Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν.

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν."

Transcript

1 Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν. Μιχάλης Κ. Στεφανάκης, Γιώργος Τσικαλάς, Ελευθέριος Τουλουπάκης, Λαζανάκη Μαρία, Χαράλαμπος Ε. Κατερινόπουλος Τμήμα Χημείας, Πανεπιστημιο Κρήτης, Βούτες, Ηράκλειο 71003, Κρήτη, Ελλάδα Παύλος Μακρίδης, Τμήμα Βιολογίας, Πανεπιστήμιο Πατρών, Πανεπιστημιούπολη Ρίο, Πάτρα, 26500, Ελλάδα Δημήτριος Ζαραγκότας, Δημήτριος Μπακρατσάς, Ηλίας Αναστασόπουλος Τμήμα Τεχνολόγων Γεωπόνων, ΤΕΙ Θεσσαλίας, Λάρισα 41110, Ελλάδα Χαρίκλεια Παπαϊωάννου, Βασίλειος Παπασωτηρόπουλος, Τμήμα Τεχνολόγων Γεωπόνων, ΤΕΙ Δυτικής Ελλάδας Αμαλιάδα 27200, Ελλάδα Περίληψη- Δείγματα ελαίου φυτών ρίγανης επιλέχθηκαν για απολύμανση τροχόζωων Brachionus plicatilis απο βακτηριακά στελέχη του γένους Vibrio. Ακολούθησε μοριακή ταυτοποίηση των επιλεγμένων κλώνων ρίγανης με ανάλυση μοριακών δεικτών SSR. Με βάση την ανάλυση αυτή, οι γενότυποι των κλώνων ρίγανης ομαδοποιήθηκαν σε τρεις κύριες ομάδες. Για ορισμένους από τους γενοτύπους αυτούς επιχειρήθηκε η συσχέτιση των αποτελεσμάτων των χημειοτυπικών αναλύσεων με αυτά από την ανάλυση μοριακής ποικιλότητας, όπου προέκυψαν παρόμοιες ομαδοποιήσεις. Λέξεις κλειδιά μοριακή ανάλυση; Origanum; SSR; Vibrio; Brachionus plicatilis; υδατοκαλλιέργειες ΕΙΣΑΓΩΓΗ Στην Ελλάδα η ρίγανη αυτοφύεται σε διάφορες περιοχές, ενώ τα τελευταία χρόνια έχει αρχίσει η συστηματική καλλιέργειά της με στόχο την εμπορική εκμετάλλευσή της. Η ύπαρξη διαφορετικών ειδών, κυριότερα των οποίων είναι τα Origanum vulgare και Origanum οnites, ο μεγάλος αριθμός υποειδών, αλλά και οι διαφορετικοί οικότυποι αποδεικνύουν τη μεγάλη γενετική ποικιλότητα, που έχει ως αποτέλεσμα τη διαφοροποίηση των φυτών, τόσο μορφολογικά όσο και ως προς διάφορες βιοχημικές τους ιδιότητές [1]. Φυτά ρίγανης έχει αποδειχθεί ότι έχουν υψηλή περιεκτικότητα σε φαινολικά [2], γεγονός που σχετίζεται με τη δραστικότητα του ελαίου τους έναντι διαφόρων φυτικών και ζωικών παθογόνων βακτηρίων [3]. Σε μελέτες για την ελληνική ρίγανη περισσότερα από 30 ενεργά συστατικά έχουν εντοπιστεί, συμπεριλαμβανομένων του ροσμαρινικού οξέως, της θυμόλης και της καρβακρόλης [4]. Διάφορες μελέτες αποδεικνύουν τις αντιμικροβιακές ιδιότητες του ελαίου της ρίγανης [5], [6]. Στην αγορά, υπάρχει ήδη ένα προϊόν, με βάση το έλαιο της ρίγανης, το οποίο χρησιμοποιείται κατά γαστρεντερικών παθογόνων, που σκοτώνει τους μικροοργανισμούς όταν έρχεται σε επαφή με αυτούς, εντός του εντέρου γαρίδων ή ψαριών [7]. Νεότερα ερευνητικά δεδομένα απέδειξαν ότι τα αιθέρια έλαια συγκεκριμένων φυτών ρίγανης μπορούν να χρησιμοποιηθούν για την μείωση της δράσης των βακτηριακών στελεχών του γένους Vibrio και στην απολύμανση ζωοπλαγκτονικών οργανισμών τροχόζωων Brachionus plicatilis, που χρησιμοποιούνται ως ζωντανή τροφή σε ψάρια [8], [9]. Ο σκοπός της παρούσας μοριακής ανάλυσης ήταν διττός. Αφενός να εκτιμηθεί η γενετική ποικιλότητα ενός ετερόκλητου πληθυσμού δειγμάτων ρίγανης και αφετέρου να ταυτοποιηθούν, μοριακά, επιλεγμένα δείγματα, που έδειξαν μέγιστη αντιβατηριακή δράση έναντι στελεχών της ομάδας Vibrio, για την απολύμανση ζωοπλαγκτονικών οργανισμών. Επίσης στη παρούσα μελέτη επιχειρήθηκε να συσχετισθούν τα αποτελέσματα των χημικών αναλύσεων με εκείνα των μοριακών αναλύσεων, των συγκεκριμένων δειγμάτων ρίγανης που έχουν μεγάλο ενδιαφέρον για απολύμανση των ζωοπλαγκτονικών οργανισμών και πιο συγκεκριμένα τροχοζώων του είδους Brachionus plicatilis. Για τις μοριακές αναλύσεις επιλέχθηκαν οι πυρηνικές μικροδορυφορικές αλληλουχίες (microsatellites), αλλιώς γνωστές και ως SSR, (Simple Sequence Repeats) κυρίως λόγω των ιδιοτήτων που εμφανίζουν όπως πχ υψηλός μεταλλακτικός ρυθμός και ποικιλότητα ακόμα και μεταξύ ποικιλιών-πληθυσμών του ιδίου είδους, καθώς και συνυπερέχων τρόπο κληρονόμησης. Οι ιδιότητες αυτές καθιστούν τους μικροδορυφορικούς δείκτες ιδανικό μοριακό εργαλείο για τη διερεύνηση της γενετικής ποικιλότητας και 65

2 την ανάλυση της γενετικής δομής στα φυτά τόσο σε διαειδικό όσο και σε ενδοειδικό επίπεδο. ΜΕΘΟΔΟΛΟΓΙΑ Συλλογή σπόρων ρίγανης Σπόροι ρίγανης συλλέχθηκαν από τη Νάξο (O. onites), το Πήλιο (O. vulgare), της Σίσες Ηρακλείου Κρήτης (O. vulgare), τα Άγραφα (O. vulgare), τη Ζαχάρω Ηλείας (O. vulgare), την Πέρδικα Θεσπρωτίας (O. vulgare) μαζί με ένα δείγμα (O. vulgare) του εμπορίου καθώς και ένα δείγμα (O. marjoram) επίσης του εμπορίου. Οι σπόροι παρουσίαζαν ποικιλομορφία ως προς το σχήμα τους, που ήταν περίπου σφαιρικό, αλλά κυρίως ως προς το χρώμα τους. Επίσης συγκεκριμένοι γενότυποι ήταν πολύ παραγωγικοί σε σπόρο, ενω άλλη είχαν μικρή απόδοση. Απομόνωση DNA Στα φυτά της ρίγανης η αυξημένη συγκέντρωση δευτερογενών μεταβολιτών (πολυφαινολικών ενώσεων κλπ) δυσχεραίνει την εξαγωγή DNA υψηλής καθαρότητας και κατά συνέπεια παρεμποδίζει τις επακόλουθες μοριακές αναλύσεις. Για το λόγο αυτό αρχικά χρησιμοποιήθηκε η μέθοδος CTAB (hexadecyltrimethylammonium bromide) (Doyle and Doyle 1990) με μικρές τροποποιήσεις καθώς και μέθοδος απομόνωσης DNA που βασίζεται σε τυποποιημένη εμπορική συσκευασία (kit) (Macherey-Nagel). Η απομόνωση DNA πραγματοποιήθηκε από 30 mg ιστού νεαρού φύλλου ο οποίος λειοτριβήθηκε σε υγρό άζωτο. Η καθαρότητα και η ποσότητα του DNA που απομονώθηκε ελέγχθηκε τόσο με ηλεκτροφόρηση σε πήκτωμα αγαρόζης, όσο και φωτομετρικά (OD 260/280 nm και 260/230 nm). αγαρόζης 2% (Sigma). Οι ζώνες που προέκυψαν απεικονίστηκαν με το σύστημα απεικόνισης GelDocEZ (BioRad). Τα μοριακά βάρη των ζωνών υπολογίστηκαν συγκρίνοντας μάρτυρες DNA γνωστού μήκους 100-bp και 1- kb (New England Biolabs). Στη συνέχεια προκειμένου να μην υπάρξουν αναστολείς στα επόμενα στάδια της αλληλούχησης και γενοτύπησης των δειγμάτων απομακρύνθηκαν τα υπολείμματα των αντιδράσεων PCR (περίσσεια εκκινητών, άλατα MgCl 2, dntps κλπ με την βοήθεια της εμπορικής συσκευασίας PCR clean up kit (Macherey-Nagel). Αντιδράσεις PCR Οι εκκινητές που χρησιμοποιήθηκαν για να μελετηθούν οι επιλεχθέντες μικροδορυφορικοί δείκτες περιγράφονται από τους Novak et al. (2008). Πρόκειται περί μικροδορυφορικών επαναλήψεων που ανιχνεύονται σε εκφραζόμενες DNA αλληλουχίες (ESTs), οι οποίες ενισχύονται από τους παρακάτω εκκινητές όπως φαίνονται μαζί με τα μοτίβα επαναλήψεων στην εικόνα 1. Οι αντιδράσεις PCR πραγματοποιήθηκαν σε ένα μείγμα 15 μl που περιείχε: γονιδιωματικό DNA, 1x ρυθμιστικό διάλυμα PCR (KapaTaq), 1.5 mm MgCl 2, 0.6 μm από κάθε εκκινητή, 100 μμ από κάθε dntp και 0.6 U θερμοσταθερή DNA πολυμέραση (KapaTaq). Οι αντιδράσεις έγιναν σε θερμικό κυκλοποιητή MJ Research PTC-100 υπό τις ακόλουθες συνθήκες: ένα αρχικό στάδιο αποδιάταξης στους 95 C για 15 λεπτά ακολουθούμενο από 35 κύκλους: i) αποδιάταξης του DNA στους 95 C για 1 λεπτό, ii) υβριδισμού των εκκινητών στη μήτρα DNA στους 59 C για 1 λεπτό και iii) επέκτασης των νουκλεοτιδικών αλυσίδων στους 72 C για 2 λεπτά δευτερόλεπτα. Το πρόγραμμα τελείωσε με ένα τελευταίο βήμα επέκτασης των αλυσίδων DNA στους 72 C για 9 λεπτά. Τα προϊόντα PCR διαχωρίστηκαν με ηλεκτροφόρηση στα 110V σε πήκτωμα Εικ.1: Εκκινητές για την ενίσχυση με PCR καθώς και μοτίβα επανάληψης των μικροδορυφορικών δεικτών που χρησιμοποιήθηκαν στην παρούσα μελέτη. Αλληλούχηση και γενοτύπηση των δειγμάτων Αρχικά αλληλουχήσαμε ορισμένα από τα δείγματα, ώστε να εξετάσουμε κατά πόσον οι εκκινητές ενισχύουν πράγματι μικροδορυφορικές αλληλουχίες και ποιο είναι το ακριβές μοτίβο επανάληψης στο νουκλεοτιδικό επίπεδο. Για το σκοπό αυτό επιλέξαμε 3 δείγματα κλώνων ρίγανης τα οποία μετά την ενίσχυση με PCR αλληλουχήθηκαν χρησιμοποιώντας το ζεύγος εκκινητών OR09. Η αλληλούχιση έγινε από την εταιρεία VBC Biotech (Austria) χρησιμοποιώντας τη συσκευή αλληλούχησης ABI 3730XL (Applied Biosystems). Οι αλληλουχήσεις έγιναν και προς τις δύο κατευθύνσεις χρησιμοποιώντας δηλαδή τόσο τον πρόσθιο (forward) όσο και τον οπίσθιο (reverse) εκκινητή, ώστε να μην έχουμε απώλεια διαβάσματος βάσεων. Η ενοποίηση και η ευθυγράμμιση των νουκλεοτιδικών αλληλουχιών έγινε χρησιμοποιώντας το υπολογιστικό πακέτο προγραμμάτων BioEdit. 66

3 H γενοτύπηση των δειγμάτων έγινε χρησιμοποιώντας εκκινητές σημασμένους με ειδικές χρωστικές φθορισμού (FAM, HEX, ROX, TAMRA). Η ηλεκτροφόρηση των θραυσμάτων μετά από τις αντιδράσεις PCR έγινε στη συσκευή αλληλούχησης ΑΒΙ 3500 (Applied Biosystems) και ο καθορισμός του μεγέθους τους δηλαδή η διάκριση των διαφορετικών αλληλομόρφων κάθε μικροδορυφορικού γενετικού τόπου πραγματοποιήθηκε με το υπολογιστικό πρόγραμμα STRand Εικ. 3: PCR αντιδράσεις συγκεριμένων δειγματων φυτών ρίγανης μετά από αντίδρασεις PCR με τους εκκινητές OR09, OR10, OR12. Μετά την αλληλούχηση επιλεγμένων δειγμάτων πήραμε ενδεικτικά τα εξής αποτελέσματα (Εικόνα 4). Στατιστική Ανάλυση Για τον υπολογισμό του αριθμού των αλληλομόρφων ανά γενετικό τόπο, του δείκτη ποικιλότητας του Shannon (Ι), ο οποίος μάλιστα δεν προϋποθέτει ισορροπία του πληθυσμού κατά Hardy-Weinberg (Lewontin 1972) και των συντελεστών γενετικής απόστασης (Nei 1972) χρησιμοποιήθηκε το πρόγραμμα POPGENE Η ανάλυση κύριων συντεταγμένων (PCoA) πραγματοποιήθηκε με το πρόγραμμα Genalex Οι τιμές των συντελεστών γενετικής απόστασης κατά Nei (1972) χρησιμοποιήθηκαν για την κατασκευή δενδρογράμματος UPGMA με το πρόγραμμα TFPGA ver ΑΠΟΤΕΛΕΣΜΑΤΑ Με βάση τα προκαταρκτικά αποτελέσματα επιλέχθηκε για τη συνέχεια ως μέθοδος απομόνωσης DNA το κιτ Macherey- Nagel (Εικόνα 2) αφού μας έδινε τα καλύτερα αποτελέσματα ως προς την καθαρότητα και την ακεραιότητα του απομονωθέντος DNA. Εικόνα 4: Νουκλεοτιδική αλληλουχία του μικροδορυφορικού δείκτη OR09 σε άτομο ρίγανης. Στη συνέχεια αφού έγινε η ενοποίηση και ευθυγραμμίση (alignment) των αλληλουχιών DNA που προέκυψαν τόσο με τον πρόσθιο όσο και με τον οπίσθιο εκκινητή χρησιμοποιώντας το υπολογιστικό πακέτο προγραμμάτων BioEdit, προέκυψαν οι πλήρεις αλληλουχίες που εμφανίζονται στην επόμενη εικόνα. Εικ. 2: Ηλεκτροφόρηση δείγματων DNA ρίγανης (Macherey- Nagel) σε πήκτωμα αγαρόζης. Οι δειγματοληπτικές αντιδράσεις PCR χρησιμοποιώντας ορισμένα δείγματα ρίγανης και ζεύγη εκκινητών έδωσαν τα αναμενόμενα αποτελέσματα ως προς το μέγεθος και τον αριθμό των ζωνών όπως φαίνεται στην επόμενη εικόνα. Εικ. 5: Σύγκριση της πλήρους αλληλουχίας του μικροδορυφορικού δείκτη OR09 σε τρία δείγματα φυτών ρίγανης. Όπως παρατηρούμε στην εικόνα 5 δεν υπάρχουν διαφορές σε νουκλεοτιδικό επίπεδο μεταξύ των τριών ατόμων για το μικροδορυφορικό δείκτη OR09. Επίσης το μοτίβο επανάληψης προσομοιάζει με την εργασία των Novak et al. (2008). Η γενοτύπηση των δειγμάτων με βάση τα δώδεκα ζεύγη μικροδορυφορικών εκκινητών που χρησιμοποιήθηκαν στην παρούσα έρευνα αποκάλυψε την ύπαρξη διαφορετικών 67

4 αλληλομόρφων σε κάθε γενετικό τόπο. Στις επόμενες εικόνες παρατίθενται οι γενότυποι που προέκυψαν για ορισμένους μικροδορυφορικούς δείκτες σε συγκεκριμένα άτομα: επιτρέπουν το πλήρη διαχωρισμό τους και την απόλυτη ταυτοποίησή τους. Ο αριθμός των αλληλομόρφων ανά γενετικό τόπο και ο δείκτης ποικιλότητας του Shannon (Ι) παρουσιάζονται στον επόμενο πίνακα. Εικ. 6: Ομοζυγωτικό άτομο του δείγματος 1 ως προς το αλληλόμορφο 144 του εκκινητή OR09. Οι συντελεστές γενετικής απόστασης κυμαίνονται από 0 (μεταξύ 12 και 16) έως 1,79 (μεταξύ των δειγμάτων 11 και 15 με το δείγμα 24). Εικ. 7: Ετεροζυγωτικό άτομο του δείγματος 17 ως προς τα αλληλόμορφα 115 και 117 του εκκινητή OR12. Οι γενότυποι όλων των ατόμων σε όλους τους γενετικούς τόπους εμφανίζονται στον επόμενο πίνακα: Πίνακας: Συντελεστές γενετικής απόστασης D κατά Nei (1972). Η ανάλυση κυρίων συντεταγμένων (PCoA) έδειξε ότι τα δείγματα που αναλύθηκαν ομαδοποιούνται κυρίως σε τρεις μεγάλες ομάδες. Η μία περιλαμβάνει τρία δείγματα O. onites, στα δεξιά της Εικόνας 8, ενώ η μεγάλη ομάδα αριστερά της ίδιας εικόνας περιλαμβάνει δείγματα O. vulgare. Τέλος η μικρότερη ομάδα, περιλαμβάνει δείγματα O. vulgare και O. marjoram. Είναι εμφανές ότι εκτός από τα άτομα 12 και 16 τα οποία εμφανίζουν τον ίδιο γενότυπο και δεν μπορούν να διακριθούν στα υπόλοιπα υπάρχουν αρκετοί διαγνωστικοί δείκτες που 68

5 2013, όπου αναφέρονται οι κωδικοί 3,4,5,6,7 και 8, οι οποίοι αντιστοιχούν στους 15,22,12,19,25 και 20 της παρούσας εργασίας). Αντίστοιχη ομαδοποίηση προκύπτει για τους γενότυπους αυτούς και με βάση τους μοριακούς δείκτες SSR Εικ. 8 Ανάλυση κυρίων συντεταγμένων PCoA με βάση τους μοριακούς δείκτες Παρόμοια ομαδοποίηση εμφανίζεται και στο δενδρογράμμα UPGMA με βάση το συντελεστή γενετικής απόστασης του Nei (1972). Εικ. 11:. Aνάλυση κυρίων συντεταγμένων (PCoA) με βάση τη χρήση δεικτών SSR. Με βάση τη γενοτυπική σύσταση είναι εύκολο να διακριθούν οι γενότυποι αυτοί μεταξύ τους καθώς έχουν προκύψει αρκετοί διαγνωστικοί δείκτες με διακριτά διαγνωστικά πρότυπα που τους διαχωρίζουν. Για να πραγματοποιηθεί όμως απόλυτη διάκριση με το σύνολο των δειγμάτων που αναλύθηκαν θα χρειαστεί να αναλυθούν περισσότεροι ή και διαφορετικού τύπου μοριακοί δείκτες οι οποίοι ενισχύουν αλληλουχίες με μεγαλύτερη ποικιλότητα σε πιο εκτεταμένες περιοχές του γονιδιώματος. Ει.κ 9: Δενδρόγραμμα UPGMA με βάση το συντελεστή γενετικής απόστασης κατά Nei (1972). Στη συνέχεια έγινε ανάλυση κυρίων συντεταγμένων (PCoA) τόσο με βάση τη σύσταση του ριγανελαίου όσο και με βάση τα αποτελέσματα της μοριακής ανάλυσης με δείκτες SSR σε συγκεκριμένους γενοτύπους που παρουσίαζαν μεγάλο ενδιαφέρον από πλευράς χημικής σύστασης και αντιμικροβιακών ιδιοτήτων του ριγανέλαιου. Η ανάλυση PCoA με βαση τα χημειοτυπικά χαρακτηριστικά επίσης έδειξε ότι οι γενότυποι ομαδοποιούνται κυρίως σε τρεις ομάδες. ΣΥΖΗΤΗΣΗ Δεδομένα που παρουσιάστηκαν σε προηγούμενες αναφορές της ερευνητικής μας ομάδας, αποδεικνύουν ότι ριγανέλαιο απο τα δείγματα 1, 15 και 20 μπορεί να μειώσει τη δράση βακτηριακών στελεχών της ομάδας Vibrio και επομένως να χρησιμοποιηθεί στην απολύμανση τροχοζώων Brachionus plicatilis που χρησιμοποιούνται ως ζωντανή τροφή σε ψάρια [8], [9]. Στη παρούσα μελέτη πραγματοποιήθηκε μοριακή αναλυση 25 γενοτύπων ρίγανης με χρήση μικροδορυφορικών DNA δεικτών (SSRs). Με βάση αυτοί οι γενότυποι ομαδοποιήθηκαν σε τρεις κύριες ομάδες και προέκυψαν αρκετοί διαγνωστικοί δείκτες οι οποίοι διαχωρίζουν τα δέιγματα αυτά μεταξύ τους. Για ορισμένους από τους γενοτύπους αυτούς συσχετίσθηκαν οι χημειοτυπικές αναλύσεις με την ανάλυση μοριακών δεικτών και προέκυψαν παρόμοιες ομαδοποιήσεις. Χρειάζονται περισσότερες αναλύσεις προκειμένου να βρεθούν μοναδικά DNA προφίλ για τη ταυτοποίηση των συγκεκριμένων δειγμάτων που παρουσιάζουν μεγαλύτερο ενδιαφέρον. Εικ. 10: Aνάλυση κυρίων συντεταγμένων (PCoA) με βάση τη σύσταση του ριγανελαίου (προσαρμογή απο Stefanakis et al ΕΥΧΑΡΙΣΤΙΕΣ 69

6 H παρούσα έρευνα έχει συγχρηματοδοτηθεί από την Ευρωπαϊκή Ένωση (Ευρωπαϊκό Κοινωνικό Ταμείο - ΕΚΤ) και από εθνικούς πόρους μέσω του Επιχειρησιακού Προγράμματος «Εκπαίδευση και Δια Βίου Μάθηση» του Εθνικού Στρατηγικού Πλαισίου Αναφοράς (ΕΣΠΑ) Ερευνητικό Χρηματοδοτούμενο Έργο: ΑΡΧΙΜΗΔΗΣ ΙΙΙ. Επένδυση στην κοινωνία της γνώσης μέσω του Ευρωπαϊκού Κοινωνικού Ταμείου. ΒΙΒΛΙΟΓΡΑΦΙΚΕΣ ΑΝΑΦΟΡΕΣ [1] Vokou D. et. al. (1993). Geographic Variation of Greek Oregano (Origanum vulgare ssp. hirtum) Essential Oils. Biochemical Systematics and Ecology, 21: [2] Kokkini, S. et. al. (1993). The Hybrid Origanum intercedens from the Island of Nisyros (SE Greece) and its Parental Taxa; Comparative Study of Essential Oils and Distribution. Biochemica/Systematics and Ecology, 21: [3] Sivropoulou A. et. al. (1996) Antimicrobial and Cytotoxic Activities of Origanum Essential Oils. J. Agric. Food Chem. 44: [4] Kokkini, S. et. al. (2004). Essential Oil Composition of Greek (Origanumvulgare ssp. hirtum) and Turkish (0. onites) Oregano :a Tool for Their Distinction. J. Essent. Oil Res., 16: [5] Burt SA and Reinders RD. (2003). Antibacterial activity of selected plant essential oils against Escherichia coli O157:H7. Lett Appl Microbiol. 36: [6] Dorman HJ and Deans SG (2000).Antimicrobial agents from plants: antibacterial activity of plant volatile oils. J Appl Microbiol.88: [7] Claire Yew, Y.C. (2008). Improving aquaculture production through better health and disease prevention the natural way. Feed technology update. Vo.3. Iss.1 [8] Stefanakis M.K, Touloupakis E., Anastassopoulos E., Ghanotakis D., Katerinopoulos H.E., Makridis P. (2013). Antibacterial activity of essential oils from plants of the genus Origanum. Food Control 34: [9] Stefanakis, M. K., Anastasopoulos, E., Katerinopoulos, H. E., & Makridis, P. (2014). Use of essential oils extracted from three Origanum species for disinfection of cultured rotifers (Brachionus plicatilis). Aquaculture Research, 45(11), [10] Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12: [11] Novak, J., Lukas, B., Bolzer, K., Grausgruber-Gröger, S., & Degenhardt, J. (2008). Identification and characterization of simple sequence repeat markers from a glandular origanum vulgare expressed sequence tag. Molecular Ecology Resources, 8(3), [12] Nei M. Interspecific gene differences and evolutionary time estimated from electrophoretic data on protein identity. Amer. Naturalist 105:385-98,

Παραδοτέα Π.Ε Ιδρυματικό Υπεύθυνος Καθηγητής κ. Χρυσάφη Χαρτώνα. Επιστημονικός Υπεύθυνος Καθηγητής κ. Ηλίας Αναστασόπουλος

Παραδοτέα Π.Ε Ιδρυματικό Υπεύθυνος Καθηγητής κ. Χρυσάφη Χαρτώνα. Επιστημονικός Υπεύθυνος Καθηγητής κ. Ηλίας Αναστασόπουλος «ΜΕΛΕΤΗ ΤΗΣ ΧΡΗΣΗΣ ΑΠΟΣΤΑΓΜΑΤΩΝ ΕΠΙΛΕΓΜΕΝΩΝ ΦΥΤΩΝ ΡΙΓΑΝΗΣ ΣΤΗ ΔΙΑΤΡΟΦΗ ΨΑΡΙΩΝ ΜΕ ΣΤΟΧΟ ΤΗ ΜΕΙΩΣΗ ΤΟΥ ΜΙΚΡΟΒΙΑΚΟΥ ΦΟΡΤΙΟΥ ΤΗΣ ΤΡΟΦΗΣ ΤΟΥΣ (ΖΩΟΠΛΑΓΚΤΟΝ)» Παραδοτέα Π.Ε.4.4.3. Ιδρυματικό Υπεύθυνος Καθηγητής

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Department of Biochemistry

Διαβάστε περισσότερα

Μελέτη της χρήσης αποσταγμάτων επιλεγμένων φυτών ρίγανης στη διατροφή ψαριών με στόχο την μείωση του μικροβιακού φορτίου της τροφής τους (ζωοπλακτόν).

Μελέτη της χρήσης αποσταγμάτων επιλεγμένων φυτών ρίγανης στη διατροφή ψαριών με στόχο την μείωση του μικροβιακού φορτίου της τροφής τους (ζωοπλακτόν). Μελέτη της χρήσης αποσταγμάτων επιλεγμένων φυτών ρίγανης στη διατροφή ψαριών με στόχο την μείωση του μικροβιακού φορτίου της τροφής τους (ζωοπλακτόν). Μιχάλης Κ. Στεφανάκης, Γιώργος Τσικαλάς, Ελευθέριος

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

Μοριακή Ανάλυση Φυτών

Μοριακή Ανάλυση Φυτών Μοριακή Ανάλυση Φυτών Μοριακοί Δείκτες Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο Δασικής Γενετικής / ΔΠΘ Γενετική ποικιλομορφία Είναι η βάση της εξέλιξης Προϋπόθεση προσαρμογής σε νέα περιβάλλοντα Το μέρος

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η Συμβολή της Μοριακής Βιολογίας

Διαβάστε περισσότερα

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR)

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) Α. ΘΕΩΡΗΤΙΚΟ ΜΕΡΟΣ Σταμάτης Κουσίσης, Δημοσθένης Κίζης, Δήμητρα Χούχουλα Βασική αρχή της Αλυσιδωτής Αντίδρασης της Πολυμεράσης

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. (Μοριακή Βελτίωση)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. (Μοριακή Βελτίωση) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (Μοριακή Βελτίωση) 1 Βασίζεται στη χρήση μοριακών δεικτών που είναι συνδεδεμένοι με επιθυμητές χρωμοσωμικές περιοχές. Μοριακοί δείκτες είναι τυχαία επιλεγμένα τμήματα DNA χωρίς

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ

Διαβάστε περισσότερα

ΣΥΝΑΝΤΗΣΗΣ ΤΟΥ ΕΡΓΟΥ 12CHN409

ΣΥΝΑΝΤΗΣΗΣ ΤΟΥ ΕΡΓΟΥ 12CHN409 ΠΡΑΚΤΙΚΑ 4 ης ΣΥΝΑΝΤΗΣΗΣ ΤΟΥ ΕΡΓΟΥ 12CHN409 Βιολογικά ενεργά αιθέρια έλαια και άλλες ευεργετικές για την υγεία ουσίες από Ελληνικά και Κινέζικα ενδημικά φυτά - Bioactive essential oils and other beneficial

Διαβάστε περισσότερα

ΑΔΑ: ΒΙΞ446914Γ-ΧΡΖ. Βαθμός Ασφαλείας. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων. Μεγ.

ΑΔΑ: ΒΙΞ446914Γ-ΧΡΖ. Βαθμός Ασφαλείας. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων. Μεγ. ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 6: Επίδραση των Αιθέριων Ελαίων σε Αλλοιογόνους και Παθογόνους Μικροοργανισμούς των Τροφίμων, 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες:

Διαβάστε περισσότερα

ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ

ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΑΠΟΣΤΟΛΟΣ ΒΑΝΤΑΡΑΚΗΣ ΒΙΟΛΟΓΟΣ (M.Sc, Ph.D) Επιδημίες μολυσματικών ασθενειών συχνά οφείλονται σε έκθεση σε μία κοινή πηγή ενός αιτιολογικού παράγοντα.

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (2/2), 2ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Εφαρμογές της τεχνολογίας του ανασυνδυασμένου DNA

Εφαρμογές της τεχνολογίας του ανασυνδυασμένου DNA Εφαρμογές της τεχνολογίας του ανασυνδυασμένου DNA Aνάλυση SNP που επηρεάζουν θέσεις περιορισμού, με στύπωμα Southern. Ένα χρωμοσωμικό τμήμα μεγέθους 7 kb φέρει θέσεις BamHI σε κάθε άκρο του. Το αλληλόμορφο

Διαβάστε περισσότερα

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Α. Ντούλης, Ινστιτούτο Αμπέλου, Λαχανοκομίας & Ανθοκομίας Ηρακλείου (ΙΑΛΑΗ), Εθνικό Ίδρυμα Αγροτικών Ερευνών (ΕΘΙΑΓΕ) και

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp.

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. 5 ο Πανελλήνιο Συνέδριο Ιατρικής Βιοπαθολογίας Η εφαρμογή μοριακών

Διαβάστε περισσότερα

ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΓΕΝΕΤΙΚΗΣ

ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΓΕΝΕΤΙΚΗΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΓΕΝΕΤΙΚΗΣ Εργαστήριο 1 ο : Ιχνηλασιμότητα. Εφαρμογές των μοριακών δεικτών (στις τροφές) στα ψάρια Τριανταφυλλίδης Α Άδειες

Διαβάστε περισσότερα

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc Εισαγωγή στη Real Time PCR Καραπέτσας Θανάσης PhD, MSc Μειονεκτήματα της κλασικής PCR Ανάλυση ύστερα από ηλεκτροφόρηση(συνήθως αγαρόζης) Τεχνική τελικού σημείου(end-point detection), Σύγκριση της έντασης

Διαβάστε περισσότερα

ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΓΕΝΕΤΙΚΗΣ

ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΓΕΝΕΤΙΚΗΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΓΕΝΕΤΙΚΗΣ Εργαστήριο: Μιτοχονδριακό DNA και RFLPs Τριανταφυλλίδης Α Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται

Διαβάστε περισσότερα

PCR Εφαρμογές-2. RACE Site directed mutagenesis

PCR Εφαρμογές-2. RACE Site directed mutagenesis PCR Εφαρμογές-2 RACE Site directed mutagenesis Σκοπός της αντίδρασης PCR (Polymerase Chain Reaction) είναι το να φτιάξει ένα μεγάλο αριθμό αντιγράφων. BHMATA 1. ΑΠΟΔΙΑΤΑΞΗ 2. ΥΒΡΙΔΙΣΜΟΣ 3. ΕΠΙΜΗΚΥΝΣΗ Επειδή

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

Διάκριση ποικιλιών ελαιολάδου μέσω μεθόδου γονοτύπησης βασιζόμενης σε φθορίζοντα μικροσφαιρίδια

Διάκριση ποικιλιών ελαιολάδου μέσω μεθόδου γονοτύπησης βασιζόμενης σε φθορίζοντα μικροσφαιρίδια Διάκριση ποικιλιών ελαιολάδου μέσω μεθόδου γονοτύπησης βασιζόμενης σε φθορίζοντα μικροσφαιρίδια Δέσποινα Π. Καλογιάννη Τμήμα Χημείας Πανεπιστήμιο Πατρών Ανάπτυξη μεθόδου ελέγχου αυθεντικότητας του ελαιολάδου

Διαβάστε περισσότερα

Γονιδιωματική. G. Patrinos

Γονιδιωματική. G. Patrinos Γονιδιωματική Η μεταγονιδιωματική εποχή... Σημαντικότερα επιτεύγματα POST GENOME ERA Ολοκλήρωση της αποκρυπτογράφησης της αλληλουχίας των γονιδιωμάτων πολλών οργανισμών. Προτύπωση μεθοδολογιών για προσδιορισμό

Διαβάστε περισσότερα

ΤΕΙ ΘΕΣΣΑΛΙΑΣ. ΕΡΕΥΝΗΤΙΚΟ ΠΡΟΓΡΑΜΜΑ «Αρχιμηδης ΙΙΙ-Ενίσχυση Ερευνητικών Ομάδων στο ΤΕΙ Λάρισας»

ΤΕΙ ΘΕΣΣΑΛΙΑΣ. ΕΡΕΥΝΗΤΙΚΟ ΠΡΟΓΡΑΜΜΑ «Αρχιμηδης ΙΙΙ-Ενίσχυση Ερευνητικών Ομάδων στο ΤΕΙ Λάρισας» ΤΕΙ ΘΕΣΣΑΛΙΑΣ ΕΡΕΥΝΗΤΙΚΟ ΠΡΟΓΡΑΜΜΑ «Αρχιμηδης ΙΙΙ-Ενίσχυση Ερευνητικών Ομάδων στο ΤΕΙ Λάρισας» ΥΠΟΕΡΓΟ 4 «ΜΕΛΕΤΗ ΤΗΣ ΧΡΗΣΗΣ ΑΠΟΣΤΑΓΜΑΤΩΝ ΕΠΙΛΕΓΜΕΝΩΝ ΦΥΤΩΝ ΡΙΓΑΝΗΣ ΣΤΗ ΔΙΑΤΡΟΦΗ ΨΑΡΙΩΝ ΜΕ ΣΤΟΧΟ ΤΗ ΜΕΙΩΣΗ

Διαβάστε περισσότερα

ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR)

ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) ΑΣΚΗΣΗ: ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (POLYMERASE CHAIN REACTION, PCR) Σκοπός της άσκησης Η εκμάθηση των βασικών σταδίων και συστατικών

Διαβάστε περισσότερα

Αϖοµόνωση και γενετική διαφοροϖοίηση ϖληθυσµών του ζαρκαδιού (Capreoluscapreolus) στην Ελλάδα νέα δεδοµένα για αϖοτελεσµατικότερη διαχείριση και διατήρηση ηµήτρης Τσαϖάρης Παναγιώτης Κασαϖίδης Κωνσταντίνος

Διαβάστε περισσότερα

Εργαστήριο Δασικής Γενετικής / ΔΠΘ Ορεστιάδα. Ποσοτική Γενετική ΒΕΛΤΙΩΣΗ & ΠΡΟΣΤΑΣΙΑ ΔΑΣΟΓΕΝΕΤΙΚΩΝ ΠΟΡΩΝ. Αριστοτέλης Χ.

Εργαστήριο Δασικής Γενετικής / ΔΠΘ Ορεστιάδα. Ποσοτική Γενετική ΒΕΛΤΙΩΣΗ & ΠΡΟΣΤΑΣΙΑ ΔΑΣΟΓΕΝΕΤΙΚΩΝ ΠΟΡΩΝ. Αριστοτέλης Χ. Εργαστήριο Δασικής Γενετικής / ΔΠΘ Ορεστιάδα Ποσοτική Γενετική ΒΕΛΤΙΩΣΗ & ΠΡΟΣΤΑΣΙΑ ΔΑΣΟΓΕΝΕΤΙΚΩΝ ΠΟΡΩΝ Αριστοτέλης Χ. Παπαγεωργίου Σύνοψη Τα γνωρίσματα που παρατηρούμε (φαινότυπος) είναι η συνδυασμένη

Διαβάστε περισσότερα

ΖΩΟΤΕΧΝΙΑ Διδάσκουσα: Κουτσούλη Παναγιώτα Τμήμα: Επιστήμης Ζωικής Παραγωγής & Υδατοκαλλιεργειών

ΖΩΟΤΕΧΝΙΑ Διδάσκουσα: Κουτσούλη Παναγιώτα Τμήμα: Επιστήμης Ζωικής Παραγωγής & Υδατοκαλλιεργειών ΖΩΟΤΕΧΝΙΑ Χαρακτηριστικά των αγροτικών ζώων με οικονομική σημασία Διδάσκουσα: Κουτσούλη Παναγιώτα Τμήμα: Επιστήμης Ζωικής Παραγωγής & Υδατοκαλλιεργειών 1. Μονογονιδιακά χαρακτηριστικά στους πληθυσμούς

Διαβάστε περισσότερα

Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa.

Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa. Αρχές PCR και υβριδισμού Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa.gr Ιστορικά στοιχεία Πρώτη αναφορά in vitro ενζυματικής αντίδρασης

Διαβάστε περισσότερα

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 1 Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης, Ηράκλειο Κρήτης. 2 Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 Department of Biology, Faculty of Science, Dokuz

Διαβάστε περισσότερα

Αειφορική Αξιοποίηση της Αρωματικής Βιοποικιλότητας των Ελληνικών Οικοσυστημάτων

Αειφορική Αξιοποίηση της Αρωματικής Βιοποικιλότητας των Ελληνικών Οικοσυστημάτων Αειφορική Αξιοποίηση της Αρωματικής Βιοποικιλότητας των Ελληνικών Οικοσυστημάτων Στέλλα Κοκκίνη Τμήμα Βιολογίας Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Η ΣΥΜΒΟΛΗ ΤΩΝ ΑΡΩΜΑΤΙΚΩΝ, ΑΡΤΥΜΑΤΙΚΩΝ & ΦΑΡΜΑΚΕΥΤΙΚΩΝ

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ 1 ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ άμεση πρόσβαση στο γενετικό υλικό εφαρμογές στην υγεία, βελτίωση φυτών και ζώων, προστασία

Διαβάστε περισσότερα

ΠΟΣΟΤΙΚΗ ΓΕΝΕΤΙΚΗ 03. ΜΕΣΗ ΤΙΜΗ & ΔΙΑΚΥΜΑΝΣΗ

ΠΟΣΟΤΙΚΗ ΓΕΝΕΤΙΚΗ 03. ΜΕΣΗ ΤΙΜΗ & ΔΙΑΚΥΜΑΝΣΗ ΠΟΣΟΤΙΚΗ ΓΕΝΕΤΙΚΗ 03. ΜΕΣΗ ΤΙΜΗ & ΔΙΑΚΥΜΑΝΣΗ 1 ΠΟΣΟΤΙΚΟ ΓΝΩΡΙΣΜΑ ΑΑββΓΓδδεεΖΖ αριθμός φυτών 50 00 150 100 50 0 10 5 184 119 17 87 40 1 5 0-10 10-0 0-30 30-40 40-50 50-60 60-70 70-80 80-90 απόδοση/φ υτό

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ YΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΑΘΗΝΑ ΔΙΟΙΚΗΣΗ 1 ης ΥΠΕ ΑΤΤΙΚΗΣ ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΠΑΙΔΩΝ ΑΘΗΝΩΝ «ΑΓΙΑ ΣΟΦΙΑ»

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ YΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΑΘΗΝΑ ΔΙΟΙΚΗΣΗ 1 ης ΥΠΕ ΑΤΤΙΚΗΣ ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΠΑΙΔΩΝ ΑΘΗΝΩΝ «ΑΓΙΑ ΣΟΦΙΑ» ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ YΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΑΘΗΝΑ 17-3-2016 ΔΙΟΙΚΗΣΗ 1 ης ΥΠΕ ΑΤΤΙΚΗΣ ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΠΑΙΔΩΝ ΑΘΗΝΩΝ «ΑΓΙΑ ΣΟΦΙΑ» Ταχ. Δ/νση : Θηβών & Παπαδιαμαντοπούλου, Γουδί Τ.Κ.

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 15 η ΜΙΚΡΟΒΙΑΚΗ ΕΞΕΛΙΞΗ ΚΑΙ ΣΥΣΤΗΜΑΤΙΚΗ

Γενική Μικροβιολογία. Ενότητα 15 η ΜΙΚΡΟΒΙΑΚΗ ΕΞΕΛΙΞΗ ΚΑΙ ΣΥΣΤΗΜΑΤΙΚΗ Γενική Μικροβιολογία Ενότητα 15 η ΜΙΚΡΟΒΙΑΚΗ ΕΞΕΛΙΞΗ ΚΑΙ ΣΥΣΤΗΜΑΤΙΚΗ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ

Διαβάστε περισσότερα

Παραλαβή αντιοξειδωτικών από το αρωματικό φυτό Satureja thymbra (θρούμπι) και μελέτη της δράσης του σε συστήματα τροφίμων

Παραλαβή αντιοξειδωτικών από το αρωματικό φυτό Satureja thymbra (θρούμπι) και μελέτη της δράσης του σε συστήματα τροφίμων Παραλαβή αντιοξειδωτικών από το αρωματικό φυτό Satureja thymbra (θρούμπι) και μελέτη της δράσης του σε συστήματα τροφίμων Ε. Χουλιτούδη, Κ. Μπράβου, Α. Μπιμπίλας, Δ. Τσιμογιάννης, Β. Ωραιοπούλου Εργαστήριο

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Δρ. Νικόλας Παπανικολάου Υπεύθυνος παρακολούθησης: Δρ. Αντρέας Ντούλης

Δρ. Νικόλας Παπανικολάου Υπεύθυνος παρακολούθησης: Δρ. Αντρέας Ντούλης Δρ. Νικόλας Παπανικολάου Υπεύθυνος παρακολούθησης: Δρ. Αντρέας Ντούλης Κίνητρο έργου Στο πεδίο της αγροτικής έρευνας στην Ελλάδα υπάρχει μεγάλη ποσότητα δεδομένων (μοριακών, μορφολογικών, αγρονομικών,

Διαβάστε περισσότερα

7. Βιοτεχνολογία. α) η διαθεσιμότητα θρεπτικών συστατικών στο θρεπτικό υλικό, β) το ph, γ) το Ο 2 και δ) η θερμοκρασία.

7. Βιοτεχνολογία. α) η διαθεσιμότητα θρεπτικών συστατικών στο θρεπτικό υλικό, β) το ph, γ) το Ο 2 και δ) η θερμοκρασία. 7. Βιοτεχνολογία Εισαγωγή Τι είναι η Βιοτεχνολογία; Η Βιοτεχνολογία αποτελεί συνδυασμό επιστήμης και τεχνολογίας. Ειδικότερα εφαρμόζει τις γνώσεις που έχουν αποκτηθεί για τις βιολογικές λειτουργίες των

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΠΡΩΤΕΪΝΩΝ. 15/10/2015 Δ.Δ. Λεωνίδας

ΜΕΛΕΤΗ ΠΡΩΤΕΪΝΩΝ. 15/10/2015 Δ.Δ. Λεωνίδας ΜΕΛΕΤΗ ΠΡΩΤΕΪΝΩΝ ΣΤΟΧΟΙ: ΑΛΛΗΛΟΥΧΙΑ αα ΤΡΙΤΟΤΑΓΗΣ ΔΟΜΗ ΜΗΧΑΝΙΣΜΟΣ ΔΡΑΣΗΣ ΣΤΑΔΙΑ 1. Απομόνωση (με βάση διαλυτότητα, μέγεθος, φορτίο, ικανότητα σύνδεσης) 2. Προσδιορισμός αλληλουχίας αα (ανασυνδυασμένο DNA,

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ 1. Προβλήματα που αναφέρονται στα κομμάτια που θα κοπεί το DNA, στις θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν

Διαβάστε περισσότερα

ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ

ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΠΙΤΡΟΠΗ ΕΚΠΑΙΔΕΥΣΗΣ & ΕΡΕΥΝΩΝ ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ ΕΠΙΧΕΙΡΗΣΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΕΚΠΑΙΔΕΥΣΗ ΚΑΙ ΔΙΑ ΒΙΟΥ

Διαβάστε περισσότερα

ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ 2η έκδοση βιολογία Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ περιεχόμενα Κεφάλαιο 1 Το γενετικό υλικό...13 Κεφάλαιο 2 Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας... 65 Κεφάλαιο 3 Ιοί...127

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DNA... 2

ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DNA... 2 ΚΕΦΑΛΑΙΟ 4 ο ΚΕΦΑΛΑΙΟ 4 ο... 2 I. Τεχνολογία του ανασυνδυασµένου DN... 2 ΚΕΦΑΛΑΙΟ 4 ο I. Τεχνολογία του ανασυνδυασµένου DN Εκπαιδευτικοί στόχοι: Μετά την ολοκλήρωση της µελέτης αυτού του κεφαλαίου ο µαθητής

Διαβάστε περισσότερα

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Γενετική δομή και πρότυπα διαφοροποίησης των πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Δημήτρης Τσαπάρης Jacob Fric Αθήνα, Οκτώβριος 2012 Jon

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΓΙΑ ΥΠΟΒΟΛΗ ΠΡΟΤΑΣΕΩΝ ΠΡΟΣ ΣΥΝΑΨΗ ΣΥΜΒΑΣΕΩΝ ΜΙΣΘΩΣΗΣ ΕΡΓΟΥ

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΓΙΑ ΥΠΟΒΟΛΗ ΠΡΟΤΑΣΕΩΝ ΠΡΟΣ ΣΥΝΑΨΗ ΣΥΜΒΑΣΕΩΝ ΜΙΣΘΩΣΗΣ ΕΡΓΟΥ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΛΑΡΙΣΑΣ ΕΠΙΤΡΟΠΗ ΕΚΠΑΙΔΕΥΣΗΣ & ΕΡΕΥΝΩΝ Περιφερειακή Οδός Λάρισας Τρικάλων, Τ.Κ. 41110 Τηλ.: 2410 684 713 Πληροφορίες: κα. Ε. Κοτίτσα Λάρισα 18-09-2012

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Τεχνικές Απόσταξης. Distillation Techniques

Τεχνικές Απόσταξης. Distillation Techniques Ενόργανη Ανάλυση - Εργαστήριο Τεχνικές Απόσταξης Distillation Techniques Πέτρος Α. Ταραντίλης Χρήστος Παππάς Εργαστήριο Χημείας 1 Μέθοδοι Απόσταξης - Παραλαβή Πτητικών Συστατικών Η παραλαβή πτητικών ουσιών

Διαβάστε περισσότερα

Η φυσική ελιά & η θρεπτική της αξία. Κωνσταντίνος Κωνσταντινίδης Διευθύνων Σύμβουλος Pelopac

Η φυσική ελιά & η θρεπτική της αξία. Κωνσταντίνος Κωνσταντινίδης Διευθύνων Σύμβουλος Pelopac Η φυσική ελιά & η θρεπτική της αξία Κωνσταντίνος Κωνσταντινίδης Διευθύνων Σύμβουλος Pelopac Η Υγεία και η Ευεξία γίνονται βασικοί οδηγοί στις συνήθειες αγοράς τροφίμων των καταναλωτών Πηγή: Deloitte: Food

Διαβάστε περισσότερα

Μονοφασική S. Typhimurium Δεδομένα Κτηνιατρικού Εργαστηρίου

Μονοφασική S. Typhimurium Δεδομένα Κτηνιατρικού Εργαστηρίου ΥΠΟΥΡΓΕΙΟ ΑΓΡΟΤΙΚΗΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΤΡΟΦΙΜΩΝ ΔΙΕΥΘΥΝΣΗ ΚΤΗΝΙΑΤΡΙΚΟΥ ΚΕΝΤΡΟΥ ΑΘΗΝΩΝ ΚΤΗΝΙΑΤΡΙΚΟ ΕΡΓΑΣΤΗΡΙΟ ΧΑΛΚΙΔΑΣ Μονοφασική S. Typhimurium Δεδομένα Κτηνιατρικού Εργαστηρίου Δ. Κατσαρός Salmonella spp.

Διαβάστε περισσότερα

Κωνσταντίνος Στεφανίδης

Κωνσταντίνος Στεφανίδης ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ - ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΑΣ ΦΥΤΩΝ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΟΙΚΟΛΟΓΙΑ-ΔΙΑΧΕΙΡΙΣΗ & ΠΡΟΣΤΑΣΙΑ ΦΥΣΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Διατριβή Μεταπτυχιακού Διπλώματος Ειδίκευσης Οικολογική

Διαβάστε περισσότερα

Πληθυσμιακή Γενετική

Πληθυσμιακή Γενετική Τμήμα Αγροτικής Ανάπτυξης Πληθυσμιακή Γενετική Γενετική Ποικιλότητα Κων/νος Τζανταρμάς Αριστοτέλης Παπαγεωργίου Κλάδοι της Γενετικής 1. Κλασική γενετική 2. Μοριακή γενετική 3. Πληθυσμιακή γενετική 4. Ποσοτική

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα

ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ

ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΠΙΤΡΟΠΗ ΕΚΠΑΙΔΕΥΣΗΣ & ΕΡΕΥΝΩΝ ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ ΕΠΙΧΕΙΡΗΣΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΕΚΠΑΙΔΕΥΣΗ ΚΑΙ ΔΙΑ ΒΙΟΥ

Διαβάστε περισσότερα

1. Αντικείµενο του ιαγωνισµού Αντικείµενο του διαγωνισµού είναι η ανάδειξη µειοδότη για την προµήθεια των αναφεροµένων στο Παράρτηµα Α της παρούσας, υ

1. Αντικείµενο του ιαγωνισµού Αντικείµενο του διαγωνισµού είναι η ανάδειξη µειοδότη για την προµήθεια των αναφεροµένων στο Παράρτηµα Α της παρούσας, υ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ (Τ.Ε.Ι.) ΑΜΘ ΕΙ ΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝ ΥΛΙΩΝ ΕΡΕΥΝΑΣ Ταχ. δ/νση: Άγιος Λουκάς, Καβάλα Τηλέφωνο: 2510 462203 FAX: 2510 462352 E-mail: ipantel@teikav.edu.gr Καβάλα 20/08/2014

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Πτυχιακή εργασία ΜΟΡΙΑΚΗ ΚΑΙ ΦΑΙΝΟΤΥΠΙΚΗ ΑΝΑΛΥΣΗ ΕΝΟΣ ΚΥΠΡΙΑΚΟΥ ΠΛΗΘΥΣΜΟΥ ΣΚΛΗΡΟΥ ΣΙΤΑΡΙΟΥ ΠΟΥ ΑΠΟΚΤΗΘΗΚΕ ΑΠΟ ΤΡΑΠΕΖΑ

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 03 : Δομή και οργάνωση του γενετικού υλικού. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ

Κυτταρική Βιολογία. Ενότητα 03 : Δομή και οργάνωση του γενετικού υλικού. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 03 : Δομή και οργάνωση του γενετικού υλικού Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό

Διαβάστε περισσότερα

Άσκηση Φαρμακευτικής Βιοτεχνολογίας

Άσκηση Φαρμακευτικής Βιοτεχνολογίας Άσκηση Φαρμακευτικής Βιοτεχνολογίας Χαρακτηρισμός Φαρμακογενετικών δεικτών με PCR-ARMS Θεωρητικό μέρος 1. Αλυσιδωτή αντίδραση Πολυμεράσης (PCR) Η αλυσιδωτή αντίδραση πολυμεράσης (polymerase chain reaction,

Διαβάστε περισσότερα

Μέρος 5 ο. Γονιδιακοί δείκτες

Μέρος 5 ο. Γονιδιακοί δείκτες Μέρος 5 ο Γονιδιακοί δείκτες R.C. Lewontin 1966 K.B. Mullis 1983 Εισαγωγή στη δασική γενετική Γονιδιακοί δείκτες Όπως είδαµε στα προηγούµενα κεφάλαια, η γενετική πληροφορία είναι οργανωµένη πάνω σε µια

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΤΕΥΘΥΝΣΗ: ΖΩΪΚΗΣ ΠΑΡΑΓΩΓΗΣ Η ΤΕΧΝΙΚΗ ΤΗΣ PCR ΣΤΗ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Ηράκλειο, 8.07.04 Αρ. πρωτ. 844 Ο Ειδικός Λογαριασμός του Πανεπιστημίου Κρήτης πρόκειται

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ Β43Θ46ΨΖ2Ν-ΛΘΜ ANAΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ Αθήνα, 26/10/2012 ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΓΙΑ ΥΠΟΒΟΛΗ ΠΡΟΤΑΣΗΣ ΓΙΑ ΚΑΤΑΡΤΙΣΗ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Η ανάλυση του DNA στον έλεγχο της πατρότητας και στην εξιχνίαση του εγκλήματος

Η ανάλυση του DNA στον έλεγχο της πατρότητας και στην εξιχνίαση του εγκλήματος ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Η ανάλυση του DNA στον έλεγχο της πατρότητας και στην εξιχνίαση του εγκλήματος Δρ. Λ. Κοβάτση Ιατρός-Ειδική Ιατροδικαστής Επίκουρη Καθηγήτρια

Διαβάστε περισσότερα

Μοριακή Μικροβιακή Οικολογία. Μοριακή αποτύπωση μικροβιακή κοινότητας Μοριακές μέθοδοι υψηλής απόδοσης και ανάλυσης

Μοριακή Μικροβιακή Οικολογία. Μοριακή αποτύπωση μικροβιακή κοινότητας Μοριακές μέθοδοι υψηλής απόδοσης και ανάλυσης Μοριακή Μικροβιακή Οικολογία Μοριακή αποτύπωση μικροβιακή κοινότητας Μοριακές μέθοδοι υψηλής απόδοσης και ανάλυσης Μοριακές μέθοδοι αποτύπωσης Ενδιάμεσης Ανάλυσης DGGE (Denaturating Gradient Gel Electrophoresis)

Διαβάστε περισσότερα

Οδηγίες χρήσης για το CRC RAScan Combination Kit KRAS and NRAS Exons 2, 3 & 4 CE IVD για τα συστήματα DHPLC

Οδηγίες χρήσης για το CRC RAScan Combination Kit KRAS and NRAS Exons 2, 3 & 4 CE IVD για τα συστήματα DHPLC 1 Κατασκευαστής Οδηγίες χρήσης για το CRC RAScan Combination Kit KRAS and NRAS Exons 2, 3 & 4 CE IVD για τα συστήματα DHPLC ιαβάστε προσεκτικά αυτές τις οδηγίες χρήσης προτού χρησιμοποιήσετε αυτό το προϊόν.

Διαβάστε περισσότερα

τα βιβλία των επιτυχιών

τα βιβλία των επιτυχιών Τα βιβλία των Εκδόσεων Πουκαμισάς συμπυκνώνουν την πολύχρονη διδακτική εμπειρία των συγγραφέων μας και αποτελούν το βασικό εκπαιδευτικό υλικό που χρησιμοποιούν οι μαθητές των φροντιστηρίων μας. Μέσα από

Διαβάστε περισσότερα

Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.)

Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.) Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.) Δρ Ελένη Μαλούπα, Τακτική Ερευνήτρια ΕΘΙΑΓΕ Fritilaria pontica Εργαστήριο Προστασίας και Αξιοποίησης Αυτοφυών

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ, ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ, ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ, ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΤΗΣ ΕΠΙΔΡΑΣΗΣ ΒΟΤΑΝΩΝ ΚΑΙ ΜΠΑΧΑΡΙΚΩΝ ΣΤΟΥΣ ΔΕΙΚΤΕΣ ΠΟΙΟΤΗΤΑΣ ΤΟΥ ΕΛΑΙΟΛΑΔΟΥ Ελένη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων Dr. Παναγιώτης Μαδέσης pmadesis@certh.gr Ι. Γανόπουλος,

Διαβάστε περισσότερα

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Eφη Πετεινάκη ΠΡΟΒΛΗΜΑΤΑ ΡΟΥΤΙΝΑΣ ΕΝΟΣ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ταυτοποίηση κάποιων βακτηρίων ο έλεγχος ευαισθησίας διάγνωση λοιμώξεων από μικροοργανισμούς

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΣΥΝΔΕΣΗ ΑΣΚΗΣΕΙΣ

ΓΕΝΕΤΙΚΗ ΣΥΝΔΕΣΗ ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗ ΣΥΝΔΕΣΗ ΑΣΚΗΣΕΙΣ 1. Έστω ότι ο γενετικός τόπος pr απέχει από τον vg 11m.u Από την διασταύρωση pr vg/pr + vg + x pr vg/pr vg Τι ποσοστό των απογόνων θα είναι pr + vg/pr vg ; 1 2. Ποιες είναι οι

Διαβάστε περισσότερα

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες IΣTOΛOΓIA H ιστολογία κλάδος της ιατρικής που µελετά > υφή βιολογικού υλικού και τους τρόπους που τα επιµέρους συστατικά στοιχεία σχετίζονται µεταξύ τους δοµικά & λειτουργικά Tα δείγµατα του βιολογικού

Διαβάστε περισσότερα

ΕΝΖΥΜΙΚΗ ΑΠΟΙΚΟΔΟΜΗΣΗ ΧΛΩΡΟΠΡΟΠΑΝΟΛΩΝ ΑΠΟ ΤΟ ΒΑΚΤΗΡΙΟ PSEUDOMONAS PUTIDA DSM437

ΕΝΖΥΜΙΚΗ ΑΠΟΙΚΟΔΟΜΗΣΗ ΧΛΩΡΟΠΡΟΠΑΝΟΛΩΝ ΑΠΟ ΤΟ ΒΑΚΤΗΡΙΟ PSEUDOMONAS PUTIDA DSM437 1 ο ΠΑΝΕΛΛΗΝΙΟ ΕΠΙΣΤΗΜΟΝΙΚΟ ΣΥΝΕΔΡΙΟ ΧΗΜΙΚΗΣ ΜΗΧΑΝΙΚΗΣ, ΠΑΤΡΑ, 4-6 ΙΟΥΝΙΟΥ, 215. ΕΝΖΥΜΙΚΗ ΑΠΟΙΚΟΔΟΜΗΣΗ ΧΛΩΡΟΠΡΟΠΑΝΟΛΩΝ ΑΠΟ ΤΟ ΒΑΚΤΗΡΙΟ PSEUDOMONAS PUTIDA DSM437 Κ. Κόντη, Δ. Μαμμά, Δ. Κέκος Σχολή Χημικών

Διαβάστε περισσότερα

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum).

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Μεντελική γενετική Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Φαινότυπος και Γονότυπος Η φυσική εκδήλωση (φαινότυπος) της γενετικής σύστασης (γονότυπος) επηρεάζεται από τις αλληλεπιδράσεις με άλλα

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΑΡΩΜΑΤΙΚΩΝ ΦΥΤΩΝ ΤΗΣ ΟΙΚΟΓΕΝΕΙΑΣ LAMIACEAE ΓΙΑ ΑΠΟΜΟΝΩΣΗ ΔΡΑΣΤΙΚΩΝ ΑΝΤΙΟΞΕΙΔΩΤΙΚΩΝ ΚΛΑΣΜΑΤΩΝ ΚΑΙ ΕΦΑΡΜΟΓΗ ΤΟΥΣ ΣΕ ΣΥΣΤΗΜΑΤΑ ΤΡΟΦΙΜΩΝ

ΜΕΛΕΤΗ ΑΡΩΜΑΤΙΚΩΝ ΦΥΤΩΝ ΤΗΣ ΟΙΚΟΓΕΝΕΙΑΣ LAMIACEAE ΓΙΑ ΑΠΟΜΟΝΩΣΗ ΔΡΑΣΤΙΚΩΝ ΑΝΤΙΟΞΕΙΔΩΤΙΚΩΝ ΚΛΑΣΜΑΤΩΝ ΚΑΙ ΕΦΑΡΜΟΓΗ ΤΟΥΣ ΣΕ ΣΥΣΤΗΜΑΤΑ ΤΡΟΦΙΜΩΝ ΜΕΛΕΤΗ ΑΡΩΜΑΤΙΚΩΝ ΦΥΤΩΝ ΤΗΣ ΟΙΚΟΓΕΝΕΙΑΣ LAMIACEAE ΓΙΑ ΑΠΟΜΟΝΩΣΗ ΔΡΑΣΤΙΚΩΝ ΑΝΤΙΟΞΕΙΔΩΤΙΚΩΝ ΚΛΑΣΜΑΤΩΝ ΚΑΙ ΕΦΑΡΜΟΓΗ ΤΟΥΣ ΣΕ ΣΥΣΤΗΜΑΤΑ ΤΡΟΦΙΜΩΝ Κ. Μπράβου, Ε. Χουλιτούδη, Α. Μπιμπίλας, Δ. Τσιμογιάννης, Β.

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων Λάρισα 02/10/2013 Προκήρυξη Αριθμός Πρωτοκόλλου: 4292/3-7-2013 ΑΞΙΟΛΟΓΙΚΟΣ ΠΙΝΑΚΑΣ - Τομέας: Ενιαίος Μικροβιολογία (Εργαστήριο)

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών ΓΕΩΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Δράμα, 10 και 11

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κ.Ε.Κ. EROWY: τηλ 210-6147001 EROWY ΠΛΗΡΟΦΟΡΙΚΗ: τηλ 210-6147002 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΙΜΕΛΕΙΑ:

Διαβάστε περισσότερα

ΠΡΟΣΚΛΗΣΗ ΕΝΔΙΑΦΕΡΟΝΤΟΣ KAI ΚΑΤΑΘΕΣΗΣ ΠΡΟΣΦΟΡΩΝ ΓΙΑ ΤΗΝ ΠΡΟΜΗΘΕΙΑ ΑΝΑΛΩΣΙΜΩΝ: «Προμήθεια αναλωσίμων εργαστηρίου»

ΠΡΟΣΚΛΗΣΗ ΕΝΔΙΑΦΕΡΟΝΤΟΣ KAI ΚΑΤΑΘΕΣΗΣ ΠΡΟΣΦΟΡΩΝ ΓΙΑ ΤΗΝ ΠΡΟΜΗΘΕΙΑ ΑΝΑΛΩΣΙΜΩΝ: «Προμήθεια αναλωσίμων εργαστηρίου» ΕΘΝΙΚΟ ΚΕΝΤΡΟ ΕΡΕΥΝΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΑΝΑΠΤΥΞΗΣ (Ε.Κ.Ε.Τ.Α.) ΙΝΣΤΙΤΟΥΤΟ ΕΡΕΥΝΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΘΕΣΣΑΛΙΑΣ (ΙΕΤΕΘ) Τομέας Κινησιολογίας Δημητριάδος 95& Π. Μελά 3ος όροφος Τ.Κ. 38333 Βόλος ΠΡΟΣΚΛΗΣΗ ΕΝΔΙΑΦΕΡΟΝΤΟΣ

Διαβάστε περισσότερα

Γιατί είναι σημαντική η Βιοποικιλότητα;

Γιατί είναι σημαντική η Βιοποικιλότητα; Γενετική Διαχείριση Ο όρος βιοποικιλότητα αναφέρεται σε όλους τους διαφορετικούς οργανισμούς του πλανήτη μας και περιλαμβάνει τόσο την ποικιλότητα σε επίπεδο ειδών, όσο και τη γενετική ποικιλότητα. Γιατί

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα