη ειδών/οικογενειών)

46 Το µέγεθος του γονιδιώµατος ποικίλει πολύ µεταξύ των διαφόρων οργανισµών Organism Molecular weight base pairs Higher plants Lily 2x x10 11 Maize 4.4x x10 9 Vertebrates Human 1.9x x10 9 Frog 1.4x x10 10 Invertebrates Fruit fly 1.2x x10 8 sea urchin 5x x10 8 Fungi Neurospora 1.8x x10 7 Bacteria E.coli 2.8x x10 6

47 Το παράδοξο της τιµής C «Πολυπλοκότητα» οργανισµόυ Bac teria Mammals Bird s Fung i Bony fish Arthropods Protozoa Salam anders Algae Μέγεθος απλοειδούς γονιδιώµατος (bp)

48 Το παράδοξο της τιµής του C (µέγεθος γονιδιώµατος DNA σε απλοειδή µορφή) Είδος Τιµή C (Kb) Drosophila melanogaster Gallus domesticus Boa constrictor Parascaris equorum Ratus norvegicus Homo sapiens Nicotiana tabaccum Paramecium caudatum Ophioglossum petiolatum Amoeba dubia

49 Εξέλιξη του µεγέθους του γονιδιώµατος - Η ποσότητα του DNA που περιέχεται στο απλοειδές γονιδίωµα, ανεξάρτητα του αριθµού των χρωµοσωµάτων, ποικίλλει σε τεράστιο βαθµό µεταξύ των οργανισµών - Επίδραση της ποσότητας του DNA στο µέγεθος των κυττάρων και στο ρυθµό της κυτταρικής διαίρεσης, όχι όµως και στον φαινότυπο - Τιµή C : υψηλή σε πολυετή φυτά, χαµηλή σε µονοετή - Το παράδοξο της τιµής C οφείλεται σε µεγάλο ποσοστό στην ύπαρξη άχρηστου DNA που βρίσκεται µε τηµορφή επαναλήψεων στα χρωµοσώµατα.

50 ηµιουργία νέων γονιδίων ιπλασιασµός και επιµήκυνση γονιδίων (Gene duplication and elongation) Ανακατάταξη εξονίων (Exon shuffling) Συγχρονισµένη εξέλιξη (Concerted evolution)

51 ιπλασιασµός Γονιδίων Τύποι διπλασιασµού Μερικός ή εσωτερικός γονιδιακός διπλασιασµός Πλήρης γονιδιακός διπλασιασµός Μερικός χρωµοσωµικός διπλασιασµός Πλήρης χρωµοσωµικός διπλασιασµός Πολυπλοειδία Η ύπαρξη επαναλαµβανόµενων αλληλουχιών αυξάνει τη συχνότητα του άνισου επιχιασµού Ο γονιδιακός διπλασιασµός σηµαντικός παράγοντας στην εξέλιξη του γονιδιώµατος.

52 Μηχανισµοί διπλασιασµού γονιδίων Οι βασικοί µοριακοί µηχανισµοί του γονιδιακού διπλασιασµού είναι: (α) µεάνισοεπιχιασµό: παράγει διπλασιασµόστοέναχρωµόσωµα, έλλειψη στο άλλο, (β) µερετροµετάθεση.

53 Πιθανά αποτελέσµατα του διπλασιασµού του DNA ιατήρηση της ίδιας λειτουργίας. Συµβαίνει σε γονίδια για τα οποία ο οργανισµός χρειάζεται µεγάλη ποσότητα προϊόντος (π.χ. rrna, ιστόνες) Απόκτηση νέας λειτουργίας Π.χ. η λακταλβουµίνη (πρωτεϊνη του γάλακτος των θηλαστικών) προήλθε από διπλασιασµένο γονίδιο της λυσοζύµης Ανάπτυξη παρόµοιας λειτουργίας, έκφραση σε διαφορετικούς ιστούς ή/και σε διαφορετικά αναπτυξιακά στάδια (π.χ σφαιρίνες) ηµιουργία ψευδογονιδίων (κάποιο από τα αντίγραφα συσσωρεύει µεταλλάξεις και γίνεται µη λειτουργικό) Κινητά στοιχεία - Παράδειγµα επεξεργασµένων ψευδογονιδίων (processed pseudogenes)

54 Απόκλιση λειτουργικότητας διπλασιασµένων γονιδίων σε είδη ψαριών της οικογένειας Catostomidae (Ferris and Whitt, 1979) Μετρήθηκε η διαφορά δραστικότητας των ισοενζύµων που παράγονται από διπλασιασµένα αντίγραφα σε διάφορους ιστούς Στο 40% τωνπεριπτώσεωνδενυπήρχεαπόκλιση στην έκφραση, σε πολλές περιπτώσεις ένα ισοένζυµο ήταν δραστικότερο από όλα τα άλλα σε όλους τους ιστούς που ελέγχθηκαν Στο 19% των περιπτώσεων τα ένζυµα εκφράζονταν διαφορετικά σε διαφορετικούς ιστούς ανεξάρτητη ρύθµιση Σε όλες σχεδόν τις περιπτώσεις απώλεια έκφρασης ενός διπλασιασµένου αντιγράφου στο ένα ή το άλλο είδος

55 Η γονιδιακή οικογένεια των σφαιρινών Χρωµόσωµα 16 ζ ψζ ψα2 ψα1 α1 α1 θ ε Gγ Αγ ψβ δ β Χρωµόσωµα 11 Χρωµόσωµα 22 µυοσφαιρίνη

56 Εξέλιξη των γονιδίων Της β οικογένειας Των σφαιρινών ιπλασιασµός Ειδογένεση Κοινός πρόγονος Hardison, PNAS 2001

57 Ορθόλογα και παράλογα γονίδια Ορθόλογα γονίδια: αντίστοιχα γονίδια σε διαφορετικά είδη (π.χ α-σφαιρίνη σε άνθρωπο, χιµπαντζή κτλ) Παράλογα γονίδια: διπλασιασµένοι τόποι εντός ενός είδους Οι συγκρίσεις ορθόλογων γονιδίων µας δίνουν πληροφορίες για την εξελικτική ιστορία των ειδών. Οι συγκρίσεις παράλογων γονιδίων µας δίνουν πληροφορίες για την ιστορία των γονιδιακών διπλασιασµών

58 Το γονίδιο της α2 αλυσίδας του κολλαγόνου τύπου Ι Gly-X-Y Gly-X-Y Gly-X-Y Gly-X-Y Gly-X-Y (X προλίνη Υ υδρόξυπρολίνη) Στην κότα: 42 εξόνια 5 µε 45bp 23 µε 54bp 5 µε 99bp 8 µε 108bp 1 µε 162bp Κάθε εξόνιο είναι πολλαπλάσιο των 9bp που κωδικοποιύν για Gly-X-Y Εξόνιο 8: 18 επαναλήψεις Gly-X-Y

59 Παραδείγµατα πρωτεϊνών µε εσωτερικούς διπλασιασµούς Ακολουθία α 1 β- γλυκοπρωτεΐνη Ανοσοσφαιρίνη εαλυσίδαc περιοχή Τροποµυοσίνη ααλυσίδα Αριθµός αµινοξέων Μήκος επανάληψης Αριθµός επαναλήψεων Ποσοστό επανάληψης % % % Πλασµινογόνο %

60 Ποσοστό διπλασιασµένων γονιδίων σε διάφορα είδη

61 Ανακατάταξη εξoνίων (exon shuffling) Στις γονιδιακές οικογένειες είναι φανερό ότι έχει γίνει κάποιες φορές ανακατάταξη λειτουργικών µονάδων κάποιου αρχικού γονιδίου ώστε να προκύψει ένας καινούριος συνδυασµός ένα καινούριο γονίδιο TPA (tissue plasminogen activator): αποτελείται από τµήµατα τριών άλλων πρωτεϊνών (πλασµινογόνο, επιδερµικός αυξητικός παράγοντας και φιµπρονεκτίνη). Το κάθε επιµέρους τµήµα συµπίπτει µε το τέλος ενός εξονίου της αρχικής πρωτεΐνης (intron-exon junction).

62 Εναλλακτικοί τρόποι παραγωγής νέων γονιδιακών λειτουργιών Α)Επικαλυπτόµενα γονίδια ηµιουργία διαφορετικών πλαισίων ανάγνωσης στην ίδια ή την συµπληρωµατική αλυσίδα µέσω µεταλλαγών, κωδικόνιο έναρξης, θέση έναρξης µεταγραφής Π.χ. Οι αµινοακυλ-trna συνθετάσες κωδικοποιούνται από δύο γονιδιακές οικογένειες που φαίνονται να µην έχουν σχέση µεταξύ τους και αρχικά υπήρχε η υπόθεση ότι προήλθαν από ανεξάρτητες «πρωτόγονες» συνθετάσες του πρώτου κυττάρου. Όµως οι Rodin και Ohno (1995) βρήκαν ότι οι δύο οικογένειες παρουσιάζουν µεγάλη αλληλουχική οµοιότητα όταν οι κωδικοποιούσες αλληλουχίες του DNA συγκριθούν στην αντίθετη κατεύθυνση. Έτσι πρότειναν ότι οι δύο οικογένειες συνθετασών προήλθαν από δύο γονίδια τοποθετηµένα στις συµπληρωµατικές αλυσίδες του ίδιου δίκλωνου DNA.

63 Β) Εναλλακτικό µάτισµα Ένα αρχικό RNA µεταγράφηµα παράγει διαφορετικά mrnas από το ίδιο DNA, τα οποία µεταφράζονται σε διαφορετικά πολυπεπτίδια Εξαιτίας αυτού η διάκριση µεταξύ εξονίων και ιντρονίων δεν είναι απόλυτη, εξαρτάται από το mrna στο οποίο αναφερόµαστε Υπάρχουν διαφορετικοί τύποι εναλλακτικού µατίσµατος Παρακράτηση ιντρονίου (intron retention) Εναλλακτική έναρξη ή τερµατισµός µεταγραφής (εναλλακτικές θέσεις πολυαδενυλίωσης) Αµοιβαίως αποκλειόµενα εξόνια Η εξέλιξη εναλλακτικού µατίσµατος απαιτεί τη δηµιουργία µια νέας θέσης µατίσµατος. Αυτό µπορεί να συµβεί µε σχετικά µεγάλη συχνότητα µέσω µεταλλάξεων. Συνήθως επιβλαβές το αποτέλεσµα.

64 Γ) Πρωτεϊνες που κωδικοποιούνται από ιντρόνια και nested γονίδια Ένα ιντρόνιο µπορεί να περιέχει ένα ανοικτό πλαίσιο ανάγνωσης που κωδικοποιεί µια πρωτεϊνη µε τελείως διαφορετική λειτουργία από αυτή των γειτονικών εξονίων Π.χ. Γονίδιο coxi της ζύµης περιέχει ένα ιντρόνιο που κωδικοποιεί το ένζυµο µατουράση, το οποίο χρειάζεται για το σωστό µάτισµα (self splicing) αυτού του ιντρονίου από το πρόδροµο mrna. Το ίδιο ένζυµο λειτουργεί ως ενδονουκλεάση στον ανασυνδυασµό του DNA Nested genes: γονίδια που κωδικοποιούνται από ιντρόνια και µεταγράφονται από τη συµπληρωµατική αλυσίδα Π.χ. Μια πρωτεϊνη του εξωσκελετού της νύµφης της Drosophila κωδικοποιείται από τη συµπληρωµατική αλυσίδα ενός ιντρονίου του γονιδίου του ενζύµου glycinamide ribotide transformylase της βιοχηµικής οδού της πουρίνης. Αυτό το γονίδιο της Drosophila περιέχει µε τη σειρά του ένα ιντρόνιο (Moriyama and Gojobori 1989)

65 ) RNA editing Είναι η µετα-µεταγραφική τροποποίηση ενός µορίου RNA Ένας από τους πιο κοινούς τύπους RNA editing είναι η µετατροπή από C σε U, που µπορεί να παρατηρηθεί µερικώς ή ολικώς σε κάποιους ιστούς διαφορική γονιδιακή έκφραση Περιστασιακά µπορεί να παραχθεί νέα πρωτεϊνη µε διαφορετική λειτουργία από αυτή του αρχικού µεταγραφήµατος. Π.χ γονίδιο απολιποπρωτεϊνης Β, που µεταφέρει λιπίδια στο αίµα. Υπάρχουν δύο τύποι: apob-100 (στο συκώτι και συνδέεται µε χαµηλής πυκνότητας λιπίδια), και apoβ-48 (στο έντερο, δεν συνδέεται µε χαµηλής πυκνότητας λιπίδια) Η apob-48 συντίθεται από ένα µακρύ mrna πανοµοιότυπο µε αυτό της apob-100, µε τη διαφορά ότι περιέχει ένα κωδικόνιο λήξης που προέκυψε από RNA editing του κωδικονίου 2153 από CAA (Gln) σε UAA.

66 Ε) Μοίρασµα γονιδίου (gene sharing) Κάποιες φορές ένα γονιδιακό προϊόν µπορεί να χρησιµοποιηθεί και για µια επιπλέον λειτουργία. Αυτό σηµαίνει ότι ένα γονίδιο αποκτά και διατηρεί µια νέα λειτουργία χωρίς να διπλασιαστεί ή να χάσει την αρχική του λειτουργία. Π.χ. Κρυσταλλίνες (κύριες υδατοδιαλυτές πρωτεϊνες στο φακό του µατιού, που εξασφαλίζουν τη διαφάνειά του και τη σωστή διάχυση του φωτός). ε-κρυσταλλίνες των πουλιών και κροκοδείλων πανοµοιότυπες µε το ένζυµο Β-γαλακτική αφυδρογονάση τ-κρυσταλλίνες των σπονδυλοζώων πανοµοιότυπες µε την α- ενολάση (ένα γλυκολυτικό ένζυµο) Αφού το µάτι είναι ένα σχετικά πρόσφατο εξελικτικό εύρηµα, θεωρούµε ότιηενζυµική λειτουργία προηγήθηκε της οπτικής. Άλλες κρυσταλλίνες (β, γ των σπονδυλοζώων) προέκυψαν µε διπλασιασµό από άλλα γονίδια

67 Τρόποι παραγωγής νέων γονιδιακών λειτουργιών Επικαλυπτόµενα γονίδια Εναλλακτικό µάτισµα Πρωτεϊνες που κωδικοποιούνται από ιντρόνια nested genes RNA editing Μοίρασµα γονιδίου (gene sharing)

68 Εξέλιξη ενζυµικής ρύθµισης Βιοχηµική προσαρµογή επιτυγχάνεται: Με δοµικές αλλαγές ενός ενζύµου Με αλλαγές στη ρύθµισή του Και µε τους δύο παραπάνω τρόπους ιάσπαση τοξικών ουσιών (π.χ. ξανθοταξίνη) που λαµβάνουν προνύµφες πεταλούδων από την τροφή τους (φυτά οικογ. Apiaceae) Papilio polyxenes: διασπά ταχέως την ξανθοταξίνη, πολύ µεγαλύτερη δράση του ενζύµου στο µεσέντερο Spodoptera frugiperda: διασπά ξανθοταξίνη αλλά µε αργόρυθµό, όχι εξειδίκευση σε κάποιο ιστό Τροφική εξειδίκευση της P. polyxenes αποτέλεσµα αλλαγής δραστικότητας και κατά ιστό ειδίκευσης ενός διαδεδοµένου στα λεπιδόπτερα (πεταλούδες) βιοχηµικού µηχανισµού

69 Μοριακός οπορτουνισµός Οι πραγµατικές καινοτοµίες είναι σπάνιες στην εξέλιξη. Συνήθως προϋπάρχοντα γονίδια ή τµήµατα γονιδίων µετασχηµατίζονται για να παράγουν νέες λειτουργίες και τα µοριακά συστήµατα συνδυάζονται για να δηµιουργήσουν νέα συνήθως πολυπλοκότερα συστήµατα. Ο µοριακός βιολόγος Francois Jacob περιέγραψε αυτή τη διαδικασία ως µοριακό µαστόρεµα (molecular tinkering). Όπως ένας µάστορας χρησιµοποιεί υλικά από παλιές κατασκευές που έχει στην αποθήκη του για να φτιάξει µια νέα κατασκευή (σε αντίθεση µε ένα µηχανικό ή σχεδιαστή που χρησιµοποιεί νεά υλικά) έτσι και στη φύση χρησιµοποιούνται προϋπάρχουσες δοµές για να φτιαχτούν καινούριες.

70 Εναρµονισµένη Εξέλιξη (Concerted evolution) Σε πολλές περιπτώσεις οι αλληλουχίες των µελών µιας πολυγονιδιακής οικογένειας είναι όµοιες µεταξύτουςεντόςενόςείδους, ενώ µπορεί να είναι αρκετά διαφορετικές µεταξύ διαφορετικών ειδών (κανονικά περιµένουµε ότι παράλογες συγκρίσεις εντός ενός είδους θα έδειχναν ίδιο µεγεθος απόκλισης µεταξύ οµόλογων συγκρίσεων σε διαφορετικά είδη). Είδος 1 Είδος 2 Είδος 3 Είδος 1 Είδος 2 Είδος 3 Προγονική οµάδα διπλασιασµένων γονιδίων Αναµενόµενο πρότυπο Παρατηρούµενο πρότυπο Αυτό το φαινόµενο ονοµάστηκε Εναρµονισµένη Εξέλιξη και οφείλεται σε µηχανισµούς που οµογενοποιούν τις αλληλουχίες των µελών µιας πολυγονιδιακής οικογένειας εντός ενός είδους. Τα µέλη µιας πολυγονιδιακής οικογένειας δεν εξελίσσονται ανεξάρτητα. Οι µηχανισµοί οµογενοποίησης που δρουν κατά την εναρµονισµένη εξέλιξη είναι κυρίως ο άνισος επιχιασµός και η γονιδιακή µετατροπή

71 Εναρµονισµένη εξέλιξη (concerted evolution) Τα µέλη γονιδιακών οικογενειών συνεχίζουν να εξελίσσονται µαζί και διατηρούν υψηλό ποσοστό οµοιότητας Καθώς εξελίσσονται συγχρονισµένα, αποκλίνουν µαζί όλο και περισσότερο από τις αντίστοιχες γονιδιακές οικογένειες σε άλλα είδη Παράδειγµα: τα γονίδια της τριχρωµατικής όρασης στα ανώτερα πρωτεύοντα Τα ιντρόνια 4 στο κόκκινο και πράσινο γονίδιο (χρωµόσωµα Χ) είναι πανοµοιότυπα, παρά το γεγονός ότι η διάσταση από τον κοινό τους πρόγονο έγινε 20ΜΥΑ µετά από ένα φαινόµενο διπλασιασµού.

72 Εναρµονισµένη εξέλιξη µέσω γονιδιακής µετατροπής Η γονιδιακή µετατροπή είναι µια µη αντιστρεπτή διαδικασία ανασυνδυασµού κατά την οποία δύο αλληλουχίες αλληλεπιδρούν έτσι ώστε η µία να µετασχηµατίζεται από την άλλη - εν αλλάζει ο αριθµός των γονιδιακών αντιγράφων. -Γίνεται µεταξύ γονιδίων που βρίσκονται µακριά το ένα από το άλλο (στην ίδια χρωµατίδα, σε οµόλογα ή µη οµόλογα χρωµοσώµατα) -Ρυθµός γονιδιακής µετατροπής µεταξύ αδελφών χρωµατίδων πιο υψηλός από αυτούς µεταξύ οµολόγων ή µη οµολόγων χρωµοσωµάτων -Μεροληπτική γονιδιακή µετατροπή: µεγαλύτερη συχνότητα µετατροπής της µίας αλληλουχίας στην άλλη.

73 Γονιδιακή µετατροπή ανάµεσα σε οµόλογες αλληλουχίες (allelic gene conversion) Αλληλόµορφο Α A Αλληλόµορφο a a A a A a

74 Γονιδιακή µετατροπή ανάµεσα σε µη οµόλογες αλληλουχίες (non-allelic gene conversion) A Τόπος Α B Τόπος Β A B A B

75 Άνισος επιχιασµός x +

76 Εναρµονισµένη εξέλιξη µέσω άνισου επιχιασµού Ο άνισος επιχιασµός αλλάζει τον αριθµό των επαναλαµβανόµενων αλληλουχιών. Οάνισοςεπιχιασµός επηρεάζει µόνο διαδοχικά γονίδια.

77 Μοριακή εξέλιξη και φαινότυπος Μεγάλο µέρος της µοριακής εξέλιξης έχει µικρή ή και µηδενική επίδραση στο φαινότυπο Για να εντοπίσει κανείς την οδό που οδηγεί από τη µοριακή εξέλιξη στην εξέλιξη του φαινοτύπου, πρέπει να εξετάσει τις αλλαγές των δοµικών και των αντίστοιχων ρυθµιστικών γονιδίων.

78 Κινητά γενετικά στοιχεία ΕΠΙΣΩΜΑΤΑ : αντιγραφή χωρίς ένθεση ΜΕΤΑΘΕΤΑ ΣΤΟΙΧΕΙΑ (transposable elements) : αντιγραφή µόνο µετά από ένθεση στα χρωµοσώµατα Εντιθέµενες αλληλουχίες: περιέχουν µόνο πληροφορία απαραίτητη για µετάθεση Τρανσποζόνια (αντιγραφή ένθεση): περιέχουν και άλλα γονίδια Ρετροστοιχεία (µεταγραφή-αντίστροφη µεταγραφήένθεση): περιέχουν γονίδιο αντίστροφης µεταγραφάσης

79 Κατάταξη Ρετροστοιχείων Αντίστροφη µεταγραφάση Ικανότητα µετάθεσης LTRs Ιικές πρωτεϊνες Ρετρόνιο Ναι Όχι Όχι Όχι Ρετροποζόνιο Ναι Ναι Όχι Όχι Ρετροτρανσποζόνιο Ναι Ναι Ναι Όχι Ρετροϊός Ναι Ναι Ναι Ναι Παραρετροϊός Ναι Όχι Ναι Ναι Ρετροαλληλουχία Όχι Όχι Όχι Όχι Οι αντίστροφες µεταγραφάσες όλων των ρετροστοιχείων παρουσιάζουν κάποια αµινοξική οµοιότητα γεγονός που υποδεικνύει κοινή εξελικτική καταγωγή

80 Κινητά στοιχεία (mobile elements) 45% του ανθρώπινου γονιδιώµατος Πολλαπλασιάζονται µέσω µετάθεσης και προάγουν την εµφάνιση µεταλλάξεων και φαινοµένων άνισου επιχιασµού LINEs (Long Interspersed Elements) επεξεργασµένα ψευδογονίδια Στοιχείο L1 SINEs (Short Interspersed Elements) Ακολουθίες Alu

81 LINEs και SINEs LINEs (long interspersed repetitive elements): µέγεθος 3-7 Κb. Η ανάλυση των αλληλουχιών τους δείχνει ότι είναι ρετροποζόνια ή εκφυλισµένα αντίγραφά τους. Κάθε λειτουργικό LINE περιέχει µια ενδονουκλεάση και αντίστροφη µεταγραφάση SINEs: µέγεθος bp. εν κωδικοποιούν πρωτεϊνες για ρετροµετάθεση. εν είναι αυτόνοµα-η µετάθεσή τους υποβοηθείται από άλλα γενετικά στοιχεία. Πως µετατίθενται τα SINEs; Η αλληλουχία στο 3 άκρο κάθε trna-sine είναι παρόµοια µετηναντίστοιχηενόςline. Έτσι, ηαντίστροφηµεταγραφάση του LINE µεταγράφει και το SINE.

82 οµές Alu και L1 5 Α B 3 ιµερές Alu (Α)ν (Α)ν 130bp 160bp 5 UTR ORF1 ORF2 3 Στοιχείο L1 (Α)ν 6,1Kb Αντίστροφη µεταγραφάση και ενδονουκλεάση

83 Μετάθεση στοιχείων Alu και L1

84 Κινητά γενετικά στοιχεία - Μεταθετά γενετικά στοιχεία στη Drosophila Στοιχείο Copia (5kb, αντίγραφα) και Copia-like : 5% γονιδιώµατος Στοιχείο FB : προκαλεί χρωµοσωµικές αναδιατάξεις Στοιχείο P (2.9kb) : υβριδιακή δυσγένεση µε µειωµένη γονιµότητα και αυξηµένη συχνότητα µεταλλάξεων (αρσενικά Ρ σε θηλυκά Μ) - Μεταθετά γενετικά στοιχεία στον άνθρωπο Οικογένεια Alu : 300 bp, 10 6 αντίγραφα LINES : αντίγραφα (17% DNA) SINES : αντίγραφα (12% DNA) LTR ρετροϊοί : 5% DNA

85 Επιδράσεις των µεταθετών στοιχείων Κατά τη διαδικασία µεταφοράς, µε κοπήκαιένθεση, είναι δυνατό, σε βακτήρια, να µεταφερθούν γονίδια που προσδίδουν ανθεκτικότητα σε αντιβιοτικά και δυνατότητα µεταβολισµού νέων ουσιών Ενεργοποίηση αδρανοποιηµένων γονιδίων (επειδή µεταφέρουν υποκινητές για µεταγραφή RNA) Αδρανοποίηση γονιδίων

86 Επιδράσεις των µεταθετών στοιχείων Οι αλληλουχίες αυτές ΕΝ ΥΠΑΡΧΟΥΝ επειδή εξυπηρετούν τον οργανισµό, αλλά επειδή ΑΝΑΠΑΡΑΓΟΝΤΑΙ ΑΥΤΟΝΟΜΑ ( Εγωιστικό DNA) «παράσιτα» του γονιδιώµατος Τα µεταθετά στοιχεία διατηρούνται παρά τις συνέπειες τους στον οργανισµό ΚΑΙΟΧΙχάρησεαυτές

87 Εξέλιξη του αριθµού των αντιγράφων και έλεγχος του εγωιστικού DNA - Γενικά, το επαναλαµβανόµενο DNA είναι άφθονο στις περιοχές των χρωµοσωµάτων που παρουσιάζουν χαµηλούς ρυθµούς επιχιασµού (κεντροµέρη, άκρα χρωµοσωµάτων, χρωµόσωµα Υ) διότι υπάρχει µεγαλύτερη πιθανότητα εγκαθίδρυσης πολλαπλών αντιγράφων σε περιοχές µε χαµηλό ανασυνδυασµό. Ισορροπία µεταξύ ρυθµού εµφάνισης (άνισος επιχιασµός), φυσικής επιλογής (αποµάκρυνση) και τυχαίας γενετικής παρέκκλισης (εγκαθίδρυση) - Συνεργιστικά αποτελέσµατα των βλαπτικών µεταλλαγών από µεταθετά στοιχεία. Η φυσική επιλογή διατηρεί τον αριθµό τους σταθερό - Ρύθµιση του ρυθµού µετάθεσης, µε µείωση καθώς αυξάνεται ο αριθµός των αντιγράφων και ανοσία µετάθεσης

88 Οριζόντια Γονιδιακή µεταφορά Μεταφορά γενετικής πληροφορίας µεταξύ πολύ διαφορετικών ειδών, κυρίως µέσω ιών και πλασµιδίων ιαφέρει από την περίπτωση της γονιδιακής ροής µε υβριδισµό η οποία συµβαίνει κυρίως µεταξύ στενά συγγενικών ειδών. Μεταφορά γονιδίων (π.χ. ανθεκτικότητας) και προφανώς µεγάλη επίδραση στο φαινότυπο. Περίπτωση του Agrobacterium στα δικοτυλήδονα φυτά Το γονίδιο του ενζύµου δισµουτάση του υπεροξειδίου φαίνεται να µεταφέρθηκε από το ψάρι-ξενιστή (Leiognathus splendens) στο βακτήριο-συµβιώτη (Photobacterium leiognathi) Γονίδια όµοια µε της αιµοσφαιρίνης σε ψυχανθή (leghemoglobin)

89 Οριζόντια Γονιδιακή µεταφορά Η «αιµοσφαιρίνη» τηςσόγιαςκαι άλλων ψυχανθών στα φυτά που συµβιώνουν µε νιτροποιητικά βακτήρια δεσµεύει το οξυγόνο που είναι τοξικό για τα βακτήρια αυτά. Η αποπρωτεϊνη παραγεται απότοφυτόενώηαίµη απότο βακτήριο. Το γονίδιο της leghemoglobin πιθανότατα µεταφέρθηκε σε κάποια φυτά από κάποιο ζώο µέσω οριζόντιας µεταφοράς. Το δέντρο των σφαιρινών (Lodish et al. 2000)

90 Εξέλιξη Η θεωρία της εξέλιξης είναι η βάση στην οποία χτίζεται η σύγχρονη βιολογία Από τη µελέτη της ανατοµίας µέχρι τη µελέτη της συµπεριφοράς και του γονιδιώµατος, η επιστηµονική µεθοδολογία απαιτεί την εκτίµηση των µεταβολών στους οργανισµούς στην πάροδο του χρόνου Είναι αδύνατη η εκτίµηση των σχέσεων ανάµεσα σε γονιδιακές αλληλουχίες χωρίς να λαµβάνουµε υπόψη τον τρόπο µε τον οποίο µεταβλήθηκαν αυτές οι αλληλουχίες στη διάρκεια της εξέλιξης

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας

Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας Διαλέξεις Βιολογίας ΙI 2014-20152015 Τμήμα Ιατρικής Πανεπιστήμιο Θεσσαλίας Βαρβάρα Τραχανά Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας Κυτταρική Βιολογία Είναι η ακαδημαϊκή περιοχή που μελετά τα κύτταρα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΜΕ ΜΕΤΑΛΛΑΓΕΣ Μεταλλαγή ή Μετάλλαξη Οποιαδήποτε αλλαγή του γενετικού υλικού που δεν οφείλεται σε ανασυνδυασµό ή σε διάσχιση των γονιδίων και η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΦΥΛΟΓΕΝΕΤΙΚ Α ΔΕΝΤΡΑ

ΦΥΛΟΓΕΝΕΤΙΚ Α ΔΕΝΤΡΑ ΦΥΛΟΓΕΝΕΤΙΚΑ ΔΕΝΤΡΑ Χαρακτηριστική πτυχή της ζωής είναι η απεριόριστη ποικιλότητα της. Δεν υπάρχουν δύο ίδια άτομα σε έναν πληθυσμό, δύο ίδιοι πληθυσμοί σε ένα είδος, δύο ίδια είδη, κ. ο. κ. Παντού, υπάρχει

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

Πρότυπα και ρυθμοί υποκαταστάσεων

Πρότυπα και ρυθμοί υποκαταστάσεων Πρωτεϊνική Εξέλιξη Πρότυπα και ρυθμοί υποκαταστάσεων Ένα σημαντικό ερώτημα στη μελέτη της εξέλιξης αναφέρεται στο πώς είναι δυνατό να διαφέρουν τα πρότυπα και οι ρυθμοί των υποκαταστάσεων ανάμεσα στα διάφορα

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. Η Επιτροπή Παιδείας της ΠΕΒ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4)

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα