07:30 10:30. παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "07:30 10:30. παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση"

Transcript

1 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία και Ώρα εξέτασης: Τρίτη, 26 Μαΐου :30 10:30 ΤΟ ΕΞΕΤΑΣΤΙΚΟ ΟΚΙΜΙΟ ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΟ ΕΚΑ (10) ΣΕΛΙ ΕΣ ΝΑ ΑΠΑΝΤΗΣΕΤΕ ΣΕ ΟΛΕΣ ΤΙΣ ΕΡΩΤΗΣΕΙΣ ΜΕΡΟΣ Α : Αποτελείται από έξι (6) ερωτήσεις των πέντε (5) µονάδων η καθεµιά. 1. Η κυτταρίνη είναι η πιο διαδεδοµένη οργανική ένωση. α. Σε ποια κατηγορία οργανικών ουσιών ανήκει; (Μονάδα 0.5) β. Ποιο είναι το µονοµερές του µορίου της κυτταρίνης; (Μονάδα 0.5) γ. Να εξηγήσετε τη λειτουργία της κυτταρίνης στα φυτικά κύτταρα. (Μονάδα 1) δ. Ποιος είναι ο ρόλος της κυτταρίνης ως συστατικού των τροφών στο πεπτικό σύστηµα του ανθρώπινου οργανισµού; (Μονάδες 2) ε. ύο (2) άλλοι διαδεδοµένοι πολυσακχαρίτες είναι το άµυλο και το γλυκογόνο. Σε ποιο είδος ζωντανών οργανισµών βρίσκεται ο καθένας και ποιος είναι ο κοινός τους ρόλος; (Μονάδα 1) 2. Έγινε προσδιορισµός των οµάδων αίµατος και του παράγοντα Ρέζους (Rhesus) τεσσάρων αδελφιών, µε αριθµό 1 µέχρι 4. Τα αποτελέσµατα του προσδιορισµού φαίνονται στον ακόλουθο πίνακα: παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 1 Έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση 3 Έγινε συγκόλληση εν έγινε συγκόλληση εν έγινε συγκόλληση 4 εν έγινε συγκόλληση εν έγινε συγκόλληση εν έγινε συγκόλληση α. Να ονοµάσετε τις οµάδες αίµατος των τεσσάρων παιδιών. (Μονάδες 2) β. Ποιο παιδί µπορεί να χαρακτηριστεί πανδότης και ποιο πανδέκτης; (Μονάδα 1) γ. Να γράψετε δύο (2) διαφορές µεταξύ ερυθρών και λευκών αιµοσφαιρίων. (Μονάδες 2)

2 3. Η εικόνα που ακολουθεί απεικονίζει φάσεις του κυτταρικού κύκλου. Α Β Γ α. Ποιο είδος κυτταρικής διαίρεσης απεικονίζεται; (Μονάδα 0.5) β. Πόσα χρωµατοσώµατα περιέχονται στα σωµατικά κύτταρα του οργανισµού αυτού; (Μονάδα 0.5) γ. Να ονοµάσετε τις φάσεις Α µέχρι Ε του κυτταρικού κύκλου που απεικονίζονται και να τις γράψετε µε τη σωστή σειρά που γίνονται. (Μονάδες 2.5) δ. Να αναφέρετε δύο (2) ρόλους της πιο πάνω κυτταρικής διαίρεσης στον ανθρώπινο οργανισµό. (Μονάδα 1) ε. Να γράψετε µια (1) διαφορά ανάµεσα στο DNA και το RNA. (Μονάδα 0.5) Ε 4. ίνονται οι ακόλουθες γενετικές παθήσεις: αλφισµός, σύνδροµο Klinefelter, σύνδροµο Down, β- θαλασσαιµία, σύνδροµο Turner. α. Ποια από αυτές οφείλεται σε αλλαγή του αριθµού αυτοσωµατικών χρωµατοσωµάτων; (Μονάδα 0.5) β. Ποιες οφείλονται σε αλλαγή του αριθµού των φυλετικών χρωµατοσωµάτων; (Μονάδα 1) γ. Να αναφέρετε δύο (2) χαρακτηριστικά συµπτώµατα για την κάθε µια από τις πιο κάτω γενετικές παθήσεις: i. σύνδροµο Down ii. β-θαλασσαιµία (Μονάδες 2) δ. Ποιες από τις πέντε (5) πιο πάνω γενετικές παθήσεις µπορούν να διαγνωσθούν µε τη µελέτη του καρυότυπου; (Μονάδες 1.5) 2

3 5. Η πενικιλίνη είναι αναστολέας του ενζύµου του οποίου η δοµή φαίνεται στην πιο κάτω εικόνα. Το ένζυµο αυτό βοηθά στην κατασκευή της µεµβράνης κάποιων βακτηρίων. α. Να ονοµάσετε τις δύο (2) δευτεροταγείς δοµές που υποδηλώνουν τα γράµµατα Α και Β και τους δεσµούς που συµβάλλουν στην κατασκευή τους. (Μονάδες 1.5) β. Να ονοµάσετε δύο (2) άλλους τύπους δεσµών που συµβάλλουν στην τριτοταγή δοµή µιας πρωτεΐνης. (Μονάδα 1) γ. Αν θεωρήσουµε ότι η πενικιλίνη είναι µόνιµος αναστολέας του ενζύµου, σε ποια περιοχή του ενζύµου προσδένεται; (Μονάδα 0.5) δ. Αν αφαιρέσουµε τη φλούδα από ένα µήλο, µετά από λίγη ώρα χάνει το φυσικό χρώµα της σάρκας του και γίνεται καφέ. Η αλλαγή χρώµατος οφείλεται σε ένα ένζυµο που περιέχεται στο µήλο. Να εξηγήσετε γιατί αν προσθέσουµε χυµό λεµονιού, πάνω στη σάρκα του µήλου, αυτή δε θα αλλάξει χρώµα. Ο χυµός λεµονιού έχει πολύ χαµηλό pη. (Μονάδες 2) 3

4 6. Η εικόνα που ακολουθεί απεικονίζει την κυτταρική µεµβράνη ενός ζωικού κυττάρου. B A Γ α. Τι παριστάνουν τα γράµµατα Α µέχρι ; (Μονάδα 1) β. Να γράψετε το ρόλο του µορίου σε σχέση µε τη λειτουργικότητα της κυτταρικής µεµβράνης. (Μονάδα 1) γ. Η χρήση του φυσιολογικού ορρού είναι πολύ συνηθισµένη πρακτική στην ιατρική. Ο φυσιολογικός ορρός περιέχει διάλυµα 0.9% χλωριούχου νατρίου. Θα µπορούσαµε, στην ιατρική, να χρησιµοποιήσουµε διάλυµα 0.5% χλωριούχου νατρίου αντί διάλυµα 0.9% χλωριούχου νατρίου; Να αιτιολογήσετε την απάντησή σας. (Μονάδες 2) δ. Να ονοµάσετε δύο (2) άλλες σηµαντικές λειτουργίες που εκτελούν οι διαµεµβρανικές πρωτεΐνες της κυτταρικής µεµβράνης, εκτός από τη µεταφορά ουσιών. (Μονάδα 1) 4

5 ΜΕΡΟΣ Β : Αποτελείται από τέσσερις (4) ερωτήσεις των δέκα (10) µονάδων η καθεµιά. 1. Να µελετήσετε, προσεκτικά, την πιο κάτω εικόνα και να απαντήσετε στα ερωτήµατα που ακολουθούν. α. Να ονοµάσετε τη διαδικασία που παριστάνεται στην πιο πάνω εικόνα. (Μονάδα 1) β. Να γράψετε τρία (3) τελικά προϊόντα της διαδικασίας της εικόνας. (Μονάδες 1.5) γ. Να περιγράψετε τη φωτόλυση του νερού και το ρόλο του κάθε προϊόντος της φωτόλυσης. (Μονάδες 2.5) δ. Να περιγράψετε τη βασική δοµή ενός φωτοσυστήµατος. (Μονάδες 1.5) ε. Μια πατατοκαλλιέργεια ποτίστηκε µε νερό που περιείχε βαρέα µέταλλα. Να προβλέψετε πώς θα επηρεαστεί ο ρυθµός της φωτοσύνθεσης των φυτών της πιο πάνω καλλιέργειας. Να αιτιολογήσετε την απάντησή σας. (Μονάδες 1.5) στ. Να γράψετε δύο (2) λόγους που να αποδεικνύουν την τεράστια σηµασία που έχει η φωτοσύνθεση για το γήινο οικοσύστηµα. (Μονάδες 2) 5

6 2. Στην ακόλουθη εικόνα απεικονίζεται η διαδικασία της κυτταρικής αναπνοής. α. Να ονοµάσετε τα µόρια Α µέχρι Ε που εµπλέκονται στη διαδικασία της κυτταρικής αναπνοής. (Μονάδες 1.25) β. Για να καταστεί δυνατή η σταδιακή διάσπαση της γλυκόζης στη διαδικασία της γλυκόλυσης, πρέπει το µόριό της, αρχικά να ενεργοποιηθεί. Να γράψετε τον τρόπο µε τον οποίο γίνεται η ενεργοποίησή της και να ονοµάσετε το ένζυµο που συµµετέχει στη διαδικασία αυτή. (Μονάδες 1.25) γ. Να γράψετε το άµεσο και το έµµεσο ενεργειακό κέρδος που προκύπτει από τη γλυκόλυση. (Μονάδες 1.5) δ. Πόσα µόρια ΑΤP παράγονται κατά την τελική οξείδωση για κάθε µόριο ΝΑDH που προέρχεται από τη διαδικασία της γλυκόλυσης; Να αιτιολογήσετε την απάντησή σας. (Μονάδες 1.5) ε. Να γράψετε τα τρία (3) προϊόντα που προκύπτουν από την οξειδωτική αποκαρβοξυλίωση του πυροσταφυλικού οξέος. (Μονάδες 1.5) στ. Κατά τη διάρκεια έντονης µυϊκής προσπάθειας, τα µυϊκά κύτταρα αναγκάζονται, προσωρινά, να επιλέξουν µια εναλλακτική διαδικασία της κυτταρικής αναπνοής, που συµβολίζεται στην εικόνα µε γράµµα Χ. Η διαδικασία αυτή έχει ως αποτέλεσµα την παραγωγή του µορίου Υ. Να ονοµάσετε τη διαδικασία Χ και το µόριο Υ. (Μονάδα 1) ζ. Να γράψετε δυο διαφορές µεταξύ αερόβιας κυτταρικής αναπνοής και αλκοολικής ζύµωσης. (Μονάδες 2) 6

7 3. Σας δίνεται η πιο κάτω εικόνα. α. Τι αντιπροσωπεύουν οι αριθµοί 1 µέχρι 6; (Μονάδες 1.5) β. Ποιος είναι ο ρόλος των τριχοειδών αιµοφόρων αγγείων; (Μονάδα 1) γ. Γιατί τα τριχοειδή χαρακτηρίζονται ως µη αποτελεσµατικός φραγµός στην ανταλλαγή ουσιών µεταξύ εγκύου και εµβρύου; (Μονάδα 1) δ. Να γράψετε ένα ρόλο των βαλβίδων των φλεβών. (Μονάδα 0.5) ε. Τι ονοµάζουµε αιµατεγκεφαλικό φραγµό; (Μονάδα 1) στ. Να ονοµάσετε τα στάδια του καρδιακού κύκλου και να γράψετε τη συνολική διάρκεια ενός καρδιακού κύκλου (παλµού). (Μονάδες 2) ζ. Να περιγράψετε την πνευµονική (µικρή) κυκλοφορία του αίµατος. (Μονάδες 3) 4. Η ακόλουθη εικόνα δείχνει το γεννητικό σύστηµα του άνδρα. 7

8 α. i. Τι αντιπροσωπεύουν οι αριθµοί 1 µέχρι 9; (Μονάδες 2.25) ii. Οι αριθµοί από το 10 µέχρι το 14 δείχνουν τα στάδια της σπερµατογένεσης που γίνεται µε τη βοήθεια των κυττάρων Sertoli (αρ. 15). Να ονοµάσετε τα κύτταρα µε αριθµούς 10 µέχρι 14. (Μονάδες 1.25) β. i. Να γράψετε το ρόλο των διάµεσων κυττάρων (κύτταρα Leydig). ii. Να γράψετε τρεις (3) ρόλους των κυττάρων Sertoli. (Μονάδες 2) γ. Ποια από τα κύτταρα 10 µέχρι 15 είναι απλοειδή και ποια διπλοειδή; (Μονάδες 1.5) δ. Να αναφέρετε τέσσερις (4) διαφορές µεταξύ σπερµατογένεσης και ωογένεσης. (Μονάδες 2) ε. Να γράψετε δύο (2) ρόλους της ορµόνης τεστοστερόνης στο γεννητικό σύστηµα του άνδρα. (Μονάδα 1) ΜΕΡΟΣ Γ : Αποτελείται από δύο (2) ερωτήσεις των δεκαπέντε (15) µονάδων η καθεµιά. 1. Η κυστική ίνωση είναι µια σοβαρή, δυνητικά θανατηφόρος κληρονοµική ασθένεια, που παρατηρείται στην Κύπρο, µε κύρια συµπτώµατα την παγκρεατική και πνευµονική ανεπάρκεια, µε συχνές λοιµώξεις και ελλιπή φυσική ανάπτυξη. Αφού µελετήσετε το πιο κάτω γενεαλογικό δέντρο να απαντήσετε στα επόµενα ερωτήµατα για τη συγκεκριµένη ασθένεια. 1 2 = φυσιολογική γυναίκα =φυσιολογικός άνδρας = ασθενής γυναίκα α. Πρόκειται για επικρατές ή υπολειπόµενο γονίδιο; Να εξηγήσετε. (Μονάδες 2) β. Οφείλεται σε φυλοσύνδετο ή αυτοσωµατικό παθολογικό γονίδιο; Να δικαιολογήσετε την απάντησή σας. (Μονάδες 2) γ. Να γράψετε τους γονότυπους των ατόµων 2 και 8. (Μονάδα 1) δ. Από τη διασταύρωση των ατόµων 4 και 5 γεννήθηκε αργότερα και ένα τέταρτο παιδί µε κυστική ίνωση. Να κάνετε τη σχετική διασταύρωση και να ονοµάσετε τους φαινότυπους των απογόνων. (Μονάδες 2) 8

9 ε. Στη συνέχεια, δίνεται ένα τµήµα της µεταγραφόµενης αλυσίδας του DNA που έχει κατά σειρά τις πιο κάτω βάσεις: Αρχικό DNA: C T T T T A T A G T A G A A A C C A C A A A G G i. Ποιο είναι το τµήµα mrna που συντίθεται από τη µεταγραφή του πιο πάνω τµήµατος DNA; (Μονάδες 2) ii. Στο ίδιο τµήµα του DNA εντοπίστηκε µία µετάλλαξη που αφορά τρία (3) νουκλεοτίδια και φαίνεται πιο κάτω. Να ονοµάσετε το είδος της γονιδιακής µετάλλαξης, δικαιολογώντας την απάντησή σας. (Μονάδα 1) Μεταλλαγµένο DNA: C T T T T A T A G T A A C C A C A A A G G στ. Ποιος είναι ο αριθµός των δεσµών υδρογόνου που έχει το δίκλωνο µόριο του αρχικού τµήµατος DNA; Να αιτιολογήσετε την απάντησή σας. (Μονάδες 2) ζ. Χρησιµοποιώντας τον πιο κάτω γενετικό κώδικα, να γράψετε µε τη σωστή σειρά τα αµινοξέα του τµήµατος της πρωτεΐνης που παράγεται από το τµήµα DNA, στο οποίο έγινε η µετάλλαξη. (Μονάδες 2) η. Εκτός από το mrna να αναφέρετε δύο (2) άλλα είδη RNA που υπάρχουν σε ένα ανθρώπινο κύτταρο. (Μονάδα 1) 1 η Βάση 2 η Βάση 3 η U C A G Βάση UUU φαινυλαλανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη U U UUC φαινυλαλανίνη UCC σερίνη UAC τυροσίνη UGC κυστεΐνη C UUA λευκίνη UCA σερίνη UAA STOP UGA STOP A UUG λευκίνη UCG σερίνη UAG STOP UGG τρυπτοφάνη G CUU λευκίνη CCU προλίνη CAU ιστιδίνη CGU αργινίνη U C CUC λευκίνη CCC προλίνη CAC ιστιδίνη CGC αργινίνη C CUA λευκίνη CCA προλίνη CAA γλουταµίνη CGA αργινίνη A CUG λευκίνη CCG προλίνη CAG γλουταµίνη CGG αργινίνη G A AUU ισολευκίνη ACU θρεονίνη AAU ασπαραγγίνη AGU σερίνη U AUC ισολευκίνη ACC θρεονίνη AAC ασπαραγγίνη AGC σερίνη C AUA ισολευκίνη ACA θρεονίνη AAA λυσίνη AGA αργινίνη A AUG µεθιονίνη STR ACG θρεονίνη AAG λυσίνη AGG αργινίνη G GUU βαλίνη GCU αλανίνη GAU ασπαρτικό οξύ GGU γλυκίνη U GUC βαλίνη GCC αλανίνη GAC ασπαρτικό οξύ GGC γλυκίνη C G GUA βαλίνη GCA αλανίνη GAA γλουταµινικό οξύ GGA γλυκίνη A GUG βαλίνη GCG αλανίνη GAG γλουταµινικό οξύ GGG γλυκίνη G 9

10 2. Στο πιο κάτω σχήµα φαίνεται τµήµα του στοµάχου. α. Ποια είδη κυττάρων παριστάνουν οι αριθµοί 1 µέχρι 4; (Μονάδες 2) β. Τα κύτταρα µε αριθµό 2 της εικόνας παράγουν ένα ανενεργό προένζυµο Α το οποίο µε την παρουσία της ουσίας Β µετατρέπεται σε ενεργό ένζυµο Γ. Να ονοµάσετε τις ουσίες Α, Β και Γ. (Μονάδες 1.5) γ. Ποιος ο ρόλος της πεψίνης στο στοµάχι; (Μονάδες 2) δ. Ποια ορµόνη παράγεται από το στοµάχι και ποια είναι η λειτουργία της; (Μονάδες 2) ε. Να εξηγήσετε πώς απορροφούνται τα τελικά προϊόντα της πέψης των πρωτεϊνών και µε ποιο αγγείο µεταφέρονται στο συκώτι. (Μονάδες 2.5) στ. Να γράψετε δύο (2) ένζυµα του παγκρεατικού υγρού και το ρόλο του καθενός. (Μονάδες 2) ζ. Να ονοµάσετε δύο (2) προστατευτικούς παράγοντες του πεπτικού συστήµατος του ανθρώπου κατά των µικροβίων, που εισέρχονται µε την τροφή στον οργανισµό του και να εξηγήσετε τη δράση του κάθε παράγοντα. (Μονάδες 3) Τ Ε Λ Ο Σ 10

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Σάββατο, 22 Μαΐου 2010 07:30-10:30

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006 Μάθηµα: ΒΙΟΛΟΓΙΑ Ηµεροµηνία και ώρα εξέτασης: ευτέρα, 5 Ιουνίου 2006 7.30 π.µ.

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΜΕΡΟΣ Α' ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΕΞΕΤΑΣΕΙΣ ΓΙΑ ΤΑ ΑΝΩΤΕΡΑ ΚΑΙ ΑΝΩΤΑΤΑ ΕΚΠΑΙΔΕΥΤΙΚΑ ΙΔΡΥΜΑΤΑ Μάθημα: ΒΙΟΛΟΓΙΑ Ημερομηνία και ώρα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. ίκλωνο

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: ευτέρα, 23 Μαΐου 2011 07:30-10:30

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr 1 TO 1. µ, : i µ µ DNA ii µ DNA iii

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2015

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2015 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2015 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ Contents ΕΝΟΤΗΤΑ 2: ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ... 3 ΕΝΟΤΗΤΑ 3: ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΝΖΥΜΑ... 16 ΕΝΟΤΗΤΑ

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Προτεινόμενα θέματα 2014

Προτεινόμενα θέματα 2014 Προτεινόμενα θέματα 2014 Θέµα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 6 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 6 ΚΕΦΑΛΑΙΟ ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 6 ΚΕΦΑΛΑΙΟ 1 Να εξηγήσετε τη γέννηση ενός κοριτσιού με αιμορροφιλία από φυσιολογικούς γονείς 2 Δίνεται το γενεαλογικό δένδρο μιας οικογένειας στην οποία εμφανίζεται μια ασθένεια που

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 Μάθημα: ΒΙΟΛΟΓΙΑ Ημερομηνία και ώρα εξέτασης: Τρίτη, 26 Μαΐου 2009 07:30 10:30

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2011 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ 1 o

ÈÅÌÁÔÁ 2011 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ 1 o 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Κατεύθυνσης Γ Λυκείου ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο κ ΙΑΓΩΝΙΣΜΑ Α Α. Να σηµειώσεις την σωστή απάντηση και να αιτιολογήσεις. I 1. Το διπλανό γενεαλογικό δένδρο αναπαριστά την κληρονόµηση:

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ΔΙΔΑΚΤΕΑ ΥΛΗ ΒΙΟΛΟΓΙΑΣ Γ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2012-2013

ΔΙΔΑΚΤΕΑ ΥΛΗ ΒΙΟΛΟΓΙΑΣ Γ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2012-2013 ΔΙΔΑΚΤΕΑ ΥΛΗ ΒΙΟΛΟΓΙΑΣ Γ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 0-03. ΕΝΟΤΗΤΑ : Χαρακτηριστικά των ζωντανών οργανισμών (απλή αναφορά). ΕΝΟΤΗΤΑ : Η Χημεία της ζωής. ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά). ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2015

ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2015 ΓΥΜΝΑΣΙΟ ΑΡΧ. ΜΑΚΑΡΙΟΥ Γ - ΠΛΑΤΥ ΣΧΟΛΙΚΟ ΕΤΟΣ 2014-2015 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2015 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ-ΧΗΜΕΙΑ ΗΜΕΡΟΜΗΝΙΑ: 12/6/2015 ΒΑΘΜΟΣ ΒΑΘΜΟΣ:... ΤΑΞΗ: Γ Αριθμητικά.. ΧΡΟΝΟΣ: 2 ώρες Ολογράφως:...

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 30 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα