ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. 1. ιδαγμένο κείμενο από το πρωτότυπο. Πλάτωνος Πρωταγόρας, 322Α-323Α.

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. www.prooptikh.com. 1. ιδαγμένο κείμενο από το πρωτότυπο. Πλάτωνος Πρωταγόρας, 322Α-323Α."

Transcript

1 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 12 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) 1. ιδαγμένο κείμενο από το πρωτότυπο. Πλάτωνος Πρωταγόρας, 322Α-323Α. Ἐπειδὴ δὲ ὁ ἄνθρωπος θείας μετέσχε μοίρας, πρῶτον μὲν διὰ τὴν τοῦ θεοῦ συγγένειαν ζῴων μόνον θεοὺς ἐνόμισεν, καὶ ἐπεχείρει βωμούς τε ἱδρύεσθαι καὶ ἀγάλματα θεῶν ἔπειτα φωνὴν καὶ ὀνόματα ταχὺ διηρθρώσατο τῇ τέχνῃ, καὶ οἰκήσεις καὶ ἐσθῆτας καὶ ὑποδέσεις καὶ στρωμνὰς καὶ τὰς ἐκ γῆς τροφὰς ηὕρετο. Οὕτω δὴ παρεσκευασμένοι κατ ἀρχὰς ἄνθρωποι ᾤκουν σποράδην, πόλεις δὲ οὐκ ἦσαν ἀπώλλυντο οὖν ὑπὸ τῶν θηρίων διὰ τὸ πανταχῇ αὐτῶν ἀσθενέστεροι εἶναι, καὶ ἡ δημιουργικὴ τέχνη αὐτοῖς πρὸς μὲν τροφὴν ἱκανὴ βοηθὸς ἦν, πρὸς δὲ τὸν τῶν θηρίων πόλεμον ἐνδεής πολιτικὴν γὰρ τέχνην οὔπω εἶχον, ἧς μέρος πολεμική ἐζήτουν δὴ ἁθροίζεσθαι καὶ σῴζεσθαι κτίζοντες πόλεις ὅτ οὖν ἁθροισθεῖεν, ἠδίκουν ἀλλήλους ἅτε οὐκ ἔχοντες τὴν πολιτικὴν τέχνην, ὥστε πάλιν σκεδαννύμενοι διεφθείροντο. Ζεὺς οὖν δείσας περὶ τῷ γένει ἡμῶν μὴ ἀπόλοιτο πᾶν, Ἑρμῆν πέμπει ἄγοντα εἰς ἀνθρώπους αἰδῶ τε καὶ δίκην, ἵν εἶεν πόλεων κόσμοι τε καὶ δεσμοὶ φιλίας συναγωγοί. Ἐρωτᾷ οὖν Ἑρμῆς ία τίνα οὖν τρόπον δοίη δίκην καὶ αἰδῶ ἀνθρώποις «Πότερον ὡς αἱ τέχναι νενέμηνται, οὕτω καὶ ταύτας νείμω; Νενέμηνται δὲ ὧδε εἷς ἔχων ἰατρικὴν πολλοῖς ἱκανὸς ἰδιώταις, καὶ οἱ ἄλλοι δημιουργοί καὶ δίκην δὴ καὶ αἰδῶ οὕτω θῶ ἐν τοῖς ἀνθρώποις, ἤ ἐπὶ πάντας νείμω;» «Ἐπὶ πάντας», ἔφη ὁ Ζεύς, «καὶ πάντες μετεχόντων οὐ γὰρ ἂν γένοιντο ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ ΑΣ

2 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ πόλεις, εἰ ὀλίγοι αὐτῶν μετέχοιεν ὥσπερ ἄλλων τεχνῶν καὶ νόμον γε θὲς παρ ἐμοῦ τὸν μὴ δυνάμενον αἰδοῦς καὶ δίκης μετέχειν κτείνειν ὡς νόσον πόλεως». Να απαντήσετε στα παρακάτω : Α) Από το κείμενο, που σας δίνεται, να μεταφράσετε στη νέα ελληνική γλώσσα το απόσπασμα: «Οὕτω δὴ... ἀνθρώποις». Μονάδες 10 Β1) Να σχολιάσετε ερμηνευτικά την πλατωνική φράση «ὁ ἄνθρωπος θείας μετέσχε μοίρας». Μονάδες 10 Β2) Να εξηγήσετε γιατί κατά τον μύθο του Πρωταγόρα η αἰδώς και η δίκη λειτουργούν ως «πόλεων κόσμοι καὶ δεσμοὶ φιλίας συναγωγοί». Μονάδες 10 Β3) Λαμβάνοντας υπόψη αφενός το απόσπασμα του πρωτοτύπου κειμένου «Οὕτω δὴ... διεφθείροντο» και αφετέρου το μεταφρασμένο απόσπασμα «Το μάθημα... ισχυρίζομαι πως διδάσκω», που ακολουθεί, να αναφέρετε πώς παρουσιάζεται η πολιτική τέχνη. Πλάτωνος Πρωταγόρας 318 Ε «Το μάθημα [το οποίο διδάσκω] είναι η εὐβουλία, η σωστή σκέψη και λήψη αποφάσεων τόσο για τα θέματα που αφορούν τα οἰκεῖα, την ιδιωτική ζωή, πώς δηλαδή να διευθετεί κανείς με τον καλύτερο τρόπο τα ζητήματα του οἴκου του, όσο και για τα θέματα που αφορούν την πόλη, ώστε να είναι κανείς όσο γίνεται πιο ικανός να πράξει και να μιλήσει για τα πολιτικά θέματα». ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ ΑΣ

3 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ «Άραγε», είπα εγώ [δηλ. ο Σωκράτης, που αφηγείται τη συζήτησή του με τον Πρωταγόρα σε τρίτο φίλο του], «παρακολουθώ σωστά τα λεγόμενά σου; Γιατί απ ό,τι καταλαβαίνω, μιλάς για την πολιτική τέχνη και εννοείς πως αναλαμβάνεις να κάνεις τους άνδρες ἀγαθοὺς πολίτες». «Αυτό ακριβώς, Σωκράτη», είπε, «είναι το μάθημα που ισχυρίζομαι πως διδάσκω». Β4) Τι γνωρίζετε για τη Σωκρατική αμφισβήτηση; Μονάδες 10 Μονάδες 10 Β5) Να γράψετε δύο ομόρριζες λέξεις της νέας ελληνικής γλώσσας, απλές ή σύνθετες, για καθεμιά από τις παρακάτω λέξεις του κειμένου: μετέσχε, διηρθρώσατο, οἰκήσεις, νενέμηνται, συναγωγοί. Μονάδες Αδίδακτο κείμενο. Λυσίου, [ ήμου καταλύσεως] ἀπολογία Ἄξιον δὲ μνησθῆναι καὶ τῶν μετὰ τοὺς τετρακοσίους πραγμάτων εὖ γὰρ εἴσεσθε ὅτι, ἃ μὲν οὗτοι συμβουλεύουσιν, οὐδεπώποτε ὑμῖν ἐλυσιτέλησεν, ἃ δ ἐγὼ παραινῶ, ἀμφοτέραις ἀεὶ ταῖς πολιτείαις συμφέρει. Ἴστε γὰρ Ἐπιγένη καὶ ημοφάνη καὶ Κλεισθένη ἰδίᾳ μὲν καρπωσαμένους τὰς τῆς πόλεως συμφοράς, δημοσίᾳ δὲ ὄντας μεγίστων κακῶν αἰτίους. Ἐνίων μὲν γὰρ ἔπεισαν ὑμᾶς ἀκρίτων θάνατον καταψηφίσασθαι, πολλῶν δὲ ἀδίκως δημεῦσαι τὰς οὐσίας, τοὺς δ ἐξελάσαι καὶ ἀτιμῶσαι τῶν πολιτῶν τοιοῦτοι γὰρ ἦσαν ὥστε τοὺς μὲν ἡμαρτηκότας ἀργύριον λαμβάνοντες ἀφιέναι, τοὺς δὲ μηδὲν ἠδικηκότας εἰς ὑμᾶς εἰσιόντες ἀπολλύναι. ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ ΑΣ

4 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ Να απαντήσετε στα παρακάτω : Γ1) Να μεταφράσετε στη νέα ελληνική γλώσσα το παραπάνω κείμενο. Μονάδες 20 Γ2α) Να γράψετε τις παρακάτω λέξεις στη δοτική πτώση του ιδίου αριθμού και γένους: πραγμάτων, τῆς πόλεως, ὄντας, ἐνίων, μεγίστων. Μονάδες 5 Γ2β) Να γράψετε τον ζητούμενο τύπο για καθεμιά από τις παρακάτω λέξεις του κειμένου : μνησθῆναι: το β ενικό πρόσωπο της προστακτικής στον ίδιο χρόνο και στην ίδια φωνή. συμβουλεύουσιν: το γ ενικό πρόσωπο της οριστικής του αορίστου στην ίδια φωνή. συμφέρει: το β πληθυντικό πρόσωπο της οριστικής του μέλλοντα στην ίδια φωνή. ὄντας: τη μετοχή του μέλλοντα στο ίδιο γένος, αριθμό και πτώση. ἔπεισαν: το γ πληθυντικό πρόσωπο της οριστικής του παρακειμένου στη μέση φωνή. Μονάδες 5 Γ3) Να γίνει συντακτική αναγνώριση των παρακάτω λέξεων του κειμένου: μνησθῆναι, οὗτοι, τὰς τῆς πόλεως, δημεῦσαι, τῶν πολιτῶν. Μονάδες 10 ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ ΑΣ

5 ΑΡΧΗ 5ΗΣ ΣΕΛΙ ΑΣ Ο ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ 1. Στο τετράδιο να γράψετε μόνον τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). εν θα μεταφέρετε στο τετράδιο τα κείμενα και τις παρατηρήσεις. 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοτυπιών, αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας, να παραδώσετε μαζί με το τετράδιο και τη φωτοτυπία. 3. Να μεταφράσετε στο τετράδιό σας ό,τι σας ζητείται από το διδαγμένο κείμενο και ολόκληρο το αδίδακτο. 4. Να απαντήσετε σε όλα τα ζητούμενα. 5. ιάρκεια εξέτασης : τρεις (3) ώρες. 6. Χρόνος δυνατής αποχώρησης : μία (1) ώρα μετά τη διανομή των φωτοτυπιών. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ ΑΣ

6 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΛΑΤΙΝΙΚΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΡΕΙΣ (3) Α. Να μεταφράσετε το παρακάτω κείμενο στη νέα ελληνική γλώσσα: Cato attulit quodam die in curiam ficum praecocem ex Carthagine ostendensque patribus «Interrogo vos» inquit «quando hanc ficum decerptam esse putetis ex arbore». Cum omnes recentem esse dixissent, «Atqui ante tertium diem» inquit «scitote decerptam esse Carthagine. Tam prope a muris habemus hostem! Itaque cavete periculum, tutamini patriam...».... Cum aliquis Sertorio nuntiavisset cervam inventam esse, Sertorius eum iussit tacere; praeterea praecepit ut eam postero die repente in eum locum emitteret, in quo ipse cum amicis futurus esset. Postridie eius diei Sertorius, admissis amicis in cubiculum suum, dixit eis visum in somno sibi esse cervam, quae perisset, ad se reverti. Μονάδες 40 Β. Παρατηρήσεις 1.α. Να γράψετε τους τύπους που ζητούνται για καθεμιά από τις παρακάτω συνεκφορές: postero die : τη δοτική πληθυντικού. eum locum : την αιτιατική πληθυντικού. cubiculum suum : την ονομαστική πληθυντικού. Μονάδες 6 1.β. Να γράψετε τους τύπους που ζητούνται για καθεμιά από τις παρακάτω λέξεις: praecocem : την αφαιρετική ενικού. patribus : τη γενική πληθυντικού. vos : τη δοτική ενικού στο α πρόσωπο. hanc : την ονομαστική πληθυντικού στο ίδιο γένος. ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ ΑΣ

7 omnes recentem hostem ipse quae ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ : την αιτιατική πληθυντικού στο ουδέτερο γένος. : την ονομαστική ενικού στο θηλυκό γένος. : τη δοτική πληθυντικού. : την αιτιατική ενικού στο ουδέτερο γένος. : τη γενική ενικού στο ίδιο γένος. Μονάδες 9 2.α. Να γράψετε τους τύπους που ζητούνται για καθένα από τα παρακάτω: putetis: το α πληθυντικό πρόσωπο του Παρατατικού της υποτακτικής και το β ενικό πρόσωπο του Ενεστώτα της προστακτικής στην ίδια φωνή. scitote: το γ ενικό πρόσωπο του Ενεστώτα της οριστικής και το β ενικό πρόσωπο του Ενεστώτα της υποτακτικής στην ίδια φωνή. tacere: το β ενικό πρόσωπο του Παρακειμένου της οριστικής και το γ πληθυντικό πρόσωπο του Ενεστώτα της υποτακτικής στην ίδια φωνή. praecepit: το β πληθυντικό πρόσωπο του Παρατατικού της υποτακτικής και το α ενικό πρόσωπο του Υπερσυντελίκου της υποτακτικής στην ίδια φωνή. emitteret: το α ενικό πρόσωπο του Μέλλοντα της οριστικής και το γ πληθυντικό πρόσωπο του Ενεστώτα της υποτακτικής στην παθητική φωνή. Μονάδες 10 2.β. iussit: να γράψετε τη μετοχή Ενεστώτα του αρσενικού γένους στην ονομαστική πτώση του ενικού αριθμού και το απαρέμφατο του Μέλλοντα της παθητικής φωνής. visum esse: να γράψετε τη γενική του γερουνδίου, την αφαιρετική του σουπίνου και το απαρέμφατο του Παρακειμένου της ενεργητικής φωνής. Μονάδες 5 3.α. Cum aliquis Sertorio nuntiavisset cervam inventam esse: Να αναγνωρίσετε το είδος της παραπάνω πρότασης (μονάδα 1) και να δικαιολογήσετε την έγκλιση (μονάδες 2) και το χρόνο του ρήματος (μονάδες 2). Μονάδες 5 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ ΑΣ

8 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ 3.β. «quando hanc ficum decerptam esse putetis...»: Να χαρακτηρίσετε συντακτικώς τους όρους της παραπάνω πρότασης. Μονάδες 10 4.α. Να μεταφέρετε στο τετράδιό σας την παρακάτω άσκηση και να συμπληρώσετε τα κενά, ώστε να φαίνεται ο συντακτικός ρόλος της κάθε λέξης. patribus : είναι... στο... recentem : είναι... στο... aliquis : είναι... στο... tacere : είναι... στο... Μονάδες 8 4.β. Cavete periculum: Να αποδώσετε την προστακτική cavete με απαγόρευση και με τους δύο τρόπους. Μονάδες 4 4.γ. admissis amicis: Να χαρακτηρίσετε το συντακτικό φαινόμενο. Μονάδες 3 Ο ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιο. 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 5. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ ΑΣ

9 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΕΜΠΤΗ 14 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΙΣΤΟΡΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΡΕΙΣ (3) ΟΜΑ Α Α ΘΕΜΑ Α1 α. Να δώσετε το περιεχόμενο των ακολούθων όρων : Εκλεκτικοί. Ομάδα των Ιαπώνων. Κλήριγκ. Μονάδες 15 β. Να προσδιορίσετε αν το περιεχόμενο των ακόλουθων προτάσεων είναι σωστό ή όχι, γράφοντας στο τετράδιό σας τη λέξη «Σωστό» ή «Λάθος» δίπλα στον αριθμό που αντιστοιχεί στην κάθε πρόταση. 1. Οι οθωνικές κυβερνήσεις αποπλήρωσαν τα επαναστατικά δάνεια. 2. Η ενσωμάτωση της Θεσσαλίας στο ελληνικό κράτος πραγματοποιήθηκε το Η συνθήκη των Σεβρών (1920) όριζε ότι η περιοχή της Σμύρνης θα βρισκόταν υπό ελληνική διοίκηση για πέντε (5) χρόνια. 4. Το 1924 το Σ.Ε.Κ.Ε. μετονομάστηκε σε Κ.Κ.Ε. Μονάδες 8 ΘΕΜΑ Α2 α. Ποιες ήταν οι πολιτικές απόψεις του Θεόδωρου ηλιγιάννη και του κόμματός του; Μονάδες 14 β. Ποιες ήταν οι επιπτώσεις στον πληθυσμό της Ελλάδας και στην εθνολογική του σύσταση, από την άφιξη των προσφύγων μετά τη Μικρασιατική Καταστροφή; Μονάδες 13 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ ΑΣ

10 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ ΟΜΑ Α Β ΘΕΜΑ Β1 Αντλώντας στοιχεία από το παρακάτω κείμενο και αξιοποιώντας τις ιστορικές σας γνώσεις να αναλύσετε: α. τα αίτια του διωγμού που υπέστησαν οι Έλληνες της Οθωμανικής Αυτοκρατορίας το 1914 β. τους τρόπους με τους οποίους αυτός εκδηλώθηκε. Μονάδες 13 Μονάδες 12 ΚΕΙΜΕΝΟ Εκτός από την άνοδο του τουρκικού εθνικισμού, που υπήρξε ο κύριος παράγων, στη δίωξη του ελληνικού στοιχείου συνετέλεσαν και οικονομικοί λόγοι. Οι Έλληνες, με τη συγκέντρωση του εμπορίου και της βιομηχανίας στα χέρια τους, ήταν φυσικό να αποτελούν εμπόδιο στην επιδίωξη της Γερμανίας να ολοκληρώσει την οικονομική της διείσδυση στην υπανάπτυκτη Τουρκία [...]. Οι διωγμοί άρχισαν [...] με τη βίαιη εκδίωξη των Ελλήνων της ανατολικής Θράκης [...]. Το Μάιο του 1914 υπό την καθοδήγηση των Γερμανών επεκτάθηκαν οι διωγμοί και στη δυτική Μικρά Ασία. Στη θέση των Ελλήνων που ξεριζώθηκαν, εγκαταστάθηκαν μουσουλμάνοι πρόσφυγες από εδάφη που έχασε η Τουρκία στους Βαλκανικούς πολέμους. Για την εκκένωση της περιοχής, που βρίσκεται απέναντι από τα επίμαχα ελληνικά νησιά του ανατολικού Αιγαίου, από τον ελληνικό πληθυσμό προβλήθηκαν λόγοι στρατιωτικής άμυνας. Βέβαια το ελληνικό κράτος ήταν ακόμη ουδέτερο και ο βασιλιάς του θεωρούνταν γερμανόφιλος. Ο ελληνικός όμως πληθυσμός της Μικράς Ασίας ήταν ύποπτος στις τουρκικές αρχές [...]. Η εκκένωση μεθοδεύτηκε παντού ομοιότροπα. Προηγήθηκε ενορχηστρωμένη ανθελληνική εκστρατεία του τουρκικού τύπου και εντάθηκαν οι καταπιέσεις για να εξαναγκαστεί το ελληνικό στοιχείο σε εκούσια μετανάστευση. Ιστορία του Ελληνικού Έθνους, τόμος ΙΕ (Αθήνα, 1978), σελ ΘΕΜΑ Β2 Αντλώντας στοιχεία από το παρακάτω κείμενο και αξιοποιώντας τις ιστορικές σας γνώσεις να επισημάνετε τα προβλήματα που ανέκυπταν στο ζήτημα της διανομής των εθνικών γαιών πριν από το ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ ΑΣ

11 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ ΚΕΙΜΕΝΟ Η εκμετάλλευση και η αξιοποίηση [των εθνικών γαιών] αποτέλεσαν ένα από τα πιο καφτά πολιτικά προβλήματα της χώρας, για ένα σχεδόν αιώνα [...]. Ως το τέλος του [19 ου ] αιώνα, το πιο επείγον υπήρξε το πρόβλημα της παραχώρησης των εδαφών στους φτωχούς άκληρους αγρότες. Αλλά οι αγώνες που έγιναν για την κατανομή των εδαφών και η αντίδραση εκείνων που επωφελούνταν από τη συγκεχυμένη κατάσταση που επικρατούσε στη διαχείριση των εθνικών γαιών, επιβράδυναν τη διανομή [...]. Η έγγεια πρόσοδος, που τελικά εισέπραττε το Κράτος, ήταν εξαιρετικά χαμηλή για την πλειοψηφία των χωρικών που κατείχαν τις εθνικές γαίες. Έτσι, οι ειδικές συνθήκες μίσθωσης των γαιών εξομοιώνουν σχεδόν τον κάτοχό τους με το μικροϊδιοκτήτη που έχει πλήρη κυριότητα. Πραγματικά, το Κράτος (ο ιδιοκτήτης γης), δεν μπορεί σε καμιά περίπτωση να ταυτιστεί μ έναν απόντα ιδιοκτήτη, έστω και μόνον από το γεγονός της πολύ μειωμένης «έγγειας προσόδου» που εισπράττονταν [...]. Το Κράτος, σαν ιδιοκτήτης, είναι ανίκανο να επιτελέσει τον κύριο οικονομικό και «τυπικό» ρόλο του ιδιοκτήτη που ζει εκτός έδρας: να καθορίσει δηλαδή τους τρόπους εξαγωγής της εγγείας προσόδου. Πιο σημαντικό είναι πως ο εκμισθωτής, ο μικροκαλλιεργητής με τα διασφαλισμένα οικονομικά δικαιώματα, λειτουργεί απέναντι στη γη σαν να ήταν δικαιωματικά ο νόμιμος ιδιοκτήτης της. Μέσα σ αυτό το πλαίσιο, λοιπόν, έγινε ο σφετερισμός των μισών περίπου εθνικών γαιών. Κ. Τσουκαλά, Εξάρτηση και αναπαραγωγή (Αθήνα, 1977), σελ Ο ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ Μονάδες Στο τετράδιο να γράψετε τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). ε θα μεταφέρετε στο τετράδιο τα κείμενα και τις παρατηρήσεις. 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε σε όλα τα ζητούμενα. 4. Κάθε απάντηση τεκμηριωμένη είναι αποδεκτή. 5. ιάρκεια εξέτασης: τρεις (3) ώρες. 6. Χρόνος δυνατής αποχώρησης: μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ ΑΣ

12 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 13 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΝΕΟΕΛΛΗΝΙΚΗ ΛΟΓΟΤΕΧΝΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΡΕΙΣ (3) Α. ΚΕΙΜΕΝΟ Ὀδυσσέας Ἐλύτης ( ) Μικρή Πράσινη Θάλασσα Μικρή πράσινη θάλασσα δεκατριῶ χρονῶ Πού θά θελα νά σέ υἱοθετήσω Νά σέ στείλω σχολεῖο στήν Ἰωνία Νά μάθεις μανταρίνι και ἄψινθο 1 5 Μικρή πράσινη θάλασσα δεκατριῶ χρονῶ Στό πυργάκι τοῦ φάρου τό καταμεσήμερο Νά γυρίσεις τόν ἥλιο καί ν ἀκούσεις Πῶς ἡ μοίρα ξεγίνεται καί πῶς Ἀπό λόφο σέ λόφο συνεννοοῦνται 10 Ἀκόμα οἱ μακρινοί μας συγγενεῖς Πού κρατοῦν τόν ἀέρα σάν ἀγάλματα Μικρή πράσινη θάλασσα δεκατριῶ χρονῶ Μέ τόν ἄσπρο γιακά καί τήν κορδέλα Νά μπεῖς ἀπ τό παράθυρο στή Σμύρνη 15 Νά μοῦ ἀντιγράψεις τίς ἀντιφεγγιές στήν ὀροφή Ἀπό τά Κυριελέησον καί τά όξα Σοι Καί μέ λίγο Βοριά λίγο Λεβάντε Κύμα τό κύμα νά γυρίσεις πίσω Μικρή πράσινη θάλασσα δεκατριῶ χρονῶ 20 Γιά νά σέ κοιμηθῶ παράνομα Καί νά βρίσκω βαθιά στήν ἀγκαλιά σου Κομμάτια πέτρες τά λόγια τῶν Θεῶν Κομμάτια πέτρες τ ἀποσπάσματα τοῦ Ἡράκλειτου. (Τό Φωτόδεντρο καί ἡ εκάτη Τετάρτη Ὀμορφιά, Ίκαρος, 1971) 1 άψινθος: αρωματικό φυτό. ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ ΑΣ

13 Β. ΕΡΩΤΗΣΕΙΣ ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ α. «Κέντρο της ποίησης του Ελύτη το Αιγαίο, άξονάς της ο ήλιος... Η κατανόηση του κόσμου επιτυγχάνεται μέσω των αισθήσεων». (Θοδωρής ασκαρόλης, «Friedrich Hölderlin Οδυσσέας Ελύτης», περ. ἡ λέξη τ. 106, Νοέμβρης- εκέμβρης 1991, σελ. 889). Να γράψετε δύο (2) παραδείγματα μέσα από το ποίημα για καθένα από τα παραπάνω χαρακτηριστικά της ποίησης του Ελύτη. Μονάδες 15 β.1 Να εντοπίσετε και να γράψετε τέσσερα (4) εκφραστικά μέσα που χρησιμοποιεί ο ποιητής και να προσδιορίσετε τον ρόλο τους στο ποίημα. Μονάδες 20 β.2 Ποιο είναι το περιεχόμενο του στίχου «Μικρή πράσινη θάλασσα δεκατριῶ χρονῶ» και πώς λειτουργεί η επανάληψή του στη δομή του ποιήματος; Μονάδες 20 γ. Να σχολιάσετε σε δύο παραγράφους ( λέξεις) το περιεχόμενο των στίχων («Μικρή πράσινη θάλασσα... τ ἀποσπάσματα τοῦ Ἡράκλειτου»). Μονάδες 25 δ. Να εντοπίσετε τα κοινά θεματικά στοιχεία στα δύο ποιήματα του Ελύτη «Μικρή Πράσινη Θάλασσα» και «Ἡ Πορτοκαλένια» («Ἡ ελληνική ποίηση», [Νεωτερικοί ποιητές του Μεσοπολέμου], Εκδόσεις Σοκόλη, Αθήνα 1979, σελ. 239). Ἡ Πορτοκαλένια Τόσο πολύ τή μέθυσε ὁ χυμός τοῦ ἥλιου Πού ἔγειρε τό κεφάλι της καί δέχτηκε νά γίνει Σιγά-σιγά: ἡ μικρή Πορτοκαλένια! Ἔτσι καθώς γλαυκόλαμψαν οἱ ἑφτά οὐρανοί Ἔτσι καθώς ἀγγίξαν μιά φωτιά τά κρύσταλλα Ἔτσι καθώς ἀστράψανε χελιδονοουρές Σάστισαν πάνω οἱ ἄγγελοι καί κάτω οἱ κοπελλιές Σάστισαν πάνω οἱ πελαργοί καί κάτω τά παγόνια Κι ὅλα μαζί συνάχτηκαν κι ὅλα μαζί τήν εἶδαν Κι ὅλα μαζί τή φώναξαν: Πορτοκαλένια! ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ ΑΣ

14 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ Μεθάει τό κλῆμα κι ὁ σκορπιός μεθάει ὁ κόσμος ὅλος ὅμως τῆς μέρας ἡ κεντιά τόν πόνο δέν ἀφήνει Τή λέει ὁ νάνος ἐρωδιός μέσα στά σκουληκάκια Τή λέει ὁ χτύπος τοῦ νεροῦ μές τίς χρυσοστιγμές Τή λέει κι ἡ δρόσο στοῦ καλοῦ βοριᾶ τό ἀπανωχείλι: Σήκω μικρή μικρή μικρή Πορτοκαλένια! Ὅπως σέ ξέρει τό φιλί κανένας δέν σέ ξέρει Μήτε σέ ξέρει ὁ γελαστός Θεός Πού μέ τό χέρι του ἀνοιχτό στή φλογερή ἀντηλιά Γυμνή σέ δείχνει στούς τριανταδυό του ἀνέμους! («Ἥλιος ὁ πρῶτος», 1943) Μονάδες 20 ΟΔΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ 1. Στο τετράδιο να γράψετε μόνον τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). εν θα μεταφέρετε στο τετράδιο τα κείμενα και τις παρατηρήσεις. 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων, αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας, να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε σε όλα τα ζητούμενα. 4. Κάθε απάντηση τεκμηριωμένη είναι αποδεκτή. 5. ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ ΑΣ

15 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΕΥΤΕΡΑ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ: ΝΕΟΕΛΛΗΝΙΚΗ ΓΛΩΣΣΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΚΕΙΜΕΝΟ Αν θέλουμε σήμερα να οδηγήσουμε σωστά τους νέους, πρέπει να τους μάθουμε πώς θα είναι υποχρεωμένοι να ζήσουν μέσα σ ένα εξαιρετικά κινητό σύμπαν. Οι παλιότεροι μπορεί να αισθανθούν την επιτάχυνση του ιστορικού γίγνεσθαι, συγκρίνοντας τα νιάτα τους με την ωριμότητά τους. Οι νέοι αυτή την επιτάχυνση την αισθάνονται σαν αθεράπευτη και ασταμάτητη ανησυχία. εν έχουν καμιά εγγύηση για το μέλλον, που το προβλέπουν γεμάτο κινδύνους. Και γι αυτό επιθυμούν ν αποκτήσουν χωρίς αργοπορία όσα πράγματα θεωρούν αξιόλογα. [...] Εκείνο που ήταν βέβαιο άλλοτε δεν είναι πια βέβαιο τώρα. Κι ενώ άλλοτε μπορούσαμε να στηρίξουμε την παιδεία μας στην παράδοση, τώρα η παράδοση αποδείχνεται ολοένα και περισσότερο ανίκανη να καλύψει την έκταση των παιδευτικών αναγκών. Χρειάζεται λοιπόν κάποιος μετασχηματισμός. Κι ανάμεσα στ άλλα ο μετασχηματισμός αυτός πρέπει να βασισθεί στην περιοδική και συχνή μετεκπαίδευση. Όποιος σπουδάζει μια επιστήμη είναι ανάγκη να νιώσει, πως, περισσότερο από κάθε άλλη φορά, θα είναι αναγκασμένος να τη σπουδάζει παντοτεινά, ν ανανεώνει τις γνώσεις του, να συμπληρώνει τα κενά που έχει αφήσει η πρώτη του μαθητεία ή τα κενά που σχηματίζονται στο αναμεταξύ από την άρση δεδομένων, που έπαυσαν πια να ισχύουν. Έτσι θα δημιουργηθεί ένας καινούριος τύπος ανθρώπου. Αλλά με ποιες αρετές πρέπει να είναι προικισμένος αυτός ο άνθρωπος; [...] Η πρώτη αρετή του καινούριου ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ ΑΣ

16 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ ανθρώπου θα είναι η γ α λ ή ν η. [...] Μέσα στον ταραγμένο και γεμάτο κινδύνους σύγχρονο κόσμο πρέπει να οπλίσουμε τα παιδιά μας με την αυτοκυριαρχία, που τα κάνει ικανά να υπερνικήσουν τις δυσκολίες, να περάσουν τα εμπόδια και να μην υποδουλωθούν στην επιτάχυνση: και τούτο θα γίνει με τη συνάσκηση σώματος και ψυχής (γυμναστική και φιλοσοφία). Η δεύτερη αρετή είναι η φ α ν τ α σ ί α. Σ ένα σταθερό κόσμο η λογική είναι η πρωταρχική ανάμεσα σ όλες τις ιδιότητες σ έναν κινητό κόσμο, συνεχώς ανανεούμενο, πρέπει να είμαστε ικανοί να επινοούμε, να εφευρίσκουμε, να συνδυάζουμε, να λύνουμε τα προβλήματα, που παρουσιάζονται σε κάθε περιοχή. Πρέπει να κρατούμε λοιπόν άγρυπνη την προσοχή των νέων ανθρώπων, πρέπει να τους μαθαίνουμε να έχουν «ιδέες». Τρίτη αρετή είναι το σ υ λ λ ο γ ι κ ό π ν ε ύ μ α. Το σύγχρονο τεχνικό σύμπαν απαιτεί τη συνεργασία πολλών ατόμων. Οι λαμπρότερες επιδόσεις απομένουν στείρες, όταν εκείνος που τις κερδίζει δεν έχει την ικανότητα να τις συνδέσει με τις ανάλογες επιδόσεις των άλλων. Η ατομική πρωτοβουλία είναι πάντα πολύτιμη. Αλλά γίνεται αληθινά ωφέλιμη, όταν δεν μεταμορφώνεται σε έκφραση ασκητισμού, αλλά σε έκφραση αλληλεγγύης. Έπειτα ο ε ν θ ο υ σ ι α σ μ ό ς και το θ ά ρ ρ ο ς. Μας χρειάζονται άνθρωποι γεμάτοι φλόγα δημιουργίας, πόθο για το καλύτερο, και ατρόμητοι μπροστά στους κινδύνους. Και πάνω απ όλα α ν θ ρ ώ π ι ν ο ι. ηλαδή προικισμένοι με τη συνείδηση της ανθρωπιάς τους. Αυτή η συνείδηση της ανθρωπιάς είναι η πραγματική, η αληθινή παιδεία. Μήτε ο πολυμαθής μήτε ο ικανός να λάμψει μέσα σ ένα κοινωνικό σύνολο μήτε ο κάτοχος μιας προνομιούχου αγωγής είναι ο αναμφισβήτητα μορφωμένος. Για τούτο είναι μάταιο ν αντιπαραθέτουμε το τεχνικό σύμπαν, το σύμπαν της τεχνικής, στο σύμπαν της παιδείας. Το πρώτο δεν ακυρώνει το δεύτερο: ολωσδιόλου αντίθετα, το προϋποθέτει, το απαιτεί. Γιατί η τεχνική είναι καμωμένη για τον άνθρωπο. ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ ΑΣ

17 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ Κι όταν το ανθρώπινο στοιχείο απουσιάζει, καμιά σημασία δεν έχουν τ άλλα στοιχεία. Το πρόβλημα συνεπώς δεν είναι άλυτο: από τη μια μεριά πρέπει να δώσουμε στο νέο άνθρωπο όλες τις γενικές γνώσεις, που θα του χρησιμεύσουν στη ζωή, από την άλλη μεριά να τον προπαρασκευάσουμε έτσι ώστε ν αποτελέσει τον μ έ λ λ ο ν τ α ά ν θ ρ ω π ο. ( ιασκευή από το δοκίμιο «Ο ρυθμός της Ιστορίας» του Ι. Μ. Παναγιωτόπουλου, Ο σύγχρονος άνθρωπος, Οι Εκδόσεις των Φίλων, Αθήνα , σελ ). Α. Να γράψετε στο τετράδιό σας την περίληψη του κειμένου που σας δόθηκε ( λέξεις). Μονάδες 25 Β1. «Το σύγχρονο τεχνικό σύμπαν απαιτεί τη συνεργασία πολλών ατόμων. Οι λαμπρότερες επιδόσεις απομένουν στείρες, όταν εκείνος που τις κερδίζει δεν έχει την ικανότητα να τις συνδέσει με τις ανάλογες επιδόσεις των άλλων». Να αναπτύξετε την παραπάνω θέση του συγγραφέα σε μια παράγραφο (60-80 λέξεις). Μονάδες 10 Β2. Με ποιον τρόπο και με ποια μέσα πειθούς ο συγγραφέας τεκμηριώνει τις απόψεις του στην πρώτη παράγραφο του κειμένου; Μονάδες 5 Β3. αθεράπευτη, αξιόλογα, πρωταρχική, ικανότητα, μεταμορφώνεται. Να γράψετε από ένα συνώνυμο για κάθε μία από τις παραπάνω λέξεις του κειμένου. Μονάδες 5 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ ΑΣ

18 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ Β4. «Αλλά με ποιες αρετές... (γυμναστική και φιλοσοφία)». Τι πετυχαίνει ο συγγραφέας με τη χρήση της ερώτησης και της παρένθεσης στην παραπάνω παράγραφο; Μονάδες 5 Γ. Το τελευταίο τεύχος του σχολικού σας περιοδικού έχει ως θέμα τον ρόλο των νέων στο σύγχρονο κόσμο. Να γράψετε ένα άρθρο στο οποίο να αναφέρετε τις προσδοκίες που έχει η κοινωνία σήμερα από τους νέους και τα εφόδια με τα οποία οι νέοι μπορούν να ανταποκριθούν σ αυτές. ( λέξεις). Μονάδες 50 Ο ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιο. 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα, τα οποία και θα καταστραφούν μετά το πέρας της εξέτασης. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. Κάθε απάντηση τεκμηριωμένη είναι αποδεκτή. 5. ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης : Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ ΑΣ

19 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 12 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ : ΜΑΘΗΜΑΤΙΚA ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΕΙΣ (4) ΘΕΜΑ 1ο α) Έστω η συνάρτηση f ( x) = x. Να αποδείξετε ότι η f είναι παραγωγίσιμη στο (0,+ ) 1 και ισχύει f ( x) =. 2 x Μονάδες 10 β) Έστω μία συνάρτηση f και το σημείο x 0 του πεδίου ορισμού της. Πότε θα λέμε ότι η f είναι συνεχής στο x 0 ; Μονάδες 5 γ) Να γράψετε στο τετράδιό σας τους αριθμούς 1, 2, 3, 4 και 5 των παρακάτω προτάσεων και δίπλα σε κάθε αριθμό να σημειώσετε την ένδειξη (Σ), αν η αντίστοιχη πρόταση είναι σωστή, ή (Λ), αν η αντίστοιχη πρόταση είναι λανθασμένη. 1. Αν z 1, z 2 είναι μιγαδικοί αριθμοί, τότε ισχύει : z +. 1 z2 z1 + z2 z1 z2 Μονάδες 2 2. Έστω η συνάρτηση f (x) = εφx. Η συνάρτηση f είναι παραγωγίσιμη στο R 1 = R { x συνx = 0 } και ισχύει 1 f (x) =. 2 συν x Μονάδες 2 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ ΑΣ

20 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ 3. Αν lim f( x) < 0 x x 0, τότε f ( x) < 0 κοντά στο x 0. Μονάδες 2 4. συνxdx = ημx+ c. Μονάδες 2 5. Αν για μία συνάρτηση f, συνεχή στο διάστημα [α,β] β ισχύει f ( x) 0 για κάθε x [ α,β], τότε f(x)dx 0. ΘΕΜΑ 2ο Έστω ότι για τον μιγαδικό αριθμό z ισχύει: ( 5 1) 5 = ( z 5 ) 5 z. α) Να δείξετε ότι 5z 1 = z 5. β) Να δείξετε ότι: z = 1. α Μονάδες 2 Μονάδες 5 Μονάδες 10 γ) Αν w = 5 z+1, να βρεθεί ο γεωμετρικός τόπος των εικόνων Μ(w) στο μιγαδικό επίπεδο. Μονάδες 10 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ ΑΣ

21 ΘΕΜΑ 3ο ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ ίνεται η συνάρτηση ( x) = ln( x 5) + 2x 12 f. α) Ποιο είναι το πεδίο ορισμού της συνάρτησης f; Mονάδες 6 β) Να αποδείξετε ότι η συνάρτηση f είναι γνησίως αύξουσα. Μονάδες 7 γ) Να βρείτε το σύνολο τιμών της συνάρτησης f. Μονάδες 6 δ) Να αποδείξετε ότι η εξίσωση f(x)=2006 έχει μοναδική λύση στο πεδίο ορισμού της συνάρτησης f. Μονάδες 6 ΘΕΜΑ 4 ο Έστω η συνεχής συνάρτηση f, για την οποία ισχύει f x ( x) = + 2 f( t)dt 3, x R α) Να αποδειχθεί ότι η συνάρτηση ( x) σταθερή. 2x β) Να αποδειχθεί ότι ( ) f x 0 = 3e. ( x) f Φ = είναι 2x e Μονάδες 5 Μονάδες 5 γ) Nα βρεθεί το εμβαδόν του χωρίου Ε(λ) που περικλείεται από τη γραφική παράσταση της συνάρτησης f, τον άξονα x x και τις ευθείες x=0, x=λ με λ>0. Μονάδες 10 δ) Να βρεθεί το lim λ 0 + Ε( λ) λ ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ ΑΣ Μονάδες 5

22 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ Ο ΗΓΙΕΣ (για τους εξεταζόμενους) 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιο. 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοτυπιών αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τις φωτοτυπίες. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοτυπιών. 6. Χρόνος δυνατής αποχώρησης : Μία (1) ώρα μετά τη διανομή των φωτοτυπιών. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ ΑΣ

23 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΕΜΠΤΗ 14 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΞΙ (6) ΘΕΜΑ 1ο Στις ημιτελείς προτάσεις 1 έως και 3, που ακολουθούν, να γράψετε στο τετράδιό σας τον αριθμό της βασικής φράσης και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. 1. Κατά τη διάδοση ενός μηχανικού κύματος σε ένα ελαστικό μέσον α. μεταφέρεται ενέργεια και ύλη. β. μεταφέρεται μόνον ύλη. γ. μεταφέρεται ενέργεια και ορμή από το ένα σημείο του μέσου στο άλλο. δ. όλα τα σημεία του ελαστικού μέσου την ίδια χρονική στιγμή έχουν την ίδια φάση. Μονάδες 5 2. Η συχνότητα ταλάντωσης f ενός συστήματος ελατηρίου _ μάζας α. είναι ανεξάρτητη από τη σταθερά Κ του ελατηρίου. β. είναι ανεξάρτητη από το πλάτος Α της ταλάντωσης. γ. εξαρτάται από την ενέργεια του ταλαντωτή. δ. είναι ανεξάρτητη από τη μάζα του ταλαντωτή. Μονάδες 5 3. Τα σημεία ενός γραμμικού ομογενούς ελαστικού μέσου στο οποίο έχει δημιουργηθεί στάσιμο εγκάρσιο κύμα και τα οποία βρίσκονται μεταξύ δύο διαδοχικών δεσμών έχουν α. διαφορετική περίοδο ταλάντωσης. β. διαφορετική συχνότητα ταλάντωσης. γ. διαφορά φάσης π (rad). δ. ίδια φάση. ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ ΑΣ Μονάδες 5

24 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ 4. Στον παρακάτω πίνακα, στη Στήλη Ι, αναφέρονται διάφορα φυσικά μεγέθη, ενώ στη Στήλη ΙΙ αναφέρονται μονάδες μέτρησης των μεγεθών στο S.I. Να γράψετε στο τετράδιό σας τους αριθμούς της Στήλης Ι και ακριβώς δίπλα σε κάθε αριθμό ένα γράμμα από τη Στήλη ΙΙ, ώστε να δημιουργείται σωστή αντιστοίχιση. (ένα δεδομένο της Στήλης ΙΙ περισσεύει). Στήλη Ι 1. Ροπή αδράνειας α. rad/s 2. Στροφορμή β. N. m 3. Γωνιακή ταχύτητα γ. kg. m 2 4. Ροπή δύναμης δ. m/s 2 5. Ένταση ηλεκτρικού πεδίου ε. V/m στ. kg. m 2 /s Στήλη ΙΙ Μονάδες 5 5. Να χαρακτηρίσετε αν το περιεχόμενο των ακόλουθων προτάσεων είναι σωστό ή λανθασμένο, γράφοντας στο τετράδιό σας την ένδειξη (Σ) ή (Λ) δίπλα στο γράμμα που αντιστοιχεί στην κάθε πρόταση. α. Η περίοδος φθίνουσας ταλάντωσης, για ορισμένη τιμή της σταθεράς απόσβεσης, διατηρείται σταθερή. β. Το φαινόμενο Doppler εμφανίζεται στα μηχανικά κύματα και όχι στα ηλεκτρομαγνητικά. γ. Εάν η συνολική εξωτερική ροπή σε ένα σύστημα σωμάτων είναι μηδέν η ολική στροφορμή του συστήματος παραμένει σταθερή. δ. Η επιλογή ενός σταθμού στο ραδιόφωνο στηρίζεται στο φαινόμενο του συντονισμού. ε. Τα ηλεκτρομαγνητικά κύματα είναι εγκάρσια. Μονάδες 5 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ ΑΣ

25 ΘΕΜΑ 2ο ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ 2.1. Μονοχρωματική ακτίνα φωτός προσπίπτει στη διαχωριστική επιφάνεια μεταξύ γυαλιού και αέρα προερχόμενη από το γυαλί. Αν η ταχύτητα διάδοσης της ακτίνας στο γυαλί είναι υ και στον αέρα c (υ c), τότε για την κρίσιμη γωνία θ crit ισχύει η σχέση α. c ημθ crit = β. υ 2 υ υ ημθ crit = γ. ημθ crit =. 2 c c Να επιλέξετε το γράμμα που αντιστοιχεί στη σωστή σχέση. Να δικαιολογήσετε την επιλογή σας. Μονάδες 2 Μονάδες Μια λεπτή και ομογενής ράβδος ΑΒ μπορεί να περιστρέφεται είτε γύρω από τον άξονα x είτε γύρω από τον άξονα y. Οι άξονες αυτοί είναι κάθετοι στη ράβδο και βρίσκονται εκατέρωθεν του μέσου Ο της ράβδου. Αν α, β είναι η απόσταση κάθε άξονα από τα άκρα της ράβδου, όπως φαίνεται στο σχήμα, και ισχύει α > β ο λόγος των ροπών αδράνειας της ράβδου Ι x, Ι y ως προς τους άξονες x,y αντίστοιχα είναι Ι α. x Ι Ι = 1 β. x > 1 γ. x < 1. I I I y y Να επιλέξετε το γράμμα που αντιστοιχεί στη σωστή σχέση. Μονάδες 2 Να δικαιολογήσετε την επιλογή σας. y Μονάδες 6 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ ΑΣ

26 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ 2.3. ύο μικρά σώματα με μάζες m 1 και m 2 συγκρούονται κεντρικά και ελαστικά. Αν Κ 1 είναι η μεταβολή της κινητικής ενέργειας του σώματος μάζας m 1 και Κ 2 είναι η μεταβολής της κινητικής ενέργειας του σώματος μάζας m 2 λόγω της ελαστικής κρούσης, τότε ισχύει Κ α. 1 Κ = 1 β. 1 = 1 γ. Κ Κ 2 2 Κ 1 m = 1. Κ Να επιλέξετε το γράμμα που αντιστοιχεί στη σωστή σχέση. Μονάδες 2 Να δικαιολογήσετε την επιλογή σας. Μονάδες 7 ΘΕΜΑ 3ο Ομογενής δίσκος μάζας m = 40 kg και ακτίνας R = 20 cm στρέφεται με γωνιακή συχνότητα ω = 5 rad/s γύρω από σταθερό άξονα που διέρχεται από το κέντρο του και είναι κάθετος σ αυτόν. Να υπολογίσετε: α. Την κινητική ενέργεια του δίσκου λόγω της περιστροφής του. β. Το μέτρο της αρχικής στροφορμής του δίσκου. 2 m 2 Μονάδες 6 Μονάδες 6 γ. Τη μέση ισχύ της ροπής (σε απόλυτη τιμή) που θα ακινητοποιήσει το δίσκο σε χρόνο 5 s. Μονάδες 6 δ. Το μέτρο της σταθερής ροπής που ακινητοποιεί το δίσκο σε χρόνο 5 s. Μονάδες 7 ίνεται ότι η ροπή αδράνειας του δίσκου ως προς τον 2 mr άξονα περιστροφής του είναι Ι=. 2 ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ ΑΣ

27 ΘΕΜΑ 4ο ΑΡΧΗ 5ΗΣ ΣΕΛΙ ΑΣ N Κατακόρυφο ελατήριο σταθεράς Κ = 100 έχει το κάτω m άκρο του στερεωμένο στο δάπεδο. Στο επάνω άκρο του ελατηρίου έχει προσδεθεί σώμα Σ 1 με μάζα Μ = 4 kg που ισορροπεί. εύτερο σώμα Σ 2 με μάζα m = 1 kg βρίσκεται πάνω από το πρώτο σώμα Σ 1 σε άγνωστο ύψος h, όπως φαίνεται στο σχήμα. π Μετακινούμε το σώμα Σ 1 προς τα κάτω κατά d = m και το 20 αφήνουμε ελεύθερο, ενώ την ίδια στιγμή αφήνουμε ελεύθερο και το δεύτερο σώμα Σ 2. α. Να υπολογίσετε την τιμή του ύψους h ώστε τα δύο σώματα να συναντηθούν στη θέση ισορροπίας του σώματος Σ 1. Μονάδες 6 β. Αν η κρούση των δύο σωμάτων είναι πλαστική να δείξετε ότι το συσσωμάτωμα αμέσως μετά την κρούση ακινητοποιείται στιγμιαία. Μονάδες 6 γ. Να υπολογίσετε το πλάτος της ταλάντωσης του συσσωματώματος. Μονάδες 6 δ. Να υπολογίσετε το μέτρο της μέγιστης δύναμης που ασκεί το ελατήριο στο συσσωμάτωμα. ίνεται g= 10 m/s 2. Να θεωρήσετε ότι π Μονάδες 7 ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ ΑΣ

28 ΑΡΧΗ 6ΗΣ ΣΕΛΙ ΑΣ Ο ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιό σας. 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα, τα οποία και θα καταστραφούν μετά το πέρας της εξέτασης. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 6ΗΣ ΣΕΛΙ ΑΣ

29 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 13 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Στις ερωτήσεις 1.1 έως και 1.3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1.1 Το άτομο ενός στοιχείου έχει ηλεκτρονιακή δομή: [Ar]3d 2 4s 2. Ποιος είναι ο ατομικός αριθμός του στοιχείου αυτού; α. 20 β. 21 γ. 22 δ. 23 Μονάδες Ποιο από τα παρακάτω ιόντα δεν έχει ηλεκτρονιακή δομή 1s 2 στη θεμελιώδη κατάσταση; α. β. γ. δ. 1 H 2 He 3Li 4Be Μονάδες 5 H 2 O 1.3 Ποια από τις επόμενες χημικές ενώσεις αντιδρά με το σε κατάλληλες συνθήκες και δίνει τελικό προϊόν προπανόνη; α. CH3CH2C N β. CH 3CH = CH2 γ. CH 3 C CH δ. CH3CH2CH2MgX Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ ΑΣ

30 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ 1.4 Να μεταφέρετε στο τετράδιό σας την παρακάτω πρόταση σωστά συμπληρωμένη, χρησιμοποιώντας ένα από τα: δεν αλλάζει, αυξάνεται, ελαττώνεται. Με την προσθήκη νερού σε υδατικό διάλυμα HCOOH και σε σταθερή θερμοκρασία, ο βαθμός ιοντισμού του οξέος.. και η συγκέντρωση των ιόντων + H 3 O του διαλύματος... Μονάδες Ακόρεστος υδρογονάνθρακας Χ δίνει αντιδράσεις προσθήκης με τα αντιδραστήρια της Στήλης Ι και προκύπτουν τα προϊόντα που αναγράφονται στη Στήλη ΙΙ. Στήλη Ι (αντιδραστήριο προσθήκης) Στήλη ΙΙ (προϊόν προσθήκης) 1. HCl α. 2 βουτανόλη 2. Cl 2 β. βουτάνιο 3. H 2 O γ. 1,2 διχλωροβουτάνιο 4. H 2 δ. 2 χλωροβουτάνιο i. Να γράψετε στο τετράδιό σας τους αριθμούς της Στήλης Ι και δίπλα από κάθε αριθμό ένα γράμμα της Στήλης ΙΙ, ώστε να προκύπτει σωστή αντιστοίχιση. ΘΕΜΑ 2ο Μονάδες 4 ii. Να γράψετε το συντακτικό τύπο του υδρογονάνθρακα Χ. Μονάδες Το παρακάτω διάγραμμα αναπαριστά ένα μέρος του Περιοδικού Πίνακα όπου σημειώνονται μερικά στοιχεία με τα σύμβολά τους. Mg Al O F K Fe α. Ποιο από τα στοιχεία αυτά έχει τη μεγαλύτερη ενέργεια πρώτου ιοντισμού; Μονάδα 1 β. Ποιο από τα στοιχεία αυτά σχηματίζει έγχρωμα σύμπλοκα ιόντα; Μονάδα 1 He ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ ΑΣ

31 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ γ. Ποιο από τα στοιχεία αυτά έχει τη μεγαλύτερη ατομική ακτίνα; Μονάδα 1 δ. Να γράψετε την ηλεκτρονιακή δομή σε υποστιβάδες των ατόμων των στοιχείων Mg και F στη θεμελιώδη κατάσταση. Μονάδες 2 ε. Να γράψετε τον ηλεκτρονιακό τύπο κατά Lewis της χημικής ένωσης μεταξύ των στοιχείων Mg και F. Μονάδες Να εξηγήσετε γιατί το ρυθμιστικό διάλυμα CH 3 COOH / CH 3 COONa διατηρεί πρακτικά το ph του σταθερό, γράφοντας και τις κατάλληλες χημικές εξισώσεις, αν στο διάλυμα αυτό προσθέσουμε: i. μικρή ποσότητα HCl ii. μικρή ποσότητα NaOH Μονάδες ίνονται οι οργανικές ενώσεις: Α: CH 3 CH 2 Cl B: CH 3 CH 2 OH Γ: CH 2 =CH 2 Να γράψετε τη χημική εξίσωση για καθεμιά από τις παρακάτω χημικές μετατροπές: i. μετατροπή της Α στη Β. ii. μετατροπή της Β στη Γ. iii. μετατροπή της Α στη Γ. Μονάδες 9 ΘΕΜΑ 3ο ίνεται το παρακάτω διάγραμμα χημικών μετατροπών: ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ ΑΣ

32 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ α. Να γράψετε τους συντακτικούς τύπους των οργανικών ενώσεων Α, Β, Γ,, Ε και Ζ. Μονάδες 12 β. Να γράψετε τη χημική εξίσωση της αντίδρασης μεταξύ της ένωσης Β και του NaHCO 3. Μονάδες 6 γ. Ποσότητα 0,1 mol της ένωσης B αντιδρά πλήρως με NaHCO 3. Να υπολογίσετε τον όγκο του αερίου που εκλύεται σε STP συνθήκες. Μονάδες 7 ΘΕΜΑ 4ο ιαθέτουμε υδατικό διάλυμα 1 όγκου 2L που περιέχει 0,1 mol CH 3 COOH και έχει ph=3. Στο διάλυμα 1 προσθέτουμε 4g στερεού NaOH, οπότε σχηματίζεται διάλυμα 2 όγκου 2L. Στο διάλυμα 2 διαβιβάζουμε 0,05 mol αερίου HCl και τελικά προκύπτει διάλυμα 3 όγκου 2L. Να υπολογίσετε: α. το βαθμό ιοντισμού του CH 3 COOH στο διάλυμα 1 και τη σταθερά ιοντισμού του CH 3 COOH. Μονάδες 8 β. Τη συγκέντρωση των ιόντων ΟΗ στο διάλυμα 2. Μονάδες 8 γ. Τη συγκέντρωση των ιόντων Η 3 Ο + στο διάλυμα 3. Μονάδες 9 ίνεται ότι όλα τα διαλύματα βρίσκονται στους 25 ο C και Κ w = Οι σχετικές ατομικές μάζες των στοιχείων είναι: Na:23, Η:1, Ο:16. Τα αριθμητικά δεδομένα του προβλήματος επιτρέπουν τις γνωστές προσεγγίσεις. Ο ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιο. ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ ΑΣ

33 ΑΡΧΗ 5ΗΣ ΣΕΛΙ ΑΣ 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοτυπιών. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ ΑΣ

34 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως και 5 και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. 1. Το σύνδρομο φωνή της γάτας (cri du chat) οφείλεται σε α. γονιδιακή μετάλλαξη. β. έλλειψη τμήματος ενός χρωμοσώματος. γ. επίδραση ιών και βακτηρίων. δ. προσθήκη βάσεων και νουκλεοτιδίων. Μονάδες 5 2. Πολύσωμα είναι α. το οργανίδιο που γίνεται η πρωτεϊνοσύνθεση. β. ομάδα ριβοσωμάτων στο κυτταρόπλασμα. γ. το σύνολο των εξωνίων του ώριμου mrna. δ. το σύμπλεγμα πολλών ριβοσωμάτων με το mrna. Μονάδες 5 3. Το άγαρ είναι α. πολυσακχαρίτης που προέρχεται από φύκη. β. πρωτεΐνη που προέρχεται από φύκη. γ. πηγή αζώτου για τις κυτταροκαλλιέργειες. δ. ρευστό υλικό σε θερμοκρασίες κάτω από 45 ο C. Μονάδες 5 4. Τα γονίδια που ενεργοποιούν φυσιολογικά τον κυτταρικό πολλαπλασιασμό είναι α. τα ογκογονίδια. β. τα ρυθμιστικά γονίδια. γ. τα πρωτο-ογκογονίδια. δ. τα ογκοκατασταλτικά γονίδια. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ ΑΣ

35 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ 5. Η γονιδιακή θεραπεία α. εφαρμόζεται μόνο στα λεμφοκύτταρα. β. έχει ως στόχο να διορθώσει μια γενετική βλάβη. γ. αντικαθιστά πολλά μεταλλαγμένα γονίδια. δ. μεταβιβάζεται πάντοτε στους απογόνους. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. Τι εννοούμε με τον όρο γονιδίωμα; Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή; Μονάδες 8 2. Ποια ονομάζουμε διαγονιδιακά ζώα και με ποιο τρόπο δημιουργούνται; Μονάδες 9 3. Τι είναι μονοκλωνικά αντισώματα και ως τι χρησιμοποιούνται; Μονάδες 8 ΘΕΜΑ 3ο Α. Φυτό Α διασταυρώνεται με φυτό Β, του ιδίου είδους, που έχει κόκκινα άνθη. Από τη διασταύρωση αυτή παίρνουμε φυτά με λευκά και κόκκινα άνθη. Το κόκκινο χρώμα καθορίζεται από υπολειπόμενο γονίδιο. 1. Να γράψετε τη διασταύρωση μεταξύ των φυτών Α και Β και να δικαιολογήσετε το γονότυπο του φυτού Α. Μονάδες 9 2. Τι ονομάζεται διασταύρωση ελέγχου και για ποιο σκοπό τη χρησιμοποιούμε; Μονάδες 6 Β. Η αλληλουχία των βάσεων του mrna καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση ένα ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ ΑΣ

36 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ κώδικα αντιστοίχισης νουκλεοτιδίων mrna με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. 1. Τι σημαίνει η έκφραση «ο γενετικός κώδικας είναι συνεχής και σχεδόν καθολικός»; Μονάδες 5 2. Γιατί ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος; Μονάδες 5 ΘΕΜΑ 4ο ίνεται το παρακάτω τμήμα DNA ενός προκαρυωτικού οργανισμού: 5 CCAGΑATTCAATTCAGGACGAAAAGAATTCAAC 3 3 GGTCTTAAGTTAAGTCCTGCTTTΤCTTAAGTTG 5 To παραπάνω τμήμα DNA κόβεται με περιοριστική ενδονουκλεάση EcoRI. Να γράψετε το τμήμα DNA που προκύπτει μετά από τη δράση της EcoRI και να δικαιολογήσετε την απάντησή σας. Μονάδες 8 Το τμήμα του DNA που προέκυψε μετά τη δράση της EcoRI μεταγράφεται. Ποια αλυσίδα από αυτό το DNA μεταγράφεται και γιατί; Μονάδες 6 Να γράψετε την αλληλουχία του mrna που προκύπτει από αυτή τη μεταγραφή και να σημειώσετε το 5 και το 3 άκρο της. Μονάδες 6 Ποιοι οργανισμοί διαθέτουν περιοριστικές ενδονουκλεάσες και ποιος είναι ο φυσιολογικός τους ρόλος; Μονάδες 5 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ ΑΣ

37 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ Ο ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιο. 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 6. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ ΑΣ

38 AΡΧΗ 1ης ΣΕΛΙ ΑΣ ΚΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΕΞΕΤΑΣΕΩΝ ΕΙ ΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΕΛΛΗΝΩΝ ΕΞΩΤΕΡΙΚΟΥ ΕΥΤΕΡΑ 18 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΚΟΙΝΗ ΕΞΕΤΑΣΗ ΟΛΩΝ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΑ ΑΓΓΛΙΚΑ Α. Να αποδώσετε στο τετράδιό σας στην ελληνική γλώσσα το παρακάτω κείμενο, προσδίδοντάς του τη μορφή που θα έπρεπε να έχει, αν επρόκειτο να δημοσιευθεί σε ελληνικό έντυπο: Thousands of undergraduate students are being forced to sign good behaviour contracts with their universities and warned they could be expelled if they breach regulations. The contracts put the onus on students to attend lectures and tutorials, but have been condemned by the National Union of Students. The NUS claims the contracts are one-sided, and do not spell out what standard of teaching students should expect to get for the 3,000-a-year tuition fees they are being charged. The NUS will oppose any arrangements not agreed with students and is calling for a debate over the obligations on all sides in an era when most undergraduates in England must use loans to fund their fees. Contracts so far contain get-out clauses allowing universities to change the way courses are taught because of cuts, the need for institutional efficiency or changes in educational practice, as long as the alterations are reasonable. Both the government and the universities insist such contracts are a matter for individual institutions. Chester University said its document is designed to protect the legitimate needs of the university s conscientious students, and to safeguard its resources from potentially vexatious claims. THE GUARDIAN, Sept. 11, 2006 onus : υποχρέωση, βάρος vexatious : ενοχλητικός, εκνευριστικός (25 points) ΤΕΛΟΣ 1ης ΣΕΛΙ ΑΣ

39 AΡΧΗ 2ης ΣΕΛΙ ΑΣ Β. Να απαντήσετε στο τετράδιό σας στα αγγλικά στις παρακάτω ερωτήσεις: B1. a. Give a title to the above article. (4 points) b. Rephrase the following by using your own words to express the meaning of the text: Thousands of undergraduate students are being forced to sign good behaviour contracts with their universities and warned they could be expelled if they breach regulations. (6 points) c. The NUS claims the contracts are one-sided.. In a paragraph of about 40 words explain what the NUS means by that. (5 points) B2. a. Is good behaviour a matter of contracts or of educational background? Give two reasons to justify your answer. (5 points) b. How can a university student get the best out of his studies? Mention at least three ways in a short paragraph of about 40 words. (6 points) c. What should a university do in order to guarantee the best standard of studies in terms of teaching staff, facilities e.t.c.? In a short paragraph suggest at least four ideas. (4 points) ΤΕΛΟΣ 2ης ΣΕΛΙ ΑΣ

40 AΡΧΗ 3ης ΣΕΛΙ ΑΣ Γ. Να γράψετε κείμενο λέξεων με θέμα: A survey is being carried out about the reasons which lead students to choose their field of studies. Write an article for a school magazine discussing the students choices concerning their own field of studies. (45 points) Ο ΗΓΙΕΣ 1. Να δοθούν απαντήσεις σε όλα τα ζητήματα. Κάθε απάντηση που καλύπτει εννοιολογικά και γλωσσικά τα ζητήματα είναι αποδεκτή. 2. Τα θέματα και οι οδηγίες θα αναπαραχθούν και θα διανεμηθούν στους υποψήφιους. εν θα εκφωνηθούν και δεν θα γραφούν στον πίνακα. 3. Τα θέματα (αγγλικό κείμενο - ερωτήσεις στα αγγλικά - θέμα «έκθεσης» στα αγγλικά) δεν θα αντιγραφούν στο τετράδιο. 4. Να μη μεταφραστεί ο τίτλος και η ημερομηνία του εντύπου. 5. Οι υποψήφιοι θα επιστρέψουν τις φωτοτυπίες των θεμάτων κατά την αποχώρησή τους στους επιτηρητές, οι οποίοι και θα τις καταστρέψουν. 6. ιάρκεια εξέτασης: Τρεις (3) ώρες. Έναρξη χρόνου εξέτασης: Αμέσως μετά τη διανομή των φωτοτυπιών στους υποψήφιους. υνατότητα αποχώρησης: Μία (1) ώρα μετά την έναρξη του χρόνου εξέτασης. 7. Η διάρκεια εξέτασης και ο χρόνος δυνατής αποχώρησης να γραφούν στον πίνακα. ΚΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 3ης ΣΕΛΙ ΑΣ

41 ΑΡΧΗ 1ης ΣΕΛΙ ΑΣ ΚΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΕΞΕΤΑΣΕΩΝ ΕΙ ΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΕΛΛΗΝΩΝ ΕΞΩΤΕΡΙΚΟΥ ΕΥΤΕΡΑ 25 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΚΟΙΝΗ ΕΞΕΤΑΣΗ ΟΛΩΝ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΗΝ ΑΡΜΟΝΙΑ ίνεται το παρακάτω θέμα (μελωδία): Να εναρμονισθεί η μελωδία αυτή σε τέσσερις (4) φωνές. ΤΕΛΟΣ 1ης ΣΕΛΙ ΑΣ

42 ΑΡΧΗ 2ης ΣΕΛΙ ΑΣ ΙΕΥΚΡΙΝΙΣΕΙΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ Α. Η εναρμόνιση του θέματος μπορεί να γραφεί σε δύο πεντάγραμμα με δύο κλειδιά κατά τον (α) ή (β) τρόπο, αλλά όχι με ανάμιξή τους. (Βλέπε το παρακάτω παράδειγμα). Παράδειγμα: Β. Η χρησιμοποίηση δυνατοτήτων εναρμόνισης του θέματος που είναι επιπλέον του υποχρεωτικού αρμονίας επιτρέπεται. Γ. Περισσότερες από μία εναρμονίσεις του θέματος ή τμημάτων του δεν επιτρέπονται.. Για πρόχειρο μπορούν να χρησιμοποιηθούν οι τέσσερις (4) τελευταίες σελίδες του τετραδίου. ΚΑΝΟΝΕΣ Οι κρυμμένες πέμπτες και όγδοες επιτρέπονται: α. Μεταξύ των δύο εξωτερικών φωνών, όταν η οξύτερη (ψηλότερη) φωνή προχωρεί κατά διάστημα δευτέρας. β. Μεταξύ εξωτερικών και εσωτερικών ή μεταξύ εσωτερικών φωνών σε κάθε περίπτωση. Πέμπτες και όγδοες αντιπαράλληλες απαγορεύονται μεταξύ των δύο εξωτερικών φωνών, αλλά επιτρέπονται μεταξύ εξωτερικής και εσωτερικής φωνής ή μεταξύ δύο εσωτερικών φωνών. Κατά τα άλλα ισχύει ό,τι περιλαμβάνει η ύλη του υποχρεωτικού αρμονίας. ΤΕΛΟΣ 2ης ΣΕΛΙ ΑΣ

43 ΑΡΧΗ 3ης ΣΕΛΙ ΑΣ Ο ΗΓΙΕΣ 1. Στο τετράδιο θα αντιγραφεί μόνο το θέμα (μελωδία). 2. Οι υποψήφιοι, πριν αρχίσουν να γράφουν, πρέπει να διαβάσουν προσεκτικά τις διευκρινίσεις, τους κανόνες και τις οδηγίες. 3. Μετά την αναπαραγωγή του θέματος να διανεμηθεί στους υποψηφίους από μία φωτοτυπία και των τριών (3) σελίδων. 4. Οι φωτοτυπίες επιστρέφονται στους επιτηρητές από τους υποψηφίους κατά την αποχώρησή τους και στη συνέχεια καταστρέφονται από τους επιτηρητές. 5. Το θέμα δεν θα εκφωνηθεί και δεν θα γραφεί στον πίνακα. 6. ιάρκεια εξέτασης: Τρεις (3) ώρες. Έναρξη χρόνου εξέτασης: δέκα (10) λεπτά μετά τη διανομή των φωτοτυπιών στους υποψηφίους. υνατότητα αποχώρησης: Μία (1) ώρα μετά την έναρξη του χρόνου εξέτασης. 7. Η διάρκεια εξέτασης και ο χρόνος δυνατής αποχώρησης να αναγραφούν στον πίνακα. ΚΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 3ης ΣΕΛΙ ΑΣ

44 ΑΡΧΗ 1ης ΣΕΛΙ ΑΣ ΚΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΕΞΕΤΑΣΕΩΝ ΕΙΔΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΕΛΛΗΝΩΝ ΕΞΩΤΕΡΙΚΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΚΟΙΝΗ ΕΞΕΤΑΣΗ ΟΛΩΝ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΑ ΓΑΛΛΙΚΑ Α. Να αποδώσετε στο τετράδιό σας στην ελληνική γλώσσα το παρακάτω κείμενο, προσδίδοντάς του τη μορφή που θα έπρεπε να έχει, αν επρόκειτο να δημοσιευθεί σε ελληνικό έντυπο. Après 30 jours de foot, 64 matchs et plusieurs centaines de milliers de visiteurs venus du monde entier, l Allemagne se calme. Elle gardera sans nul doute la trace de cet événement. En particulier les jeunes, qui ont directement participé à l organisation. En tout, personnes ont travaillé bénévolement pour la FIFA, 58% d entre elles avaient moins de 30 ans. Anne, 18 ans, a travaillé quatre fois par semaine pendant sept heures. Elle était heureuse d accueillir le monde dans son propre pays. «Pendant mon travail, je n ai rencontré que des gens gentils et joyeux», se réjouit-elle, décrivant l atmosphère cosmopolite de la ville. Comme elle, l Allemagne était à la fête. Pas seulement en raison de la présence des supporteurs étrangers, mais aussi grâce à l enthousiasme des Allemands, habituellement réservés, qui se sont montrés passionnés. Beaucoup espèrent que ce sentiment ne disparaîtra pas avec le Mondial. Alexander, 19 ans, bénévole à la section sécurité au stade de Berlin, a vu tous les matchs berlinois en direct. Il a été impressionné par l ouverture d esprit des gens de tous les âges et de toutes les nationalités. Ils n ont pas seulement prouvé que l Allemagne est un pays ouvert et hospitalier, mais aussi créé une attitude pleine d espoir. Les clés de l actualité, N o 673, juillet-août 2006 (25 points) ΤΕΛΟΣ 1ης ΣΕΛΙ ΑΣ

Διδαγμένο κείμενο Πλάτωνος Πρωταγόρας (322a-d)

Διδαγμένο κείμενο Πλάτωνος Πρωταγόρας (322a-d) ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 25 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) Διδαγμένο

Διαβάστε περισσότερα

ιδαγμένο κείμενο Πλάτωνος Πρωταγόρας 322b6-323a3

ιδαγμένο κείμενο Πλάτωνος Πρωταγόρας 322b6-323a3 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 11 ΙΟΥΛΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ιδαγμένο

Διαβάστε περισσότερα

r r r r r r r r r r r Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

r r r r r r r r r r r Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ Γ ΤΑΞΗΣ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΑΡΑΣΚΕΥΗ 0 ΜΑÏΟΥ 011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΕΥΤΕΡΑ, 25 ΜΑΪΟΥ 2015

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΕΥΤΕΡΑ, 25 ΜΑΪΟΥ 2015 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΕΥΤΕΡΑ, 25 ΜΑΪΟΥ 2015 Α. Έτσι λοιπόν εφοδιασμένοι οι άνθρωποι αρχικά κατοικούσαν σκόρπια, ενώ δεν υπήρχαν

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ 2002 ΘΕΜΑΤΑ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 6 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΥΟ ΚΥΚΛΩΝ): ΦΥΣΙΚΗ

Διαβάστε περισσότερα

Μονάδες 5 1.3 β. Μονάδες 5 1.4 Μονάδες 5

Μονάδες 5 1.3 β. Μονάδες 5 1.4 Μονάδες 5 ΘΕΜΑ 1 ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 29 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΠΤΑ (7) Για τις ημιτελείς

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ ΘΕΜΑΤΑ ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΠΑΝΕΛΛΗΝΙΕΣ 2008 ΘΕΜΑΤΑ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 29 ΜΑÏΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ

Διαβάστε περισσότερα

ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΕΣΠΕΡΙΝΟΥ ΕΠΑΛ (ΟΜΑ ΑΣ Β ) ΠΕΜΠΤΗ 27 MAΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Α1. Από το παραπάνω κείμενο να γράψετε στο τετράδιό σας τη μετάφραση του αποσπάσματος: «Οὕτω δὴ παρεσκευασμένοι... φιλίας συναγωγοί».

Α1. Από το παραπάνω κείμενο να γράψετε στο τετράδιό σας τη μετάφραση του αποσπάσματος: «Οὕτω δὴ παρεσκευασμένοι... φιλίας συναγωγοί». ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 25 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) Διδαγμένο κείμενο Πλάτωνος Πρωταγόρας

Διαβάστε περισσότερα

3. Σε στάσιμο κύμα δύο σημεία του ελαστικού μέσου βρίσκονται μεταξύ δύο διαδοχικών δεσμών. Τότε τα σημεία αυτά έχουν

3. Σε στάσιμο κύμα δύο σημεία του ελαστικού μέσου βρίσκονται μεταξύ δύο διαδοχικών δεσμών. Τότε τα σημεία αυτά έχουν ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΠΑΛ (ΟΜΑ Α Β ) ΕΥΤΕΡΑ 25 ΜΑÏΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ιδαγμένο κείμενο Αριστοτέλους Πολιτικά Θ 2.1-4

ιδαγμένο κείμενο Αριστοτέλους Πολιτικά Θ 2.1-4 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ιδαγμένο κείμενο Αριστοτέλους

Διαβάστε περισσότερα

ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΕΣΠΕΡΙΝΟΥ ΕΠΑΛ (ΟΜΑ ΑΣ Β ) ΠΕΜΠΤΗ 27 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 6 ΙΟΥΛΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Για τις ερωτήσεις

Διαβάστε περισσότερα

α. f A = f s β. f A = f s υ + υ γ. f A = f s δ. f A =

α. f A = f s β. f A = f s υ + υ γ. f A = f s δ. f A = ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΕΜΠΤΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

Μονάδες 5. Μονάδες 5. Μονάδες 5. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ

Μονάδες 5. Μονάδες 5. Μονάδες 5. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΘΕΜΑ ο ΑΡΧΗ ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ ΠΡΟΣΟΜΟΙΩΣΗΣ Γ ΤΑΞΗΣ ου ΓΕΛ ΠΕΤΡΟΥΠΟΛΗΣ ΔΕΥΤΕΡΑ 3 ΜΑΪΟΥ 200 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ : ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ () Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 9 ΜΑΪΟΥ 015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ

Διαβάστε περισσότερα

αποτελεί παράδειγμα: α. εφαρμογής του κανόνα του Markovnikov β. εφαρμογής του κανόνα του Saytzev γ. αντίδρασης προσθήκης δ. αντίδρασης υποκατάστασης

αποτελεί παράδειγμα: α. εφαρμογής του κανόνα του Markovnikov β. εφαρμογής του κανόνα του Saytzev γ. αντίδρασης προσθήκης δ. αντίδρασης υποκατάστασης ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 1 ΙΟΥΝΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Για τις ερωτήσεις

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 19 ΙΟΥΝΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΛΟΓΟΤΕΧΝΙΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΛΟΓΟΤΕΧΝΙΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΛΟΓΟΤΕΧΝΙΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Δ'. ΚΕΙΜΕΝΟ 'Οδυσσέας Ελύτης (1911-1996) Μικρή Πράσινη Θάλασσα Μικρή πράσινη θάλασσα δεκατριώ χρονώ Που θα θελα να σε υιοθετήσω Να σε στείλω σχολείο στην Ιωνία

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 0 0 5 Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΘΕΜΑ 1 o Για τις ερωτήσεις 1 4, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ Θέμα Α ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 9 ΜΑΪΟΥ 015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ

Διαβάστε περισσότερα

1) Πάνω σε ευθύγραµµο οριζόντιο δρόµο ένας τροχός κυλάει χωρίς να ολισθαίνει. Ποιες από τις παρακάτω σχέσεις είναι σωστές ;

1) Πάνω σε ευθύγραµµο οριζόντιο δρόµο ένας τροχός κυλάει χωρίς να ολισθαίνει. Ποιες από τις παρακάτω σχέσεις είναι σωστές ; 45 Χρόνια ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΣΑΒΒΑΪ Η-ΜΑΝΩΛΑΡΑΚΗ ΠΑΓΚΡΑΤΙ : Χρυσ Σµύρνης 3 : Τηλ.: 107601470 ΙΑΓΩΝΙΣΜΑ : ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 006 ΘΕΜΑ 1 1) Πάνω σε ευθύγραµµο οριζόντιο δρόµο ένας τροχός

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ιδαγμένο κείμενο Πλάτωνος Πρωταγόρας 324A C

ιδαγμένο κείμενο Πλάτωνος Πρωταγόρας 324A C ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 8 ΙΟΥΝΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Α4. Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες:

Α4. Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ)

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2005 - Γ' ΛΥΚΕΙΟΥ 7/6/2005 ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2005 - Γ' ΛΥΚΕΙΟΥ 7/6/2005 ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2005 - Γ' ΛΥΚΕΙΟΥ 7/6/2005 ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

Ã. ÁÓÉÁÊÇÓ ÐÅÉÑÁÉÁÓ Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ. ΘΕΜΑ 1 ο

Ã. ÁÓÉÁÊÇÓ ÐÅÉÑÁÉÁÓ Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ. ΘΕΜΑ 1 ο Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ο Στι ερωτήσει - 4 να γράψετε στο τετράδιό σα τον αριθµό των ερώτηση και δίπλα σε κάθε αριθµό το γράµµα που αντιστοιχεί στη σωστή απάντηση.. Τροχό κυλίεται πάνω σε οριζόντιο

Διαβάστε περισσότερα

ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΛΑΤΙΝΙΚΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5)

ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΛΑΤΙΝΙΚΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΛΑΤΙΝΙΚΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Α. Να µεταφράσετε στο τετράδιό σας το παρακάτω

Διαβάστε περισσότερα

ΘΕΜΑ 1ο 1.1 Να γράψετε στο τετράδιό σας τα φυσικά µεγέθη από τη Στήλη Ι και, δίπλα σε καθένα, τη µονάδα της Στήλης ΙΙ που αντιστοιχεί σ' αυτό.

ΘΕΜΑ 1ο 1.1 Να γράψετε στο τετράδιό σας τα φυσικά µεγέθη από τη Στήλη Ι και, δίπλα σε καθένα, τη µονάδα της Στήλης ΙΙ που αντιστοιχεί σ' αυτό. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΕΣΠΕΡΙΝΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 5 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ: ΦΥΣΙΚΗ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΕΠΤΑ (7) ΘΕΜΑ 1ο 1.1 Να γράψετε στο τετράδιό σας τα

Διαβάστε περισσότερα

ΕΠΙΜΕΛΕΙΑ: ΓΑΛΑΝΑΚΗΣ ΓΙΩΡΓΟΣ ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΣ ΜΙΧΑΛΗΣ

ΕΠΙΜΕΛΕΙΑ: ΓΑΛΑΝΑΚΗΣ ΓΙΩΡΓΟΣ ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΣ ΜΙΧΑΛΗΣ ΘΕΜΑ Α Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί η σωστή απάντηση 1. Δίσκος κυλίεται χωρίς να ολισθαίνει με την επίδραση σταθερής οριζόντιας

Διαβάστε περισσότερα

Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. ΜΑΘΗΜΑ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΘΕΜΑ ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις - 4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.. Ένα σώµα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΘΕΜΑ Α ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ(5) Για τις προτάσεις

Διαβάστε περισσότερα

1 ο ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ-ΤΕΧΝΟΛΟΓΙΚΗΣ

1 ο ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ ΘΕΤΙΚΗΣ-ΤΕΧΝΟΛΟΓΙΚΗΣ ο ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΗΣ ΘΕΤΙΗΣ-ΤΕΧΝΟΛΟΓΙΗΣ ΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΕΙΟΥ Θέμα ο. ύλινδρος περιστρέφεται γύρω από άξονα που διέρχεται από το κέντρο μάζας του με γωνιακή ταχύτητα ω. Αν ο συγκεκριμένος κύλινδρος περιστρεφόταν

Διαβάστε περισσότερα

ΝΕΟΕΛΛΗΝΙΚΗ ΛΟΓΟΤΕΧΝΙΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΑΥΚΕΙΟΥ (27 /5/2004)

ΝΕΟΕΛΛΗΝΙΚΗ ΛΟΓΟΤΕΧΝΙΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΑΥΚΕΙΟΥ (27 /5/2004) ΝΕΟΕΛΛΗΝΙΚΗ ΛΟΓΟΤΕΧΝΙΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΑΥΚΕΙΟΥ (27 /5/2004) Α'. ΚΕΙΜΕΝΟ Ὀδυσσέας Ἐλύτης (1911-1996) Μικρή Πράσινη Θάλασσα Μικρή πράσινη θάλασσα δεκατριῶ χρονῶ Πού θά 'θελα νά σέ υἱοθετήσω Νά

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Τετάρτη 18 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Τετάρτη 18 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Ηµεροµηνία: Τετάρτη 18 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Στις ερωτήσεις 1 έως 4 να γράψετε στο τετράδιο σας τον αριθµό

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΦΥΣΙΚΗ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις - 4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Θέμα Α ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

Μονάδες 5 Απαντήσεις Α5. Σ, Σ, Λ, Λ, Σ

Μονάδες 5 Απαντήσεις Α5. Σ, Σ, Λ, Λ, Σ ΠΑΝΕΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΟΥ ΥΕΙΟΥ & ΕΠΑ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΕΥΗ 5 ΜΑÏΟΥ 0 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΗ ΘΕΤΙΗΣ & ΤΕΧΝΟΟΓΙΗΣ ΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α-Α4 να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ερωτήσεις και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Δύο χορδές μιας κιθάρας Χ1, Χ2

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝ/ΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝ/ΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 5 ΧΡΟΝΙΑ ΕΜΠΕΙΡΙΑ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝ/ΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Στις ερωτήσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και, δίπλα, το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ & ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΘΕΜΑ Στις ηµιτελείς προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθµό της πρότασης και δίπλα το γράµµα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Nα γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 Nα γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 9 Χρόνια ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΣΑΒΒΑΪ Η-ΜΑΝΩΑΡΑΚΗ ΠΑΓΚΡΑΤΙ : Φιλολάου & Εκφαντίδου 6 : Τηλ.: 076070 ΙΑΓΩΝΙΣΜΑ : ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΥΚΕΙΟΥ 009 ΘΕΜΑ Nα γράψετε στο τετράδιο σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΘΕΜΑ A ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ Θέμα Α ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΔΥΟ ΚΥΚΛΩΝ) Θέμα Α Στις

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ (Επαναληπτικός ιαγωνισμός)

Γ ΛΥΚΕΙΟΥ (Επαναληπτικός ιαγωνισμός) 4 Η ΠΑΓΚΥΠΡΙΑ ΟΛΥΜΠΙΑ Α ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ (Επαναληπτικός ιαγωνισμός) Κυριακή, 5 Απριλίου, 00, Ώρα:.00 4.00 Προτεινόμενες Λύσεις Άσκηση ( 5 μονάδες) Δύο σύγχρονες πηγές, Π και Π, που απέχουν μεταξύ τους

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα, που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα, που αντιστοιχεί στη σωστή απάντηση. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 MAΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε

Διαβάστε περισσότερα

ΑΡΧΗ 1 ΗΣ ΣΕΛΙΔΑΣ Γ ΛΥΚΕΙΟΥ ΦΡΟΝΤΙΣΤΗΡΙΑ ΘΕΩΡΙΑ ΚΑΙ ΠΡΑΞΗ ΔΙΑΓΩΝΙΣΜΑ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΝΤΙΚΕΙΜΕΝΟ: ΤΑΛΑΝΤΩΣΕΙΣ - ΚΥΜΑΤΑ

ΑΡΧΗ 1 ΗΣ ΣΕΛΙΔΑΣ Γ ΛΥΚΕΙΟΥ ΦΡΟΝΤΙΣΤΗΡΙΑ ΘΕΩΡΙΑ ΚΑΙ ΠΡΑΞΗ ΔΙΑΓΩΝΙΣΜΑ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΝΤΙΚΕΙΜΕΝΟ: ΤΑΛΑΝΤΩΣΕΙΣ - ΚΥΜΑΤΑ ΑΡΧΗ 1 ΗΣ ΣΕΛΙΔΑΣ Γ ΛΥΚΕΙΟΥ ΦΡΟΝΤΙΣΤΗΡΙΑ ΘΕΩΡΙΑ ΚΑΙ ΠΡΑΞΗ ΔΙΑΓΩΝΙΣΜΑ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΝΤΙΚΕΙΜΕΝΟ: ΤΑΛΑΝΤΩΣΕΙΣ - ΚΥΜΑΤΑ ΘΕΜΑ Α : Για να απαντήσετε στις παρακάτω ερωτήσεις πολλαπλής

Διαβάστε περισσότερα

ΘΕΜΑ Α Στις παρακάτω προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ Α Στις παρακάτω προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 53 Χρόνια ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΣΑΒΒΑΪΔΗ-ΜΑΝΩΛΑΡΑΚΗ ΠΑΓΚΡΑΤΙ : Φιλολάου & Εκφαντίδου 26 : Τηλ.: 2107601470 ΔΙΑΓΩΝΙΣΜΑ : ΦΥΣΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 2013 ΘΕΜΑ Α Στις παρακάτω προτάσεις Α1-Α4 να

Διαβάστε περισσότερα

ΘΕΜΑ Α Ι. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ Α Ι. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Ι. Στις ερωτήσεις 1-4 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΦΥΣΙΚΗ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 4 ΘΕΜΑ ο ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις - 4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση..

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ÓÕÍÅÉÑÌÏÓ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ÓÕÍÅÉÑÌÏÓ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΧΗΜΕΙΑ Ηµεροµηνία: Μ. Τετάρτη 16 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Α.1 Ποια από τις παρακάτω τετράδες κβαντικών αριθµών αντιστοιχεί

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΡΙΤΗ 10 ΙΟΥΝΙΟΥ 014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΔΥΟ

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 0 ΜΑΪΟΥ 015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) Θέμα Α Στις ερωτήσεις Α1-Α4

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. Ι ΑΓΜΕΝΟ ΚΕΙΜΕΝΟ Θουκυδίδου Περικλέους Ἐπιτάφιος (ΙΙ, 41)

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. Ι ΑΓΜΕΝΟ ΚΕΙΜΕΝΟ Θουκυδίδου Περικλέους Ἐπιτάφιος (ΙΙ, 41) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 6 IOYΝIOY 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ : ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ : ΠΕΝΤΕ (5) Ι ΑΓΜΕΝΟ ΚΕΙΜΕΝΟ Θουκυδίδου

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΓΑΛΑΝΑΚΗΣ ΓΙΩΡΓΟΣ ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΣ ΜΙΧΑΛΗΣ

ΓΑΛΑΝΑΚΗΣ ΓΙΩΡΓΟΣ ΔΗΜΗΤΡΑΚΟΠΟΥΛΟΣ ΜΙΧΑΛΗΣ ΘΕΜΑ Α Στις ερωτήσεις -4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί η σωστή απάντηση. Ένας ακίνητος τρoχός δέχεται σταθερή συνιστάμενη ροπή ως προς άξονα διερχόμενο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 Μάθηµα: ΦΥΣΙΚΗ Ηµεροµηνία και ώρα εξέτασης: Σάββατο, 4 Ιουνίου 2011 8:30 11:30

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 Μάθημα: Αρχαία Ελληνικά Ημερομηνία και ώρα εξέτασης: Τετάρτη, 27 Μαΐου 2009, ώρα

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα, που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα, που αντιστοιχεί στη σωστή απάντηση. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 MAΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1 ο Στις ερωτήσεις 1-4 να γράψετε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Θέµατα Εξετάσεων Γ Λυκείου Μαθηµατικά Θετικής και Τεχνολογικής Κατεύθυνσης 2000-2015

Θέµατα Εξετάσεων Γ Λυκείου Μαθηµατικά Θετικής και Τεχνολογικής Κατεύθυνσης 2000-2015 Θέµατα Εξετάσεων Γ Λυκείου Μαθηµατικά Θετικής και Τεχνολογικής Κατεύθυνσης 000-05 Περιεχόµενα Θέµατα Επαναληπτικών 05............................................. 3 Θέµατα 05......................................................

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 9 Μάθημα: ΦΥΣΙΚΗ 4ωρο Τ.Σ. Ημερομηνία και ώρα εξέτασης: Τρίτη Ιουνίου 9 11. 14. ΤΟ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΟΜΑ Α Α

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΟΜΑ Α Α ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γʹ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 7 ΜΑÏΟΥ 009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΗΛΕΚΤΡΟΛΟΓΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΥ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

Επαναληπτικό διαγώνισµα στα Κύµατα

Επαναληπτικό διαγώνισµα στα Κύµατα ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1 Επαναληπτικό διαγώνισµα στα Κύµατα Θέµα 1 0 Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Γ' ΤΑΞΗ ΓΕΝ.ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΤΑΞΗ ΓΕΝ.ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΕΚΦΩΝΗΣΕΙΣ Γ' ΤΑΞΗ ΓΕΝ.ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ & ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΦΥΣΙΚΗ ΘΕΜΑ ο ΕΚΦΩΝΗΣΕΙΣ. Αρµονικό κύµα διαδίδεται σε ένα εθύγραµµο ελαστικό µέσο. Όλα τα σηµεία το µέσο διάδοσης, πο ταλαντώνονται λόγω της διέλεσης

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ HMEΡΗΣΙΩΝ ΚΑΙ ΕΣΠΕΡΙΝΩΝ ΕΠΑΓΓΕΛΜΑΤΙΚΩΝ ΛΥΚΕΙΩΝ (ΟΜΑ Α A ) ΚΑΙ ΜΑΘΗΜΑΤΩΝ ΕΙ ΙΚΟΤΗΤΑΣ ΕΠΑΓΓΕΛΜΑΤΙΚΩΝ ΛΥΚΕΙΩΝ (ΟΜΑ Α Β ) ΤΡΙΤΗ 9 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΗΛΕΚΤΡΟΤΕΧΝΙΑ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 2 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΡΕΙΣ (3) Διδαγμένο

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. 2. Το σφάλµα προσέγγισης είναι πάντοτε θετικό. Μονάδες 1

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. 2. Το σφάλµα προσέγγισης είναι πάντοτε θετικό. Μονάδες 1 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 28 ΙΟΥΝΙΟΥ 1999 ΚΑΤΕΥΘΥΝΣΗ: ΤΕΧΝΟΛΟΓΙΚΗ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΜΑΘΗΜΑΤΙΚΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Να χαρακτηρίσετε στο τετράδιό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΡΧΑΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΡΧΑΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΡΧΑΙΑ ΚΑΤΕΥΘΥΝΣΗΣ A.1. ΜΕΤΑΦΡΑΣΗ Επομένως, ούτε εκ φύσεως, αλλά ούτε και αντίθετα προς τη φύση μας υπάρχουν μέσα μας οι αρετές, αλλά έχουμε από τη φύση

Διαβάστε περισσότερα

ΝΕΟΕΛΛΗΝΙΚΗ ΛΟΓΟΤΕΧΝΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΝΕΟΕΛΛΗΝΙΚΗ ΛΟΓΟΤΕΧΝΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΝΕΟΕΛΛΗΝΙΚΗ ΛΟΓΟΤΕΧΝΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ Α. ΚΕΙΜΕΝΟ Β. ΕΡΩΤΗΣΕΙΣ 1. Κάποια από τα χαρακτηριστικά της ποίησης του Οδ. Ελύτη ειναι: η ποιητική προσέγγιση του κόσµου µε τις

Διαβάστε περισσότερα

ΝΕΟΕΛΛΗΝΙΚΗ ΛΟΓΟΤΕΧΝΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΝΕΟΕΛΛΗΝΙΚΗ ΛΟΓΟΤΕΧΝΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΝΕΟΕΛΛΗΝΙΚΗ ΛΟΓΟΤΕΧΝΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 Α. ΚΕΙΜΕΝΟ Β. ΕΡΩΤΗΣΕΙΣ 1. Κάποια από τα χαρακτηριστικά της ποίησης του Οδ. Ελύτη ειναι: η ποιητική προσέγγιση του κόσµου µε τις αισθήσεις,

Διαβάστε περισσότερα

ΕΝΩΣΗ ΚΥΠΡΙΩΝ ΦΥΣΙΚΩΝ

ΕΝΩΣΗ ΚΥΠΡΙΩΝ ΦΥΣΙΚΩΝ 9η Ολυμπιάδα Φυσικής Γ Λυκείου (Β φάση) Κυριακή 9 Μαρτίου 01 Ώρα:.00-1.00 ΟΔΗΓΙΕΣ: 1. Το δοκιμιο αποτελειται απο εννεα (9) σελιδες και επτα (7) θεματα.. Να απαντησετε σε ολα τα θεματα του δοκιμιου.. Μαζι

Διαβάστε περισσότερα

ιαγώνισµα στις Ταλαντώσεις ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1

ιαγώνισµα στις Ταλαντώσεις ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1 ιαγώνισµα στις Ταλαντώσεις ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΤΑΙΧΜΙΟ 1 ΘΕΜΑ 1 0 Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Η ελληνική και η ευρωπαϊκή ταυτότητα

Η ελληνική και η ευρωπαϊκή ταυτότητα ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΔΙΑΓΩΝΙΣΜΑ ΕΝΔΟΦΡ/ΚΗΣ ΠΡΟΣΟΜΟΙΩΣΗΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΥΡΙΑΚΗ 14 ΔΕΚΕΜΒΡΙΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΝΕΟΕΛΛΗΝΙΚΗ ΓΛΩΣΣΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: (4) ΚΕΙΜΕΝΟ Η ελληνική

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΕΛΟΣ 1ΗΣ ΑΠΟ 6 ΣΕΛΙ ΕΣ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΕΛΟΣ 1ΗΣ ΑΠΟ 6 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΩΝ ΚΑΙ ΕΣΠΕΡΙΝΩΝ ΕΠΑΓΓΕΛΜΑΤΙΚΩΝ ΛΥΚΕΙΩΝ (ΟΜΑ Α A ) ΚΑΙ ΜΑΘΗΜΑΤΩΝ ΕΙ ΙΚΟΤΗΤΑΣ ΕΠΑΓΓΕΛΜΑΤΙΚΩΝ ΛΥΚΕΙΩΝ (ΟΜΑ Α Β ) ΕΥΤΕΡΑ 16 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

Διαβάστε περισσότερα

5. Να βρείτε τον ατομικό αριθμό του 2ου μέλους της ομάδας των αλογόνων και να γράψετε την ηλεκτρονιακή δομή του.

5. Να βρείτε τον ατομικό αριθμό του 2ου μέλους της ομάδας των αλογόνων και να γράψετε την ηλεκτρονιακή δομή του. Ερωτήσεις στο 2o κεφάλαιο από τράπεζα θεμάτων 1. α) Ποιος είναι ο μέγιστος αριθμός ηλεκτρονίων που μπορεί να πάρει κάθε μία από τις στιβάδες: K, L, M, N. β) Ποιος είναι ο μέγιστος αριθμός ηλεκτρονίων που

Διαβάστε περισσότερα

Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΘΕΩΡΗΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Α.1. Έτσι λοιπόν εφοδιασµένοι οι άνθρωποι στην αρχή κατοικούσαν διασκορπισµένοι, πόλεις όµως δεν υπήρχαν

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘEMA 1 ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ερωτήσεις 1-4 και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση A1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Φυσικών της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Φυσικών της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Φυσικών της Ώθησης 1 Τετάρτη, 20 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΦΥΣΙΚΗ ΘΕΜΑ Στις ημιτελείς προτάσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και δίπλα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑ Β Β1. Σωστό το β. Δόθηκε ότι οι μάζες των σωμάτων είναι ίσες, δηλαδή ma = mb. Με διαίρεση κατά μέλη των σχέσεων (1) και (2) έχουμε:

ΘΕΜΑ Β Β1. Σωστό το β. Δόθηκε ότι οι μάζες των σωμάτων είναι ίσες, δηλαδή ma = mb. Με διαίρεση κατά μέλη των σχέσεων (1) και (2) έχουμε: ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 6 ΙΟΥΛΙΟΥ 00 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α δ Α β Α β Α4 γ Α5. α Σ, β Λ,

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2014. 8:00-11:00 π.μ.

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2014. 8:00-11:00 π.μ. ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 014 Μάθημα: ΦΥΣΙΚΗ Ημερομηνία και ώρα εξέτασης: Δευτέρα, 6 Μαΐου 014 8:00-11:00 π.μ.

Διαβάστε περισσότερα

Πρόγραμμα θερινής περιόδου Γ Λυκείου 2015 2016. Από 22 Ιουνίου έως 24 Ιουλίου Διάρκεια προγράμματος: 5 εβδομάδες

Πρόγραμμα θερινής περιόδου Γ Λυκείου 2015 2016. Από 22 Ιουνίου έως 24 Ιουλίου Διάρκεια προγράμματος: 5 εβδομάδες Πρόγραμμα θερινής περιόδου Γ Λυκείου 2015 2016 Από 22 Ιουνίου έως 24 Ιουλίου Διάρκεια προγράμματος: 5 εβδομάδες Εβδομαδιαίο πρόγραμμα (διδακτική ώρα: 50 ) 1. Νεοελληνική Γλώσσα (για όλες τις ομάδες προσανατολισμού)

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα

Διαβάστε περισσότερα

α. Μόνο η ορμή του συστήματος των σωμάτων. β. Η ορμή και η κινητική ενέργεια του κάθε σώματος.

α. Μόνο η ορμή του συστήματος των σωμάτων. β. Η ορμή και η κινητική ενέργεια του κάθε σώματος. ΔΙΑΓΩΝΙΣΜΑ ΦΥΣΙΚΗΣ Γ ΛΥΚΕΙΟΥ. ΦΡΟΝΤΙΣΤΗΡΙΟ ΓΝΩΣΗ ΘΕΜΑ 1 1. Σε μια ελαστική κρούση δύο σωμάτων διατηρείται: α. Μόνο η ορμή του συστήματος των σωμάτων. β. Η ορμή και η κινητική ενέργεια του κάθε σώματος.

Διαβάστε περισσότερα

και έντασης ρεύματος I 0 που περιστρέφονται με γωνιακή ταχύτητα ω. Το κύκλωμα περιλαμβάνει: α. μόνο ωμική αντίσταση β. μόνο ιδανικό πηνίο

και έντασης ρεύματος I 0 που περιστρέφονται με γωνιακή ταχύτητα ω. Το κύκλωμα περιλαμβάνει: α. μόνο ωμική αντίσταση β. μόνο ιδανικό πηνίο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 1 ΙΟΥΝΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΗΛΕΚΤΡΟΛΟΓΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΥ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1 α Α2 β Α3 β Α4 α Α5. α Σ β Σ γ Λ δ Λ ε Σ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1 α Α2 β Α3 β Α4 α Α5. α Σ β Σ γ Λ δ Λ ε Σ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΕΜΠΤΗ 6 ΣΕΠΤΕΜΡΙΟΥ 0 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΦΥΣΙΚΗ ΘΕΜΑ Α α Α β Α β Α α Α5. α Σ β Σ γ Λ

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΠΡΟΔΙΑΓΡΑΦΕΣ - ΟΔΗΓΙΕΣ ΔΙΑΜΟΡΦΩΣΗΣ ΘΕΜΑΤΩΝ ΓΙΑ ΤΟ ΜΑΘΗΜΑ

ΠΡΟΔΙΑΓΡΑΦΕΣ - ΟΔΗΓΙΕΣ ΔΙΑΜΟΡΦΩΣΗΣ ΘΕΜΑΤΩΝ ΓΙΑ ΤΟ ΜΑΘΗΜΑ ΠΡΟΔΙΑΓΡΑΦΕΣ - ΟΔΗΓΙΕΣ ΔΙΑΜΟΡΦΩΣΗΣ ΘΕΜΑΤΩΝ ΓΙΑ ΤΟ ΜΑΘΗΜΑ Χημεία Α ΤΑΞΗ ΗΜΕΡΗΣΙΟΥ και Α, Β ΤΑΞΕΙΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ Α ΤΑΞΗ ΗΜΕΡΗΣΙΟΥ και Α ΤΑΞΗ ΕΣΠΕΡΙΝΟΥ ΕΠΑΛ ΚΕΝΤΡΙΚΗ ΕΠΙΣΤΗΜΟΝΙΚΗ ΕΠΙΤΡΟΠΗ ΤΡΑΠΕΖΑΣ

Διαβάστε περισσότερα