Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Από. Από. κατά την πορεία της μεταγραφής. την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης. Από"


1 Τα επίπεδα του mrna πού είναι διαθέσιμα για την μετάφραση προσδιορίζονται Από την ταχύτητα σύνθεσης του μηνύματος κατά την πορεία της μεταγραφής Από την αποδοτικότητα της Μεταμεταγραφικής ωρίμανσης Από την ταχύτητα μεταφοράς του μηνύματος έξω από τον πυρήνα Από την ταχύτητα αποικοδόμησης στο κυτταρόπλασμα







8 Σήμερα πιστευεται ότι η παρουσία της αλυσίδας του Poly(A) στο mrna σχετίζεται αμεσα με την αποικοδόμηση του.μεταξύ των ενδείξεων που υποστηρίζουν την άποψη αυτή περιλαμβάνονται και οι παρακάτω Οι ακολουθίες του poly(a) του κυτταροπλασματικού mrna γίνονται προοδευτικά μικρότερες με τον χρόνο Το mrna το οποίο στερείται poly(a) έχει μικρότερη ημιζωή από ότι τα περισσότερα ευκαρυωτικά mrna Το αποαδενυλιωμένο mrna της γλοβίνης μεταφράζεται με μικρότερη ικανότητα από ότι το κανονικό mrna όταν γίνεται ένεση σε ωοκύτταρα του Xenopus αλλά όχι όταν προστίθεται σε συστήματα ελευθέρων κυττάρων σε μικρά χρονικά διαστήματα Έχει κατορθωθεί να αυξηθεί η σταθερότητα των διαφόρων μηνυμάτων όταν πολυαδενυλιώνονται In vitro Ελαττώνεται η σταθερότητα του μηνύματος του αδενοιού όταν παρεμποδίζεται η προσθήκη poly(a) με δεοξυαδενοσίνη

9 Το μέγεθος του poly(a) όμως φαίνεται ότι δεν είναι ο μοναδικός παράγων ο οποίος ελέγχει την σταθερότητα του RNA έτσι έχει βρεθεί ότι mrna τα οποία περιέχουν λίγο ή καθόλου poly(a) έχουν υψηλή σταθερότητα Η περιοχή του mrna που βρίσκεται κοντά στο σημείο σύνδεσης με το poly(a) φαίνεται να είναι μια περιοχή που είναι ευαίσθητη σε ριβονουκλεάση Οι πρωτεΐνες που συνδέονται στην περιοχή του poly (A) ή στην 3 μη μεταφραζόμενη περιοχή και ιδιαίτερα οι διαμορφώσεις της δευτεροταγούς και τριτοταγούς δομής εχουν καθοριστικό ρόλο στην σταθερότητα του μηνύματος RNA



12 Τα ευκαρυωτικά κυτταρικά mrna είναι καλυμμένα στο 5 άκρο από μία δομή πού έχει την μορφή m7g(5 )ppp(5 )ppp(5 )N)N (όπου( με Ν παριστάνεται τό κάθε νουκλεοτίδιο Ο ρόλος της δομής του καπέλου κατά την μετάφραση των μηνυμάτων σε In vitro συστήματα μετάφρασης υποστηρίχθηκε από δύο κύκλους πειραμάτων Καλυμμένα με καπέλο μηνύματα που απομονώνονται από ορισμένους ιούς ή από ορισμένα κύτταρα μεταφράζονται πολύ πιο αποδοτικά από τα μηνύματα εκείνα πού δεν φέρουν καπέλο Ανάλογα του καπέλου όπως m7gmp ή m7gdp αναστέλλουν ειδικά την μετάφραση των καλυμμένων μηνυμάτων ελαττώνοντας την δέσμευση της 40S ριβοσωμικής υπομονάδος στο mrna

13 Παρά την σημασία του καπέλου κατά την μετάφραση η αναγκαιότητα του φαίνεται να μην είναι ούτε απόλυτη ούτε για όλους τους οργανισμούς.γεγονός που δημιουργεί δύο ερωτήματα Ποιοι είναι οι παράγοντες εκείνοι οι οποίοι επηρεάζουν τον βαθμό στο οποίο ένα μήνυμα εξαρτάται από την δομή του καπέλου και πώς η αναγκαιότητα αυτή διαπλέκεται με την ρύθμιση της μετάφρασης Πώς ένα μήνυμα RNA πού στην φυσική του κατάσταση είναι μη καλυμμένο ξεπερνά την αναγκαιότητα της παρουσίας του καπέλου της μετάφρασης

14 Μέθοδος για τον προσδιορισμό των πρωτεινών πού δεσμεύονται στο καπέλο όπως αναπτύχθηκε από τους Sonenberg και Shatkin Συντίθεται mrna in vivo παρουσία τριτιωμένης στο μεθύλιο S-αδενοσυλομεθειονίνη για να ραδιοσημανθεί ειδικά το m7g τμήμα του καπέλου Η 2,3 cis διόλη της ριβόζης του m7g οξειδώνεται για να δώσει μια δραστική διαλδευδη Οι βάσεις του schiff που σχηματίζονται μεταξύ οξειδωμένου καπέλου και ελευθέρων αμινομάδων σταθεροποιούνται με αναγωγή με NaBH3CN Το μήνυμα αποικοδομείται Το σύμπλεγμα των πρωτεινών που δεσμεύεται στο καπέλο αναλύεται με ηλεκτροφόρηση δύο διαστάσεων και φλουρογραφία

15 Για τον προσδιορισμό των πρωτεινών που δεσμεύονται στο καπέλο με την μέθοδο της χρωματογραφίας συγγενείας ακολουθεί η παρακάτω πορεία Ανάλογα του καπέλου δεσμεύονται σε αδρανές υλικό Στο υλικό χρωματογραφούνται οι πρωτεϊνες οι οποίες ελαμβάνοντο από μη κλασματωμένο εκχύλισμα παραγόντων έναρξης Οι πρωτεϊνες πού προσδένονται στην στήλη εκλύονται καί αναλύονται με ηλεκτροφόρηση δύο διαστάσεων


17 Η άποψη οτι η μόνη από τις πρωτεϊνες πού αναγνωρίζει συγκεκριμένη θέση είναι η 24K ενώ οι άλλες eif-4a και eif-4b δεσμεύονται με ένα δευτερογενή τρόπο πού είναι συνέπεια της αρχικής αλληλεπίδρασης της 24Κ CBP υποστηρίζεται από διάφορες ενδείξεις Η μόνη από τις πρωτεΐνες πού δεσμεύονται απ ευθείας στο καπέλο και η οποία μπορεί να καθαρισθεί σε εξατομικευμένη οντότητα με χρωματογραφία συγγενείας eif-4b σε υπόστρωμα με m7gdp είναι η 24Κ Τα συμπλέγματα υψηλού μοριακού βάρους πού δεσμεύονται στο καπέλο σχεδόν όλα περιέχουν την 24Κ Οι eif-4a και eif-4b δεν μπορούν να διασυνδεθούν με το mrna μόνες τους ή σε συνδυασμό παρά μόνο όταν αναμιχθούν με την 24Κ Παράγωγο φωτοσυγγενείας ανάλογα του καπέλου δεν μπορούν να σημάνουν ούτε τον eif-4a ούτε eif-4b αλλά μπορούν και σημαίνουν τον 24Κ


19 Η 3-UTR συνιστά σήμερα καθοριστικό στοιχείο για την ρύθμιση της μεταφραστικής ικανότητος σε πρώιμα αναπτυξιακά στάδια.πλήθος πρωτεινικών μορίων που προσδενονται στην περιοχή επηρεάζουν ουσιαστικά την μετάφραση Φαίνεται οτι στην UTR υπάρχει η πληροφορία για το πότε θα παραχθεί η πρωτείνη που κωδικοποιείται στην κωδογόνο περιοχή σε πόση ποσότητα και σε ποιά περιοχή του κυτταροπλάσματος

20 Η 3-UTR φαίνεται να εηρεάζει την πρωτεινοσύνθεση με ενα η περισσότερους από τους παρακάτω τρόπους Την προσθήκη η αποικοδόμηση του Poly(A) στο 3- ακρο Την μετατροπή του μηνύματος σε RNP (μεταφραστικά ανενεργό σωμάτιο) Την μεταφορά καί μετάφραση πολλών mrna σε καθωρισμένες περιοχές του κυτταροπλάσματος Τον χρονο ημιζωής των μηνυμάτων στο κυτταρόπλασμα Την δευτεροταγή δομή του μηνύματος στο 5-ακρο και την συγγένεια του 5-ακρου του μηνύματος με τους ειδικούς παράγοντες εναρξης της μετάφρασης






Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία

Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία Στην μελέτη του ριβοσώματος, των στοιχείων που το συγκροτούν αλλά και του τρόπου με τον οποίο αυτά

Διαβάστε περισσότερα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα ΣτονΣτον ρόλο των διαφόρων οµάδων των ριβοσωµικών πρωτεινών. Κατά πόσο δηλαδή υπάρχει ετερογένεια στις

Διαβάστε περισσότερα

Μηχανισμοί Μεταμεταγραφικού Ελέγχου

Μηχανισμοί Μεταμεταγραφικού Ελέγχου Μηχανισμοί Μεταμεταγραφικού Ελέγχου Δημήτρης Λ. Κοντογιάννης, PhD Ερευνητής Β, Ινστιτούτο Ανοσολογίας ΕΕΠΑ Αθήνα 6-2-2010 Crowne-Plaza Μεταμεταγραφικοί Μηχανισμοί Χρήσης- Τα Βασικά... ΕΕΠΑ Αθήνα 6-2-2010

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό με τα δεδομένα που λαμβάνονται από ανοσοχημικές

Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό με τα δεδομένα που λαμβάνονται από ανοσοχημικές Εν αντιθέσει με αυτά που έχουν βρεθεί για τους προκαρυωτικούς οργανισμούς, για τους ευκαρυωτικούς υπάρχουν διαθέσιμες μόνο λίγες ακολουθίες ριβοσωμικών πρωτεϊνών. Από τα δεδομένα της πρωτοδιάταξης σε συνδυασμό

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! ΜΕΤΑΓΡΑΦΗ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ! 14/03/2014! Καθηγητής Δρ. Κωνσταντίνος Ε. Βοργιάς! 1! 1.Ποιά είναι τα διάφορα είδη RNA 2.Ποιά είναι τα στάδια της µεταγραφής 3.Μεταγραφική ωρίµανση RNA 4.Ποιά είναι η ενζυµολογία

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που κωδικοποιούν για τις πρωτεϊνες που επάγονται από το θερµικό

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 24 : Το µάτισµα και η επεξεργασία του RNA

Κ Ε Φ Α Λ Α Ι Ο 24 : Το µάτισµα και η επεξεργασία του RNA Κ Ε Φ Α Λ Α Ι Ο 24 : Το µάτισµα και η επεξεργασία του RNA Εικόνα 24.1 Το hnrna απαντάται ως ριβονουκλεοπρωτεϊνικό σύµπλοκο µε µορφή µιας σειράς από χάντρες. Εικόνα 24.2 Το RNA τροποποιείται στον πυρήνα

Διαβάστε περισσότερα


Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ) Η διαδικασία της μεταγραφής απαιτεί τη δράση του

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Εικόνα 25.1 Το αυτο-µάτισµα του πρώιµου rrna 35S της Tetrahymena thermophila µπορεί να µελετηθεί µε ηλεκτροφόρηση σε πήκτωµα. Το αποδεσµευµένο ιντρόνιο σχηµατίζει

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα


ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΤΑΒΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 2005 ΘΕΜΑ 1 ο 1. γ 2. α 3. α 4. β 5. δ ΘΕΜΑ 2 ο 1. σελ. 135: «Είναι φανερό ότι η χρησιμοποίηση σε σχέση µε παραδοσιακές τεχνικές». 2. σελ. 15, 16, 17

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Οµάδα Μοριακής Παθολογικής Ανατοµικής Ηµερίδα: Αρχές Μοριακής και Κυτταρικής Βιολογίας. Σεµινάριο οµή RNA- Τύποι RNA- Σύνθεση και επεξεργασία RNA

Οµάδα Μοριακής Παθολογικής Ανατοµικής Ηµερίδα: Αρχές Μοριακής και Κυτταρικής Βιολογίας. Σεµινάριο οµή RNA- Τύποι RNA- Σύνθεση και επεξεργασία RNA Οµάδα Μοριακής Παθολογικής Ανατοµικής Ηµερίδα: Αρχές Μοριακής και Κυτταρικής Βιολογίας Σεµινάριο οµή RNA- Τύποι RNA- Σύνθεση και επεξεργασία RNA ρ. Αποστολία Γκιάλη Υπεύθυνη Προγράµµατος Μοριακή Βιολογία

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ Εξεταζόμενο μάθημα Συκούδη Κωνσταντίνα Διδάσκων/επιβλέπων καθηγήτρια 3:00 ώρες Διάρκεια εξέτασης Ονοματεπώνυμο εξεταζόμενου Όνομα:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ (Γενετικό υλικό των βακτηρίων ρύθμιση της γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 Γενετικό υλικό των βακτηρίων Αποτελείται από ένα μόριο DNA σε υπερελιγμένη μορφή και τα άκρα του

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Τα γονίδια καθορίζουν τα είδη των πρωτεϊνών που συντίθενται στα κύτταρα

Τα γονίδια καθορίζουν τα είδη των πρωτεϊνών που συντίθενται στα κύτταρα Σύνθεση του RNA Δομή και σύνθεση του RNA Τα γονίδια όλων των κυττάρων αλλά και πολλών ιών αποτελούνται από DNA Τα γονίδια καθορίζουν τα είδη των πρωτεϊνών που συντίθενται στα κύτταρα Το μόριο όμως που

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

εισέρχεται στο φυτό ως ενυδατωµένο κατιόν

εισέρχεται στο φυτό ως ενυδατωµένο κατιόν Κατιόν µαγνησίουmg 2+ εισέρχεται στο φυτό ως ενυδατωµένο κατιόν Θρέψη Φυτών. Μπουράνης, Σ. Χωριανοπούλου 1 Επίπεδο Μg για κανονική αύξηση 0,15 0,35% ή60 140 µmol Mg gξμ -1 ΤοMgκινείταιστοΞΑΣκαιστοΗΑΣ HΑΣ100

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18


Διαβάστε περισσότερα


ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Μετα-μεταγραφική ρύθμιση και πρωτεϊνοσύνθεση σε προκαρυωτικά και ευκαρυωτικά

Μετα-μεταγραφική ρύθμιση και πρωτεϊνοσύνθεση σε προκαρυωτικά και ευκαρυωτικά Μετα-μεταγραφική ρύθμιση και πρωτεϊνοσύνθεση σε προκαρυωτικά και ευκαρυωτικά Το βασικό δόγμα σε προκαρυωτικά και ευκαρυωτικά http://barleyworld.org/sites/default/files/figure-08-01_0.jpg Μεταγραφή-μετάφραση

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 4 Μαρτίου 2012 Θέμα 1 ο : 1.β 2.γ 3.γ 4.δ 5.δ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 4 Μαρτίου 2012 Θέμα 1 ο : 1.β 2.γ 3.γ 4.δ 5.δ Θέμα 2 ο : 1. Σχολικό βιβλίο, σελ.119 «Οι ιντερφερόνες είναι αντιικές πρωτεΐνες.με

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης 2. Πρόσδεση πρωτεϊνικών καταστολέων σε αλληλουχίες της 3 περιοχής, στη μη-μεταφραζόμενη

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

Από το γονίδιο στην πρωτεΐνη

Από το γονίδιο στην πρωτεΐνη Κεφάλαιο 17 Από το γονίδιο στην πρωτεΐνη Original Slides by Erin Barley Kathleen Fitzpatrick Γρηγόρης Παπαγρηγορίου 1 Η ροή της γενετικής πληροφορίας Η πληροφορία που περιέχεται στα γονίδια έχει την μορφή

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

Ενα τυπικό πρωτόκολλο για τον καθαρισμό μιας διαλυτής κυτταρικής πρωτείνης περιλαμβάνει

Ενα τυπικό πρωτόκολλο για τον καθαρισμό μιας διαλυτής κυτταρικής πρωτείνης περιλαμβάνει Ενα τυπικό πρωτόκολλο για τον καθαρισμό μιας διαλυτής κυτταρικής πρωτείνης περιλαμβάνει Διάσπαση της κυτταρικής μεμβράνης με ομοιογενοποίηση Διαφορική φυγοκέντριση ωστε να διαχωρισθεί η πρωτεινική ενεργότητα

Διαβάστε περισσότερα