Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από"


1 Τα επίπεδα του mrna πού είναι διαθέσιμα για την μετάφραση προσδιορίζονται Από την ταχύτητα σύνθεσης του μηνύματος κατά την πορεία της μεταγραφής Από την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης Από την ταχύτητα μεταφοράς του μηνύματος έξω από τον πυρήνα Από την ταχύτητα αποικοδόμησης στο κυτταρόπλασμα







8 Σήμερα πιστευεται ότι η παρουσία της αλυσίδας του Poly(A) στο mrna σχετίζεται αμεσα με την αποικοδόμηση του.μεταξύ των ενδείξεων που υποστηρίζουν την άποψη αυτή περιλαμβάνονται και οι παρακάτω Οι ακολουθίες του poly(a) του κυτταροπλασματικού mrna γίνονται προοδευτικά μικρότερες με τον χρόνο Το mrna το οποίο στερείται poly(a) έχει μικρότερη ημιζωή από ότι τα περισσότερα ευκαρυωτικά mrna Το αποαδενυλιωμένο mrna της γλοβίνης μεταφράζεται με μικρότερη ικανότητα από ότι το κανονικό mrna όταν γίνεται ένεση σε ωοκύτταρα του Xenopus αλλά όχι όταν προστίθεται σε συστήματα ελευθέρων κυττάρων σε μικρά χρονικά διαστήματα Έχει κατορθωθεί να αυξηθεί η σταθερότητα των διαφόρων μηνυμάτων όταν πολυαδενυλιώνονται In vitro Ελαττώνεται η σταθερότητα του μηνύματος του αδενοιού όταν παρεμποδίζεται η προσθήκη poly(a) με δεοξυαδενοσίνη

9 Το μέγεθος του poly(a) όμως φαίνεται ότι δεν είναι ο μοναδικός παράγων ο οποίος ελέγχει την σταθερότητα του RNA έτσι έχει βρεθεί ότι mrna τα οποία περιέχουν λίγο ή καθόλου poly(a) έχουν υψηλή σταθερότητα Η περιοχή του mrna που βρίσκεται κοντά στο σημείο σύνδεσης με το poly(a) φαίνεται να είναι μια περιοχή που είναι ευαίσθητη σε ριβονουκλεάση Οι πρωτεΐνες που συνδέονται στην περιοχή του poly (A) ή στην 3 μη μεταφραζόμενη περιοχή και ιδιαίτερα οι διαμορφώσεις της δευτεροταγούς και τριτοταγούς δομής εχουν καθοριστικό ρόλο στην σταθερότητα του μηνύματος RNA



12 Τα ευκαρυωτικά κυτταρικά mrna είναι καλυμμένα στο 5 άκρο από μία δομή πού έχει την μορφή m7g(5 )ppp(5 )ppp(5 )N)N (όπου( με Ν παριστάνεται τό κάθε νουκλεοτίδιο Ο ρόλος της δομής του καπέλου κατά την μετάφραση των μηνυμάτων σε In vitro συστήματα μετάφρασης υποστηρίχθηκε από δύο κύκλους πειραμάτων Καλυμμένα με καπέλο μηνύματα που απομονώνονται από ορισμένους ιούς ή από ορισμένα κύτταρα μεταφράζονται πολύ πιο αποδοτικά από τα μηνύματα εκείνα πού δεν φέρουν καπέλο Ανάλογα του καπέλου όπως m7gmp ή m7gdp αναστέλλουν ειδικά την μετάφραση των καλυμμένων μηνυμάτων ελαττώνοντας την δέσμευση της 40S ριβοσωμικής υπομονάδος στο mrna

13 Παρά την σημασία του καπέλου κατά την μετάφραση η αναγκαιότητα του φαίνεται να μην είναι ούτε απόλυτη ούτε για όλους τους οργανισμούς.γεγονός που δημιουργεί δύο ερωτήματα Ποιοι είναι οι παράγοντες εκείνοι οι οποίοι επηρεάζουν τον βαθμό στο οποίο ένα μήνυμα εξαρτάται από την δομή του καπέλου και πώς η αναγκαιότητα αυτή διαπλέκεται με την ρύθμιση της μετάφρασης Πώς ένα μήνυμα RNA πού στην φυσική του κατάσταση είναι μη καλυμμένο ξεπερνά την αναγκαιότητα της παρουσίας του καπέλου της μετάφρασης

14 Μέθοδος για τον προσδιορισμό των πρωτεινών πού δεσμεύονται στο καπέλο όπως αναπτύχθηκε από τους Sonenberg και Shatkin Συντίθεται mrna in vivo παρουσία τριτιωμένης στο μεθύλιο S-αδενοσυλομεθειονίνη για να ραδιοσημανθεί ειδικά το m7g τμήμα του καπέλου Η 2,3 cis διόλη της ριβόζης του m7g οξειδώνεται για να δώσει μια δραστική διαλδευδη Οι βάσεις του schiff που σχηματίζονται μεταξύ οξειδωμένου καπέλου και ελευθέρων αμινομάδων σταθεροποιούνται με αναγωγή με NaBH3CN Το μήνυμα αποικοδομείται Το σύμπλεγμα των πρωτεινών που δεσμεύεται στο καπέλο αναλύεται με ηλεκτροφόρηση δύο διαστάσεων και φλουρογραφία

15 Για τον προσδιορισμό των πρωτεινών που δεσμεύονται στο καπέλο με την μέθοδο της χρωματογραφίας συγγενείας ακολουθεί η παρακάτω πορεία Ανάλογα του καπέλου δεσμεύονται σε αδρανές υλικό Στο υλικό χρωματογραφούνται οι πρωτεϊνες οι οποίες ελαμβάνοντο από μη κλασματωμένο εκχύλισμα παραγόντων έναρξης Οι πρωτεϊνες πού προσδένονται στην στήλη εκλύονται καί αναλύονται με ηλεκτροφόρηση δύο διαστάσεων


17 Η άποψη οτι η μόνη από τις πρωτεϊνες πού αναγνωρίζει συγκεκριμένη θέση είναι η 24K ενώ οι άλλες eif-4a και eif-4b δεσμεύονται με ένα δευτερογενή τρόπο πού είναι συνέπεια της αρχικής αλληλεπίδρασης της 24Κ CBP υποστηρίζεται από διάφορες ενδείξεις Η μόνη από τις πρωτεΐνες πού δεσμεύονται απ ευθείας στο καπέλο και η οποία μπορεί να καθαρισθεί σε εξατομικευμένη οντότητα με χρωματογραφία συγγενείας eif-4b σε υπόστρωμα με m7gdp είναι η 24Κ Τα συμπλέγματα υψηλού μοριακού βάρους πού δεσμεύονται στο καπέλο σχεδόν όλα περιέχουν την 24Κ Οι eif-4a και eif-4b δεν μπορούν να διασυνδεθούν με το mrna μόνες τους ή σε συνδυασμό παρά μόνο όταν αναμιχθούν με την 24Κ Παράγωγο φωτοσυγγενείας ανάλογα του καπέλου δεν μπορούν να σημάνουν ούτε τον eif-4a ούτε eif-4b αλλά μπορούν και σημαίνουν τον 24Κ


19 Η 3-UTR συνιστά σήμερα καθοριστικό στοιχείο για την ρύθμιση της μεταφραστικής ικανότητος σε πρώιμα αναπτυξιακά στάδια.πλήθος πρωτεινικών μορίων που προσδενονται στην περιοχή επηρεάζουν ουσιαστικά την μετάφραση Φαίνεται οτι στην UTR υπάρχει η πληροφορία για το πότε θα παραχθεί η πρωτείνη που κωδικοποιείται στην κωδογόνο περιοχή σε πόση ποσότητα και σε ποιά περιοχή του κυτταροπλάσματος

20 Η 3-UTR φαίνεται να εηρεάζει την πρωτεινοσύνθεση με ενα η περισσότερους από τους παρακάτω τρόπους Την προσθήκη η αποικοδόμηση του Poly(A) στο 3- ακρο Την μετατροπή του μηνύματος σε RNP (μεταφραστικά ανενεργό σωμάτιο) Την μεταφορά καί μετάφραση πολλών mrna σε καθωρισμένες περιοχές του κυτταροπλάσματος Τον χρονο ημιζωής των μηνυμάτων στο κυτταρόπλασμα Την δευτεροταγή δομή του μηνύματος στο 5-ακρο και την συγγένεια του 5-ακρου του μηνύματος με τους ειδικούς παράγοντες εναρξης της μετάφρασης






Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία

Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία Στην μελέτη του ριβοσώματος, των στοιχείων που το συγκροτούν αλλά και του τρόπου με τον οποίο αυτά

Διαβάστε περισσότερα

Οταν επώασαν σε Ιn vitro σύστηµα πρωτεϊνοσυνθέσεως

Οταν επώασαν σε Ιn vitro σύστηµα πρωτεϊνοσυνθέσεως Οι Ενδείξεις οι οποίες υποστηρίζουν οτι η αναστολή της πρωτεϊνοσυνθέσεως από τους αναστολείς HCR και DAI εξασφαλίζεται µέσω της αντεπίδρασης µε τον eif-2 είναι πολλές η σηµαντικότερη οµως είναι µία Οταν

Διαβάστε περισσότερα

Λειτουργική Περιοχή της GTP-ασης

Λειτουργική Περιοχή της GTP-ασης Λειτουργική Περιοχή της GTP-ασης Οι πρωτεΐνες πού φαίνεται να εµπλέκονται στην περιοχή είναι οι πρωτεΐνες L7/L12. Οι πρωτεΐνες αυτές φαίνεται να είναι απαραίτητες για την ενεργότητα του ριβοσώµατος και

Διαβάστε περισσότερα

1. Τα διαφόρων τυπων συστήματα ελευθέρων κυττάρων 2.Τα. εξατομικευμένα κύτταρα στα οποία

1. Τα διαφόρων τυπων συστήματα ελευθέρων κυττάρων 2.Τα. εξατομικευμένα κύτταρα στα οποία Για τον εντοπισμό των μεταβολών πού επισυμβαίνουν στις διάφορες παραμέτρους της πρωτεινοσύνθεσης υπό την επίδραση διαφόρων παραγόντων χρησιμοποιούνται τα In vitro συστήματα Με τον ορο In vitro συστήματα

Διαβάστε περισσότερα

πρωτεινοσύνθεσης που έχουν χρησιμοποιηθεί σε μεγάλη έκταση είναι

πρωτεινοσύνθεσης που έχουν χρησιμοποιηθεί σε μεγάλη έκταση είναι Για τον εντοπισμό των μεταβολών πού επισυμβαίνουν στις διάφορες παραμέτρους της πρωτεινοσύνθεσης υπό την επίδραση διαφόρων παραγόντων χρησιμοποιούνται τα In vitro συστήματα Με τον ορο In vitro συστήματα

Διαβάστε περισσότερα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα ΣτονΣτον ρόλο των διαφόρων οµάδων των ριβοσωµικών πρωτεινών. Κατά πόσο δηλαδή υπάρχει ετερογένεια στις

Διαβάστε περισσότερα

Σύμφωνα με τις απόψεις που σήμερα επικρατούν η διαδικασία της έναρξης μπορεί να διαιρεθεί σε πέντε στάδια Διάσταση του 80S Ριβοσώματος στη 60S και την 40S υπομοναδα Φόρτιση του 40S S eif-3 συμπλέγματος

Διαβάστε περισσότερα

Τ ι είναι όμως αυτό π ου π ροσδιορίζει τα γεγονότα εναρξης στην μονάδα του χρόνου

Τ ι είναι όμως αυτό π ου π ροσδιορίζει τα γεγονότα εναρξης στην μονάδα του χρόνου Τ ι είναι όμως αυτό π ου π ροσδιορίζει τα γεγονότα εναρξης στην μονάδα του χρόνου Τ έσσερεις είναι οι κύριες π αράμετροι π ου επηρεάζουν ή προσδιορίζουν την ταχύτητα μιας σφαιρικής π ρωτεΐνης. Ποσότητα

Διαβάστε περισσότερα

Μηχανισμοί Μεταμεταγραφικού Ελέγχου

Μηχανισμοί Μεταμεταγραφικού Ελέγχου Μηχανισμοί Μεταμεταγραφικού Ελέγχου Δημήτρης Λ. Κοντογιάννης, PhD Ερευνητής Β, Ινστιτούτο Ανοσολογίας ΕΕΠΑ Αθήνα 6-2-2010 Crowne-Plaza Μεταμεταγραφικοί Μηχανισμοί Χρήσης- Τα Βασικά... ΕΕΠΑ Αθήνα 6-2-2010

Διαβάστε περισσότερα

Χαρακτηριστικά της Φεριτίνης

Χαρακτηριστικά της Φεριτίνης Ηρυθµιση της σύνθεσης της Φεριτίνης είναι το καλύτερο παράδειγµα µεταφραστικής ρύθµισης µέσω µιας πρωτεϊνης πού δεσµευεται σε συγκεκριµένη αλληλουχία του m-rna ως µεταφραστικός καταστολέας Ηφεριτίνη είναι

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Μοριακή Βιολογία. Ενότητα # (5): Ωρίμανση του RNA, ιντρόνια/εξώνια και μεταγραφική ρύθμιση. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής

Μοριακή Βιολογία. Ενότητα # (5): Ωρίμανση του RNA, ιντρόνια/εξώνια και μεταγραφική ρύθμιση. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Μοριακή Βιολογία Ενότητα # (5): Ωρίμανση του RNA, ιντρόνια/εξώνια και μεταγραφική ρύθμιση Παναγιωτίδης Χρήστος Άδειες Χρήσης Το παρόν

Διαβάστε περισσότερα

Η πρώτη χρυσή περίοδος για την ερευνά στο ριβόσωμα φαίνεται να τελειώνει

Η πρώτη χρυσή περίοδος για την ερευνά στο ριβόσωμα φαίνεται να τελειώνει Συχνά στην ιστορία των επιστημών παρουσιάζεται το φαινόμενο μια επιστημονική περιοχή να είναι σε μεγάλη ανάπτυξη ενώ σε μια άλλη να μην παρουσιάζει κανένα ενδιαφέρον Η πρώτη χρυσή περίοδος για την ερευνά

Διαβάστε περισσότερα

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια)

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια) ΕΠΩΝΥΜΟ:... ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε

Διαβάστε περισσότερα

Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό με τα δεδομένα που λαμβάνονται από ανοσοχημικές

Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό με τα δεδομένα που λαμβάνονται από ανοσοχημικές Εν αντιθέσει με αυτά που έχουν βρεθεί για τους προκαρυωτικούς οργανισμούς, για τους ευκαρυωτικούς υπάρχουν διαθέσιμες μόνο λίγες ακολουθίες ριβοσωμικών πρωτεϊνών. Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα


ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! 14/03/2014! Καθηγητής Δρ. Κωνσταντίνος Ε. Βοργιάς! 1! 1.Ποιά είναι τα διάφορα είδη RNA 2.Ποιά είναι τα στάδια της µεταγραφής 3.Μεταγραφική ωρίµανση RNA 4.Ποιά είναι η ενζυµολογία

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που κωδικοποιούν για τις πρωτεϊνες που επάγονται από το θερµικό

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 24 : Το µάτισµα και η επεξεργασία του RNA

Κ Ε Φ Α Λ Α Ι Ο 24 : Το µάτισµα και η επεξεργασία του RNA Κ Ε Φ Α Λ Α Ι Ο 24 : Το µάτισµα και η επεξεργασία του RNA Εικόνα 24.1 Το hnrna απαντάται ως ριβονουκλεοπρωτεϊνικό σύµπλοκο µε µορφή µιας σειράς από χάντρες. Εικόνα 24.2 Το RNA τροποποιείται στον πυρήνα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ) Η διαδικασία της μεταγραφής απαιτεί τη δράση του

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Η πεπτιδυλοτρανσφεράση είναι τό ενζυμο το οποίο καταλύει τον σχηματισμό του πεπτιδικού δεσμού.το ενζυμο διερευνάται εντατικά τα τελευταία 30 χρόνια και εχουν αναπτυχθεί ποικίλες απόψεις οσον αφορά την

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τύποι νουκλεϊκών οξέων

Τύποι νουκλεϊκών οξέων Τύποι νουκλεϊκών οξέων DNA ένας τύπος, μια λειτουργία RNA - 4 τύποι, 4 λειτουργίες Ριβοσωμικό RNA Αγγελιαφόρο RNA Μεταφορικό RNA Καταλυτικό RNA Βιοχημεία Ι Δ-1 Βιοχημεία Ι Δ-2 3 5 φωσφοδιεστερικός δεσμός

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Εργασία στην Βιολογία

Εργασία στην Βιολογία Εργασία στην Βιολογία Μεμβράνη του Πυρήνα του Κυττάρου Χρονιά: 2013-2014 Επιμέλεια: Σταμάτης Ορφανός, Μάριος Παναγιωτόπουλος [1] Πυρήνας του Κυττάρου Ο πυρήνας είναι το πιο μεγάλο και ευδιάκριτο οργανίδιο

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ_1.1 In vivo πειράματα απόδειξης της έννοιας του μετασχηματισμού και in vitro απόδειξη ότι το DNA είναι αυτό που προκαλεί το μετασχηματισμό. ΕΡΩΤΗΣΕΙΣ 1. Γιατί πιστεύετε ότι θανατώνονται τα βακτήρια

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Εικόνα 25.1 Το αυτο-µάτισµα του πρώιµου rrna 35S της Tetrahymena thermophila µπορεί να µελετηθεί µε ηλεκτροφόρηση σε πήκτωµα. Το αποδεσµευµένο ιντρόνιο σχηµατίζει

Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα


ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΤΑΒΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 2005 ΘΕΜΑ 1 ο 1. γ 2. α 3. α 4. β 5. δ ΘΕΜΑ 2 ο 1. σελ. 135: «Είναι φανερό ότι η χρησιμοποίηση σε σχέση µε παραδοσιακές τεχνικές». 2. σελ. 15, 16, 17

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το

Διαβάστε περισσότερα

Εισαγωγή στα microrna Δ. ΣΙΔΕΡΗΣ

Εισαγωγή στα microrna Δ. ΣΙΔΕΡΗΣ Εισαγωγή στα microrna Δ. ΣΙΔΕΡΗΣ Non-Coding RNA: Παλαιότερα γνωστό ως «JUNK» NC-RNAs: Αποτελούν την πλειοψηφία των μεταγράφων σε σύνθετα γονιδιώματα Non-Coding RNA: Κλειδί στην πολυπλοκότητα των ευκαρυωτικών?

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογία ΙI Κυτταρική Επικοινωνία Διδάσκοντες: Σ. Γεωργάτος, Θ. Τζαβάρας, Π. Κούκλης, Χ. Αγγελίδης Υπεύθυνος μαθήματος: Σ. Γεωργάτος Άδειες Χρήσης Το

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

Οµάδα Μοριακής Παθολογικής Ανατοµικής Ηµερίδα: Αρχές Μοριακής και Κυτταρικής Βιολογίας. Σεµινάριο οµή RNA- Τύποι RNA- Σύνθεση και επεξεργασία RNA

Οµάδα Μοριακής Παθολογικής Ανατοµικής Ηµερίδα: Αρχές Μοριακής και Κυτταρικής Βιολογίας. Σεµινάριο οµή RNA- Τύποι RNA- Σύνθεση και επεξεργασία RNA Οµάδα Μοριακής Παθολογικής Ανατοµικής Ηµερίδα: Αρχές Μοριακής και Κυτταρικής Βιολογίας Σεµινάριο οµή RNA- Τύποι RNA- Σύνθεση και επεξεργασία RNA ρ. Αποστολία Γκιάλη Υπεύθυνη Προγράµµατος Μοριακή Βιολογία

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ Εξεταζόμενο μάθημα Συκούδη Κωνσταντίνα Διδάσκων/επιβλέπων καθηγήτρια 3:00 ώρες Διάρκεια εξέτασης Ονοματεπώνυμο εξεταζόμενου Όνομα:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ (Γενετικό υλικό των βακτηρίων ρύθμιση της γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 Γενετικό υλικό των βακτηρίων Αποτελείται από ένα μόριο DNA σε υπερελιγμένη μορφή και τα άκρα του

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα