Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν.

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν."

Transcript

1 Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν. Μιχάλης Κ. Στεφανάκης, Γιώργος Τσικαλάς, Ελευθέριος Τουλουπάκης, Λαζανάκη Μαρία, Χαράλαμπος Ε. Κατερινόπουλος Τμήμα Χημείας, Πανεπιστημιο Κρήτης, Βούτες, Ηράκλειο 71003, Κρήτη, Ελλάδα Παύλος Μακρίδης, Τμήμα Βιολογίας, Πανεπιστήμιο Πατρών, Πανεπιστημιούπολη Ρίο, Πάτρα, 26500, Ελλάδα Δημήτριος Ζαραγκότας, Δημήτριος Μπακρατσάς, Ηλίας Αναστασόπουλος Τμήμα Τεχνολόγων Γεωπόνων, ΤΕΙ Θεσσαλίας, Λάρισα 41110, Ελλάδα Χαρίκλεια Παπαϊωάννου, Βασίλειος Παπασωτηρόπουλος, Τμήμα Τεχνολόγων Γεωπόνων, ΤΕΙ Δυτικής Ελλάδας Αμαλιάδα 27200, Ελλάδα Περίληψη- Δείγματα ελαίου φυτών ρίγανης επιλέχθηκαν για απολύμανση τροχόζωων Brachionus plicatilis απο βακτηριακά στελέχη του γένους Vibrio. Ακολούθησε μοριακή ταυτοποίηση των επιλεγμένων κλώνων ρίγανης με ανάλυση μοριακών δεικτών SSR. Με βάση την ανάλυση αυτή, οι γενότυποι των κλώνων ρίγανης ομαδοποιήθηκαν σε τρεις κύριες ομάδες. Για ορισμένους από τους γενοτύπους αυτούς επιχειρήθηκε η συσχέτιση των αποτελεσμάτων των χημειοτυπικών αναλύσεων με αυτά από την ανάλυση μοριακής ποικιλότητας, όπου προέκυψαν παρόμοιες ομαδοποιήσεις. Λέξεις κλειδιά μοριακή ανάλυση; Origanum; SSR; Vibrio; Brachionus plicatilis; υδατοκαλλιέργειες ΕΙΣΑΓΩΓΗ Στην Ελλάδα η ρίγανη αυτοφύεται σε διάφορες περιοχές, ενώ τα τελευταία χρόνια έχει αρχίσει η συστηματική καλλιέργειά της με στόχο την εμπορική εκμετάλλευσή της. Η ύπαρξη διαφορετικών ειδών, κυριότερα των οποίων είναι τα Origanum vulgare και Origanum οnites, ο μεγάλος αριθμός υποειδών, αλλά και οι διαφορετικοί οικότυποι αποδεικνύουν τη μεγάλη γενετική ποικιλότητα, που έχει ως αποτέλεσμα τη διαφοροποίηση των φυτών, τόσο μορφολογικά όσο και ως προς διάφορες βιοχημικές τους ιδιότητές [1]. Φυτά ρίγανης έχει αποδειχθεί ότι έχουν υψηλή περιεκτικότητα σε φαινολικά [2], γεγονός που σχετίζεται με τη δραστικότητα του ελαίου τους έναντι διαφόρων φυτικών και ζωικών παθογόνων βακτηρίων [3]. Σε μελέτες για την ελληνική ρίγανη περισσότερα από 30 ενεργά συστατικά έχουν εντοπιστεί, συμπεριλαμβανομένων του ροσμαρινικού οξέως, της θυμόλης και της καρβακρόλης [4]. Διάφορες μελέτες αποδεικνύουν τις αντιμικροβιακές ιδιότητες του ελαίου της ρίγανης [5], [6]. Στην αγορά, υπάρχει ήδη ένα προϊόν, με βάση το έλαιο της ρίγανης, το οποίο χρησιμοποιείται κατά γαστρεντερικών παθογόνων, που σκοτώνει τους μικροοργανισμούς όταν έρχεται σε επαφή με αυτούς, εντός του εντέρου γαρίδων ή ψαριών [7]. Νεότερα ερευνητικά δεδομένα απέδειξαν ότι τα αιθέρια έλαια συγκεκριμένων φυτών ρίγανης μπορούν να χρησιμοποιηθούν για την μείωση της δράσης των βακτηριακών στελεχών του γένους Vibrio και στην απολύμανση ζωοπλαγκτονικών οργανισμών τροχόζωων Brachionus plicatilis, που χρησιμοποιούνται ως ζωντανή τροφή σε ψάρια [8], [9]. Ο σκοπός της παρούσας μοριακής ανάλυσης ήταν διττός. Αφενός να εκτιμηθεί η γενετική ποικιλότητα ενός ετερόκλητου πληθυσμού δειγμάτων ρίγανης και αφετέρου να ταυτοποιηθούν, μοριακά, επιλεγμένα δείγματα, που έδειξαν μέγιστη αντιβατηριακή δράση έναντι στελεχών της ομάδας Vibrio, για την απολύμανση ζωοπλαγκτονικών οργανισμών. Επίσης στη παρούσα μελέτη επιχειρήθηκε να συσχετισθούν τα αποτελέσματα των χημικών αναλύσεων με εκείνα των μοριακών αναλύσεων, των συγκεκριμένων δειγμάτων ρίγανης που έχουν μεγάλο ενδιαφέρον για απολύμανση των ζωοπλαγκτονικών οργανισμών και πιο συγκεκριμένα τροχοζώων του είδους Brachionus plicatilis. Για τις μοριακές αναλύσεις επιλέχθηκαν οι πυρηνικές μικροδορυφορικές αλληλουχίες (microsatellites), αλλιώς γνωστές και ως SSR, (Simple Sequence Repeats) κυρίως λόγω των ιδιοτήτων που εμφανίζουν όπως πχ υψηλός μεταλλακτικός ρυθμός και ποικιλότητα ακόμα και μεταξύ ποικιλιών-πληθυσμών του ιδίου είδους, καθώς και συνυπερέχων τρόπο κληρονόμησης. Οι ιδιότητες αυτές καθιστούν τους μικροδορυφορικούς δείκτες ιδανικό μοριακό εργαλείο για τη διερεύνηση της γενετικής ποικιλότητας και 65

2 την ανάλυση της γενετικής δομής στα φυτά τόσο σε διαειδικό όσο και σε ενδοειδικό επίπεδο. ΜΕΘΟΔΟΛΟΓΙΑ Συλλογή σπόρων ρίγανης Σπόροι ρίγανης συλλέχθηκαν από τη Νάξο (O. onites), το Πήλιο (O. vulgare), της Σίσες Ηρακλείου Κρήτης (O. vulgare), τα Άγραφα (O. vulgare), τη Ζαχάρω Ηλείας (O. vulgare), την Πέρδικα Θεσπρωτίας (O. vulgare) μαζί με ένα δείγμα (O. vulgare) του εμπορίου καθώς και ένα δείγμα (O. marjoram) επίσης του εμπορίου. Οι σπόροι παρουσίαζαν ποικιλομορφία ως προς το σχήμα τους, που ήταν περίπου σφαιρικό, αλλά κυρίως ως προς το χρώμα τους. Επίσης συγκεκριμένοι γενότυποι ήταν πολύ παραγωγικοί σε σπόρο, ενω άλλη είχαν μικρή απόδοση. Απομόνωση DNA Στα φυτά της ρίγανης η αυξημένη συγκέντρωση δευτερογενών μεταβολιτών (πολυφαινολικών ενώσεων κλπ) δυσχεραίνει την εξαγωγή DNA υψηλής καθαρότητας και κατά συνέπεια παρεμποδίζει τις επακόλουθες μοριακές αναλύσεις. Για το λόγο αυτό αρχικά χρησιμοποιήθηκε η μέθοδος CTAB (hexadecyltrimethylammonium bromide) (Doyle and Doyle 1990) με μικρές τροποποιήσεις καθώς και μέθοδος απομόνωσης DNA που βασίζεται σε τυποποιημένη εμπορική συσκευασία (kit) (Macherey-Nagel). Η απομόνωση DNA πραγματοποιήθηκε από 30 mg ιστού νεαρού φύλλου ο οποίος λειοτριβήθηκε σε υγρό άζωτο. Η καθαρότητα και η ποσότητα του DNA που απομονώθηκε ελέγχθηκε τόσο με ηλεκτροφόρηση σε πήκτωμα αγαρόζης, όσο και φωτομετρικά (OD 260/280 nm και 260/230 nm). αγαρόζης 2% (Sigma). Οι ζώνες που προέκυψαν απεικονίστηκαν με το σύστημα απεικόνισης GelDocEZ (BioRad). Τα μοριακά βάρη των ζωνών υπολογίστηκαν συγκρίνοντας μάρτυρες DNA γνωστού μήκους 100-bp και 1- kb (New England Biolabs). Στη συνέχεια προκειμένου να μην υπάρξουν αναστολείς στα επόμενα στάδια της αλληλούχησης και γενοτύπησης των δειγμάτων απομακρύνθηκαν τα υπολείμματα των αντιδράσεων PCR (περίσσεια εκκινητών, άλατα MgCl 2, dntps κλπ με την βοήθεια της εμπορικής συσκευασίας PCR clean up kit (Macherey-Nagel). Αντιδράσεις PCR Οι εκκινητές που χρησιμοποιήθηκαν για να μελετηθούν οι επιλεχθέντες μικροδορυφορικοί δείκτες περιγράφονται από τους Novak et al. (2008). Πρόκειται περί μικροδορυφορικών επαναλήψεων που ανιχνεύονται σε εκφραζόμενες DNA αλληλουχίες (ESTs), οι οποίες ενισχύονται από τους παρακάτω εκκινητές όπως φαίνονται μαζί με τα μοτίβα επαναλήψεων στην εικόνα 1. Οι αντιδράσεις PCR πραγματοποιήθηκαν σε ένα μείγμα 15 μl που περιείχε: γονιδιωματικό DNA, 1x ρυθμιστικό διάλυμα PCR (KapaTaq), 1.5 mm MgCl 2, 0.6 μm από κάθε εκκινητή, 100 μμ από κάθε dntp και 0.6 U θερμοσταθερή DNA πολυμέραση (KapaTaq). Οι αντιδράσεις έγιναν σε θερμικό κυκλοποιητή MJ Research PTC-100 υπό τις ακόλουθες συνθήκες: ένα αρχικό στάδιο αποδιάταξης στους 95 C για 15 λεπτά ακολουθούμενο από 35 κύκλους: i) αποδιάταξης του DNA στους 95 C για 1 λεπτό, ii) υβριδισμού των εκκινητών στη μήτρα DNA στους 59 C για 1 λεπτό και iii) επέκτασης των νουκλεοτιδικών αλυσίδων στους 72 C για 2 λεπτά δευτερόλεπτα. Το πρόγραμμα τελείωσε με ένα τελευταίο βήμα επέκτασης των αλυσίδων DNA στους 72 C για 9 λεπτά. Τα προϊόντα PCR διαχωρίστηκαν με ηλεκτροφόρηση στα 110V σε πήκτωμα Εικ.1: Εκκινητές για την ενίσχυση με PCR καθώς και μοτίβα επανάληψης των μικροδορυφορικών δεικτών που χρησιμοποιήθηκαν στην παρούσα μελέτη. Αλληλούχηση και γενοτύπηση των δειγμάτων Αρχικά αλληλουχήσαμε ορισμένα από τα δείγματα, ώστε να εξετάσουμε κατά πόσον οι εκκινητές ενισχύουν πράγματι μικροδορυφορικές αλληλουχίες και ποιο είναι το ακριβές μοτίβο επανάληψης στο νουκλεοτιδικό επίπεδο. Για το σκοπό αυτό επιλέξαμε 3 δείγματα κλώνων ρίγανης τα οποία μετά την ενίσχυση με PCR αλληλουχήθηκαν χρησιμοποιώντας το ζεύγος εκκινητών OR09. Η αλληλούχιση έγινε από την εταιρεία VBC Biotech (Austria) χρησιμοποιώντας τη συσκευή αλληλούχησης ABI 3730XL (Applied Biosystems). Οι αλληλουχήσεις έγιναν και προς τις δύο κατευθύνσεις χρησιμοποιώντας δηλαδή τόσο τον πρόσθιο (forward) όσο και τον οπίσθιο (reverse) εκκινητή, ώστε να μην έχουμε απώλεια διαβάσματος βάσεων. Η ενοποίηση και η ευθυγράμμιση των νουκλεοτιδικών αλληλουχιών έγινε χρησιμοποιώντας το υπολογιστικό πακέτο προγραμμάτων BioEdit. 66

3 H γενοτύπηση των δειγμάτων έγινε χρησιμοποιώντας εκκινητές σημασμένους με ειδικές χρωστικές φθορισμού (FAM, HEX, ROX, TAMRA). Η ηλεκτροφόρηση των θραυσμάτων μετά από τις αντιδράσεις PCR έγινε στη συσκευή αλληλούχησης ΑΒΙ 3500 (Applied Biosystems) και ο καθορισμός του μεγέθους τους δηλαδή η διάκριση των διαφορετικών αλληλομόρφων κάθε μικροδορυφορικού γενετικού τόπου πραγματοποιήθηκε με το υπολογιστικό πρόγραμμα STRand Εικ. 3: PCR αντιδράσεις συγκεριμένων δειγματων φυτών ρίγανης μετά από αντίδρασεις PCR με τους εκκινητές OR09, OR10, OR12. Μετά την αλληλούχηση επιλεγμένων δειγμάτων πήραμε ενδεικτικά τα εξής αποτελέσματα (Εικόνα 4). Στατιστική Ανάλυση Για τον υπολογισμό του αριθμού των αλληλομόρφων ανά γενετικό τόπο, του δείκτη ποικιλότητας του Shannon (Ι), ο οποίος μάλιστα δεν προϋποθέτει ισορροπία του πληθυσμού κατά Hardy-Weinberg (Lewontin 1972) και των συντελεστών γενετικής απόστασης (Nei 1972) χρησιμοποιήθηκε το πρόγραμμα POPGENE Η ανάλυση κύριων συντεταγμένων (PCoA) πραγματοποιήθηκε με το πρόγραμμα Genalex Οι τιμές των συντελεστών γενετικής απόστασης κατά Nei (1972) χρησιμοποιήθηκαν για την κατασκευή δενδρογράμματος UPGMA με το πρόγραμμα TFPGA ver ΑΠΟΤΕΛΕΣΜΑΤΑ Με βάση τα προκαταρκτικά αποτελέσματα επιλέχθηκε για τη συνέχεια ως μέθοδος απομόνωσης DNA το κιτ Macherey- Nagel (Εικόνα 2) αφού μας έδινε τα καλύτερα αποτελέσματα ως προς την καθαρότητα και την ακεραιότητα του απομονωθέντος DNA. Εικόνα 4: Νουκλεοτιδική αλληλουχία του μικροδορυφορικού δείκτη OR09 σε άτομο ρίγανης. Στη συνέχεια αφού έγινε η ενοποίηση και ευθυγραμμίση (alignment) των αλληλουχιών DNA που προέκυψαν τόσο με τον πρόσθιο όσο και με τον οπίσθιο εκκινητή χρησιμοποιώντας το υπολογιστικό πακέτο προγραμμάτων BioEdit, προέκυψαν οι πλήρεις αλληλουχίες που εμφανίζονται στην επόμενη εικόνα. Εικ. 2: Ηλεκτροφόρηση δείγματων DNA ρίγανης (Macherey- Nagel) σε πήκτωμα αγαρόζης. Οι δειγματοληπτικές αντιδράσεις PCR χρησιμοποιώντας ορισμένα δείγματα ρίγανης και ζεύγη εκκινητών έδωσαν τα αναμενόμενα αποτελέσματα ως προς το μέγεθος και τον αριθμό των ζωνών όπως φαίνεται στην επόμενη εικόνα. Εικ. 5: Σύγκριση της πλήρους αλληλουχίας του μικροδορυφορικού δείκτη OR09 σε τρία δείγματα φυτών ρίγανης. Όπως παρατηρούμε στην εικόνα 5 δεν υπάρχουν διαφορές σε νουκλεοτιδικό επίπεδο μεταξύ των τριών ατόμων για το μικροδορυφορικό δείκτη OR09. Επίσης το μοτίβο επανάληψης προσομοιάζει με την εργασία των Novak et al. (2008). Η γενοτύπηση των δειγμάτων με βάση τα δώδεκα ζεύγη μικροδορυφορικών εκκινητών που χρησιμοποιήθηκαν στην παρούσα έρευνα αποκάλυψε την ύπαρξη διαφορετικών 67

4 αλληλομόρφων σε κάθε γενετικό τόπο. Στις επόμενες εικόνες παρατίθενται οι γενότυποι που προέκυψαν για ορισμένους μικροδορυφορικούς δείκτες σε συγκεκριμένα άτομα: επιτρέπουν το πλήρη διαχωρισμό τους και την απόλυτη ταυτοποίησή τους. Ο αριθμός των αλληλομόρφων ανά γενετικό τόπο και ο δείκτης ποικιλότητας του Shannon (Ι) παρουσιάζονται στον επόμενο πίνακα. Εικ. 6: Ομοζυγωτικό άτομο του δείγματος 1 ως προς το αλληλόμορφο 144 του εκκινητή OR09. Οι συντελεστές γενετικής απόστασης κυμαίνονται από 0 (μεταξύ 12 και 16) έως 1,79 (μεταξύ των δειγμάτων 11 και 15 με το δείγμα 24). Εικ. 7: Ετεροζυγωτικό άτομο του δείγματος 17 ως προς τα αλληλόμορφα 115 και 117 του εκκινητή OR12. Οι γενότυποι όλων των ατόμων σε όλους τους γενετικούς τόπους εμφανίζονται στον επόμενο πίνακα: Πίνακας: Συντελεστές γενετικής απόστασης D κατά Nei (1972). Η ανάλυση κυρίων συντεταγμένων (PCoA) έδειξε ότι τα δείγματα που αναλύθηκαν ομαδοποιούνται κυρίως σε τρεις μεγάλες ομάδες. Η μία περιλαμβάνει τρία δείγματα O. onites, στα δεξιά της Εικόνας 8, ενώ η μεγάλη ομάδα αριστερά της ίδιας εικόνας περιλαμβάνει δείγματα O. vulgare. Τέλος η μικρότερη ομάδα, περιλαμβάνει δείγματα O. vulgare και O. marjoram. Είναι εμφανές ότι εκτός από τα άτομα 12 και 16 τα οποία εμφανίζουν τον ίδιο γενότυπο και δεν μπορούν να διακριθούν στα υπόλοιπα υπάρχουν αρκετοί διαγνωστικοί δείκτες που 68

5 2013, όπου αναφέρονται οι κωδικοί 3,4,5,6,7 και 8, οι οποίοι αντιστοιχούν στους 15,22,12,19,25 και 20 της παρούσας εργασίας). Αντίστοιχη ομαδοποίηση προκύπτει για τους γενότυπους αυτούς και με βάση τους μοριακούς δείκτες SSR Εικ. 8 Ανάλυση κυρίων συντεταγμένων PCoA με βάση τους μοριακούς δείκτες Παρόμοια ομαδοποίηση εμφανίζεται και στο δενδρογράμμα UPGMA με βάση το συντελεστή γενετικής απόστασης του Nei (1972). Εικ. 11:. Aνάλυση κυρίων συντεταγμένων (PCoA) με βάση τη χρήση δεικτών SSR. Με βάση τη γενοτυπική σύσταση είναι εύκολο να διακριθούν οι γενότυποι αυτοί μεταξύ τους καθώς έχουν προκύψει αρκετοί διαγνωστικοί δείκτες με διακριτά διαγνωστικά πρότυπα που τους διαχωρίζουν. Για να πραγματοποιηθεί όμως απόλυτη διάκριση με το σύνολο των δειγμάτων που αναλύθηκαν θα χρειαστεί να αναλυθούν περισσότεροι ή και διαφορετικού τύπου μοριακοί δείκτες οι οποίοι ενισχύουν αλληλουχίες με μεγαλύτερη ποικιλότητα σε πιο εκτεταμένες περιοχές του γονιδιώματος. Ει.κ 9: Δενδρόγραμμα UPGMA με βάση το συντελεστή γενετικής απόστασης κατά Nei (1972). Στη συνέχεια έγινε ανάλυση κυρίων συντεταγμένων (PCoA) τόσο με βάση τη σύσταση του ριγανελαίου όσο και με βάση τα αποτελέσματα της μοριακής ανάλυσης με δείκτες SSR σε συγκεκριμένους γενοτύπους που παρουσίαζαν μεγάλο ενδιαφέρον από πλευράς χημικής σύστασης και αντιμικροβιακών ιδιοτήτων του ριγανέλαιου. Η ανάλυση PCoA με βαση τα χημειοτυπικά χαρακτηριστικά επίσης έδειξε ότι οι γενότυποι ομαδοποιούνται κυρίως σε τρεις ομάδες. ΣΥΖΗΤΗΣΗ Δεδομένα που παρουσιάστηκαν σε προηγούμενες αναφορές της ερευνητικής μας ομάδας, αποδεικνύουν ότι ριγανέλαιο απο τα δείγματα 1, 15 και 20 μπορεί να μειώσει τη δράση βακτηριακών στελεχών της ομάδας Vibrio και επομένως να χρησιμοποιηθεί στην απολύμανση τροχοζώων Brachionus plicatilis που χρησιμοποιούνται ως ζωντανή τροφή σε ψάρια [8], [9]. Στη παρούσα μελέτη πραγματοποιήθηκε μοριακή αναλυση 25 γενοτύπων ρίγανης με χρήση μικροδορυφορικών DNA δεικτών (SSRs). Με βάση αυτοί οι γενότυποι ομαδοποιήθηκαν σε τρεις κύριες ομάδες και προέκυψαν αρκετοί διαγνωστικοί δείκτες οι οποίοι διαχωρίζουν τα δέιγματα αυτά μεταξύ τους. Για ορισμένους από τους γενοτύπους αυτούς συσχετίσθηκαν οι χημειοτυπικές αναλύσεις με την ανάλυση μοριακών δεικτών και προέκυψαν παρόμοιες ομαδοποιήσεις. Χρειάζονται περισσότερες αναλύσεις προκειμένου να βρεθούν μοναδικά DNA προφίλ για τη ταυτοποίηση των συγκεκριμένων δειγμάτων που παρουσιάζουν μεγαλύτερο ενδιαφέρον. Εικ. 10: Aνάλυση κυρίων συντεταγμένων (PCoA) με βάση τη σύσταση του ριγανελαίου (προσαρμογή απο Stefanakis et al ΕΥΧΑΡΙΣΤΙΕΣ 69

6 H παρούσα έρευνα έχει συγχρηματοδοτηθεί από την Ευρωπαϊκή Ένωση (Ευρωπαϊκό Κοινωνικό Ταμείο - ΕΚΤ) και από εθνικούς πόρους μέσω του Επιχειρησιακού Προγράμματος «Εκπαίδευση και Δια Βίου Μάθηση» του Εθνικού Στρατηγικού Πλαισίου Αναφοράς (ΕΣΠΑ) Ερευνητικό Χρηματοδοτούμενο Έργο: ΑΡΧΙΜΗΔΗΣ ΙΙΙ. Επένδυση στην κοινωνία της γνώσης μέσω του Ευρωπαϊκού Κοινωνικού Ταμείου. ΒΙΒΛΙΟΓΡΑΦΙΚΕΣ ΑΝΑΦΟΡΕΣ [1] Vokou D. et. al. (1993). Geographic Variation of Greek Oregano (Origanum vulgare ssp. hirtum) Essential Oils. Biochemical Systematics and Ecology, 21: [2] Kokkini, S. et. al. (1993). The Hybrid Origanum intercedens from the Island of Nisyros (SE Greece) and its Parental Taxa; Comparative Study of Essential Oils and Distribution. Biochemica/Systematics and Ecology, 21: [3] Sivropoulou A. et. al. (1996) Antimicrobial and Cytotoxic Activities of Origanum Essential Oils. J. Agric. Food Chem. 44: [4] Kokkini, S. et. al. (2004). Essential Oil Composition of Greek (Origanumvulgare ssp. hirtum) and Turkish (0. onites) Oregano :a Tool for Their Distinction. J. Essent. Oil Res., 16: [5] Burt SA and Reinders RD. (2003). Antibacterial activity of selected plant essential oils against Escherichia coli O157:H7. Lett Appl Microbiol. 36: [6] Dorman HJ and Deans SG (2000).Antimicrobial agents from plants: antibacterial activity of plant volatile oils. J Appl Microbiol.88: [7] Claire Yew, Y.C. (2008). Improving aquaculture production through better health and disease prevention the natural way. Feed technology update. Vo.3. Iss.1 [8] Stefanakis M.K, Touloupakis E., Anastassopoulos E., Ghanotakis D., Katerinopoulos H.E., Makridis P. (2013). Antibacterial activity of essential oils from plants of the genus Origanum. Food Control 34: [9] Stefanakis, M. K., Anastasopoulos, E., Katerinopoulos, H. E., & Makridis, P. (2014). Use of essential oils extracted from three Origanum species for disinfection of cultured rotifers (Brachionus plicatilis). Aquaculture Research, 45(11), [10] Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12: [11] Novak, J., Lukas, B., Bolzer, K., Grausgruber-Gröger, S., & Degenhardt, J. (2008). Identification and characterization of simple sequence repeat markers from a glandular origanum vulgare expressed sequence tag. Molecular Ecology Resources, 8(3), [12] Nei M. Interspecific gene differences and evolutionary time estimated from electrophoretic data on protein identity. Amer. Naturalist 105:385-98,

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

Μελέτη της χρήσης αποσταγμάτων επιλεγμένων φυτών ρίγανης στη διατροφή ψαριών με στόχο την μείωση του μικροβιακού φορτίου της τροφής τους (ζωοπλακτόν).

Μελέτη της χρήσης αποσταγμάτων επιλεγμένων φυτών ρίγανης στη διατροφή ψαριών με στόχο την μείωση του μικροβιακού φορτίου της τροφής τους (ζωοπλακτόν). Μελέτη της χρήσης αποσταγμάτων επιλεγμένων φυτών ρίγανης στη διατροφή ψαριών με στόχο την μείωση του μικροβιακού φορτίου της τροφής τους (ζωοπλακτόν). Μιχάλης Κ. Στεφανάκης, Γιώργος Τσικαλάς, Ελευθέριος

Διαβάστε περισσότερα

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR)

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) Α. ΘΕΩΡΗΤΙΚΟ ΜΕΡΟΣ Σταμάτης Κουσίσης, Δημοσθένης Κίζης, Δήμητρα Χούχουλα Βασική αρχή της Αλυσιδωτής Αντίδρασης της Πολυμεράσης

Διαβάστε περισσότερα

ΣΥΝΑΝΤΗΣΗΣ ΤΟΥ ΕΡΓΟΥ 12CHN409

ΣΥΝΑΝΤΗΣΗΣ ΤΟΥ ΕΡΓΟΥ 12CHN409 ΠΡΑΚΤΙΚΑ 4 ης ΣΥΝΑΝΤΗΣΗΣ ΤΟΥ ΕΡΓΟΥ 12CHN409 Βιολογικά ενεργά αιθέρια έλαια και άλλες ευεργετικές για την υγεία ουσίες από Ελληνικά και Κινέζικα ενδημικά φυτά - Bioactive essential oils and other beneficial

Διαβάστε περισσότερα

ΑΔΑ: ΒΙΞ446914Γ-ΧΡΖ. Βαθμός Ασφαλείας. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων. Μεγ.

ΑΔΑ: ΒΙΞ446914Γ-ΧΡΖ. Βαθμός Ασφαλείας. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων. Μεγ. ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Α. Ντούλης, Ινστιτούτο Αμπέλου, Λαχανοκομίας & Ανθοκομίας Ηρακλείου (ΙΑΛΑΗ), Εθνικό Ίδρυμα Αγροτικών Ερευνών (ΕΘΙΑΓΕ) και

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp.

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. 5 ο Πανελλήνιο Συνέδριο Ιατρικής Βιοπαθολογίας Η εφαρμογή μοριακών

Διαβάστε περισσότερα

Αϖοµόνωση και γενετική διαφοροϖοίηση ϖληθυσµών του ζαρκαδιού (Capreoluscapreolus) στην Ελλάδα νέα δεδοµένα για αϖοτελεσµατικότερη διαχείριση και διατήρηση ηµήτρης Τσαϖάρης Παναγιώτης Κασαϖίδης Κωνσταντίνος

Διαβάστε περισσότερα

Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa.

Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa. Αρχές PCR και υβριδισμού Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa.gr Ιστορικά στοιχεία Πρώτη αναφορά in vitro ενζυματικής αντίδρασης

Διαβάστε περισσότερα

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 1 Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης, Ηράκλειο Κρήτης. 2 Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 Department of Biology, Faculty of Science, Dokuz

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Δρ. Νικόλας Παπανικολάου Υπεύθυνος παρακολούθησης: Δρ. Αντρέας Ντούλης

Δρ. Νικόλας Παπανικολάου Υπεύθυνος παρακολούθησης: Δρ. Αντρέας Ντούλης Δρ. Νικόλας Παπανικολάου Υπεύθυνος παρακολούθησης: Δρ. Αντρέας Ντούλης Κίνητρο έργου Στο πεδίο της αγροτικής έρευνας στην Ελλάδα υπάρχει μεγάλη ποσότητα δεδομένων (μοριακών, μορφολογικών, αγρονομικών,

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ 2η έκδοση βιολογία Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ περιεχόμενα Κεφάλαιο 1 Το γενετικό υλικό...13 Κεφάλαιο 2 Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας... 65 Κεφάλαιο 3 Ιοί...127

Διαβάστε περισσότερα

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΓΙΑ ΥΠΟΒΟΛΗ ΠΡΟΤΑΣΕΩΝ ΠΡΟΣ ΣΥΝΑΨΗ ΣΥΜΒΑΣΕΩΝ ΜΙΣΘΩΣΗΣ ΕΡΓΟΥ

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΓΙΑ ΥΠΟΒΟΛΗ ΠΡΟΤΑΣΕΩΝ ΠΡΟΣ ΣΥΝΑΨΗ ΣΥΜΒΑΣΕΩΝ ΜΙΣΘΩΣΗΣ ΕΡΓΟΥ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΛΑΡΙΣΑΣ ΕΠΙΤΡΟΠΗ ΕΚΠΑΙΔΕΥΣΗΣ & ΕΡΕΥΝΩΝ Περιφερειακή Οδός Λάρισας Τρικάλων, Τ.Κ. 41110 Τηλ.: 2410 684 713 Πληροφορίες: κα. Ε. Κοτίτσα Λάρισα 18-09-2012

Διαβάστε περισσότερα

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Γενετική δομή και πρότυπα διαφοροποίησης των πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Δημήτρης Τσαπάρης Jacob Fric Αθήνα, Οκτώβριος 2012 Jon

Διαβάστε περισσότερα

ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΤΕΥΘΥΝΣΗ: ΖΩΪΚΗΣ ΠΑΡΑΓΩΓΗΣ Η ΤΕΧΝΙΚΗ ΤΗΣ PCR ΣΤΗ

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ

ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ Β43Θ46ΨΖ2Ν-ΛΘΜ ANAΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΕΘΝΙΚΟ ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ Αθήνα, 26/10/2012 ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΓΙΑ ΥΠΟΒΟΛΗ ΠΡΟΤΑΣΗΣ ΓΙΑ ΚΑΤΑΡΤΙΣΗ

Διαβάστε περισσότερα

Οδηγίες χρήσης για το CRC RAScan Combination Kit KRAS and NRAS Exons 2, 3 & 4 CE IVD για τα συστήματα DHPLC

Οδηγίες χρήσης για το CRC RAScan Combination Kit KRAS and NRAS Exons 2, 3 & 4 CE IVD για τα συστήματα DHPLC 1 Κατασκευαστής Οδηγίες χρήσης για το CRC RAScan Combination Kit KRAS and NRAS Exons 2, 3 & 4 CE IVD για τα συστήματα DHPLC ιαβάστε προσεκτικά αυτές τις οδηγίες χρήσης προτού χρησιμοποιήσετε αυτό το προϊόν.

Διαβάστε περισσότερα

Μέρος 5 ο. Γονιδιακοί δείκτες

Μέρος 5 ο. Γονιδιακοί δείκτες Μέρος 5 ο Γονιδιακοί δείκτες R.C. Lewontin 1966 K.B. Mullis 1983 Εισαγωγή στη δασική γενετική Γονιδιακοί δείκτες Όπως είδαµε στα προηγούµενα κεφάλαια, η γενετική πληροφορία είναι οργανωµένη πάνω σε µια

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων Dr. Παναγιώτης Μαδέσης pmadesis@certh.gr Ι. Γανόπουλος,

Διαβάστε περισσότερα

ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ

ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΠΙΤΡΟΠΗ ΕΚΠΑΙΔΕΥΣΗΣ & ΕΡΕΥΝΩΝ ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ ΕΠΙΧΕΙΡΗΣΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΕΚΠΑΙΔΕΥΣΗ ΚΑΙ ΔΙΑ ΒΙΟΥ

Διαβάστε περισσότερα

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum).

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Μεντελική γενετική Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Φαινότυπος και Γονότυπος Η φυσική εκδήλωση (φαινότυπος) της γενετικής σύστασης (γονότυπος) επηρεάζεται από τις αλληλεπιδράσεις με άλλα

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.18 Ενημέρωση με τα στοιχεία από τα ευρήματα της έρευνας για τη δραστηριότητα

Διαβάστε περισσότερα

ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ

ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΙΑΣ ΕΠΙΤΡΟΠΗ ΕΚΠΑΙΔΕΥΣΗΣ & ΕΡΕΥΝΩΝ ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ ΕΠΙΧΕΙΡΗΣΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΕΚΠΑΙΔΕΥΣΗ ΚΑΙ ΔΙΑ ΒΙΟΥ

Διαβάστε περισσότερα

Κωνσταντίνος Στεφανίδης

Κωνσταντίνος Στεφανίδης ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ - ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΑΣ ΦΥΤΩΝ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΟΙΚΟΛΟΓΙΑ-ΔΙΑΧΕΙΡΙΣΗ & ΠΡΟΣΤΑΣΙΑ ΦΥΣΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Διατριβή Μεταπτυχιακού Διπλώματος Ειδίκευσης Οικολογική

Διαβάστε περισσότερα

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών ΓΕΩΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Δράμα, 10 και 11

Διαβάστε περισσότερα

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Eφη Πετεινάκη ΠΡΟΒΛΗΜΑΤΑ ΡΟΥΤΙΝΑΣ ΕΝΟΣ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ταυτοποίηση κάποιων βακτηρίων ο έλεγχος ευαισθησίας διάγνωση λοιμώξεων από μικροοργανισμούς

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.)

Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.) Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.) Δρ Ελένη Μαλούπα, Τακτική Ερευνήτρια ΕΘΙΑΓΕ Fritilaria pontica Εργαστήριο Προστασίας και Αξιοποίησης Αυτοφυών

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Η ΧΡΗΣΗ ΤΗΣ REAL TIME PCR (RT- PCR) ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΩΝ ΣΤΕΛΕΧΩΝ ΒΑΚΤΗΡΙΟΥ

Διαβάστε περισσότερα

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες IΣTOΛOΓIA H ιστολογία κλάδος της ιατρικής που µελετά > υφή βιολογικού υλικού και τους τρόπους που τα επιµέρους συστατικά στοιχεία σχετίζονται µεταξύ τους δοµικά & λειτουργικά Tα δείγµατα του βιολογικού

Διαβάστε περισσότερα

ΠΡΟΣΚΛΗΣΗ ΕΝΔΙΑΦΕΡΟΝΤΟΣ KAI ΚΑΤΑΘΕΣΗΣ ΠΡΟΣΦΟΡΩΝ ΓΙΑ ΤΗΝ ΠΡΟΜΗΘΕΙΑ ΑΝΑΛΩΣΙΜΩΝ: «Προμήθεια αναλωσίμων εργαστηρίου»

ΠΡΟΣΚΛΗΣΗ ΕΝΔΙΑΦΕΡΟΝΤΟΣ KAI ΚΑΤΑΘΕΣΗΣ ΠΡΟΣΦΟΡΩΝ ΓΙΑ ΤΗΝ ΠΡΟΜΗΘΕΙΑ ΑΝΑΛΩΣΙΜΩΝ: «Προμήθεια αναλωσίμων εργαστηρίου» ΕΘΝΙΚΟ ΚΕΝΤΡΟ ΕΡΕΥΝΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΑΝΑΠΤΥΞΗΣ (Ε.Κ.Ε.Τ.Α.) ΙΝΣΤΙΤΟΥΤΟ ΕΡΕΥΝΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΘΕΣΣΑΛΙΑΣ (ΙΕΤΕΘ) Τομέας Κινησιολογίας Δημητριάδος 95& Π. Μελά 3ος όροφος Τ.Κ. 38333 Βόλος ΠΡΟΣΚΛΗΣΗ ΕΝΔΙΑΦΕΡΟΝΤΟΣ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Γιατί είναι σημαντική η Βιοποικιλότητα;

Γιατί είναι σημαντική η Βιοποικιλότητα; Γενετική Διαχείριση Ο όρος βιοποικιλότητα αναφέρεται σε όλους τους διαφορετικούς οργανισμούς του πλανήτη μας και περιλαμβάνει τόσο την ποικιλότητα σε επίπεδο ειδών, όσο και τη γενετική ποικιλότητα. Γιατί

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

ΕΝΖΥΜΙΚΗ ΑΠΟΙΚΟΔΟΜΗΣΗ ΧΛΩΡΟΠΡΟΠΑΝΟΛΩΝ ΑΠΟ ΤΟ ΒΑΚΤΗΡΙΟ PSEUDOMONAS PUTIDA DSM437

ΕΝΖΥΜΙΚΗ ΑΠΟΙΚΟΔΟΜΗΣΗ ΧΛΩΡΟΠΡΟΠΑΝΟΛΩΝ ΑΠΟ ΤΟ ΒΑΚΤΗΡΙΟ PSEUDOMONAS PUTIDA DSM437 1 ο ΠΑΝΕΛΛΗΝΙΟ ΕΠΙΣΤΗΜΟΝΙΚΟ ΣΥΝΕΔΡΙΟ ΧΗΜΙΚΗΣ ΜΗΧΑΝΙΚΗΣ, ΠΑΤΡΑ, 4-6 ΙΟΥΝΙΟΥ, 215. ΕΝΖΥΜΙΚΗ ΑΠΟΙΚΟΔΟΜΗΣΗ ΧΛΩΡΟΠΡΟΠΑΝΟΛΩΝ ΑΠΟ ΤΟ ΒΑΚΤΗΡΙΟ PSEUDOMONAS PUTIDA DSM437 Κ. Κόντη, Δ. Μαμμά, Δ. Κέκος Σχολή Χημικών

Διαβάστε περισσότερα

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων Λάρισα 02/10/2013 Προκήρυξη Αριθμός Πρωτοκόλλου: 4292/3-7-2013 ΑΞΙΟΛΟΓΙΚΟΣ ΠΙΝΑΚΑΣ - Τομέας: Ενιαίος Μικροβιολογία (Εργαστήριο)

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΑΡΩΜΑΤΙΚΩΝ ΦΥΤΩΝ ΤΗΣ ΟΙΚΟΓΕΝΕΙΑΣ LAMIACEAE ΓΙΑ ΑΠΟΜΟΝΩΣΗ ΔΡΑΣΤΙΚΩΝ ΑΝΤΙΟΞΕΙΔΩΤΙΚΩΝ ΚΛΑΣΜΑΤΩΝ ΚΑΙ ΕΦΑΡΜΟΓΗ ΤΟΥΣ ΣΕ ΣΥΣΤΗΜΑΤΑ ΤΡΟΦΙΜΩΝ

ΜΕΛΕΤΗ ΑΡΩΜΑΤΙΚΩΝ ΦΥΤΩΝ ΤΗΣ ΟΙΚΟΓΕΝΕΙΑΣ LAMIACEAE ΓΙΑ ΑΠΟΜΟΝΩΣΗ ΔΡΑΣΤΙΚΩΝ ΑΝΤΙΟΞΕΙΔΩΤΙΚΩΝ ΚΛΑΣΜΑΤΩΝ ΚΑΙ ΕΦΑΡΜΟΓΗ ΤΟΥΣ ΣΕ ΣΥΣΤΗΜΑΤΑ ΤΡΟΦΙΜΩΝ ΜΕΛΕΤΗ ΑΡΩΜΑΤΙΚΩΝ ΦΥΤΩΝ ΤΗΣ ΟΙΚΟΓΕΝΕΙΑΣ LAMIACEAE ΓΙΑ ΑΠΟΜΟΝΩΣΗ ΔΡΑΣΤΙΚΩΝ ΑΝΤΙΟΞΕΙΔΩΤΙΚΩΝ ΚΛΑΣΜΑΤΩΝ ΚΑΙ ΕΦΑΡΜΟΓΗ ΤΟΥΣ ΣΕ ΣΥΣΤΗΜΑΤΑ ΤΡΟΦΙΜΩΝ Κ. Μπράβου, Ε. Χουλιτούδη, Α. Μπιμπίλας, Δ. Τσιμογιάννης, Β.

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών

Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Προϋποθέσεις εφαρμογής των μοριακών τεχνικών Α. Μεντής ιαγνωστικό Εργαστήριο Λοιμωδών Νοσημάτων Εθνικό Εργαστήριο Αναφοράς Γρίπης Νοτίου Ελλάδος Εθνικό Εργαστήριο Αναφοράς Ερυθράς/Ιλαράς Ελλάδος, Εθνικό

Διαβάστε περισσότερα

Η χρήση της ελιάς στο Αιγαίο κατά την αρχαιότητα

Η χρήση της ελιάς στο Αιγαίο κατά την αρχαιότητα Η χρήση της ελιάς στο Αιγαίο κατά την αρχαιότητα Μ. Ρούμπου 1, Β. Κυλίκογλου 2, N. Müeller 2 & Ν. Καλογερόπουλος 1 1 Χαροκόπειο Πανεπιστήμιο, Τμήμα Επιστήμης Διατολογίας-Διατροφής, Αθήνα 2 Ε.Κ.Ε.Φ.Ε. Δημόκριτος,Τομέας

Διαβάστε περισσότερα

ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ

ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ Β. Σοφιανοπούλου Ινστιτούτο Βιολογίας, ΕΚΕΦΕ Βιολογικά συστήµατα µελέτης διαµεµβρανικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Δομή του πληθυσμού του σπάνιου και απειλούμενου φυτού Eriolobus trilobatus στο Ν. Έβρου

Δομή του πληθυσμού του σπάνιου και απειλούμενου φυτού Eriolobus trilobatus στο Ν. Έβρου Δομή του πληθυσμού του σπάνιου και απειλούμενου φυτού Eriolobus trilobatus στο Ν. Έβρου Παπαλαζάρου Κ. 1, Μπαλάσκα Κ. 1, Κοράκης Γ. 1, Ποϊραζίδης Κ. 1, Παπαγεωργίου Α.Χ. 1 1 Εργαστήριο Δασικής Γενετικής,

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

ToxPlus. Spin-off εταιρία του Εργαστηρίου Τοξικολογίας Πανεπιστημίου Κρήτης. Επιδοτούμενη από το ΕΣΠΑ (2007 2013)

ToxPlus. Spin-off εταιρία του Εργαστηρίου Τοξικολογίας Πανεπιστημίου Κρήτης. Επιδοτούμενη από το ΕΣΠΑ (2007 2013) KENTΡΟ ΤΟΞΙΚΟΛΟΓΙΑΣ Α.Ε. Επιστημονικό και Τεχνολογικό Πάρκο Κρήτης Step C, N. Πλαστήρα 100, Βασιλικά Βουτών, Τ.Κ. 700 13 Ηράκλειο, Κρήτη www.toxplus.gr ToxPlus Spin-off εταιρία του Εργαστηρίου Τοξικολογίας

Διαβάστε περισσότερα

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο Διάλεξη 2 Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο (Κ. Ματθιόπουλοσ) Τι είναι «είδος»; Μοριακή ταυτοποίηση: είδος, άτομο,, φύλο Πόσο αξίζει μια ομάδα οργανισμών τις προσπάθειες διατήρησής τους Δηλαδή: πόσο

Διαβάστε περισσότερα

Μετάλλαξη και Ανασυνδυασμός

Μετάλλαξη και Ανασυνδυασμός BIOΛOΓIA TΩN MIKPOOPΓANIΣMΩN ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ Μετάλλαξη και Ανασυνδυασμός Μετάλλαξη ή μεταλλαγή είναι οποιαδήποτε κληρονομήσιμη αλλαγή της αλληλουχίας των βάσεων του νουκλεϊκού οξέος, που

Διαβάστε περισσότερα

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ. Κωνσταντίνα - Παρασκευή Σ. Μπαθρέλλου. Βιολόγος

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ. Κωνσταντίνα - Παρασκευή Σ. Μπαθρέλλου. Βιολόγος ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ Κωνσταντίνα - Παρασκευή Σ. Μπαθρέλλου Βιολόγος Ταξινόμηση, κατανομή και αιθέρια έλαια αρωματικών φυτών στους τύπους οικοτόπων

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ 4 Ο Εξάµηνο Ακαδηµαϊκό Έτος 2006-2007

ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ 4 Ο Εξάµηνο Ακαδηµαϊκό Έτος 2006-2007 Το µάθηµα: ΣΥΣΤΗΜΑΤΙΚΗ ΒΟΤΑΝΙΚΗ ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ 4 Ο Εξάµηνο Ακαδηµαϊκό Έτος 2006-2007 1 Η Ι ΑΚΤΙΚΗ ΟΜΑ Α: Στέλλα Κοκκίνη, καθηγήτρια Ρεγγίνα Καρούσου, λέκτορας Σοφία Λαυρεντιάδου, ΕΕ ΙΠ ΙΙ 2 1 ΤΡΟΠΟΙ Ι

Διαβάστε περισσότερα

σπανίων φυλών των ζώων

σπανίων φυλών των ζώων Προβλήματα διατήρησης των σπανίων φυλών των ζώων Problems of conservation of rare breeds of animals Ανεξέλεγκτες διασταυρώσεις στα ποίμνια Μικρό μέγεθος Ελεγχο ομομειξίας μ Αδυναμία κατάταξης των ζώων

Διαβάστε περισσότερα

Διαχείριση Αποβλήτων

Διαχείριση Αποβλήτων ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ Διαχείριση Αποβλήτων Ενότητα 11 : Βιομηχανικά Στερεά και Υγρά Απόβλητα Δρ. Σταυρούλα Τσιτσιφλή Τμήμα Μηχανικών Χωροταξίας, Πολεοδομίας και Περιφερειακής Ανάπτυξης Άδειες Χρήσης Το

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι

Μικροβιολογία Τροφίμων Ι Μικροβιολογία Τροφίμων Ι Ενότητα 9: Αντιμικροβιακά Εμπόδια - Αιθέρια Έλαια, 1.5ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Γεώργιος - Ιωάννης Νύχας Ευστάθιος Πανάγου Μαθησιακοί

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

Σύμφωνα με: Τους Καν. (ΕΚ) 889/2008 & 834/2007

Σύμφωνα με: Τους Καν. (ΕΚ) 889/2008 & 834/2007 ΔΜ 2-2 Γ` ΣΔΠ Σελ. 1 ΦΥΣΙΟΛΟΓΙΚΗ επε. (GR-BIO-02) Π Ρ Ο Δ Ι Α Γ Ρ Α Φ Ε Σ ΒΙΟΛΟΓΙΚΗΣ ΜΕΛΙΣΣΟΚΟΜΙΑΣ Σύμφωνα με: Τους Καν. (ΕΚ) 889/2008 & 834/2007 «Φυσιολογική» επε Εθνικής Αντίστασης 66, Αλεξάνδρεια 59300,,

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) 1 ΔΗΜΙΟΥΡΓΙΑ ΦΥΤΩΝ ΜΕ ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ 19 Παράγοντες που συμβάλλουν σε αύξηση των εντόμων 1. Μονοκαλλιέργειες 2. Βελτίωση με κριτήριο αποκλειστικά την

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Πτυχιακή εργασία ΕΛΕΓΧΟΣ ΓΟΝΙΔΙΑΚΩΝ ΣΥΧΝΟΤΗΤΩΝ ACAA2 ΣΤΟ ΕΞΩΝΙΟ 10 ΣΤΑ ΠΡΟΒΑΤΑ ΧΙΟΥ Μύρια Χατζηκώστα Λεμεσός, 2013

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

ΔΙΕΝΕΡΓΕΙΑ ΣΥΝΟΠΤΙΚΟΥ ΠΡΟΧΕΙΡΟΥ ΜΕΙΟΔΟΤΙΚΟΥ ΔΙΑΓΩΝΙΣΜΟΥ ΓΙΑ ΤΗΝ ΠΡΟΜΗΘΕΙΑ ΑΝΑΛΩΣΙΜΩΝ ΥΛΙΚΩΝ ΕΡΓΑΣΤΗΡΙΟΥ

ΔΙΕΝΕΡΓΕΙΑ ΣΥΝΟΠΤΙΚΟΥ ΠΡΟΧΕΙΡΟΥ ΜΕΙΟΔΟΤΙΚΟΥ ΔΙΑΓΩΝΙΣΜΟΥ ΓΙΑ ΤΗΝ ΠΡΟΜΗΘΕΙΑ ΑΝΑΛΩΣΙΜΩΝ ΥΛΙΚΩΝ ΕΡΓΑΣΤΗΡΙΟΥ ΓΕΝΙΚΗ ΔΙΕΥΘΥΝΣΗ ΑΓΡΟΤΙΚΗΣ ΕΡΕΥΝΑΣ ΙΝΣΤΙΤΟΥΤΟ ΕΛΙΑΣ, ΥΠΟΤΡΟΠΙΚΩΝ ΦΥΤΩΝ &ΑΜΠΕΛΟΥ ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΩΝΙΚΟ ΤΑΜΕΙΟ ΕΠΙΧΕΙΡΗΣΙΑΚΟ ΠΡΟΓΡΑΜΜΑ «ΑΝΤΑΓΩΝΙΣΤΙΚΟΤΗΤΑ ΚΑΙ ΕΠΙΧΕΙΡΗΜΑΤΙΚΟΤΗΤΑ»

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

3021 Οξείδωση του ανθρακενίου σε ανθρακινόνη

3021 Οξείδωση του ανθρακενίου σε ανθρακινόνη Οξείδωση του ανθρακενίου σε ανθρακινόνη Ce(IV)(NH ) (N ) 6 C H CeH 8 N 8 8 C H 8 (78.) (58.) (8.) Βιβλιογραφία Tse-Lok Ho et al., Synthesis 97, 6. Ταξινόµηση Τύποι αντιδράσεων και τάξεις ουσιών Οξείδωση.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΑ ΔΙΑΚΡΙΣΗ ΓΙΑ ΤΗΝ ΑΝΑΠΤΥΞΗ ΚΑΙΝΟΤΟΜΟΥ ΠΡΟΪΌΝΤΟΣ

ΠΑΝΕΛΛΗΝΙΑ ΔΙΑΚΡΙΣΗ ΓΙΑ ΤΗΝ ΑΝΑΠΤΥΞΗ ΚΑΙΝΟΤΟΜΟΥ ΠΡΟΪΌΝΤΟΣ ΠΑΝΕΛΛΗΝΙΑ ΔΙΑΚΡΙΣΗ ΓΙΑ ΤΗΝ ΑΝΑΠΤΥΞΗ ΚΑΙΝΟΤΟΜΟΥ ΠΡΟΪΌΝΤΟΣ Στα πλαίσια του διαγωνισμού Ecotrophelia 2013 που διοργάνωσε ο Σύνδεσμος Ελληνικών Βιομηχανιών Τροφίμων (ΣΕΒΤ) στις 29/7/2013, και ο οποίος αποτελεί

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ 1η ΕΠΙΣΤΗΜΟΝΙΚΗ ΔΙΗΜΕΡΙΔΑ «ΕΛΕΓΧΟΣ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ ΕΦΑΡΜΟΓΕΣ ΣΤΗ ΚΑΘΗΜΕΡΙΝΗ ΠΡΑΞΗ ΔΥΝΑΤΟΤΗΤΕΣ ΠΡΟΟΠΤΙΚΕΣ» ΛΑΜΙΑ 21 22 22 ΟΚΤΩΒΡΙΟΥ 2005 ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ

Διαβάστε περισσότερα

ΕΡΕΥΝΗΤΙΚΑ ΠΡΟΓΡΑΜΜΑΤΑ ΑΡΧΙΜΗΔΗΣ ΕΝΙΣΧΥΣΗ ΕΡΕΥΝΗΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΟ ΤΕΙ ΣΕΡΡΩΝ. Ενέργεια. 2.2.3.στ ΘΕΜΑ ΕΡΕΥΝΑΣ: ΔΙΑΡΘΡΩΣΗ ΠΕΡΙΕΧΟΜΕΝΟΥ ΕΧΡΩΜΩΝ ΕΓΓΡΑΦΩΝ

ΕΡΕΥΝΗΤΙΚΑ ΠΡΟΓΡΑΜΜΑΤΑ ΑΡΧΙΜΗΔΗΣ ΕΝΙΣΧΥΣΗ ΕΡΕΥΝΗΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΟ ΤΕΙ ΣΕΡΡΩΝ. Ενέργεια. 2.2.3.στ ΘΕΜΑ ΕΡΕΥΝΑΣ: ΔΙΑΡΘΡΩΣΗ ΠΕΡΙΕΧΟΜΕΝΟΥ ΕΧΡΩΜΩΝ ΕΓΓΡΑΦΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΣΕΡΡΩΝ Τμήμα ΠΛΗΡΟΦΟΡΙΚΗΣ & ΕΠΙΚΟΙΝΩΝΙΩΝ ΕΡΕΥΝΗΤΙΚΑ ΠΡΟΓΡΑΜΜΑΤΑ ΑΡΧΙΜΗΔΗΣ ΕΝΙΣΧΥΣΗ ΕΡΕΥΝΗΤΙΚΩΝ ΟΜΑΔΩΝ ΣΤΟ ΤΕΙ ΣΕΡΡΩΝ Ενέργεια. 2.2.3.στ ΘΕΜΑ ΕΡΕΥΝΑΣ: ΔΙΑΡΘΡΩΣΗ

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι

Μικροβιολογία Τροφίμων Ι Μικροβιολογία Τροφίμων Ι Ενότητα 11: Εξωγενείς Παράγοντες Θερμοκρασία, 2ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Γεώργιος - Ιωάννης Νύχας Ευστάθιος Πανάγου Μαθησιακοί Στόχοι

Διαβάστε περισσότερα

ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 4. ΓΕΝΕΤΙΚΗ ΠΑΡΑΛΛΑΚΤΙΚΟΤΗΤΑ

ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 4. ΓΕΝΕΤΙΚΗ ΠΑΡΑΛΛΑΚΤΙΚΟΤΗΤΑ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 4. ΓΕΝΕΤΙΚΗ ΠΑΡΑΛΛΑΚΤΙΚΟΤΗΤΑ 1 ΑΡΧΕΣ ΒΕΛΤΙΩΣΗΣ 2 Στόχοι της βελτίωσης Δημιουργία νέων ποικιλιών με βελτιωμένα αγρονομικά χαρακτηριστικά: υψηλότερες αποδόσεις καλύτερη προσαρμοστικότητα και

Διαβάστε περισσότερα

6 CO 2 + 6H 2 O C 6 Η 12 O 6 + 6 O2

6 CO 2 + 6H 2 O C 6 Η 12 O 6 + 6 O2 78 ΠΑΡΑΓΩΓΙΚΟΤΗΤΑ ΥΔΑΤΙΝΩΝ ΟΙΚΟΣΥΣΤΗΜΑΤΩΝ ΦΥΤΙΚΟΙ ΟΡΓΑΝΙΣΜΟΙ (μακροφύκη φυτοπλαγκτόν) ΠΡΩΤΟΓΕΝΕΙΣ ΠAΡΑΓΩΓΟΙ ( μετατρέπουν ανόργανα συστατικά σε οργανικές ενώσεις ) φωτοσύνθεση 6 CO 2 + 6H 2 O C 6 Η 12

Διαβάστε περισσότερα

Ηλεκτροφορητικές Μέθοδοι Διαχωρισμού. Πηκτώματα αγαρόζης / ακρυλαμιδίου

Ηλεκτροφορητικές Μέθοδοι Διαχωρισμού. Πηκτώματα αγαρόζης / ακρυλαμιδίου Ηλεκτροφορητικές Μέθοδοι Διαχωρισμού Πηκτώματα αγαρόζης / ακρυλαμιδίου Ηλεκτροφόρηση Μέθοδος διαχωρισμού και ανάλυσης μορίων DNA, RNA και πρωτεϊνών σύμφωνα με το μέγεθος και το φορτίο τους Η ιδέα να χρησιμοποιηθεί

Διαβάστε περισσότερα

ΔΙΑΘΕΣΗ ΣΤΕΡΕΩΝ ΚΑΙ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΤΟ ΓΕΩΛΟΓΙΚΟ ΠΕΡΙΒΑΛΛΟΝ

ΔΙΑΘΕΣΗ ΣΤΕΡΕΩΝ ΚΑΙ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΤΟ ΓΕΩΛΟΓΙΚΟ ΠΕΡΙΒΑΛΛΟΝ ΔΙΑΘΕΣΗ ΣΤΕΡΕΩΝ ΚΑΙ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΤΟ ΓΕΩΛΟΓΙΚΟ ΠΕΡΙΒΑΛΛΟΝ Ενότητα 9: Υγρά αστικά απόβλητα Διάθεση λυμάτων στο έδαφος (φυσικά συστήματα επεξεργασίας) (Μέρος 1 ο ) Ζαγγανά Ελένη Σχολή : Θετικών Επιστημών

Διαβάστε περισσότερα

Πηγές πληροφόρησης για τη χρήση της ελιάς:

Πηγές πληροφόρησης για τη χρήση της ελιάς: Η χρήση της ελιάς σο στο Αιγαίο κατά την αρχαιότητα Μ. Ρούμπου 1, Β. Κυλίκογλου 2, N. Müeller 2 & Ν. Καλογερόπουλος 1 1 Χαροκόπειο Πανεπιστήμιο, Τμήμα Επιστήμης Διαιτολογίας-Διατροφής, Διατροφής, Αθήνα

Διαβάστε περισσότερα

Αξιολόγηση και εφαρμογή μοριακών μεθόδων για τη διάκριση στελεχών μη-σακχαρομυκήτων από ζυμούμενα γλεύκη

Αξιολόγηση και εφαρμογή μοριακών μεθόδων για τη διάκριση στελεχών μη-σακχαρομυκήτων από ζυμούμενα γλεύκη Αξιολόγηση και εφαρμογή μοριακών μεθόδων για τη διάκριση στελεχών μη-σακχαρομυκήτων από ζυμούμενα γλεύκη Εμμανουέλα Ε. Γυφτογιάννη Γεωπονικό Πανεπιστήμιο Αθηνών Τμήμα Επιστήμης Τροφίμων και Διατροφής του

Διαβάστε περισσότερα

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων Λάρισα 05/09/2013 Προκήρυξη Αριθμός Πρωτοκόλλου: 4292/3-7-2013 ΑΞΙΟΛΟΓΙΚΟΣ ΠΙΝΑΚΑΣ - Τομέας: Ενιαίος Μικροβιολογία (Εργαστήριο)

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Δασική Γενετική Τα πειράματα του Mendel

Δασική Γενετική Τα πειράματα του Mendel Δασική Γενετική Τα πειράματα του Mendel Χειμερινό εξάμηνο 2014-2015 Παράδοξο... Οι απόγονοι μοιάζουν στους γονείς τους Δεν είναι όμως ακριβώς ίδιοι, ούτε με τους γονείς τους, ούτε μεταξύ τους Κληρονομικότητα

Διαβάστε περισσότερα

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ Το πρόγραμμα σπουδών του τμήματος Γεωπονικής Βιοτεχνολογίας πρέπει να ανταποκρίνεται στην εξαγωγή επιστημόνων Γεωπόνων Βιοτεχνολόγων ικανών να μελετούν, να αντιμετωπίζουν και να προτείνουν

Διαβάστε περισσότερα

15PROC003177823 2015-10-16. Fax: 213 204 1838 E-mail: karetou@0304.syzefxis.gov.gr

15PROC003177823 2015-10-16. Fax: 213 204 1838 E-mail: karetou@0304.syzefxis.gov.gr ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ 1 Η ΥΠΕ ΑΤΤΙΚΗΣ Γ.Ν.Α «Ο ΕΥΑΓΓΕΛΙΣΜΟΣ- ΟΦΘΑΛΜΙΑΤΡΕΙΟ ΑΘΗΝΩΝ- ΠΟΛΥΚΛΙΝΙΚΗ» Ν.Π.. ΥΠΗΡΕΣΙΑ: ΙΟΙΚΗΤΙΚΗ ΥΠΟ /ΝΣΗ: ΟΙΚΟΝΟΜΙΚΟΥ ΤΜΗΜΑ: ΟΙΚΟΝΟΜΙΚΟ ΓΡΑΦΕΙΟ: ΠΡΟΜΗΘΕΙΩΝ Πληροφορίες:. Καρέτου

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών Κεφάλαιο 1: Εισαγωγή 1.1 Μικροοργανισμοί, Μικροβιολογία και Μικροβιολόγοι... 19 1.1.1 Μικροοργανισμοί... 19 1.1.2 Μικροβιολογία... 20 1.1.3 Μικροβιολόγοι... 21 1.2 Σύντομη Ιστορική Εξέλιξη της Μικροβιολογίας...

Διαβάστε περισσότερα