Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν.

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν."


1 Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν. Μιχάλης Κ. Στεφανάκης, Γιώργος Τσικαλάς, Ελευθέριος Τουλουπάκης, Λαζανάκη Μαρία, Χαράλαμπος Ε. Κατερινόπουλος Τμήμα Χημείας, Πανεπιστημιο Κρήτης, Βούτες, Ηράκλειο 71003, Κρήτη, Ελλάδα Παύλος Μακρίδης, Τμήμα Βιολογίας, Πανεπιστήμιο Πατρών, Πανεπιστημιούπολη Ρίο, Πάτρα, 26500, Ελλάδα Δημήτριος Ζαραγκότας, Δημήτριος Μπακρατσάς, Ηλίας Αναστασόπουλος Τμήμα Τεχνολόγων Γεωπόνων, ΤΕΙ Θεσσαλίας, Λάρισα 41110, Ελλάδα Χαρίκλεια Παπαϊωάννου, Βασίλειος Παπασωτηρόπουλος, Τμήμα Τεχνολόγων Γεωπόνων, ΤΕΙ Δυτικής Ελλάδας Αμαλιάδα 27200, Ελλάδα Περίληψη- Δείγματα ελαίου φυτών ρίγανης επιλέχθηκαν για απολύμανση τροχόζωων Brachionus plicatilis απο βακτηριακά στελέχη του γένους Vibrio. Ακολούθησε μοριακή ταυτοποίηση των επιλεγμένων κλώνων ρίγανης με ανάλυση μοριακών δεικτών SSR. Με βάση την ανάλυση αυτή, οι γενότυποι των κλώνων ρίγανης ομαδοποιήθηκαν σε τρεις κύριες ομάδες. Για ορισμένους από τους γενοτύπους αυτούς επιχειρήθηκε η συσχέτιση των αποτελεσμάτων των χημειοτυπικών αναλύσεων με αυτά από την ανάλυση μοριακής ποικιλότητας, όπου προέκυψαν παρόμοιες ομαδοποιήσεις. Λέξεις κλειδιά μοριακή ανάλυση; Origanum; SSR; Vibrio; Brachionus plicatilis; υδατοκαλλιέργειες ΕΙΣΑΓΩΓΗ Στην Ελλάδα η ρίγανη αυτοφύεται σε διάφορες περιοχές, ενώ τα τελευταία χρόνια έχει αρχίσει η συστηματική καλλιέργειά της με στόχο την εμπορική εκμετάλλευσή της. Η ύπαρξη διαφορετικών ειδών, κυριότερα των οποίων είναι τα Origanum vulgare και Origanum οnites, ο μεγάλος αριθμός υποειδών, αλλά και οι διαφορετικοί οικότυποι αποδεικνύουν τη μεγάλη γενετική ποικιλότητα, που έχει ως αποτέλεσμα τη διαφοροποίηση των φυτών, τόσο μορφολογικά όσο και ως προς διάφορες βιοχημικές τους ιδιότητές [1]. Φυτά ρίγανης έχει αποδειχθεί ότι έχουν υψηλή περιεκτικότητα σε φαινολικά [2], γεγονός που σχετίζεται με τη δραστικότητα του ελαίου τους έναντι διαφόρων φυτικών και ζωικών παθογόνων βακτηρίων [3]. Σε μελέτες για την ελληνική ρίγανη περισσότερα από 30 ενεργά συστατικά έχουν εντοπιστεί, συμπεριλαμβανομένων του ροσμαρινικού οξέως, της θυμόλης και της καρβακρόλης [4]. Διάφορες μελέτες αποδεικνύουν τις αντιμικροβιακές ιδιότητες του ελαίου της ρίγανης [5], [6]. Στην αγορά, υπάρχει ήδη ένα προϊόν, με βάση το έλαιο της ρίγανης, το οποίο χρησιμοποιείται κατά γαστρεντερικών παθογόνων, που σκοτώνει τους μικροοργανισμούς όταν έρχεται σε επαφή με αυτούς, εντός του εντέρου γαρίδων ή ψαριών [7]. Νεότερα ερευνητικά δεδομένα απέδειξαν ότι τα αιθέρια έλαια συγκεκριμένων φυτών ρίγανης μπορούν να χρησιμοποιηθούν για την μείωση της δράσης των βακτηριακών στελεχών του γένους Vibrio και στην απολύμανση ζωοπλαγκτονικών οργανισμών τροχόζωων Brachionus plicatilis, που χρησιμοποιούνται ως ζωντανή τροφή σε ψάρια [8], [9]. Ο σκοπός της παρούσας μοριακής ανάλυσης ήταν διττός. Αφενός να εκτιμηθεί η γενετική ποικιλότητα ενός ετερόκλητου πληθυσμού δειγμάτων ρίγανης και αφετέρου να ταυτοποιηθούν, μοριακά, επιλεγμένα δείγματα, που έδειξαν μέγιστη αντιβατηριακή δράση έναντι στελεχών της ομάδας Vibrio, για την απολύμανση ζωοπλαγκτονικών οργανισμών. Επίσης στη παρούσα μελέτη επιχειρήθηκε να συσχετισθούν τα αποτελέσματα των χημικών αναλύσεων με εκείνα των μοριακών αναλύσεων, των συγκεκριμένων δειγμάτων ρίγανης που έχουν μεγάλο ενδιαφέρον για απολύμανση των ζωοπλαγκτονικών οργανισμών και πιο συγκεκριμένα τροχοζώων του είδους Brachionus plicatilis. Για τις μοριακές αναλύσεις επιλέχθηκαν οι πυρηνικές μικροδορυφορικές αλληλουχίες (microsatellites), αλλιώς γνωστές και ως SSR, (Simple Sequence Repeats) κυρίως λόγω των ιδιοτήτων που εμφανίζουν όπως πχ υψηλός μεταλλακτικός ρυθμός και ποικιλότητα ακόμα και μεταξύ ποικιλιών-πληθυσμών του ιδίου είδους, καθώς και συνυπερέχων τρόπο κληρονόμησης. Οι ιδιότητες αυτές καθιστούν τους μικροδορυφορικούς δείκτες ιδανικό μοριακό εργαλείο για τη διερεύνηση της γενετικής ποικιλότητας και 65

2 την ανάλυση της γενετικής δομής στα φυτά τόσο σε διαειδικό όσο και σε ενδοειδικό επίπεδο. ΜΕΘΟΔΟΛΟΓΙΑ Συλλογή σπόρων ρίγανης Σπόροι ρίγανης συλλέχθηκαν από τη Νάξο (O. onites), το Πήλιο (O. vulgare), της Σίσες Ηρακλείου Κρήτης (O. vulgare), τα Άγραφα (O. vulgare), τη Ζαχάρω Ηλείας (O. vulgare), την Πέρδικα Θεσπρωτίας (O. vulgare) μαζί με ένα δείγμα (O. vulgare) του εμπορίου καθώς και ένα δείγμα (O. marjoram) επίσης του εμπορίου. Οι σπόροι παρουσίαζαν ποικιλομορφία ως προς το σχήμα τους, που ήταν περίπου σφαιρικό, αλλά κυρίως ως προς το χρώμα τους. Επίσης συγκεκριμένοι γενότυποι ήταν πολύ παραγωγικοί σε σπόρο, ενω άλλη είχαν μικρή απόδοση. Απομόνωση DNA Στα φυτά της ρίγανης η αυξημένη συγκέντρωση δευτερογενών μεταβολιτών (πολυφαινολικών ενώσεων κλπ) δυσχεραίνει την εξαγωγή DNA υψηλής καθαρότητας και κατά συνέπεια παρεμποδίζει τις επακόλουθες μοριακές αναλύσεις. Για το λόγο αυτό αρχικά χρησιμοποιήθηκε η μέθοδος CTAB (hexadecyltrimethylammonium bromide) (Doyle and Doyle 1990) με μικρές τροποποιήσεις καθώς και μέθοδος απομόνωσης DNA που βασίζεται σε τυποποιημένη εμπορική συσκευασία (kit) (Macherey-Nagel). Η απομόνωση DNA πραγματοποιήθηκε από 30 mg ιστού νεαρού φύλλου ο οποίος λειοτριβήθηκε σε υγρό άζωτο. Η καθαρότητα και η ποσότητα του DNA που απομονώθηκε ελέγχθηκε τόσο με ηλεκτροφόρηση σε πήκτωμα αγαρόζης, όσο και φωτομετρικά (OD 260/280 nm και 260/230 nm). αγαρόζης 2% (Sigma). Οι ζώνες που προέκυψαν απεικονίστηκαν με το σύστημα απεικόνισης GelDocEZ (BioRad). Τα μοριακά βάρη των ζωνών υπολογίστηκαν συγκρίνοντας μάρτυρες DNA γνωστού μήκους 100-bp και 1- kb (New England Biolabs). Στη συνέχεια προκειμένου να μην υπάρξουν αναστολείς στα επόμενα στάδια της αλληλούχησης και γενοτύπησης των δειγμάτων απομακρύνθηκαν τα υπολείμματα των αντιδράσεων PCR (περίσσεια εκκινητών, άλατα MgCl 2, dntps κλπ με την βοήθεια της εμπορικής συσκευασίας PCR clean up kit (Macherey-Nagel). Αντιδράσεις PCR Οι εκκινητές που χρησιμοποιήθηκαν για να μελετηθούν οι επιλεχθέντες μικροδορυφορικοί δείκτες περιγράφονται από τους Novak et al. (2008). Πρόκειται περί μικροδορυφορικών επαναλήψεων που ανιχνεύονται σε εκφραζόμενες DNA αλληλουχίες (ESTs), οι οποίες ενισχύονται από τους παρακάτω εκκινητές όπως φαίνονται μαζί με τα μοτίβα επαναλήψεων στην εικόνα 1. Οι αντιδράσεις PCR πραγματοποιήθηκαν σε ένα μείγμα 15 μl που περιείχε: γονιδιωματικό DNA, 1x ρυθμιστικό διάλυμα PCR (KapaTaq), 1.5 mm MgCl 2, 0.6 μm από κάθε εκκινητή, 100 μμ από κάθε dntp και 0.6 U θερμοσταθερή DNA πολυμέραση (KapaTaq). Οι αντιδράσεις έγιναν σε θερμικό κυκλοποιητή MJ Research PTC-100 υπό τις ακόλουθες συνθήκες: ένα αρχικό στάδιο αποδιάταξης στους 95 C για 15 λεπτά ακολουθούμενο από 35 κύκλους: i) αποδιάταξης του DNA στους 95 C για 1 λεπτό, ii) υβριδισμού των εκκινητών στη μήτρα DNA στους 59 C για 1 λεπτό και iii) επέκτασης των νουκλεοτιδικών αλυσίδων στους 72 C για 2 λεπτά δευτερόλεπτα. Το πρόγραμμα τελείωσε με ένα τελευταίο βήμα επέκτασης των αλυσίδων DNA στους 72 C για 9 λεπτά. Τα προϊόντα PCR διαχωρίστηκαν με ηλεκτροφόρηση στα 110V σε πήκτωμα Εικ.1: Εκκινητές για την ενίσχυση με PCR καθώς και μοτίβα επανάληψης των μικροδορυφορικών δεικτών που χρησιμοποιήθηκαν στην παρούσα μελέτη. Αλληλούχηση και γενοτύπηση των δειγμάτων Αρχικά αλληλουχήσαμε ορισμένα από τα δείγματα, ώστε να εξετάσουμε κατά πόσον οι εκκινητές ενισχύουν πράγματι μικροδορυφορικές αλληλουχίες και ποιο είναι το ακριβές μοτίβο επανάληψης στο νουκλεοτιδικό επίπεδο. Για το σκοπό αυτό επιλέξαμε 3 δείγματα κλώνων ρίγανης τα οποία μετά την ενίσχυση με PCR αλληλουχήθηκαν χρησιμοποιώντας το ζεύγος εκκινητών OR09. Η αλληλούχιση έγινε από την εταιρεία VBC Biotech (Austria) χρησιμοποιώντας τη συσκευή αλληλούχησης ABI 3730XL (Applied Biosystems). Οι αλληλουχήσεις έγιναν και προς τις δύο κατευθύνσεις χρησιμοποιώντας δηλαδή τόσο τον πρόσθιο (forward) όσο και τον οπίσθιο (reverse) εκκινητή, ώστε να μην έχουμε απώλεια διαβάσματος βάσεων. Η ενοποίηση και η ευθυγράμμιση των νουκλεοτιδικών αλληλουχιών έγινε χρησιμοποιώντας το υπολογιστικό πακέτο προγραμμάτων BioEdit. 66

3 H γενοτύπηση των δειγμάτων έγινε χρησιμοποιώντας εκκινητές σημασμένους με ειδικές χρωστικές φθορισμού (FAM, HEX, ROX, TAMRA). Η ηλεκτροφόρηση των θραυσμάτων μετά από τις αντιδράσεις PCR έγινε στη συσκευή αλληλούχησης ΑΒΙ 3500 (Applied Biosystems) και ο καθορισμός του μεγέθους τους δηλαδή η διάκριση των διαφορετικών αλληλομόρφων κάθε μικροδορυφορικού γενετικού τόπου πραγματοποιήθηκε με το υπολογιστικό πρόγραμμα STRand Εικ. 3: PCR αντιδράσεις συγκεριμένων δειγματων φυτών ρίγανης μετά από αντίδρασεις PCR με τους εκκινητές OR09, OR10, OR12. Μετά την αλληλούχηση επιλεγμένων δειγμάτων πήραμε ενδεικτικά τα εξής αποτελέσματα (Εικόνα 4). Στατιστική Ανάλυση Για τον υπολογισμό του αριθμού των αλληλομόρφων ανά γενετικό τόπο, του δείκτη ποικιλότητας του Shannon (Ι), ο οποίος μάλιστα δεν προϋποθέτει ισορροπία του πληθυσμού κατά Hardy-Weinberg (Lewontin 1972) και των συντελεστών γενετικής απόστασης (Nei 1972) χρησιμοποιήθηκε το πρόγραμμα POPGENE Η ανάλυση κύριων συντεταγμένων (PCoA) πραγματοποιήθηκε με το πρόγραμμα Genalex Οι τιμές των συντελεστών γενετικής απόστασης κατά Nei (1972) χρησιμοποιήθηκαν για την κατασκευή δενδρογράμματος UPGMA με το πρόγραμμα TFPGA ver ΑΠΟΤΕΛΕΣΜΑΤΑ Με βάση τα προκαταρκτικά αποτελέσματα επιλέχθηκε για τη συνέχεια ως μέθοδος απομόνωσης DNA το κιτ Macherey- Nagel (Εικόνα 2) αφού μας έδινε τα καλύτερα αποτελέσματα ως προς την καθαρότητα και την ακεραιότητα του απομονωθέντος DNA. Εικόνα 4: Νουκλεοτιδική αλληλουχία του μικροδορυφορικού δείκτη OR09 σε άτομο ρίγανης. Στη συνέχεια αφού έγινε η ενοποίηση και ευθυγραμμίση (alignment) των αλληλουχιών DNA που προέκυψαν τόσο με τον πρόσθιο όσο και με τον οπίσθιο εκκινητή χρησιμοποιώντας το υπολογιστικό πακέτο προγραμμάτων BioEdit, προέκυψαν οι πλήρεις αλληλουχίες που εμφανίζονται στην επόμενη εικόνα. Εικ. 2: Ηλεκτροφόρηση δείγματων DNA ρίγανης (Macherey- Nagel) σε πήκτωμα αγαρόζης. Οι δειγματοληπτικές αντιδράσεις PCR χρησιμοποιώντας ορισμένα δείγματα ρίγανης και ζεύγη εκκινητών έδωσαν τα αναμενόμενα αποτελέσματα ως προς το μέγεθος και τον αριθμό των ζωνών όπως φαίνεται στην επόμενη εικόνα. Εικ. 5: Σύγκριση της πλήρους αλληλουχίας του μικροδορυφορικού δείκτη OR09 σε τρία δείγματα φυτών ρίγανης. Όπως παρατηρούμε στην εικόνα 5 δεν υπάρχουν διαφορές σε νουκλεοτιδικό επίπεδο μεταξύ των τριών ατόμων για το μικροδορυφορικό δείκτη OR09. Επίσης το μοτίβο επανάληψης προσομοιάζει με την εργασία των Novak et al. (2008). Η γενοτύπηση των δειγμάτων με βάση τα δώδεκα ζεύγη μικροδορυφορικών εκκινητών που χρησιμοποιήθηκαν στην παρούσα έρευνα αποκάλυψε την ύπαρξη διαφορετικών 67

4 αλληλομόρφων σε κάθε γενετικό τόπο. Στις επόμενες εικόνες παρατίθενται οι γενότυποι που προέκυψαν για ορισμένους μικροδορυφορικούς δείκτες σε συγκεκριμένα άτομα: επιτρέπουν το πλήρη διαχωρισμό τους και την απόλυτη ταυτοποίησή τους. Ο αριθμός των αλληλομόρφων ανά γενετικό τόπο και ο δείκτης ποικιλότητας του Shannon (Ι) παρουσιάζονται στον επόμενο πίνακα. Εικ. 6: Ομοζυγωτικό άτομο του δείγματος 1 ως προς το αλληλόμορφο 144 του εκκινητή OR09. Οι συντελεστές γενετικής απόστασης κυμαίνονται από 0 (μεταξύ 12 και 16) έως 1,79 (μεταξύ των δειγμάτων 11 και 15 με το δείγμα 24). Εικ. 7: Ετεροζυγωτικό άτομο του δείγματος 17 ως προς τα αλληλόμορφα 115 και 117 του εκκινητή OR12. Οι γενότυποι όλων των ατόμων σε όλους τους γενετικούς τόπους εμφανίζονται στον επόμενο πίνακα: Πίνακας: Συντελεστές γενετικής απόστασης D κατά Nei (1972). Η ανάλυση κυρίων συντεταγμένων (PCoA) έδειξε ότι τα δείγματα που αναλύθηκαν ομαδοποιούνται κυρίως σε τρεις μεγάλες ομάδες. Η μία περιλαμβάνει τρία δείγματα O. onites, στα δεξιά της Εικόνας 8, ενώ η μεγάλη ομάδα αριστερά της ίδιας εικόνας περιλαμβάνει δείγματα O. vulgare. Τέλος η μικρότερη ομάδα, περιλαμβάνει δείγματα O. vulgare και O. marjoram. Είναι εμφανές ότι εκτός από τα άτομα 12 και 16 τα οποία εμφανίζουν τον ίδιο γενότυπο και δεν μπορούν να διακριθούν στα υπόλοιπα υπάρχουν αρκετοί διαγνωστικοί δείκτες που 68

5 2013, όπου αναφέρονται οι κωδικοί 3,4,5,6,7 και 8, οι οποίοι αντιστοιχούν στους 15,22,12,19,25 και 20 της παρούσας εργασίας). Αντίστοιχη ομαδοποίηση προκύπτει για τους γενότυπους αυτούς και με βάση τους μοριακούς δείκτες SSR Εικ. 8 Ανάλυση κυρίων συντεταγμένων PCoA με βάση τους μοριακούς δείκτες Παρόμοια ομαδοποίηση εμφανίζεται και στο δενδρογράμμα UPGMA με βάση το συντελεστή γενετικής απόστασης του Nei (1972). Εικ. 11:. Aνάλυση κυρίων συντεταγμένων (PCoA) με βάση τη χρήση δεικτών SSR. Με βάση τη γενοτυπική σύσταση είναι εύκολο να διακριθούν οι γενότυποι αυτοί μεταξύ τους καθώς έχουν προκύψει αρκετοί διαγνωστικοί δείκτες με διακριτά διαγνωστικά πρότυπα που τους διαχωρίζουν. Για να πραγματοποιηθεί όμως απόλυτη διάκριση με το σύνολο των δειγμάτων που αναλύθηκαν θα χρειαστεί να αναλυθούν περισσότεροι ή και διαφορετικού τύπου μοριακοί δείκτες οι οποίοι ενισχύουν αλληλουχίες με μεγαλύτερη ποικιλότητα σε πιο εκτεταμένες περιοχές του γονιδιώματος. Ει.κ 9: Δενδρόγραμμα UPGMA με βάση το συντελεστή γενετικής απόστασης κατά Nei (1972). Στη συνέχεια έγινε ανάλυση κυρίων συντεταγμένων (PCoA) τόσο με βάση τη σύσταση του ριγανελαίου όσο και με βάση τα αποτελέσματα της μοριακής ανάλυσης με δείκτες SSR σε συγκεκριμένους γενοτύπους που παρουσίαζαν μεγάλο ενδιαφέρον από πλευράς χημικής σύστασης και αντιμικροβιακών ιδιοτήτων του ριγανέλαιου. Η ανάλυση PCoA με βαση τα χημειοτυπικά χαρακτηριστικά επίσης έδειξε ότι οι γενότυποι ομαδοποιούνται κυρίως σε τρεις ομάδες. ΣΥΖΗΤΗΣΗ Δεδομένα που παρουσιάστηκαν σε προηγούμενες αναφορές της ερευνητικής μας ομάδας, αποδεικνύουν ότι ριγανέλαιο απο τα δείγματα 1, 15 και 20 μπορεί να μειώσει τη δράση βακτηριακών στελεχών της ομάδας Vibrio και επομένως να χρησιμοποιηθεί στην απολύμανση τροχοζώων Brachionus plicatilis που χρησιμοποιούνται ως ζωντανή τροφή σε ψάρια [8], [9]. Στη παρούσα μελέτη πραγματοποιήθηκε μοριακή αναλυση 25 γενοτύπων ρίγανης με χρήση μικροδορυφορικών DNA δεικτών (SSRs). Με βάση αυτοί οι γενότυποι ομαδοποιήθηκαν σε τρεις κύριες ομάδες και προέκυψαν αρκετοί διαγνωστικοί δείκτες οι οποίοι διαχωρίζουν τα δέιγματα αυτά μεταξύ τους. Για ορισμένους από τους γενοτύπους αυτούς συσχετίσθηκαν οι χημειοτυπικές αναλύσεις με την ανάλυση μοριακών δεικτών και προέκυψαν παρόμοιες ομαδοποιήσεις. Χρειάζονται περισσότερες αναλύσεις προκειμένου να βρεθούν μοναδικά DNA προφίλ για τη ταυτοποίηση των συγκεκριμένων δειγμάτων που παρουσιάζουν μεγαλύτερο ενδιαφέρον. Εικ. 10: Aνάλυση κυρίων συντεταγμένων (PCoA) με βάση τη σύσταση του ριγανελαίου (προσαρμογή απο Stefanakis et al ΕΥΧΑΡΙΣΤΙΕΣ 69

6 H παρούσα έρευνα έχει συγχρηματοδοτηθεί από την Ευρωπαϊκή Ένωση (Ευρωπαϊκό Κοινωνικό Ταμείο - ΕΚΤ) και από εθνικούς πόρους μέσω του Επιχειρησιακού Προγράμματος «Εκπαίδευση και Δια Βίου Μάθηση» του Εθνικού Στρατηγικού Πλαισίου Αναφοράς (ΕΣΠΑ) Ερευνητικό Χρηματοδοτούμενο Έργο: ΑΡΧΙΜΗΔΗΣ ΙΙΙ. Επένδυση στην κοινωνία της γνώσης μέσω του Ευρωπαϊκού Κοινωνικού Ταμείου. ΒΙΒΛΙΟΓΡΑΦΙΚΕΣ ΑΝΑΦΟΡΕΣ [1] Vokou D. et. al. (1993). Geographic Variation of Greek Oregano (Origanum vulgare ssp. hirtum) Essential Oils. Biochemical Systematics and Ecology, 21: [2] Kokkini, S. et. al. (1993). The Hybrid Origanum intercedens from the Island of Nisyros (SE Greece) and its Parental Taxa; Comparative Study of Essential Oils and Distribution. Biochemica/Systematics and Ecology, 21: [3] Sivropoulou A. et. al. (1996) Antimicrobial and Cytotoxic Activities of Origanum Essential Oils. J. Agric. Food Chem. 44: [4] Kokkini, S. et. al. (2004). Essential Oil Composition of Greek (Origanumvulgare ssp. hirtum) and Turkish (0. onites) Oregano :a Tool for Their Distinction. J. Essent. Oil Res., 16: [5] Burt SA and Reinders RD. (2003). Antibacterial activity of selected plant essential oils against Escherichia coli O157:H7. Lett Appl Microbiol. 36: [6] Dorman HJ and Deans SG (2000).Antimicrobial agents from plants: antibacterial activity of plant volatile oils. J Appl Microbiol.88: [7] Claire Yew, Y.C. (2008). Improving aquaculture production through better health and disease prevention the natural way. Feed technology update. Vo.3. Iss.1 [8] Stefanakis M.K, Touloupakis E., Anastassopoulos E., Ghanotakis D., Katerinopoulos H.E., Makridis P. (2013). Antibacterial activity of essential oils from plants of the genus Origanum. Food Control 34: [9] Stefanakis, M. K., Anastasopoulos, E., Katerinopoulos, H. E., & Makridis, P. (2014). Use of essential oils extracted from three Origanum species for disinfection of cultured rotifers (Brachionus plicatilis). Aquaculture Research, 45(11), [10] Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12: [11] Novak, J., Lukas, B., Bolzer, K., Grausgruber-Gröger, S., & Degenhardt, J. (2008). Identification and characterization of simple sequence repeat markers from a glandular origanum vulgare expressed sequence tag. Molecular Ecology Resources, 8(3), [12] Nei M. Interspecific gene differences and evolutionary time estimated from electrophoretic data on protein identity. Amer. Naturalist 105:385-98,


Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Μελέτη της χρήσης αποσταγμάτων επιλεγμένων φυτών ρίγανης στη διατροφή ψαριών με στόχο την μείωση του μικροβιακού φορτίου της τροφής τους (ζωοπλακτόν).

Μελέτη της χρήσης αποσταγμάτων επιλεγμένων φυτών ρίγανης στη διατροφή ψαριών με στόχο την μείωση του μικροβιακού φορτίου της τροφής τους (ζωοπλακτόν). Μελέτη της χρήσης αποσταγμάτων επιλεγμένων φυτών ρίγανης στη διατροφή ψαριών με στόχο την μείωση του μικροβιακού φορτίου της τροφής τους (ζωοπλακτόν). Μιχάλης Κ. Στεφανάκης, Γιώργος Τσικαλάς, Ελευθέριος

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. (Μοριακή Βελτίωση) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (Μοριακή Βελτίωση) 1 Βασίζεται στη χρήση μοριακών δεικτών που είναι συνδεδεμένοι με επιθυμητές χρωμοσωμικές περιοχές. Μοριακοί δείκτες είναι τυχαία επιλεγμένα τμήματα DNA χωρίς

Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η Συμβολή της Μοριακής Βιολογίας

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΣΥΝΑΝΤΗΣΗΣ ΤΟΥ ΕΡΓΟΥ 12CHN409 ΠΡΑΚΤΙΚΑ 4 ης ΣΥΝΑΝΤΗΣΗΣ ΤΟΥ ΕΡΓΟΥ 12CHN409 Βιολογικά ενεργά αιθέρια έλαια και άλλες ευεργετικές για την υγεία ουσίες από Ελληνικά και Κινέζικα ενδημικά φυτά - Bioactive essential oils and other beneficial

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

ΑΔΑ: ΒΙΞ446914Γ-ΧΡΖ. Βαθμός Ασφαλείας. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων. Μεγ.

ΑΔΑ: ΒΙΞ446914Γ-ΧΡΖ. Βαθμός Ασφαλείας. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων. Μεγ. ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα


ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΑΠΟΣΤΟΛΟΣ ΒΑΝΤΑΡΑΚΗΣ ΒΙΟΛΟΓΟΣ (M.Sc, Ph.D) Επιδημίες μολυσματικών ασθενειών συχνά οφείλονται σε έκθεση σε μία κοινή πηγή ενός αιτιολογικού παράγοντα.

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Α. Ντούλης, Ινστιτούτο Αμπέλου, Λαχανοκομίας & Ανθοκομίας Ηρακλείου (ΙΑΛΑΗ), Εθνικό Ίδρυμα Αγροτικών Ερευνών (ΕΘΙΑΓΕ) και

Διαβάστε περισσότερα


ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp.

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. 5 ο Πανελλήνιο Συνέδριο Ιατρικής Βιοπαθολογίας Η εφαρμογή μοριακών

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

Διάκριση ποικιλιών ελαιολάδου μέσω μεθόδου γονοτύπησης βασιζόμενης σε φθορίζοντα μικροσφαιρίδια

Διάκριση ποικιλιών ελαιολάδου μέσω μεθόδου γονοτύπησης βασιζόμενης σε φθορίζοντα μικροσφαιρίδια Διάκριση ποικιλιών ελαιολάδου μέσω μεθόδου γονοτύπησης βασιζόμενης σε φθορίζοντα μικροσφαιρίδια Δέσποινα Π. Καλογιάννη Τμήμα Χημείας Πανεπιστήμιο Πατρών Ανάπτυξη μεθόδου ελέγχου αυθεντικότητας του ελαιολάδου

Διαβάστε περισσότερα

Αϖοµόνωση και γενετική διαφοροϖοίηση ϖληθυσµών του ζαρκαδιού (Capreoluscapreolus) στην Ελλάδα νέα δεδοµένα για αϖοτελεσµατικότερη διαχείριση και διατήρηση ηµήτρης Τσαϖάρης Παναγιώτης Κασαϖίδης Κωνσταντίνος

Διαβάστε περισσότερα

ΖΩΟΤΕΧΝΙΑ Διδάσκουσα: Κουτσούλη Παναγιώτα Τμήμα: Επιστήμης Ζωικής Παραγωγής & Υδατοκαλλιεργειών

ΖΩΟΤΕΧΝΙΑ Διδάσκουσα: Κουτσούλη Παναγιώτα Τμήμα: Επιστήμης Ζωικής Παραγωγής & Υδατοκαλλιεργειών ΖΩΟΤΕΧΝΙΑ Χαρακτηριστικά των αγροτικών ζώων με οικονομική σημασία Διδάσκουσα: Κουτσούλη Παναγιώτα Τμήμα: Επιστήμης Ζωικής Παραγωγής & Υδατοκαλλιεργειών 1. Μονογονιδιακά χαρακτηριστικά στους πληθυσμούς

Διαβάστε περισσότερα

Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa.

Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa. Αρχές PCR και υβριδισμού Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa.gr Ιστορικά στοιχεία Πρώτη αναφορά in vitro ενζυματικής αντίδρασης

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 1 Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης, Ηράκλειο Κρήτης. 2 Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 Department of Biology, Faculty of Science, Dokuz

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ 1 ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ άμεση πρόσβαση στο γενετικό υλικό εφαρμογές στην υγεία, βελτίωση φυτών και ζώων, προστασία

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 15 η ΜΙΚΡΟΒΙΑΚΗ ΕΞΕΛΙΞΗ ΚΑΙ ΣΥΣΤΗΜΑΤΙΚΗ


Διαβάστε περισσότερα

Παραλαβή αντιοξειδωτικών από το αρωματικό φυτό Satureja thymbra (θρούμπι) και μελέτη της δράσης του σε συστήματα τροφίμων

Παραλαβή αντιοξειδωτικών από το αρωματικό φυτό Satureja thymbra (θρούμπι) και μελέτη της δράσης του σε συστήματα τροφίμων Παραλαβή αντιοξειδωτικών από το αρωματικό φυτό Satureja thymbra (θρούμπι) και μελέτη της δράσης του σε συστήματα τροφίμων Ε. Χουλιτούδη, Κ. Μπράβου, Α. Μπιμπίλας, Δ. Τσιμογιάννης, Β. Ωραιοπούλου Εργαστήριο

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Δρ. Νικόλας Παπανικολάου Υπεύθυνος παρακολούθησης: Δρ. Αντρέας Ντούλης

Δρ. Νικόλας Παπανικολάου Υπεύθυνος παρακολούθησης: Δρ. Αντρέας Ντούλης Δρ. Νικόλας Παπανικολάου Υπεύθυνος παρακολούθησης: Δρ. Αντρέας Ντούλης Κίνητρο έργου Στο πεδίο της αγροτικής έρευνας στην Ελλάδα υπάρχει μεγάλη ποσότητα δεδομένων (μοριακών, μορφολογικών, αγρονομικών,

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ

θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν κλπ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ 1. Προβλήματα που αναφέρονται στα κομμάτια που θα κοπεί το DNA, στις θέσεις που κόβουν οι περιοριστικές ενδονουκλεάσες, στον αριθμό των πλασμιδίων που θα χρειαστούν

Διαβάστε περισσότερα


ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ 2η έκδοση βιολογία Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ περιεχόμενα Κεφάλαιο 1 Το γενετικό υλικό...13 Κεφάλαιο 2 Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας... 65 Κεφάλαιο 3 Ιοί...127

Διαβάστε περισσότερα

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Γενετική δομή και πρότυπα διαφοροποίησης των πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Δημήτρης Τσαπάρης Jacob Fric Αθήνα, Οκτώβριος 2012 Jon

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

1. Αντικείµενο του ιαγωνισµού Αντικείµενο του διαγωνισµού είναι η ανάδειξη µειοδότη για την προµήθεια των αναφεροµένων στο Παράρτηµα Α της παρούσας, υ

1. Αντικείµενο του ιαγωνισµού Αντικείµενο του διαγωνισµού είναι η ανάδειξη µειοδότη για την προµήθεια των αναφεροµένων στο Παράρτηµα Α της παρούσας, υ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ (Τ.Ε.Ι.) ΑΜΘ ΕΙ ΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝ ΥΛΙΩΝ ΕΡΕΥΝΑΣ Ταχ. δ/νση: Άγιος Λουκάς, Καβάλα Τηλέφωνο: 2510 462203 FAX: 2510 462352 E-mail: ipantel@teikav.edu.gr Καβάλα 20/08/2014

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα

Άσκηση Φαρμακευτικής Βιοτεχνολογίας

Άσκηση Φαρμακευτικής Βιοτεχνολογίας Άσκηση Φαρμακευτικής Βιοτεχνολογίας Χαρακτηρισμός Φαρμακογενετικών δεικτών με PCR-ARMS Θεωρητικό μέρος 1. Αλυσιδωτή αντίδραση Πολυμεράσης (PCR) Η αλυσιδωτή αντίδραση πολυμεράσης (polymerase chain reaction,

Διαβάστε περισσότερα

Μέρος 5 ο. Γονιδιακοί δείκτες

Μέρος 5 ο. Γονιδιακοί δείκτες Μέρος 5 ο Γονιδιακοί δείκτες R.C. Lewontin 1966 K.B. Mullis 1983 Εισαγωγή στη δασική γενετική Γονιδιακοί δείκτες Όπως είδαµε στα προηγούµενα κεφάλαια, η γενετική πληροφορία είναι οργανωµένη πάνω σε µια

Διαβάστε περισσότερα

Η φυσική ελιά & η θρεπτική της αξία. Κωνσταντίνος Κωνσταντινίδης Διευθύνων Σύμβουλος Pelopac

Η φυσική ελιά & η θρεπτική της αξία. Κωνσταντίνος Κωνσταντινίδης Διευθύνων Σύμβουλος Pelopac Η φυσική ελιά & η θρεπτική της αξία Κωνσταντίνος Κωνσταντινίδης Διευθύνων Σύμβουλος Pelopac Η Υγεία και η Ευεξία γίνονται βασικοί οδηγοί στις συνήθειες αγοράς τροφίμων των καταναλωτών Πηγή: Deloitte: Food

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κωνσταντίνος Στεφανίδης


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Οδηγίες χρήσης για το CRC RAScan Combination Kit KRAS and NRAS Exons 2, 3 & 4 CE IVD για τα συστήματα DHPLC

Οδηγίες χρήσης για το CRC RAScan Combination Kit KRAS and NRAS Exons 2, 3 & 4 CE IVD για τα συστήματα DHPLC 1 Κατασκευαστής Οδηγίες χρήσης για το CRC RAScan Combination Kit KRAS and NRAS Exons 2, 3 & 4 CE IVD για τα συστήματα DHPLC ιαβάστε προσεκτικά αυτές τις οδηγίες χρήσης προτού χρησιμοποιήσετε αυτό το προϊόν.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

τα βιβλία των επιτυχιών

τα βιβλία των επιτυχιών Τα βιβλία των Εκδόσεων Πουκαμισάς συμπυκνώνουν την πολύχρονη διδακτική εμπειρία των συγγραφέων μας και αποτελούν το βασικό εκπαιδευτικό υλικό που χρησιμοποιούν οι μαθητές των φροντιστηρίων μας. Μέσα από

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.)

Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.) Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.) Δρ Ελένη Μαλούπα, Τακτική Ερευνήτρια ΕΘΙΑΓΕ Fritilaria pontica Εργαστήριο Προστασίας και Αξιοποίησης Αυτοφυών

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων Dr. Παναγιώτης Μαδέσης pmadesis@certh.gr Ι. Γανόπουλος,

Διαβάστε περισσότερα

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες IΣTOΛOΓIA H ιστολογία κλάδος της ιατρικής που µελετά > υφή βιολογικού υλικού και τους τρόπους που τα επιµέρους συστατικά στοιχεία σχετίζονται µεταξύ τους δοµικά & λειτουργικά Tα δείγµατα του βιολογικού

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum).

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Μεντελική γενετική Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Φαινότυπος και Γονότυπος Η φυσική εκδήλωση (φαινότυπος) της γενετικής σύστασης (γονότυπος) επηρεάζεται από τις αλληλεπιδράσεις με άλλα

Διαβάστε περισσότερα

Γιατί είναι σημαντική η Βιοποικιλότητα;

Γιατί είναι σημαντική η Βιοποικιλότητα; Γενετική Διαχείριση Ο όρος βιοποικιλότητα αναφέρεται σε όλους τους διαφορετικούς οργανισμούς του πλανήτη μας και περιλαμβάνει τόσο την ποικιλότητα σε επίπεδο ειδών, όσο και τη γενετική ποικιλότητα. Γιατί

Διαβάστε περισσότερα

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών ΓΕΩΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Δράμα, 10 και 11

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.18 Ενημέρωση με τα στοιχεία από τα ευρήματα της έρευνας για τη δραστηριότητα

Διαβάστε περισσότερα


ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων Λάρισα 02/10/2013 Προκήρυξη Αριθμός Πρωτοκόλλου: 4292/3-7-2013 ΑΞΙΟΛΟΓΙΚΟΣ ΠΙΝΑΚΑΣ - Τομέας: Ενιαίος Μικροβιολογία (Εργαστήριο)

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

Δομή του πληθυσμού του σπάνιου και απειλούμενου φυτού Eriolobus trilobatus στο Ν. Έβρου

Δομή του πληθυσμού του σπάνιου και απειλούμενου φυτού Eriolobus trilobatus στο Ν. Έβρου Δομή του πληθυσμού του σπάνιου και απειλούμενου φυτού Eriolobus trilobatus στο Ν. Έβρου Παπαλαζάρου Κ. 1, Μπαλάσκα Κ. 1, Κοράκης Γ. 1, Ποϊραζίδης Κ. 1, Παπαγεωργίου Α.Χ. 1 1 Εργαστήριο Δασικής Γενετικής,

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

Άσκηση 11: Ηλεκτροφόρηση μακρομορίων

Άσκηση 11: Ηλεκτροφόρηση μακρομορίων Άσκηση 11: Ηλεκτροφόρηση μακρομορίων Σύνοψη Σκοπός της άσκησης είναι να γνωρίσουν οι εκπαιδευόμενοι την ηλεκτροφόρηση, μια από τις βασικότερες τεχνικές για τον διαχωρισμό και την απομόνωση νουκλεϊκών οξέων

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Α. Μεντής ιαγνωστικό Εργαστήριο Λοιμωδών Νοσημάτων Εθνικό Εργαστήριο Αναφοράς Γρίπης Νοτίου Ελλάδος Εθνικό Εργαστήριο Αναφοράς Ερυθράς/Ιλαράς Ελλάδος, Εθνικό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ToxPlus. Spin-off εταιρία του Εργαστηρίου Τοξικολογίας Πανεπιστημίου Κρήτης. Επιδοτούμενη από το ΕΣΠΑ (2007 2013)

ToxPlus. Spin-off εταιρία του Εργαστηρίου Τοξικολογίας Πανεπιστημίου Κρήτης. Επιδοτούμενη από το ΕΣΠΑ (2007 2013) KENTΡΟ ΤΟΞΙΚΟΛΟΓΙΑΣ Α.Ε. Επιστημονικό και Τεχνολογικό Πάρκο Κρήτης Step C, N. Πλαστήρα 100, Βασιλικά Βουτών, Τ.Κ. 700 13 Ηράκλειο, Κρήτη www.toxplus.gr ToxPlus Spin-off εταιρία του Εργαστηρίου Τοξικολογίας

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ 4 Ο Εξάµηνο Ακαδηµαϊκό Έτος 2006-2007

ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ 4 Ο Εξάµηνο Ακαδηµαϊκό Έτος 2006-2007 Το µάθηµα: ΣΥΣΤΗΜΑΤΙΚΗ ΒΟΤΑΝΙΚΗ ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ 4 Ο Εξάµηνο Ακαδηµαϊκό Έτος 2006-2007 1 Η Ι ΑΚΤΙΚΗ ΟΜΑ Α: Στέλλα Κοκκίνη, καθηγήτρια Ρεγγίνα Καρούσου, λέκτορας Σοφία Λαυρεντιάδου, ΕΕ ΙΠ ΙΙ 2 1 ΤΡΟΠΟΙ Ι

Διαβάστε περισσότερα

Η χρήση της ελιάς στο Αιγαίο κατά την αρχαιότητα

Η χρήση της ελιάς στο Αιγαίο κατά την αρχαιότητα Η χρήση της ελιάς στο Αιγαίο κατά την αρχαιότητα Μ. Ρούμπου 1, Β. Κυλίκογλου 2, N. Müeller 2 & Ν. Καλογερόπουλος 1 1 Χαροκόπειο Πανεπιστήμιο, Τμήμα Επιστήμης Διατολογίας-Διατροφής, Αθήνα 2 Ε.Κ.Ε.Φ.Ε. Δημόκριτος,Τομέας

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα


ΗΛΕΚΤΡΟΦΟΡΗΣΗ ΠΡΩΤΕΙΝΩΝ ΗΛΕΚΤΡΟΦΟΡΗΣΗ ΠΡΩΤΕΙΝΩΝ Άννα-Μαρία Ψαρρά ΤΒΒ, Παν/μιο Θεσσαλίας Λάρισα 2015 ΗΛΕΚΤΡΟΦΟΡΗΣΗ Αναλυτικός τρόπος διαχωρισμού πρωτεϊνών και άλλων μακρομορίων όπως πρωτεϊνών DNA, RNA Αρχή της μεθόδου Μόρια που

Διαβάστε περισσότερα

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο Διάλεξη 2 Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο (Κ. Ματθιόπουλοσ) Τι είναι «είδος»; Μοριακή ταυτοποίηση: είδος, άτομο,, φύλο Πόσο αξίζει μια ομάδα οργανισμών τις προσπάθειες διατήρησής τους Δηλαδή: πόσο

Διαβάστε περισσότερα

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Γενετική Βακτηρίων Κατανόηση μηχανισμών λειτουργίας ευκαρυωτικών κυττάρων Ταξινόμηση βακτηρίων Διάγνωση λοιμωδών νοσημάτων Επιδημιολογική μελέτη

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 2 ΙΣΟΡΡΟΠΙΑ HARDY-WEINBERG ΚΕΦΑΛΑΙΟ ΙΣΟΡΡΟΠΙΑ HARDY-WEINBERG 1 Σύνοψη Σε αυτό το κεφάλαιο θα ξεκινήσουµε να µιλάµε για γενετική πληθυσµών, η οποία αναφέρεται στη δυναµική των γονιδίων µέσα στους πληθυσµούς. Θα µάθουµε να υπολογίζουµε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι

Μικροβιολογία Τροφίμων Ι Μικροβιολογία Τροφίμων Ι Ενότητα 9: Αντιμικροβιακά Εμπόδια - Αιθέρια Έλαια, 1.5ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Γεώργιος - Ιωάννης Νύχας Ευστάθιος Πανάγου Μαθησιακοί

Διαβάστε περισσότερα


ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ. Κωνσταντίνα - Παρασκευή Σ. Μπαθρέλλου. Βιολόγος ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ Κωνσταντίνα - Παρασκευή Σ. Μπαθρέλλου Βιολόγος Ταξινόμηση, κατανομή και αιθέρια έλαια αρωματικών φυτών στους τύπους οικοτόπων

Διαβάστε περισσότερα

Σύμφωνα με: Τους Καν. (ΕΚ) 889/2008 & 834/2007

Σύμφωνα με: Τους Καν. (ΕΚ) 889/2008 & 834/2007 ΔΜ 2-2 Γ` ΣΔΠ Σελ. 1 ΦΥΣΙΟΛΟΓΙΚΗ επε. (GR-BIO-02) Π Ρ Ο Δ Ι Α Γ Ρ Α Φ Ε Σ ΒΙΟΛΟΓΙΚΗΣ ΜΕΛΙΣΣΟΚΟΜΙΑΣ Σύμφωνα με: Τους Καν. (ΕΚ) 889/2008 & 834/2007 «Φυσιολογική» επε Εθνικής Αντίστασης 66, Αλεξάνδρεια 59300,,

Διαβάστε περισσότερα

Μετάλλαξη και Ανασυνδυασμός

Μετάλλαξη και Ανασυνδυασμός BIOΛOΓIA TΩN MIKPOOPΓANIΣMΩN ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ Μετάλλαξη και Ανασυνδυασμός Μετάλλαξη ή μεταλλαγή είναι οποιαδήποτε κληρονομήσιμη αλλαγή της αλληλουχίας των βάσεων του νουκλεϊκού οξέος, που

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) 1 ΔΗΜΙΟΥΡΓΙΑ ΦΥΤΩΝ ΜΕ ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ 19 Παράγοντες που συμβάλλουν σε αύξηση των εντόμων 1. Μονοκαλλιέργειες 2. Βελτίωση με κριτήριο αποκλειστικά την

Διαβάστε περισσότερα