Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:





3 Μέλη Εξεταστικής επιτροπής: 1. Σκούρας Ζαχαρίας, Καθηγητής Τμήματος Βιολογίας Α.Π.Θ. 2. Γιάγκου Μηνάς, Αναπλ. Καθηγητής Τμήματος Βιολογίας Α.Π.Θ. 3. Δροσοπούλου Ελένη, Λέκτορας Τμήματος Βιολογίας Α.Π.Θ

4 ΠΡΟΛΟΓΟΣ Η παρούσα μεταπτυχιακή εργασία πραγματοποιήθηκε στον Τομέα Γενετικής, Ανάπτυξης και Μοριακής Βιολογίας του Τμήματος Βιολογίας, του Αριστοτέλειου Πανεπιστήμιου Θεσσαλονίκης κατά το ακαδημαϊκό έτος Η εργασία εκπονήθηκε στα πλαίσια της Μεταπτυχιακής Διπλωματικής Εργασίας της κατεύθυνσης «Εφαρμοσμένη Γενετική και Βιοτεχνολογία» του Προγράμματος Μεταπτυχιακών Σπουδών του τμήματος. Ευχαριστίες: Στον Καθηγητή του τμήματος κ. Ζαχαρία Σκούρα, ο οποίος μου ανέθεσε την εκπόνηση της παρούσας εργασίας και την επέβλεπε καθ όλη τη διάρκειά της εκφράζω τις ειλικρινείς μου ευχαριστίες. Εκφράζω, επίσης, τις ειλικρινείς μου ευχαριστίες στην Λέκτορα του τμ. Βιολογίας κ. Ελένη Δροσοπούλου, η οποία επέβλεπε την πορεία της εργασίας και με την οποία είχα άψογη συνεργασία και ήταν πρόθυμη να με βοηθήσει όπου είχα πραγματικά ανάγκη. Επίσης, θα ήθελα μαζί με τους προαναφερθέντες να ευχαριστήσω τον αναπληρωτή Καθηγητή του τμήματος κ. Μηνά Γιάγκου, για την ολοπρόθυμη συμμετοχή τους στην εξεταστική επιτροπή της παρούσας εργασίας. Θα ήθελα να ευχαριστήσω θερμά τον αναπληρωτή Καθηγητή του Τμήματος Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων του Πανεπιστημίου Ιωαννίνων κ. Κων/νο Μπούρτζη για την φιλοξενία στο εργαστήριό του κατά την εκμάθηση των τεχνικών για την μελέτη της μικροβιακής ποικιλότητας. Την διδάκτορα του τμήματος Χρύσα Παντζαρτζή, τον υποψήφιο διδάκτορα Σπύρο Βήττα ευχαριστώ για την συνεργασία και βοήθεια τους στο εργαστήριο. Επίσης την μεταπτυχιακή φοιτήτρια Ευαγγελία Βαρθολομαίου και τους προπτυχιακούς φοιτητές Σωτηρία Μακρή, Ένη Μηλιαρά και Ιωάννη Πράττη για την άψογη συνεργασία και συνύπαρξη στο χώρο του εργαστηρίου. Επίσης θα ήθελα να ευχαριστήσω τον διευθυντή του Κέντρου Περιβαλλοντικής Εκπαίδευσης Καστοριάς, κ. Θεόδωρο Μαρδίρη, καθώς και τους υπόλοιπους εργαζομένους στο κέντρο για την παραχώρηση του εργαστηρίου Χημείας του κέντρου την περίοδο των δειγματοληψιών. Τέλος, θα ήθελα να ευχαριστήσω θερμά την ιχθυολόγο Νίκη Ματζαφλέρη, χωρίς την βοήθεια της οποίας δεν θα ήταν δυνατή η πραγματοποίηση των δειγματοληψιών

5 ΠΕΡΙΛΗΨΗ Η λίμνη της Καστοριάς εντοπίζεται στον ομώνυμο νομό και ένα από τα βασικά της χαρακτηριστικά είναι ο υπερεύτροφος χαρακτήρας της, λόγω αυξημένης εισροής ανόργανων θρεπτικών ως αποτέλεσμα ανθρώπινων δραστηριοτήτων στην λεκάνη απορροής. Επίσης, η παρουσία της πόλης της Καστοριάς στις όχθες αποτελεί πηγή ρύπων για τη λίμνη (όμβρια ύδατα κ.α.). Για το λόγο αυτό η λίμνη της Καστοριάς αποτελεί ένα ιδιαίτερα ενδιαφέρον οικοσύστημα για τον προσδιορισμό της μικροβιακής σύστασης. Στην παρούσα εργασία έγινε μια πρώτη καταγραφή της μικροβιακής ποικιλότητας στο ίζημα της λίμνης σχετικά με την παρουσία Archaea και Bacteria. Πραγματοποιήθηκαν τέσσερις εποχιακές δειγματοληψίες κατά την διάρκεια του έτους 2009 (Ιανουάριος, Απρίλιος, Ιούλιος και Οκτώβριος) σε τέσσερα σημεία της λίμνης (ίζημα και επιφανειακό νερό). Έγινε μέτρηση φυσικοχημικών παραγόντων οι οποίοι αποδεικνύουν τον υπερεύτροφο χαρακτήρα της λίμνης. Τα υψηλά επίπεδα της χλωροφύλλης, ιδιαίτερα τον μήνα Οκτώβριο (~ mg/m 3 ) και η μικρή διαφάνεια του νερού (<2m τους μήνες Ιούλιο και Οκτώβριο), δείχνουν συνθήκες υπερευτροφισμού στη λίμνη. Με την χρήση κατάλληλων παγκόσμιων εκκινητών ενισχύθηκε το 16S rrna των Archaea και Bacteria σε δείγματα απομονωμένου DNA από τα τέσσερα σημεία της λίμνης και κατασκευάστηκαν 16S βιβλιοθήκες για τα Archaea και τα Bacteria των ιζημάτων των σταθμών 2, 3 και 4 από την δειγματοληψία του Απριλίου Από την 16S βιβλιοθήκη για τα Bacteria του ιζήματος του σταθμού 2 αναλύθηκαν μέχρι στιγμής 54 κλώνοι που αντιστοιχούν σε 40 OTUs και οι οποίες κατατάσσονται σε 10 φύλα (Verrucomicrobia, Actinobacteria, Flavobacteria, Acidobacteria, Fusobacteria, Planctomycetes, Firmicutes, Cyanobacteria, Gemmatimonadetes και τα πέντε υπο-φύλα (α- έως ε-) των Proteobacteria, με τα τελευταία να εμφανίζονται σε μεγαλύτερη συχνότητα (38%). Ωστόσο, απαιτείται ανάλυση μεγαλύτερου αριθμού κλώνων ώστε να εκπροσωπούνται όλα τα Bacteria του δείγματος. Από την 16S βιβλιοθήκη για τα Archaea του ιζήματος του σταθμού 2 αναλύθηκαν συνολικά 39 κλώνοι που αντιστοιχούν σε 21 OTUs που ανήκουν στα φύλα Euryarchaeota και Crenarchaeota, με εντονότερη παρουσία (84%) των τάξεων Methanomicrobiales και Methanosarcinales, που συνίστανται από μεθανογόνα στελέχη

6 ABSTRACT The Kastoria Lake is located in the north-west Greece, in the prefecture of Kastoria. It is a polymictic lake with 28 km 2 surface area and 9 m maximum depth. The excessive use of fertilizers in the surrounding area and the presence of Kastoria city on the coast have an important effect on the lake ecosystem which is characterized as eutrophic. In this context, the study of the microbial community of the lake, as well as the correlation of the observed diversity with physical or anthropogenic parameters presents particular interest. During 2009, seasonal samplings of both surface water and sediment have been performed at selected stations. Physicochemical parameters (temperature, ph, dissolved oxygen concentration etc.) have been measured in situ and the concentrations of anorganic nutrients and chlorophyll a have been determined spectrophotometrically. The high levels of chlorophyll a detected, especially in October (~ mg/m 3 ), as well as the limited transparency of the water (<2m depth) indicate hypertrophic conditions in the lake.. Universal primers for Bacteria (27F, 1391R) and Archaea (4F, 1492R) have been used to amplify part of the16s rrna gene, and 16S clone libraries have been constructed from sediment samples. 54 bacterial and 39 archaean clones have been sequenced and bioinformatically analyzed. The above analysis revealed the presence of 40 bacterial OTUs belonging to 10 phyla: Verrucomicrobia, Actinobacteria, Flavobacteria, Acidobacteria, Fusobacteria, Planctomycetes, Firmicutes, Cyanobacteria, Gemmatimonadetes and the five sub-phyla of Proteobacteria which were the most abundant (38%). Furthermore, Archaea belonging to two phyla (Euryarchaeota and Crenarchaeota), have been detected with strains of Methanomicrobiales and Methanosarcinales being by far the most frequent (84%). These two orders consist of methanogens, which are widely prevalent in lake sediments

7 ΠΕΡΙΕΧΟΜΕΝΑ 1. ΕΙΣΑΓΩΓΗ Γενικά για τους μικροοργανισμούς Ανακάλυψη μικροοργανισμών Κατηγορίες μικροοργανισμών Προκαρυωτικοί μικροοργανισμοί Γενετικοί τόποι ως εργαλεία ταξινόμησης των προκαρυωτικών μικροοργανισμών Το φυλογενετικό δέντρο της ζωής κατά Woese Μικροβιακή ποικιλότητα Η λίμνη της Καστοριάς Σκοπός της εργασίας ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ Δειγματοληψία Επί τόπου μέτρηση φυσικοχημικών παραμέτρων Ποσοτικός προσδιορισμός χλωροφύλλης α Ποσοτικός προσδιορισμός ανόργανων θρεπτικών συστατικών (αζωτούχων και φωσφορικών) Διήθηση περιβαλλοντικών δειγμάτων και ανάκτηση μικροοργανισμών Απομόνωση DNA από τους μικροοργανισμούς Προσδιορισμός της ποσότητας του απομονωμένου DNA από τα περιβαλλοντικά δείγματα Ενίσχυση τμήματος της αλληλουχίας του 16S rrna γονιδίου των Bacteria και Archaea Κλωνοποίηση των προϊόντων της PCR Κατασκευή 16S βιβλιοθηκών Επιλογή λευκών - μπλε αποικιών ( blue-white screening) Ανάλυση κλώνων από τις 16S βιβλιοθήκες των Archaea και Bacteria του ιζήματος του σταθμού ΑΠΟΤΕΛΕΣΜΑΤΑ ΣΥΖΗΤΗΣΗ Επί τόπου μέτρηση φυσικοχημικών παραγόντων (θερμοκρασία, ph, αλατότητα, συγκέντρωση διαλυμένου οξυγόνου, αγωγιμότητα, ολικά στερεά) και διαφάνειας ύδατος

8 3.2 Ποσοτικός προσδιορισμός χλωροφύλλης α Ποσοτικός προσδιορισμός ανόργανων αζωτούχων και φωσφορικών θρεπτικών Κατασκευή βιβλιοθηκών 16S Ανάλυση μικροβιακής κοινότητας ΒΙΒΛΙΟΓΡΑΦΙΑ

9 1. ΕΙΣΑΓΩΓΗ - 9 -

10 1.1 Γενικά για τους μικροοργανισμούς Μικροοργανισμοί (μικρός + οργανισμοί) ή μικρόβια χαρακτηρίζονται οι οργανισμοί που δεν μπορούν να γίνουν διακριτοί με γυμνό μάτι και απαιτείται η χρήση μικροσκοπίου για την παρατήρησή τους. Τα είδη των μικροοργανισμών ποικίλουν: συμπεριλαμβάνονται τα βακτήρια, οι μύκητες, τα Archaea, τα Protista, μικροσκοπικά φυτά καθώς και ζώα (ζωοπλαγκτόν, Planaria). Ορισμένοι μικροβιολόγοι κατατάσσουν στους μικροοργανισμούς και τους ιούς, ωστόσο υπάρχει μια έντονη διχογνωμία για το αν οι ιοί είναι ζωντανοί οργανισμοί ή όχι (Rybicki 1990). Οι μικροοργανισμοί αποτελούν την πρώτη μορφή ζωής που εμφανίστηκε στη γη, πριν από περίπου 3,5 δισεκατομμύριο χρόνια (Schopf 2006). Για περισσότερα από 3 δισεκατομμύρια χρόνια, καθ όλη την διάρκεια της Προκάμβριας περιόδου, αποτελούσαν τους μοναδικούς ζωντανούς οργανισμούς (Delong & Pace 2001). Βακτήρια, φύκη και μύκητες έχουν παρατηρηθεί σε ήλεκτρο που χρονολογείται περίπου στα 220 εκατομμύρια χρόνια (τριασσική περίοδος) με χαρακτηριστική ομοιότητα σε σχέση με τους σημερινούς μικροοργανισμούς. Οι μικροοργανισμοί απαντώνται σε όλα τα σημεία της βιόσφαιρας: σε όλα τα υδάτινα οικοσυστήματα, στο έδαφος, στον πυθμένα των ωκεανών, από τα υψηλά στρώματα της ατμόσφαιρας έως τα πετρώματα του εξωτερικού φλοιού της γης. Είναι χαρακτηριστικό ότι έχουν βρεθεί ζωντανοί μικροοργανισμοί σε θερμοπηγές με θερμοκρασία 130 C, ενώ αντίστοιχα έχουν εντοπιστεί και σε χαμηλές θερμοκρασίες (-17 C). Επίσης, ορισμένοι μικροοργανισμοί μπορούν να επιβιώσουν σε ιδιαίτερα υψηλές πιέσεις ( atm), ενώ έχουν εντοπιστεί και σε συνθήκες «κενού του διαστήματος», 0 atm (Horneck 1981). Οι περισσότεροι μικροοργανισμοί είναι μονοκύτταροι (εικ.1), ωστόσο εξαίρεση στον κανόνα αποτελεί η ύπαρξη πολυκύτταρων μικροοργανισμών (ορισμένα Myxozoa). Επίσης, παρόλο που η συντριπτική πλειοψηφία των μονοκύτταρων οργανισμών δεν είναι ορατοί με γυμνό οφθαλμό, υπάρχουν βακτήρια, όπως το Thiomargarita namibiensis, το οποίο είναι μακροσκοπικά διακριτό

11 Εικόνα 1. Αποικία βακτηρίων E.coli (μεγέθυνση 10000Χ) (ηλεκτρονική πηγή 1). 1.2 Ανακάλυψη μικροοργανισμών Παρόλο που η ουσιαστική ανακάλυψη των μικροοργανισμών έλαβε χώρα μόλις τον 17 ο αιώνα, η ύπαρξη τους αποτελούσε θέμα συζήτησης αρκετούς αιώνες πριν. Η πρώτη αναφορά στους μικροοργανισμούς έγινε από τον Ρωμαίο Marcus Terentius Varro τον 1 ο αιώνα π.x. στο σύγγραμμα του On Agriculture, στο οποίο κάνει λόγο για «όντα που δεν μπορούμε να δούμε με γυμνό οφθαλμό, τα οποία αιωρούνται στην ατμόσφαιρα και εισέρχονται μέσω του στόματος και της μύτης στο σώμα μας προκαλώντας σοβαρές ασθένειες». Όταν η βουβωνική χολέρα έφτασε στην Ανδαλουσία της Ισπανίας τον 14 ο αιώνα μ.x., ο Ibn Khatima έγραψε ότι οι μεταδοτικές ασθένειες προκαλούνται μεταδοτικά μικροσκοπικά όντα («minute bodies»), τα οποία εισέρχονται στο ανθρώπινο σώμα (Syed 2002). Αργότερα, το 1546, ο Girolamo Fracastoro, πρότεινε ότι οι επιδημίες προκαλούνται από μεταφερόμενες σποριόμορφες οντότητες, οι οποίες μπορούν να μεταδώσουν την μόλυνση είτε με άμεση επαφή, είτε από μεγάλη απόσταση. Ο Anton van Leeuwenhoek (εικ.2) ήταν ο πρώτος που παρατήρησε μικροοργανισμούς, χρησιμοποιώντας μικροσκόπιο δικής του κατασκευής, το Πριν την ανακάλυψη των μικροοργανισμών από τον Leeuwenhoek, αποτελούσε μυστήριο ο τρόπος με τον οποίο τα σταφύλια μετατρέπονταν σε κρασί, το γάλα σε τυρί ή ο λόγος που αλλοιωνόταν το φαγητό. Ο Leeuwenhoek, παρόλο που δεν έκανε την συσχέτιση ανάμεσα στους μικροοργανισμούς και στις προαναφερθείσες

12 διαδικασίες, χρησιμοποιώντας ένα μικροσκόπιο απέδειξε ότι υπάρχουν μορφές ζωής που δεν είναι ορατές με γυμνό οφθαλμό. Η παρατήρηση των μικροοργανισμών από τον Leeuwenhoek, καθώς και τα πειράματα των Spallanzani και Pasteur, έδωσαν τέλος στην μακραίωνη θεωρία ότι η ζωή εμφανίζεται αυτόματα από μη ζώντα συστατικά κατά την διαδικασία «φθοράς» της ύλης (spoilage process), και σε συνδυασμό με τα αξιώματα του Koch, αποτελούν τους πρωτεργάτες της θεωρίας ότι οι μικροοργανισμοί είναι υπεύθυνοι για την πλειοψηφία των ασθενειών (germ theory) (Madigan & Martinko 2005). Εικόνα 2. Ο Anton van Leeuwenhoek, ο πρώτος μικροβιολόγος και ο πρώτος που παρατήρησε μικροοργανισμούς χρησιμοποιώντας μικροσκόπιο (ηλεκτρονική πηγή 1). 1.3 Κατηγορίες μικροοργανισμών Οι μικροοργανισμοί διαχωρίζονται σε δύο κύριες κατηγορίες, ανάλογα με την παρουσία πυρήνα ή όχι στο κυτταρόπλασμά τους: τους προκαρυωτικούς μικροοργανισμούς και τους ευκαρυωτικούς μικροοργανισμούς. Στους προκαρυωτικούς μικροοργανισμούς ανήκουν δύο ομάδες, τα Bacteria και τα Archaea, τα οποία αποτελούν και το αντικείμενο μελέτης της παρούσας εργασίας και για το λόγο αυτό θα αναλυθούν εκτενώς στη συνέχεια. Στους ευκαρυωτικούς μικροοργανισμούς ανήκουν τα Protista, μικροσκοπικά ζώα, μύκητες (Fungi), καθώς και διάφορα μικροσκοπικά φυτά

13 1.4 Προκαρυωτικοί μικροοργανισμοί Όπως προαναφέρθηκε, οι προκαρυωτικοί μικροοργανισμοί περιλαμβάνουν δύο ομάδες, τα Bacteria και τα Archaea. Είναι αποκλειστικά μονοκύτταροι οργανισμοί, ωστόσο σε διάφορα στάδια της ζωής τους συναθροίζονται σε σύνθετες δομές, όπως τα Myxobacteria. Οι προκαρυωτικοί μικροοργανισμοί είναι η πιο ποικιλόμορφη και άφθονη ομάδα οργανισμών στη γη και απαντώνται σχεδόν σε όλα τα περιβάλλοντα όπου είναι διαθέσιμο το νερό, έστω και σε ελάχιστες ποσότητες και η θερμοκρασία είναι χαμηλότερη από 140 C. Ουσιαστικά, όλες οι επιφάνειες που δεν έχουν αποστειρωθεί είναι καλυμμένες από προκαρυωτικούς μικροοργανισμούς. Ο αριθμός των προκαρυωτικών μικροοργανισμών υπολογίζεται σε 5 X άτομα σε όλη τη γη Bacteria Παρόλο που τα Bacteria ανακαλύφθηκαν από τον Anton van Leeuwenhoek το 1676, η ονομασία τους δόθηκε από τον Christian Gottfried Ehrenberg το Παρουσιάζουν ένα μεγάλο εύρος σχήματος και μεγεθών. Τα βακτηριακά κύτταρα κατά μέσο όρο είναι δέκα φορές μικρότερα από τα ευκαρυωτικά κύτταρα, με εύρος μήκους 0,5 5 μm (εικ.3). Ωστόσο, μερικά είδη, όπως τα Thiomargarita namibiensis και Epulopiscium fishelsoni φθάνουν σε μέγεθος 500 μm. Αντίθετα, μεταξύ των μικρότερων σε μέγεθος βακτηρίων ανήκουν στελέχη του γένους Mycoplasma, που φτάνουν σε μέγεθος μόλις τα 0,3 μm, μικρότερα και από τους μεγάλους ιούς. Τα περισσότερα είδη των Bacteria είναι είτε σφαιρικά, οπότε ονομάζονται κόκκοι, είτε ραβδόμορφα, οπότε ονομάζονται βάκιλοι. Ορισμένα είδη έχουν τετραεδρικό ή κυβοειδές σχήμα (Wanger et al. 2008). Επίσης, παρόλο που τα περισσότερα Bacteria απαντώνται στο περιβάλλον ως μονήρη κύτταρα, έχουν παρατηρηθεί και σε άλλες διαμορφώσεις: το γένος Neisseria απαντάται σε ζεύγη κυττάρων, το γένος Streptococcus σχηματίζει αλυσίδες και το γένος Staphylococcus σχηματίζει μια δομή «τσαμπιού σταφυλιού». Τέλος, ορισμένα στελέχη μπορούν να επιμηκύνονται σχηματίζοντας νημάτια με χαρακτηριστική περίπτωση τα Actinobacteria. Στην εικόνα 3 παρουσιάζονται οι διάφοροι τύποι μορφολογίας των Bacteria

14 Εικόνα 3. Τα Bacteria παρουσιάζουν μεγάλο εύρος μορφολογίας και κυτταρικών διαμορφώσεων (ηλεκτρονική πηγή 1). - Ταξινόμηση των Bacteria Η ταξινόμηση των Bacteria γίνεται με βάση την κυτταρική δομή (μελέτη με μικροσκόπιο και κατάταξη), τον μεταβολισμό των κυττάρων (βιοχημική προσέγγιση) ή με βάση διαφορές που παρατηρούνται σε συστατικά των κυττάρων όπως στο DNA, τα λιπαρά οξέα, χρωστικές, αντιγόνα και ένζυμα. Ωστόσο, αυτές οι διαφορές δεν είναι ξεκάθαρο αν αντιπροσωπεύουν διαφορές ανάμεσα σε ξεχωριστά είδη ή ανάμεσα σε στελέχη του ίδιου είδους. Ένα φαινόμενο που διαδραματίζει σημαντικό ρόλο στη δυσκολία ταξινόμησης των μικροοργανισμών είναι η οριζόντια μεταφορά γενετικού υλικού ανάμεσα σε στελέχη που δεν ανήκουν στο ίδιο είδος (Woese et al. 1994). Εξαιτίας της οριζόντιας μεταφοράς γενετικού υλικού, στενά συγγενικά άτομα είναι δυνατόν να παρουσιάζουν διαφορετική μορφολογία και μεταβολισμό. Για να υπερνικηθεί αυτό το εμπόδιο στην συστηματική κατάταξη των Bacteria δίνεται ιδιαίτερη έμφαση στη χρήση μοριακών εργαλείων ταξινόμησης όπως η σύγκριση του λόγου A+T / G+C (GC ratio) μεταξύ διαφορετικών στελεχών, ποσοστό υβριδισμού μεταξύ γονιδιωμάτων, η χρήση γενετικών τόπων στους οποίους δεν έχει παρατηρηθεί

15 ή έχει παρατηρηθεί ελάχιστα οριζόντια μεταφορά γενετικού υλικού, όπως το γονίδιο που κωδικοποιεί για το 16S rrna (βλ. παρακάτω). Για την ταξινόμηση των Bacteria έχει συσταθεί η Διεθνής Επιτροπή Συστηματικής Βακτηριολογίας (International Committee on Systematic Bacteriology, ICSB ), η οποία θέτει τους κανόνες για την ονοματολογία των Bacteria και των taxa και την κατάταξη τους στον Διεθνή Κώδικα Ονοματολογίας των Bacteria ( International Code of Nomenclature of Bacteria) Archaea Τα Archaea αποτελούν την δεύτερη ομάδα προκαρυωτικών μικροοργανισμών. Αρχικά τα Archaea αποτελούσαν ένα ξεχωριστό φύλο των βακτηρίων και ονομάζονταν Αρχαιοβακτήρια (Archaebacteria), ωστόσο ο Carl Woese μετά από φυλογενετικές μελέτες με βάση το 16S rrna τα κατέταξε στο ξεχωριστό Βασίλειο των Archaea, προτείνοντας το «φυλογενετικό δέντρο της ζωής» των τριών ομάδων (three domain tree), μαζί με τα Βασίλεια των Bacteria και των Eucaryota (βλ. παρακάτω) (Woese et al. 2000) (εικ.4). Τα Archaea διαιρούνται περαιτέρω σε τέσσερα αναγνωρισμένα φύλα, με βασικότερα τα Euryarchaeota και Crenarchaeota. Τα υπόλοιπα δύο φύλα, τα οποία δεν έχουν μελετηθεί αρκετά, είναι τα Nanoarchaeota και Korarchaeota. Αρχικά, τα Archaea θεωρούνταν προκαρυωτικοί οργανισμοί που απαντώνται σε ακραία περιβάλλοντα όπως θερμοπηγές και λίμνες με υψηλές συγκεντρώσεις αλατότητας. Σήμερα, έχει αποδειχθεί ότι απαντώνται σε ένα ευρύ φάσμα ενδιαιτημάτων όπως στο έδαφος και στους ωκεανούς. Πιο συγκεκριμένα, τα Archaea που απαντώνται σε πλαγκτονικούς πληθυσμούς αποτελούν μια από τις πιο άφθονες ομάδες οργανισμών στον πλανήτη. Γενικότερα, τα Archaea αναγνωρίζονται ως ένα σημαντικό τμήμα της βιόσφαιρας και διαδραματίζουν σημαντικό ρόλο σε πολλούς τομείς όπως π.χ. στους κύκλους του αζώτου και του άνθρακα. Τα Archaea αναπαράγονται ασεξουαλικά με διχοτόμηση, πολλαπλή διάσπαση ή εκβλάστηση. Σε αντίθεση με τα Bacteria που έχουν την δυνατότητα σχηματισμού ενδοσπορίων ως απόκριση σε ακραίες περιβαλλοντικές συνθήκες, στα Archaea δεν έχει παρατηρηθεί αυτό το φαινόμενο. Αντίθετα, ορισμένα Haloarhaea έχουν την δυνατότητα να μεταβάλλουν την μορφολογία των κυττάρων τους ως απόκριση στην ωσμωτική πίεση και με αυτό τον τρόπο μπορούν να επιβιώνουν σε υδάτινα περιβάλλοντα με χαμηλή συγκέντρωση αλάτων

16 Εικόνα 4.Φυλογενετικό δέντρο που δείχνει τη σχέση των Archaea με τους υπόλοιπους οργανισμούς. Πράσινο : Archaea, Κόκκινο : Eucaryota, Μπλε : Bacteria (ηλεκτρονική πηγή 1) Διαφορές Bacteria Archaea Εκτός από τις διαφορές στο γενότυπο ανάμεσα σε Bacteria και Archaea, στις οποίες βασίστηκε κατά κύριο λόγο ο Carl Woese για να προτείνει το φυλογενετικό δέντρο των τριών κύριων φυλογενετικών ομάδων (Bacteria, Archaea και Eucaryota), παρατηρούνται αρκετές φαινοτυπικές διαφορές ανάμεσα στα δύο Βασίλεια. Οι διαφορές αυτές είναι οι εξής: 1. Το κυτταρικό τοίχωμα των Bacteria περιέχει πεπτιδογλυκάνη, ενώ δεν απαντάται στο κυτταρικό τοίχωμα των Archaea. 2. Στα λιπίδια της πλασματικής μεμβράνης η σύνδεση των πλευρικών αλυσίδων με τις πολικές κεφαλές γίνεται με εστερικούς δεσμούς στα Bacteria, ενώ στα Archaea γίνεται με αιθερικούς δεσμούς. 3. Στα Bacteria απαντάται μια RNA πολυμεράση, που αποτελείται από τέσσερις υπομονάδες, ενώ από τα Archaea έχουν απομονωθεί αρκετές διαφορετικές πολυμεράσες με πολλές υπομονάδες. 4. Το εναρκτήριο trna κατά τη μετάφραση είναι στα Bacteria η φορμυλμεθειονίνη, σε αντίθεση με τα Archaea, που είναι η μεθειονίνη. Στον πίνακα 1 συνοψίζονται οι παραπάνω φαινοτυπικές διαφορές ανάμεσα στα Bacteria, τα Archaea και τα Eucaryota. Είναι εμφανές ότι τα Archaea, αν και προκαρυωτικοί οργανισμοί, παρουσιάζουν σε πολλά χαρακτηριστικά περισσότερες ομοιότητες με τα Eucaryota παρά με τα Bacteria (Κολιάης 2001)

17 Πίνακας 1. Φαινοτυπικές διαφορές μεταξύ Bacteria, Archaea και Eucaryota (Κολιάης 2001) Bacteria Archaea Eucaryota Εστερικοί δεσμοί Αιθερικοί δεσμοί Εστερικοί δεσμοί Λιπίδια πλασματικής μεταξύ πλευρικών μεταξύ πλευρικών μεταξύ πλευρικών μεμβράνης αλυσίδων και πολικών αλυσίδων και πολικών αλυσίδων και πολικών κεφαλών κεφαλών κεφαλών RNA πολυμεράση Μία (4 υπομονάδες) Πολλές (8-12 υπομονάδες) Τρεις (~14 υπομονάδες) Κυτταρικό τοίχωμα Περιέχει πεπτιδογλυκάνη Δεν περιέχει πεπτιδογλυκάνη Δεν περιέχει πεπτιδογλυκάνη (όταν υπάρχει) Αρχικό trna στη μετάφραση Φορμυλ-μεθειονίνη Μεθειονίνη Μεθειονίνη 1.5 Γενετικοί τόποι ως εργαλεία ταξινόμησης των προκαρυωτικών μικροοργανισμών. Η συστηματική κατάταξη των μικροοργανισμών, όπως προαναφέρθηκε, γίνεται με βάση: α) μορφολογικούς χαρακτήρες (μικροσκοπική παρατήρηση), β) βιοχημικούς χαρακτήρες (ένζυμα, πρωτεΐνες κ.α.) και γ) γενετικούς τόπους. Χαρακτηριστικά γονίδια, που ενώ εμπεριέχουν αξιόλογη πληροφορία για την φυλογένεση των προκαρυωτικών μικροοργανισμών αλλά δεν έχουν χρησιμοποιηθεί είναι αυτά που κωδικοποιούν για το ένζυμο DNA γυράση την σαπερονίνη-60 την β-υπομονάδα της RNA πολυμεράσης την β-υπομονάδα της ATPάσης τον παράγοντα επιμήκυνσης EF-Tu τις πρωτεΐνες DnaK, HscA (Hsc66), και HscC (Hsc62) της πρωτεϊνικής οικογένειας Hsp70 σ70 παράγοντα της RNA πολυμεράσης trna συνθετάσες, με βασικότερη της αμινο-ακυλ-trna συνθετάσης και τις πρωτεΐνες RadA (Archaea) / RecA (Bacteria), που συμμετέχουν στην διαδικασία του ομόλογου ανασυνδυασμού (Riesenfeld et al. 2004)

18 Από την άλλη πλευρά, τα γονίδια που κωδικοποιούν για τα μόρια rrna και κυρίως για το 16S rrna έχουν χρησιμοποιηθεί ευρέως ως εργαλεία για την ταξινόμηση και φυλογένεση τόσο των προκαρυωτικών όσο και των ευκαρυωτικών οργανισμών Γονίδια που κωδικοποιούν μόρια rrna Τα γονίδια που κωδικοποιούν μόρια rrna ανήκουν στα γονίδια βασικών λειτουργιών (housekeeping genes). Στους προκαρυωτικούς μικροοργανισμούς απαντώνται 3 μόρια rrna, 5S, 16S και 23S. Αρχικά, για την συστηματική κατάταξη των μικροοργανισμών χρησιμοποιήθηκε η αλληλουχία του γονιδίου 5S rrna. Ωστόσο, το μικρό μήκος της αλληλουχίας (120 bp) αποτελούσε σημαντικό μειονέκτημα στη χρήση του ως εργαλείο φυλογένεσης. Αντιθέτως, τα γονίδιο για το 16S rrna (συστατικό της μικρής ριβοσωμικής υπομονάδας, ~1500 bp) και το 23S (~2900 bp) περιέχουν πολλή περισσότερη «φυλογενετική» πληροφορία. Καθώς όμως το γονίδιο για το 16S rrna είναι πιο εύχρηστο στα πειράματα από το γονίδιο για το 23S, η επιστημονική κοινότητα έχει επικεντρωθεί κατά κύριο λόγο στην μελέτη της αλληλουχίας του πρώτου (Rudi et al. 2007) Το γονίδιο 16S rrna ως εργαλείο για την ταξινόμηση και φυλογένεση των προκαρυωτικών μικροοργανισμών. Στην προηγούμενη παράγραφο έγινε αναφορά στις διαφορές που υπάρχουν ανάμεσα στα γονίδια που κωδικοποιούν τα μόρια rrna των προκαρυωτικών οργανισμών (εικ.5). Ωστόσο, το γονίδιο για το 16S rrna έχει ορισμένες ιδιότητες που το καθιστούν γενικότερα ένα πολύ χρήσιμο εργαλείο για την μελέτη των μικροοργανισμών. Οι ιδιότητες αυτές είναι οι εξής: Το μήκος της αλληλουχίας είναι αρκετά μεγάλο ώστε να χρησιμοποιηθεί για φυλογενετική ανάλυση Είναι γονίδιο που απαντάται σε όλους τους μικροοργανισμούς Η αλληλουχία του είναι υψηλά συντηρημένη με μια σχετική ποικιλομορφία Δεν έχει παρατηρηθεί ή έχει παρατηρηθεί σπάνια ενδοειδική ή διαειδική μεταφορά του γονιδίου με οριζόντια μεταφορά γενετικού υλικού (horizontal gene transfer, HGT) (Woese 1987, Woese 2000, Rudi et al. 2007)

19 Ωστόσο η παρουσία περισσότερων τους ενός αντιγράφων του 16S rrna γονιδίου στο γονιδίωμα των προκαρυωτικών οργανισμών (αριθμός αντιγράφων 1-15), δημιουργεί πολλές φορές προβλήματα στην ταυτοποίηση τους. Αυτό μπορεί να οφείλεται τόσο σε διαφορετικές αλληλουχίες των επιμέρους γονιδίων για το 16S rrna, όσο και στον διαφορετικό αριθμό αντιγράφων ανά οργανισμό οπότε δεν υπάρχει ισότιμη εκπροσώπηση των μικροοργανισμών στις 16S βιβλιοθήκες (βλ. παρακάτω) (Riesenfeld et al. 2004). Εικόνα 5. Δευτεροταγής δομή του 16S rrna των προκαρυωτικών μικροοργανισμών (ηλ. πηγή 2). 1.6 Το φυλογενετικό δέντρο της ζωής κατά Woese Ο Carl Woese ήταν ο πρώτος εξελικτικός που βασίστηκε σε βάθος σε μοριακούς - γενετικούς δείκτες για να εξάγει συμπεράσματα σχετικά με τις εξελικτικές σχέσεις μεταξύ των οργανισμών και πιο ειδικά των προκαρυωτικών μικροοργανισμών (Woese & Fox 1977). Για τις μελέτες του βασίστηκε στο 16S rrna, για τους λόγους που αναφέρθηκαν στην προηγούμενη ενότητα. Το πιο σημαντικό αποτέλεσμα αυτών των μελετών είναι η ανακάλυψη ενός νέου Βασιλείου μικροοργανισμών, του Βασιλείου των Archaea, που μέχρι τότε ονομάζονταν αρχαιοβακτήρια και θεωρούνταν ομάδα του Βασιλείου των Μονήρων μαζί με τα υπόλοιπα βακτήρια (Eubacteria) (Woese et al. 1978). Τα Archaea ισαπέχουν εξελικτικά από τους υπόλοιπους προκαρυωτικούς μικροοργανισμούς και τα Eucaryota. Η εξελικτική διαφοροποίηση των Archaea οδήγησε τον Woese στο συμπέρασμα ότι όλοι οι ζωντανοί οργανισμοί μπορούν να καταταγούν σε τρεις κύριες ομάδες Βασίλεια : i. Eucaryota, όπου ανήκουν όλοι οι ευκαρυωτικοί μικροοργανισμοί

20 ii. Archaea, όπου ανήκουν τα μέχρι πρότινος αρχαιοβακτήρια, και iii. Bacteria, όπου ανήκουν οι υπόλοιποι προκαρυωτικοί μικροοργανισμοί (Woese et al. 1990) (εικ.7). Το συγκεκριμένο φυλογενετικό δέντρο είναι σχετικά απλό από άποψη δομής, ωστόσο, αποτελεί πηγή σημαντικών συμπερασμάτων. Με μια πρώτη ματιά, το φυλογενετικό δέντρο που πρότεινε ο Woese και οι συνεργάτες του δείχνει ότι η μερίδα του λέοντος όσον αφορά την βιοποικιλότητα ανήκει στους προκαρυωτικούς οργανισμούς, σε αντίθεση με τους ευκαρυωτικούς που εμφανίζουν σαφώς μικρότερη ποικιλότητα και αποτελούν τους πιο πρόσφατους τελευταίους οργανισμούς της εξελικτικής ιστορίας (εικ.6). Αυτό γίνεται ιδιαίτερα κατανοητό αν λάβουμε υπόψη τα 3,8 δισεκατομμύρια χρόνια παρουσίας των προκαρυωτικών οργανισμών στον πλανήτη σε αντίθεση με τα 2 δισεκατομμύρια χρόνια παρουσίας των ευκαρυωτικών οργανισμών και τα μόλις 600 εκατομμύρια χρόνια παρουσίας των ανώτερων ζωικών οργανισμών (DeLong & Pace 2001). Εικόνα 6. Παρουσία των οργανισμών στη γη (ηλεκτρονική πηγή 3)

21 Εικόνα 7. Το φυλογενετικό δέντρο της ζωής με βάση την αλληλουχία της μικρής ριβοσωμικής υπομονάδας (16S / 18S rrna) (από Barns et al. 1996). 1.7 Μικροβιακή ποικιλότητα Η μελέτη της μικροβιακής ποικιλότητας στο περιβάλλον αποτελεί ένα από τα γνωστικά αντικείμενα της περιβαλλοντικής μικροβιολογίας. Ουσιαστικά, αποβλέπει στην μελέτη της σύνθεσης και φυσιολογίας των μικροβιακών κοινοτήτων στο περιβάλλον. Η μικροβιακή ποικιλότητα στοιχειοθετείται από δύο χαρακτηριστικά: αφθονία και ομοιογένεια. Κατά συνέπεια, ο υψηλότερος βαθμός ποικιλότητας εντοπίζεται σε μικροβιακές κοινότητες με όσο το δυνατόν περισσότερα διαφορετικά είδη μικροοργανισμών (αφθονία) σε σχετικά ίσους πληθυσμούς (ομοιογένεια) (Kapur & Kumar Jain 2004). Το εύρος της μικροβιακής ποικιλότητας σχετίζεται με μια πληθώρα περιβαλλοντικών παραγόντων. Όσον αφορά τις λίμνες, χαρακτηριστικοί

22 περιβαλλοντικοί παράγοντες που επηρεάζουν την σύσταση των μικροβιακών κοινοτήτων αποτελούν η πρωτογενής παραγωγή, η θερμοκρασία, το ph, η διαπερατότητα του ηλιακού φωτός, η ποσότητα του διαλυμένου οξυγόνου κ.α (Liu et al. 2009) Εκτίμηση μικροβιακής ποικιλότητας Μέχρι τα μέσα του προηγούμενου αιώνα, όταν ακόμα η μοριακή βιολογία δεν είχε αναπτυχθεί σε τέτοιο βαθμό ώστε να χρησιμοποιείται στην ταξινόμηση των μικροοργανισμών, ο μόνος τρόπος για την ταυτοποίηση ενός μικροβίου από περιβαλλοντικό δείγμα ήταν η απομόνωση και καλλιέργεια του στο εργαστήριο και η χρήση μικροσκοπίου ή βιοχημικών μεθόδων. Κατά συνέπεια, έως σχετικά πρόσφατα, η γνώση που είχαμε για τους μικροοργανισμούς του περιβάλλοντος περιοριζόταν αποκλειστικά σε αυτούς που έχουν την δυνατότητα καλλιέργειας στο εργαστήριο. Σύμφωνα με τους Ammann et al.,(1995), μόλις το 0,001-0,1% των θαλάσσιων μικροοργανισμών, το 0,25% των μικροοργανισμών εσωτερικών υδάτων και το 0,3% των μικροοργανισμών του εδάφους μπορούν να καλλιεργηθούν στο εργαστήριο με τις υπάρχουσες μέχρι στιγμής μεθόδους καλλιέργειας. Το γεγονός αυτό οδηγεί στο συμπέρασμα ότι δεν γνωρίζουμε προσεγγιστικά το 99% των μικροοργανισμών που υπάρχουν στον πλανήτη! Το πρόβλημα αυτό μπορεί να λυθεί με την απευθείας απομόνωση και κλωνοποίηση ολόκληρων γονιδιωμάτων ή συγκεκριμένων τμημάτων όλων των μικροοργανισμών που απαντώνται σε ένα περιβαλλοντικό δείγμα χωρίς να απαιτείται απομόνωση και καλλιέργεια των μικροοργανισμών αυτών. Η προσέγγιση αυτή στην μελέτη της μικροβιακής ποικιλότητας λαμβάνει χώρα την τελευταία περίπου εικοσαετία και συνιστά τον κλάδο της μεταγονιδιωματικής (metagenomics) στην περιβαλλοντική μικροβιολογία (Riesenfeld et al. 2004, Schloss & Handelsman 2005, Langer et al. 2006,). Μεταγονιδίωμα, ουσιαστικά, είναι το σύνολο του γενετικού υλικού ενός περιβαλλοντικού δείγματος, από όλους τους οργανισμούς, που έχει απομονωθεί χωρίς να έχει προηγηθεί καλλιέργεια των μικροοργανισμών αυτών. Με την μεταγονιδιωματική προσέγγιση, πέραν του προσδιορισμού της μικροβιακής ποικιλότητας επιτυγχάνεται και η μελέτη της φυσιολογίας μιας μικροβιακής κοινότητας, καθώς καθίσταται δυνατή η απομόνωση και ταυτοποίηση γονιδίων με σημαντικές ιδιότητες (ογκογονίδια, γονίδια που συμμετέχουν στο μεταβολισμό ρύπων κ.α.)

23 Το πρώτο και άμεσο συμπέρασμα που προέκυψε με την εφαρμογή της μεταγονιδιωματικής προσέγγισης στο πεδίο της περιβαλλοντικής μικροβιολογίας, όπως προαναφέρθηκε, είναι η ανακάλυψη του πλούτου των μικροοργανισμών που δεν μπορούν να καλλιεργηθούν. Χαρακτηριστικό είναι ότι μέχρι τον Απρίλιο του 2004, η βάση δεδομένων GenBank (www.ncbi.nlm.nih.gov) περιείχε αλληλουχίες του γονιδίου 16S rrna από προκαρυωτικούς οργανισμούς που μπορούν να καλλιεργηθούν και από που δεν μπορούν να καλλιεργηθούν (Rappe & Giovannoni 2003). Πριν προτείνει ο Woese την χρήση του 16S rrna για την φυλογένεση των οργανισμών, ήταν αναγνωρισμένα 12 βακτηριακά φύλα, τα οποία είχαν τουλάχιστον από 1 αντιπρόσωπο με δυνατότητα καλλιέργειας. Με την χρήση του 16S rrna, έχουν αναγνωριστεί 14 επιπλέον φύλα με αντιπροσώπους με δυνατότητα καλλιέργειας. Επιπλέον, έχουν προταθεί 26 υποψήφια φύλα, τα οποία δεν έχουν κανένα αντιπρόσωπο που να μπορεί να καλλιεργηθεί με τις μέχρι στιγμής μεθόδους καλλιέργειας. Αυτό δείχνει την σημασία της χρήσης μεθόδων που δεν απαιτούν καλλιέργεια για τον προσδιορισμό της μικροβιακής ποικιλότητας Γιατί μελετάμε την μικροβιακή ποικιλότητα Στο σημείο αυτό εγείρεται το ερώτημα: για ποιο λόγο είναι σημαντικό να ανακαλύψουμε αυτόν τον τεράστιο και σχεδόν ανεξερεύνητο μικροβιακό πλούτο; Είναι ευρέως γνωστό ότι τα προκαρυωτικά κύτταρα υπερτερούν αριθμητικά των ευκαρυωτικών κατά πολλές τάξεις μεγέθους. Χαρακτηριστικό παράδειγμα αποτελεί το ανθρώπινο σώμα όπου τα βακτηριακά κύτταρα είναι φορές ( ) περισσότερα από τα κύτταρα του σώματος (10 13 ). Επίσης πρόσφατες εκτιμήσεις υποδηλώνουν ότι η βιομάζα των προκαρυωτικών οργανισμών ξεπερνά κατά πολύ την βιομάζα του συνόλου των ευκαρυωτικών κυττάρων. Εκτιμάται ότι περίπου 500 δισεκατομμύρια τόνοι άνθρακα είναι ενσωματωμένοι στα κύτταρα των προκαρυωτικών οργανισμών και αποτελεί την μισή ποσότητα άνθρακα που απαντάται στη βιόσφαιρα (Whitman et al. 1998). Από τους αριθμούς και μόνο γίνεται κατανοητή η σημασία της μελέτης της μικροβιακής ποικιλότητας. Ωστόσο, κάποιες ιδιότητες των προκαρυωτικών μικροοργανισμών καθιστούν την ανάγκη της μελέτης αυτής ακόμη πιο επιτακτική (Schleifer 2004): Οι προκαρυωτικοί μικροοργανισμοί αποτελούν το θεμέλιο της βιόσφαιρας. Είναι οι πρώτοι ζωντανοί οργανισμοί που εμφανίστηκαν στη γη και χωρίς την παρουσία τους οι υπόλοιπες μορφές ζωής δεν θα είχαν εξελιχθεί και δεν

24 θα μπορούσαν να υπάρξουν. Επίσης οι προκαρυωτικοί μικροοργανισμοί δημιούργησαν ένα περιβάλλον πλούσιο σε οξυγόνο που είναι απαραίτητο για την γένεση και επιβίωση των ανώτερων μορφών ζωής Οι βιογεωχημικοί κύκλοι θα ήταν ατελείς χωρίς την συνεισφορά των μικροβίων. Πιο συγκεκριμένα, η ολοκλήρωση των κύκλων του αζώτου και του θείου όπως επίσης και η οξείδωση και αναγωγή των μετάλλων θα ήταν αδύνατη χωρίς την παρουσία των μικροβίων. Οι προκαρυωτικοί μικροοργανισμοί αποκτούν ενέργεια για την ανάπτυξη τους μεταφέροντας ηλεκτρόνια σε ένα μεγάλο αριθμό βλαβερών μετάλλων όπως ουράνιο, χρώμιο, αρσενικό και πλουτώνιο. Τα όρια της ζωής καθορίζονται επίσης από τους προκαρυωτικούς μικροοργανισμούς. Μπορούν να επιβιώσουν και να αναπτυχθούν στις πιο ακραίες περιβαλλοντικές συνθήκες, σε θερμοπηγές με θερμοκρασία νερού 121 C (Kashefi & Lovley 2003) ή σε παγωμένο νερό λίμνης τέσσερα χιλιόμετρα κάτω από τον πάγο στην ανατολική Ανταρκτική (Karl et al. 1999). Πολλοί προκαρυωτικοί μικροοργανισμοί είναι ενδοσυμβιωτικοί σε άλλους ανώτερους οργανισμούς και διαδραματίζουν σημαντικό ρόλο στην επιβίωση τους. Φέρουν σε πέρας βιοχημικές αντιδράσεις που δεν μπορούν να επιτελέσουν οι ξενιστές όπως η βιοσύνθεση αμινοξέων, βιταμινών ή η αποικοδόμηση ορισμένων μακρομορίων. Οι προκαρυωτικοί μικροοργανισμοί αποτελούν τους «διαχειριστές» της γης, καθώς αποικοδομούν τους νεκρούς οργανισμούς και συμβάλλουν έτσι στην ανακύκλωση της ύλης. Επίσης, καταστρέφουν ρυπαντές, συμβάλλοντας έτσι στην προστασία του περιβάλλοντος (Colwell 1997). Φέρουν γονίδια που ομόλογα τους παρατηρούνται σε πολλούς ανώτερους οργανισμούς και έτσι αποτελούν αντικείμενο μελέτης της εξέλιξης Τέλος, οι μικροοργανισμοί αποτελούν σημαντικά εργαλεία στη βιοτεχνολογία και πηγή νέων προϊόντων και βιοτεχνολογικών εφαρμογών. Με βάση τις παραπάνω ιδιότητες, και όχι μόνο αυτές, την τελευταία εικοσαετία παρατηρείται μια έντονη επιστημονική δραστηριότητα στο χώρο της περιβαλλοντικής μικροβιολογίας και συγκεκριμένα της μικροβιακής οικολογίας. Με την βοήθεια των εφαρμογών της μοριακής βιολογίας και της γενετικής μηχανικής, είναι πλέον

25 ευκολότερο να προσδιοριστεί η μικροβιακή ποικιλότητα και να ανακαλυφθεί ο τεράστιος παγκόσμιος μικροβιακός πλούτος. 1.8 Η λίμνη της Καστοριάς Η λίμνη της Καστοριάς βρίσκεται στη δυτική Μακεδονία, στον νομό Καστοριάς (40 31 N, E ) σε υψόμετρο 620μ. Έχει σχήμα νεφροειδές (εικ.8) και καλύπτει έκταση 28 km 2. Η λίμνη έχει μέσο βάθος 5 m και μέγιστο βάθος 8,5 m (Mourkides & Tsiouris, 1984). Η λίμνη αποτελεί κατάλοιπο παλιάς εκτεταμένης λίμνης με έκταση 164 km 2 και μέγιστο βάθος μεγαλύτερο από 50 m (Τεταρτογενές). Είναι τεκτονικής προέλευσης και υπολογίζεται ότι σχηματίστηκε πριν από έτη (Μειόκαινο). Η λεκάνη απορροής της λίμνης έχει έκταση 253 απ όπου μέσω 8 χειμάρρων τροφοδοτείται η λίμνη. Εκτός από τα ρέματα η λίμνη τροφοδοτείται και από το νερό της βροχής καθώς και από πολλές υπολίμνιες πηγές. Εικόνα 8. Πανοραμική άποψη της πόλης της Καστοριάς και της ομώνυμης λίμνης. Οι υψηλές συγκεντρώσεις θρεπτικών όπως του ανόργανου αζώτου και του φωσφόρου και οι υψηλές τιμές βιομάζας της ομάδας των κυανοβακτηρίων, υποδηλώνουν ένα υπερεύτροφο σύστημα που χαρακτηρίζεται από συχνές ανθίσεις του νερού (waterblooms) κατά τη διάρκεια του χρόνου, με μεγαλύτερη συχνότητα εμφάνισης κατά τη θερμή περίοδο (Κατσιάπη 2007). Τα είδη που δημιουργούν αυτές τις ανθίσεις στην λίμνη είναι τα Microcystis aeruginosa, M. flos-aquae, M. novacekii,

26 M. wesenbergii, καθώς και τα Anabaena flos-aquae και A. viguieri. Επίσης, άλλα κυανοβακτηριακά είδη που επικρατούν στη λίμνη της Καστοριάς είναι τα Limnothrix redekei και Cylindrospermopsis raciborskii (Βαρδάκα 2001). Η λίμνη της Καστοριάς εμφανίζει τις εξής «ιδιαιτερότητες»: Για πολλές δεκαετίες, μέχρι και το 1995 (το 1996 γίνεται έναρξη της λειτουργίας μονάδας βιολογικού καθαρισμού στη περιοχή της Καστοριάς) δεχόταν αστικά λύματα, τα οποία ουσιαστικά διαμόρφωσαν τον υπερεύτροφο χαρακτήρα της με συνέπεια την εμφάνιση ανθίσεων του νερού σε όλη τη διάρκεια του έτους. Επίσης κατά καιρούς, πραγματοποιήθηκαν διάφορες επεμβάσεις σε αυτή είτε με στόχο την αύξηση των ιχθυαποθεμάτων (εμπλουτισμός με κυπρινοειδή) ή για αισθητικούς λόγους (κοπή των μακροφύτων, χρήση φυτοφαρμάκων για τη μείωση των κυανοβακτηρίων), οι οποίες ουσιαστικά ευνόησαν ακόμη περισσότερο την εμφάνιση ανθίσεων του νερού. Ο υπερεύτροφος χαρακτήρας της λίμνης, σε συνδυασμό με την παρουσία της πόλης της Καστοριάς αλλά και άλλων οικισμών στις όχθες της, την καθιστούν ένα ιδιαίτερο οικοσύστημα για τον προσδιορισμό της μικροβιακής ποικιλότητας. 1.9 Σκοπός της εργασίας Σκοπός της παρούσας εργασίας ήταν η καταγραφή της μικροβιακής ποικιλότητας στη λίμνη της Καστοριάς, τόσο στην υδάτινη φάση όσο και στο ίζημα. Πιο συγκεκριμένα, στη συγκεκριμένη εργασία οι επιμέρους στόχοι ήταν: Ο προσδιορισμός της σύστασης των προκαρυωτικών μικροοργανισμών (Archaea & Bacteria) σε συγκεκριμένα σημεία της λίμνης, η μελέτη της δυναμικής των μικροβιακών κοινοτήτων κατά την διάρκεια του έτους 2009 και η συσχέτιση της μικροβιακής σύστασης με φυσικούς και ανθρωπογενείς περιβαλλοντικούς παράγοντες


28 2.1 Δειγματοληψία Επί τόπου μέτρηση φυσικοχημικών παραμέτρων Κατά την διάρκεια του έτους 2009 πραγματοποιήθηκαν 4 εποχιακές δειγματοληψίες (Ιανουάριος, Απρίλιος, Ιούλιος, Οκτώβριος) σε τέσσερα συγκεκριμένα σημεία της λίμνης (εικ.9). Σ 1 Σ 4 Σ 2 Σ 3 Εικόνα 9. Η λίμνη της Καστοριάς (εικόνα από δορυφόρο). Η επιλογή των σταθμών δειγματοληψίας έγινε με βάση ορισμένα χαρακτηριστικά που έγιναν γνωστά από προηγούμενες υδροβιολογικές μελέτες (Μουστάκα και συν. 2000). Τα χαρακτηριστικά κάθε σταθμού δειγματοληψίας είναι τα εξής: Σταθμός 1. Στον συγκεκριμένο σταθμό έχουν παρατηρηθεί οι υψηλότερες συγκεντρώσεις θρεπτικών συστατικών (αζωτούχων και φωσφορικών ενώσεων) στη λίμνη, λόγω των παρακείμενων γεωργικών εκτάσεων (καλλιέργειες μήλου και φασολιού). Σταθμός 2. Ο συγκεκριμένος σταθμός έχει σχεδόν τα ίδια χαρακτηριστικά με το σταθμό 1 και επιπλέον βρίσκεται κοντά στις εκβολές του χειμάρρου «Ξηροποτάμου», που αποτελεί τον μεγαλύτερο σε ποσότητα νερού χείμαρρο της λεκάνης απορροής της λίμνης

29 Σταθμός 3. Στον συγκεκριμένο σταθμό έχουν παρατηρηθεί οι χαμηλότερες συγκεντρώσεις θρεπτικών συστατικών στη λίμνη. Επιλέχθηκε ως ένα σημείο με τη σχετικά μικρότερη επιβάρυνση από λιπάσματα και φυτοφάρμακα, ενώ βρίσκεται κοντά στην περιοχή του θηροφράγματος, από το οποίο απομακρύνεται ελεγχόμενα ποσότητα νερού όταν η στάθμη φτάσει σε υψηλά επίπεδα. Σταθμός 4. Ο συγκεκριμένος σταθμός βρίσκεται στον μικρό κόλπο που περιβάλλεται από την πόλη της Καστοριάς. Στο σημείο αυτό καταλήγουν τα όμβρια ύδατα από την πόλη της Καστοριάς, ενώ πριν λειτουργήσει ο βιολογικός καθαρισμός κατέληγαν στο σημείο αυτό και τα αστικά λύματα. Σε κάθε σταθμό έγινε δειγματοληψία 5 L επιφανειακού νερού (για την ακρίβεια νερού βάθους 0,5 m) με χρήση κατάλληλου δειγματολήπτη ( δειγματολήπτης νερού KC Ruttner, 0,7 L) και ιζήματος με κατάλληλο δειγματολήπτη ιζήματος (Ekman Birge δειγματολήπτης) (εικ.10). Εικόνα 10. Δειγματολήπτης ιζήματος Ekman - Birge (αριστερά) και δειγματολήπτης νερού KC - Ruttner (δεξιά) (ηλεκτρονικές πηγές 4 και 5). Επίσης, σε κάθε σταθμό δειγματοληψίας έγινε λήψη 2 L νερού τόσο από βάθος 0,5 m όσο και από το νερό ακριβώς πάνω από τον πυθμένα για ποσοτικό προσδιορισμό χλωροφύλλης α και θρεπτικών συστατικών (αζωτούχων και φωσφορικών)

30 Με την χρήση κατάλληλου οργάνου μέτρησης (YSI 556 Handheld Multiparameter) έγινε in situ μέτρηση της θερμοκρασίας, ph, συγκέντρωσης διαλυμένου οξυγόνου, αλατότητας, αγωγιμότητας και συγκέντρωσης ολικών στερεών. Επίσης, με την χρήση του δίσκου Secchi (εικ.11) μετρήθηκε η διαφάνεια του νερού (με βάση το μέγιστο βάθος στο οποίο εξακολουθεί να είναι ορατός ο δίσκος). Εικόνα 11. Ο δίσκος Secchi, με τον οποίο υπολογίζεται η διαφάνεια του νερού σε υδάτινα συστήματα (ηλεκτρονική πηγή 6). Για τον σωστό ποσοτικό προσδιορισμό της χλωροφύλλης α, τα δείγματα τοποθετούνταν σε μαύρες σακούλες, ώστε να μην μετατρέπεται η χλωροφύλλη α υπό την επίδραση της ηλιακής ακτινοβολίας σε άλλες μορφές (φαιοφυτίνη κ.α.). Ακολούθησε μεταφορά των δειγμάτων στο εργαστήριο και άμεσος ποσοτικός προσδιορισμός της συγκέντρωσης της χλωροφύλλης α και των θρεπτικών συστατικών (αζωτούχων και φωσφορικών)

31 2.2 Ποσοτικός προσδιορισμός χλωροφύλλης α Ο ποσοτικός προσδιορισμός της χλωροφύλλης α πραγματοποιούνταν εντός 24 ωρών από την στιγμή της δειγματοληψίας. Η διαδικασία για τον ποσοτικό προσδιορισμό της χλωροφύλλης α είναι η εξής (APHA,1999) : I. Διήθηση 1000 ml δείγματος μέσω φίλτρων ινών υάλου Whatman ( Whatman Grade GF/F, cat # ). Για κάθε δείγμα χρησιμοποιείται μόνο ένα φίλτρο. II. Μεταφορά του κάθε φίλτρου σε σωλήνα falcon όπου έχει τοποθετηθεί διάλυμα ακετόνης 90% III. Μεταφορά τους 4 C για 20 ώρες περίπου. IV. Μεταφορά των διαλυμάτων χωρίς τα φίλτρα σε νέα σωληνάκια falcon, καταγραφή του όγκου (extract volume) και φυγοκέντρηση στις 2500 rpm για 20 λεπτά. V. Μέτρηση συγκέντρωσης της χλωροφύλλης α με φασματοφωτομέτρηση. Πιο συγκεκριμένα, υπολογίζεται η οπτική πυκνότητα του υπερκειμένου σε τρία διαφορετικά μήκη κύματος, 664nm,647nm και 630nm, οπότε η συγκέντρωση της χλωροφύλλης στο υπερκείμενο προκύπτει από τον τύπο : C α = 11,85 Χ (OD664) 1,54 X (OD647) 0,08 Χ (OD630), όπου OD = Optical Density, Οπτική Πυκνότητα. Η συγκέντρωση της χλωροφύλλης στο αρχικό περιβαλλοντικό δείγμα προκύπτει από τον τύπο: C chla = C α Χ extract volume / διηθούμενος όγκος δείγματος 2.3 Ποσοτικός προσδιορισμός ανόργανων θρεπτικών συστατικών (αζωτούχων και φωσφορικών) Ο ποσοτικός προσδιορισμός των ανόργανων αζωτούχων και φωσφορικών συστατικών έγινε με την μέθοδο της φασματοφωτομέτρησης με την χρήση του φασματοφωτόμετρου Smart της εταιρίας LaMotte (Model No. LMC202 Rev E) (εικ.12)

32 Εικόνα 12. Το φασματοφωτόμετρο Smart της εταιρίας LaMotte (ηλεκτρονική πηγή 7). Για τον ποσοτικό προσδιορισμό των θρεπτικών συστατικών χρησιμοποιήθηκαν 4 kit της ίδιας εταιρίας : Για τον ποσοτικό προσδιορισμό των αμμωνιακών αζωτούχων χρησιμοποιήθηκε το kit με κωδικό SC, που βασίζεται στη μέθοδο του σαλικυλικού άλατος. Για τον ποσοτικό προσδιορισμό των νιτρικών αζωτούχων χρησιμοποιήθηκε το kit με κωδικό 3649-SC, που βασίζεται στη μέθοδο αναγωγής του καδμίου. Για τον ποσοτικό προσδιορισμό των νιτρωδών αζωτούχων χρησιμοποιήθηκε το kit με κωδικό 3650-SC, που βασίζεται στη μέθοδο diazotization. Για τον ποσοτικό προσδιορισμό των φωσφορικών χρησιμοποιήθηκε το kit με κωδικό 3653-SC, που βασίζεται στη μέθοδο αναγωγής του ασκορβικού οξέος. Σε όλες τις παραπάνω μεθόδους, μετά από κατάλληλες αντιδράσεις, παράγεται μια χρωστική, η ένταση της οποίας είναι ανάλογη της συγκέντρωσης του κάθε θρεπτικού στο δείγμα (www.lamotte.com). 2.4 Διήθηση περιβαλλοντικών δειγμάτων και ανάκτηση μικροοργανισμών Η ανάκτηση των μικροοργανισμών από κάθε δείγμα πραγματοποιήθηκε με διαδοχικές διηθήσεις του δείγματος και συγκέντρωση τους σε κατάλληλα φίλτρα. Πιο συγκεκριμένα, για την ανάκτηση των μικροοργανισμών από δείγμα του ιζήματος η διαδικασία που ακολουθήθηκε είναι η εξής : 1. Επαναιώρηση 150g από την λάσπη του ιζήματος σε 2 L απιονισμένου νερού ή νερού από τον πυθμένα, πάνω από το ίζημα

33 2. Διήθηση του δείγματος 2-3 φορές από υδρόφιλο βαμβάκι 3. Διήθηση του δείγματος από φίλτρο με διάμετρο πόρου 20μm (Millipore, cat# NY ) με χρήση αντλίας κενού (εικ.14) 4. Διήθηση του δείγματος από φίλτρο με διάμετρο πόρου 3μm (Whatman Grade GF/D, cat# ) 5. Τελική διήθηση για συγκράτηση βακτηριακών κυττάρων από φίλτρα διαμέτρου 0,45μm (Whatman Mixed cellulose ester filters, cat# ) (εικ.13). Εικόνα 13. Φίλτρα Whatman με διάμετρο πόρου 0,45μm για την συγκράτηση μικροοργανισμών. 6. Τοποθέτηση των φίλτρων ανά 4 σε σωλήνες φυγοκέντρου των 50ml και αποθήκευση στην κατάψυξη για εξαγωγή DNA Για την ανάκτηση των μικροοργανισμών από δείγμα της υδάτινης στήλης (επιφάνειας) ακολουθείται η ίδια διαδικασία με την διαφορά ότι διηθείται ποσότητα δείγματος ίση με 5 L και δεν γίνεται διήθηση από υδρόφιλο βαμβάκι. Εικόνα 14. Η διάταξη που χρησιμοποιήθηκε για την διήθηση των δειγμάτων (ηλ.πηγή 8)

34 2.5 Απομόνωση DNA από τους μικροοργανισμούς Για την απομόνωση DNA από τους μικροοργανισμούς που έχουν συγκρατηθεί στα φίλτρα εφαρμόστηκε το εξής πρωτόκολλο: 1. Προσθήκη ml διαλύματος TE Buffer ph 8 (10mM Tris HCl ph 8, 1mM EDTA ph 8) και έντονη ανάδευση (vortex) ώστε να απομακρυνθούν οι μικροοργανισμοί από τα φίλτρα, 2. Μεταφορά του περιεχομένου σε σωλήνα φυγοκέντρησης και φυγοκέντρηση για 20 λεπτά στους 4 C (13000 rpm). 3. Απομάκρυνση υπερκειμένου και επαναδιάλυση του ιζήματος σε 600 μl διαλύματος ΤΕ Buffer. 4. Προσθήκη 36 μl διαλύματος 10% SDS και 11 μl πρωτεϊνάσης Κ (10mg/ml). Ανάδευση και επώαση στους 37 C για 45 λεπτά. 5. Προσθήκη 120 μl διαλύματος 5M NaCl και ελαφριά ανάδευση. 6. Προσθήκη 100 μl διαλύματος απομόνωσης CTAB και επώαση στους 10 C για 15 λεπτά. 7. Προσθήκη ίσης ποσότητας διαλύματος χλωροφορμίου/ισοαμυλικής αλκοόλης (24 : 1) και καλή ανάδευση. 8. Φυγοκέντρηση στους 4 C για 10 λεπτά (13000 rpm) 9. Μεταφορά 500 μl από το υπερκείμενο σε νέο σωλήνα και προσθήκη 700 μl ισοπροπανόλης. 10. Μεταφορά στους -20 C overnight. 11. Φυγοκέντρηση για 15 λεπτά (14000 rpm) στους 4 C. 12. Απομάκρυνση υπερκειμένου και προσθήκη 1 ml αιθανόλης 70%. 13. Φυγοκέντρηση στους 4 C για 10 λεπτά (13000 rpm). 14. Απομάκρυνση υπερκειμένου 15. Απομάκρυνση καταλοίπων αιθανόλης και επαναδιάλυση του ιζήματος σε 30 μl διαλύματος TE Buffer. 16. Αποθήκευση στους 4 C

35 2.6 Προσδιορισμός της ποσότητας του απομονωμένου DNA από τα περιβαλλοντικά δείγματα. Μετά την απομόνωση του DNA, έγινε ηλεκτροφόρηση συγκεκριμένης ποσότητας των δειγμάτων σε πηκτή αγαρόζης, ώστε να προσδιοριστεί η συγκέντρωση του απομονωμένου DNA. Χρησιμοποιήθηκε πηκτή με συγκέντρωση αγαρόζης 0,7% w/v, ενώ ως μάρτυρας μοριακών βαρών χρησιμοποιήθηκε ο Lambda DNA/EcoRI+HindIII Marker 3 της εταιρίας Fermentas. 2.7 Ενίσχυση τμήματος της αλληλουχίας του 16S rrna γονιδίου των Bacteria και Archaea. Το ολικό γονιδιωματικό DNA που απομονώθηκε από κάθε δείγμα αντιστοιχεί στην πλειονότητα, αν όχι στο σύνολο, των μικροοργανισμών που απαντώνται σε κάθε δείγμα. Με την χρήση κατάλληλων παγκόσμιων εκκινητών έγινε ενίσχυση τμήματος της αλληλουχίας του 16S rrna γονιδίου για τα Bacteria και τα Archaea που απαντώνται σε κάθε δείγμα. Στον πίνακα 2 παρουσιάζονται τα ζεύγη των εκκινητών που χρησιμοποιήθηκαν με κάποιες ιδιότητες τους (JGI 2008). Πίνακας 2. Τα ζεύγη των εκκινητών που χρησιμοποιήθηκαν για την ενίσχυση τμήματος των γονιδίων 16S rrna των Bacteria και Archaea Οργανισμός Bacteria Όνομα εκκινητή Αλληλουχία εκκινητή (5 3 ) Μήκος Μέγεθος προϊόντος 27F AGAGTTTGATCCTGGCTCAG R GACGGGCGGTGWGTRCA 17 ~1400 bp Archaea 4F TCCGGTTGATCCTGCCRG R GGTTACCTTGTTACGACTT 19 ~1500 bp Ως υπόστρωμα για την αντίδραση της PCR χρησιμοποιήθηκε, όπως προαναφέρθηκε, απομονωμένο DNA από τα περιβαλλοντικά δείγματα. Η ποσότητα του κυμαινόταν μεταξύ 0,08 και 1,2 ng, όπως προέκυψε μετά από ένα αριθμό δοκιμαστικών αντιδράσεων (αραίωση 1:50). Η αντίδραση έγινε σε τελικό όγκο 20 μl. Χρησιμοποιήθηκε, εκτός του υποστρώματος, η θερμοανθεκτική DNA πολυμεράση GoTaq Flexi της εταιρίας Promega μαζί με το PCR Buffer και MgCl 2, dntp s της

36 εταιρείας Invitrogen και τα ζεύγη εκκινητών της εταιρίας Operon. Οι συγκεντρώσεις του κάθε συστατικού στην αντίδραση παρουσιάζονται στον πίνακα 3. Πίνακας 3. Συγκεντρώσεις των συστατικών της PCR για την ενίσχυση τμήματος του 16S rrna γονιδίου των Archaea και Bacteria Συστατικό Τελική συγκέντρωση PCR buffer 1 MgCl 2 1,5 dntp s 0,125 Forward Primer (27F / 4F) 0,3 Reverse Primer (1391R / 1492R) 0,3 GoTaq Flexi DNA πολυμεράση Υπόστρωμα 1U 0,08 1,2 ng Η αντίδραση έγινε στον θερμικό κυκλοποιητή CreaCon T-CY. Το πρόγραμμα που ακολουθήθηκε ήταν κοινό για τα Archaea και τα Bacteria. Χαρακτηριστικό είναι ότι για κάθε δείγμα έγιναν τρεις αντιδράσεις PCR με θερμοκρασίες υβριδισμού 50 C, 53 C και 57 C. Αυτό έγινε ώστε να είναι δυνατή η ενίσχυση του τμήματος 16S rrna από όσο το δυνατόν περισσότερα στελέχη. Στον πίνακα 4 παρουσιάζεται το πρόγραμμα της PCR που ακολουθήθηκε. Πίνακας 4. Το πρόγραμμα της PCR που εφαρμόστηκε για την ενίσχυση τμήματος του 16S rrna γονιδίου των Archaea και Bacteria Στάδιο Θερμοκρασία Χρόνος Αριθμός κύκλων Αρχική αποδιάταξη 95 C 5 Αποδιάταξη 95 C 30 Υβριδισμός 50 C,53 C,57 C 40 Χ 35 Επιμήκυνση 72 C 120 Τελική επιμήκυνση 72 C

37 2.8 Κλωνοποίηση των προϊόντων της PCR Κατασκευή 16S βιβλιοθηκών Το επόμενο στάδιο ήταν η κλωνοποίηση των προϊόντων της PCR σε κατάλληλο πλασμιδιακό φορέα και η δημιουργία 16S rrna βιβλιοθηκών για Archaea και Bacteria για τα δείγματα ιζήματος των σταθμών Σ2, Σ3 και Σ4 από την δειγματοληψία του Απριλίου Πριν την διαδικασία της κλωνοποίησης, έγινε καθαρισμός των προϊόντων PCR από τους εκκινητές και την περίσσεια dntps. Για τον σταθμό Σ2 έγινε καθαρισμός τόσο με gel extraction όσο και απευθείας καθαρισμός με χρήση του κατάλληλου πρωτοκόλλου. Αντίθετα, για τους σταθμούς Σ3 και Σ4 έγινε καθαρισμός μόνο με χρήση του κατάλληλου πρωτοκόλλου. Για τον καθαρισμό των PCR προϊόντων με gel extraction εφαρμόστηκε το πρωτόκολλο Protocol for DNA extraction from agarose gels Nucleospin Extract II της εταιρίας Macherey Nagel, ενώ για τον καθαρισμό των προϊόντων PCR το πρωτόκολλο Protocol for PCR clean-up - Nucleospin Extract II της εταιρίας Macherey Nagel (www.macherey-nagel.com) Για κλωνοποίηση των προϊόντων PCR χρησιμοποιήθηκε το kit pgem -T Easy Vector Systems της εταιρίας Promega (www.promega.com), σύμφωνα με το πρωτόκολλο που το συνοδεύει. Τα στάδια της διαδικασίας περιγράφονται αναλυτικά στη συνέχεια : -Σύνδεση ενθέματος (PCR προϊόντος) με τον φορέα κλωνοποίησης ( Ligation ). Η διαδικασία σύνδεσης έχει ως εξής : i. Ξεπάγωμα των 2X Rapid Ligation Buffer(ρυθμιστικό διάλυμα για την αντίδραση σύνδεσης), pgem-t Easy Vector (πλασμίδιο - φορέας κλωνοποίησης) (εικ.15) και της DNA λιγάσης T4. ii. Ανάμιξη των αντιδραστηρίων για την αντίδραση σύνδεσης σύμφωνα με τον πίνακα 5 iii. Ανάμιξη και επώαση overnight στους 4 C Πίνακας 5. Συστατικά της αντίδρασης σύνδεσης του προϊόντος PCR με τον πλασμιδιακό φορέα Συστατικό αντίδρασης Όγκος 2X Rapid Ligation Buffer pgem-t Easy Vector Προϊόν PCR T4 DNA λιγάση H 2 O Σύνολο 5 μl 1 μl 100 ng 1 μl 3 μl 10 μl

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών

Κεφάλαιο 1: Εισαγωγή. Κεφάλαιο 2: Η Βιολογία των Ιών Κεφάλαιο 1: Εισαγωγή 1.1 Μικροοργανισμοί, Μικροβιολογία και Μικροβιολόγοι... 19 1.1.1 Μικροοργανισμοί... 19 1.1.2 Μικροβιολογία... 20 1.1.3 Μικροβιολόγοι... 21 1.2 Σύντομη Ιστορική Εξέλιξη της Μικροβιολογίας...

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα


Ενότητα: ΕΥΚΑΡΥΩΤΙΚΑ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Τίτλος Μαθήματος: Γενική Μικροβιολογία Ενότητα: ΕΥΚΑΡΥΩΤΙΚΑ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Διδάσκων: Καθηγητής Ιωάννης Σαββαΐδης Τμήμα: Χημείας ΚΕΦΑΛΑΙΟ 3 Ευκαρυωτικά και Προκαρυωτικά Κύτταρα Οι διάφορες βιοχημικές

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 01 : Εισαγωγή. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ

Κυτταρική Βιολογία. Ενότητα 01 : Εισαγωγή. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 01 : Εισαγωγή Παναγιωτίδης Χρήστος ΑΠΘ Άδειες χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης

Διαβάστε περισσότερα

Σήµερα οι εξελίξεις στην Επιστήµη και στην Τεχνολογία δίνουν τη

Σήµερα οι εξελίξεις στην Επιστήµη και στην Τεχνολογία δίνουν τη ΚΕΦΑΛΑΙΟ 7ο: ΑΡΧΕΣ & ΜΕΘΟ ΟΛΟΓΙΑ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ Συνδυασµός ΤΕΧΝΟΛΟΓΙΑΣ & ΕΠΙΣΤΗΜΗΣ Προσφέρει τη δυνατότητα χρησιµοποίησης των ζωντανών οργανισµών για την παραγωγή χρήσιµων προϊόντων 1 Οι ζωντανοί οργανισµοί

Διαβάστε περισσότερα

Κατηγοριοποίηση μικροοργανισμών

Κατηγοριοποίηση μικροοργανισμών Κατηγοριοποίηση μικροοργανισμών 1 Μαθησιακά αποτελέσματα 1. Καταγραφή των χαρακτηριστικών των διαφόρων τύπων μικροοργανισμών 2. Κατηγοριοποίηση των μικροοργανισμών σε βακτήρια, μύκητες, πρωτόζωα, ιούς

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Department of Biochemistry

Διαβάστε περισσότερα

6 CO 2 + 6H 2 O C 6 Η 12 O 6 + 6 O2

6 CO 2 + 6H 2 O C 6 Η 12 O 6 + 6 O2 78 ΠΑΡΑΓΩΓΙΚΟΤΗΤΑ ΥΔΑΤΙΝΩΝ ΟΙΚΟΣΥΣΤΗΜΑΤΩΝ ΦΥΤΙΚΟΙ ΟΡΓΑΝΙΣΜΟΙ (μακροφύκη φυτοπλαγκτόν) ΠΡΩΤΟΓΕΝΕΙΣ ΠAΡΑΓΩΓΟΙ ( μετατρέπουν ανόργανα συστατικά σε οργανικές ενώσεις ) φωτοσύνθεση 6 CO 2 + 6H 2 O C 6 Η 12

Διαβάστε περισσότερα

7. Βιοτεχνολογία. α) η διαθεσιμότητα θρεπτικών συστατικών στο θρεπτικό υλικό, β) το ph, γ) το Ο 2 και δ) η θερμοκρασία.

7. Βιοτεχνολογία. α) η διαθεσιμότητα θρεπτικών συστατικών στο θρεπτικό υλικό, β) το ph, γ) το Ο 2 και δ) η θερμοκρασία. 7. Βιοτεχνολογία Εισαγωγή Τι είναι η Βιοτεχνολογία; Η Βιοτεχνολογία αποτελεί συνδυασμό επιστήμης και τεχνολογίας. Ειδικότερα εφαρμόζει τις γνώσεις που έχουν αποκτηθεί για τις βιολογικές λειτουργίες των

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 15 η ΜΙΚΡΟΒΙΑΚΗ ΕΞΕΛΙΞΗ ΚΑΙ ΣΥΣΤΗΜΑΤΙΚΗ


Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα ΚΕΦΑΛΑΙΟ 1 Οργάνωση της ζωής βιολογικά συστήματα 1.2 Κύτταρο: η μονάδα της ζωής Ιστορικά 1665: Ο Ρ.Χουκ μιλά για κύτταρα. Σύγχρονη κυτταρική θεωρία: Το κύτταρο είναι η θεμελιώδης δομική και λειτουργική

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Κεφάλαιο 2 ο : Άνθρωπος και Περιβάλλον

Βιολογία Γενικής Παιδείας Κεφάλαιο 2 ο : Άνθρωπος και Περιβάλλον Βιολογία Γενικής Παιδείας Κεφάλαιο 2 ο : Άνθρωπος και Περιβάλλον Οικολογία: η επιστήμη που μελετά τις σχέσεις των οργανισμών, και φυσικά του ανθρώπου, με τους βιοτικούς (ζωντανούς οργανισμούς του ίδιου

Διαβάστε περισσότερα

ΙΠ: Μεταπτυχιακό Πρόγραµµα

ΙΠ: Μεταπτυχιακό Πρόγραµµα ΙΠ: Μεταπτυχιακό Πρόγραµµα Τεχνολογικό Πανεπιστήµιο Κύπρου, Τµήµα ιαχείρισης Περιβάλλοντος. (Επιστήµη και Τεχνολογία Περιβάλλοντος) Συντονιστής Προγράµµατος: Καθ. Κωνσταντίνος Βαρώτσης c.varotsis@cut.ac.cy

Διαβάστε περισσότερα


ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα


ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ Στο φλοιό της Γης απαντώνται 92 χημικά στοιχεία, από τα οποία 27 μόνο είναι απαραίτητα για τη ζωή. ΠΟΣΟΣΤΟ ΣΤΟΙΧΕΙΑ 96% ο άνθρακας (C), το υδρογόνο (H), το οξυγόνο (O) και

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Βιοτεχνολογία. Ανάπτυξη μικροοργανισμών Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Βιοτεχνολογία. Ανάπτυξη μικροοργανισμών Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιοτεχνολογία Ανάπτυξη μικροοργανισμών Διδάσκουσα: Αναπλ. Καθ. Άννα Ειρήνη Κούκκου Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Bιολογία γενικής παιδείας

Bιολογία γενικής παιδείας Bιολογία γενικής παιδείας Α1. 1. δ 2. α 3. β 4. δ ΘΕΜΑ Α Α2. ΟΛΑ ΚΑΠΟΙΑ Τοξίνες + Πλασματική μεμβράνη + Κυτταρικό τοίχωμα + Αποικίες + Κάψα + Πλασμίδια + Μαστίγια + Ριβοσώματα + Πυρηνοειδές + Ενδοσπόρια

Διαβάστε περισσότερα

Ποιοτικά Χαρακτηριστικά Λυµάτων

Ποιοτικά Χαρακτηριστικά Λυµάτων Ποιοτικά Χαρακτηριστικά Λυµάτων µπορούν να καταταχθούν σε τρεις κατηγορίες: Φυσικά Χηµικά Βιολογικά. Πολλές από τις παραµέτρους που ανήκουν στις κατηγορίες αυτές αλληλεξαρτώνται π.χ. η θερµοκρασία που

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr OΙΚΟΛΟΓΙΑ 1. Όσο το ποσό της ενέργειας: α) μειώνεται προς τα ανώτερα

Διαβάστε περισσότερα

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς Λειτουργίες Γενετικού Υλικού o Αποθήκευση της γενετικής πληροφορίας. Η οργάνωση της γενετικής πληροφορίας

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέμα 1 ο : Να επιλέξετε τη σωστή απάντηση: 1. Το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης δεν περιλαμβάνει α. το mrna β. τη μεγάλη ριβοσωμική υπομονάδα γ.

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

Μικροβιολογία Καλλιέργεια µικροοργανισµών

Μικροβιολογία Καλλιέργεια µικροοργανισµών Μικροβιολογία Καλλιέργεια µικροοργανισµών Θεωρητικό µέρος Οι µικροοργανισµοί χωρίζονται από άποψη κυτταρικής οργάνωσης σε δύο µεγάλες κατηγορίες: τους προκαρυωτικούς και ευκαρυωτικούς. Οι προκαρυωτικοί

Διαβάστε περισσότερα


ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΑΠΟΣΤΟΛΟΣ ΒΑΝΤΑΡΑΚΗΣ ΒΙΟΛΟΓΟΣ (M.Sc, Ph.D) Επιδημίες μολυσματικών ασθενειών συχνά οφείλονται σε έκθεση σε μία κοινή πηγή ενός αιτιολογικού παράγοντα.

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 1: Εισαγωγικές Έννοιες Μικροβιολογίας, Βιοχημείας και Μικροοργανισμών Βιομηχανικών Ζυμώσεων: Έννοιες Μικροβιολογίας(3/3), 1.5ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια Τεχνικές διεργασίες Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια ΓΕΩΡΓΙΑ Γενετική βελτίωση ποικιλιών φυτών για αντοχή στις ασθένειες, ξηρασία, αφιλόξενα εδάφη Μαζική παραγωγή κλώνων Ανάπτυξη βιο-εντομοκτόνων

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Τίτλος Μαθήματος: Γενική Μικροβιολογία. Ενότητα: ΙΣΤΟΡΙΑ ΤΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Διδάσκων: Καθηγητής Ιωάννης Σαββαΐδης. Τμήμα: Χημείας

Τίτλος Μαθήματος: Γενική Μικροβιολογία. Ενότητα: ΙΣΤΟΡΙΑ ΤΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Διδάσκων: Καθηγητής Ιωάννης Σαββαΐδης. Τμήμα: Χημείας Τίτλος Μαθήματος: Γενική Μικροβιολογία Ενότητα: ΙΣΤΟΡΙΑ ΤΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Διδάσκων: Καθηγητής Ιωάννης Σαββαΐδης Τμήμα: Χημείας ΚΕΦΑΛΑΙΟ 1 Ιστορία της Μικροβιολογίας Μικροβιολογία είναι η επιστήμη που

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΦΩΤΟΣΥΝΘΕΣΗ. Αυτότροφοι και ετερότροφοι οργανισμοί. Καρβουντζή Ηλιάνα Βιολόγος

ΦΩΤΟΣΥΝΘΕΣΗ. Αυτότροφοι και ετερότροφοι οργανισμοί. Καρβουντζή Ηλιάνα Βιολόγος ΦΩΤΟΣΥΝΘΕΣΗ Αυτότροφοι και ετερότροφοι οργανισμοί Η ζωή στον πλανήτη μας στηρίζεται στην ενέργεια του ήλιου. Η ενέργεια αυτή εκπέμπεται με τη μορφή ακτινοβολίας. Ένα πολύ μικρό μέρος αυτής της ακτινοβολίας

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ανακύκλωση & διατήρηση Θρεπτικών

Ανακύκλωση & διατήρηση Θρεπτικών Ανακύκλωση & διατήρηση Θρεπτικών 30-12-2014 EVA PAPASTERGIADOU Ανακύκλωση των Θρεπτικών είναι η χρησιμοποίηση, ο μετασχηματισμός, η διακίνηση & η επαναχρησιμοποίηση των θρεπτικών στοιχείων στα οικοσυστήματα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα


ΖΩΗ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΗΣ ΖΩΗ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΗΣ Τάξη: Οι οργανισμοί διαδραματίζουν συγκεκριμένο ενεργειακό ρόλο μέσα στο σύστημά τους Αναπαραγωγή: Οι οργανισμοί αναπαράγουν τους εαυτούς τους Αύξηση και εξέλιξη:οι οργανισμοί φέρουν

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κεφ.3. Τεχνολογία ανασυνδυασμένου DNA. 1. Τι ονομάζεται ανασυνδυασμένο DNA και τι τεχνολογία ανασυνδυασμένου DNA. Ποιά η σημασία της.

Κεφ.3. Τεχνολογία ανασυνδυασμένου DNA. 1. Τι ονομάζεται ανασυνδυασμένο DNA και τι τεχνολογία ανασυνδυασμένου DNA. Ποιά η σημασία της. 1 Κεφ.3. Τεχνολογία ανασυνδυασμένου DNA 1. Τι ονομάζεται ανασυνδυασμένο DNA και τι τεχνολογία ανασυνδυασμένου DNA. Ποιά η σημασία της. Ανασυνδυασμένο DNA: είναι αυτό που προκύπτει από την συνένωση 2 τμημάτων

Διαβάστε περισσότερα

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp.

Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. Ανάπτυξη Mοριακών Tεχνικών Real-Time PCR για την Aνίχνευση Eντεροαιμορραγικών Στελεχών E. coli, Campylobacter jejuni και Salmonella spp. 5 ο Πανελλήνιο Συνέδριο Ιατρικής Βιοπαθολογίας Η εφαρμογή μοριακών

Διαβάστε περισσότερα

μελετά τις σχέσεις μεταξύ των οργανισμών και με το περιβάλλον τους

μελετά τις σχέσεις μεταξύ των οργανισμών και με το περιβάλλον τους Η ΕΠΙΣΤΗΜΗ ΤΗΣ ΟΙΚΟΛΟΓΙΑΣ μελετά τις σχέσεις μεταξύ των οργανισμών και με το περιβάλλον τους Οι οργανισμοί αλληλεπιδρούν με το περιβάλλον τους σε πολλά επίπεδα στα πλαίσια ενός οικοσυστήματος Οι φυσικές

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εργαστηριακή καλλιέργεια μικροοργανισμών

Εργαστηριακή καλλιέργεια μικροοργανισμών BIOΛOΓIA TΩN MIKPOOPΓANIΣMΩN ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ Εργαστηριακή καλλιέργεια μικροοργανισμών Η μελέτη των μικροοργανισμών απαιτεί συνήθως την καλλιέργεια τους στο εργαστήριο Γίνεται χρήση στερεών

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί

3.1 Ενέργεια και οργανισμοί Δημήτρης Η. Β 1 25.3.14 3 Ο Κεφάλαιο 3.1 Ενέργεια και οργανισμοί Η ενέργεια έχει κεντρική σημασία για έναν οργανισμό, γιατί ό,τι και να κάνουμε χρειαζόμαστε ενέργεια. Ο κλάδος της βιολογίας που ασχολείται

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΕΚΠ. ΕΤΟΥΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΗΜΕΡΟΜΗΝΙΑ: 05/02/1017 ΘΕΜΑ 1 ο Επιλέξτε τη σωστή απάντηση: 1. Σε ένα οικοσύστημα θα τοποθετήσουμε τις ύαινες και τα λιοντάρια στο ίδιο τροφικό επίπεδο

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα



Διαβάστε περισσότερα

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια

EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ. Εξεταζόμενο μάθημα. Συκούδη Κωνσταντίνα. Διδάσκων/επιβλέπων καθηγήτρια EΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1,2,4,9 ΚΕΦΑΛΑΙΑ Εξεταζόμενο μάθημα Συκούδη Κωνσταντίνα Διδάσκων/επιβλέπων καθηγήτρια 3:00 ώρες Διάρκεια εξέτασης Ονοματεπώνυμο εξεταζόμενου Όνομα:

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ. Αρχαία Βακτήρια. Προκαρυωτικό κύτταρο: πυρηνοειδές. Πρώτιστα Μύκητες Φυτά Ζώα. Ευκαρυωτικό κύτταρο: πυρήνας

ΤΟ ΚΥΤΤΑΡΟ. Αρχαία Βακτήρια. Προκαρυωτικό κύτταρο: πυρηνοειδές. Πρώτιστα Μύκητες Φυτά Ζώα. Ευκαρυωτικό κύτταρο: πυρήνας ΤΟ ΚΥΤΤΑΡΟ Προκαρυωτικό κύτταρο: πυρηνοειδές Αρχαία Βακτήρια Ευκαρυωτικό κύτταρο: πυρήνας Δομή: μεμβρανικά οργανίδια Παραγωγή ενέργειας Δομή γενετικού υλικού Διαίρεση / Αναπαραγωγή Γενετικός ανασυνδυασμός

Διαβάστε περισσότερα

Δ.Π.Μ.Σ. Επιστήμη & Τεχνολογία Υδατικών Πόρων


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η έννοια του οικοσυστήματος Ροή ενέργειας

Η έννοια του οικοσυστήματος Ροή ενέργειας ΘΕΜΑ 1 ο Η έννοια του οικοσυστήματος Ροή ενέργειας Α. Ερωτήσεις πολλαπλής επιλογής Στις παρακάτω ερωτήσεις, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ)

1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ) Θάνος Α. Β1 ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟ ΤΡΙΤΟ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Όλοι οι οργανισμοί προκειμένου να επιβιώσουν και να επιτελέσουν τις λειτουργίες τους χρειάζονται ενέργεια. Οι φυτικοί οργανισμοί μετατρέπουν

Διαβάστε περισσότερα


Ορισμός το. φλψ Στάδια επεξεργασίας λυμάτων ΘΕΜΑ: ΒΙΟΛΟΓΙΚΟΣ ΚΑΘΑΡΙΣΜΟΣ ΣΤΗΝ ΚΩ ΤΙ ΕΙΝΑΙ Ο ΒΙΟΛΟΓΙΚΟΣ ΚΑΘΑΡΙΣΜΟΣ? ΘΕΜΑ: ΒΙΟΛΟΓΙΚΟΣ ΚΑΘΑΡΙΣΜΟΣ ΣΤΗΝ ΚΩ ΤΙ ΕΙΝΑΙ Ο ΒΙΟΛΟΓΙΚΟΣ ΚΑΘΑΡΙΣΜΟΣ? Ο βιολογικος καθαρισμος αφορα την επεξεργασια λυματων, δηλαδη τη διαδικασια μεσω της οποιας διαχωριζονται οι μολυσματικες ουσιες από

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΒΙΟΓΕΩΧΗΜΙΚΟΙ ΚΥΚΛΟΙ Βιογεωχημικός κύκλος

ΒΙΟΓΕΩΧΗΜΙΚΟΙ ΚΥΚΛΟΙ Βιογεωχημικός κύκλος ΒΙΟΓΕΩΧΗΜΙΚΟΙ ΚΥΚΛΟΙ Βιογεωχημικός κύκλος ενός στοιχείου είναι, η επαναλαμβανόμενη κυκλική πορεία του στοιχείου στο οικοσύστημα. Οι βιογεωχημικοί κύκλοι, πραγματοποιούνται με την βοήθεια, βιολογικών, γεωλογικών

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 15 η ΜΙΚΡΟΒΙΑΚΗ ΕΞΕΛΙΞΗ ΚΑΙ ΣΥΣΤΗΜΑΤΙΚΗ


Διαβάστε περισσότερα

Η ΡΥΠΑΝΣΗ ΤΟΥ ΝΕΡΟΥ. Σοφοκλής Λογιάδης

Η ΡΥΠΑΝΣΗ ΤΟΥ ΝΕΡΟΥ. Σοφοκλής Λογιάδης Η ΡΥΠΑΝΣΗ ΤΟΥ ΝΕΡΟΥ Σοφοκλής Λογιάδης Τι ειναι ρυπανση του νερου -ορισμος Το νερό είναι η πηγή ζωής στον πλανήτη μας. Περίπου το 70% της επιφάνειας του σκεπάζεται με νερό. Από το συνολικό διαθέσιμο νερό

Διαβάστε περισσότερα

ΑΥΞΗΣΗΣ (Κεφάλαιο 6 )

ΑΥΞΗΣΗΣ (Κεφάλαιο 6 ) ΑΥΞΗΣΗΣ (Κεφάλαιο 6 ) Απαραίτητος ο έλεγχος της αύξησης (αν και η αύξηση είναι αυτοπεριοριζόμενη) Ιδιαίτερα σημαντικός ο έλεγχος για τα τρόφιμα Ο περιορισμός της αύξησης μπορεί να γίνει είτε με αναστολή

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

1.2 Κύτταρο: η βασική μονάδα της ζωής

1.2 Κύτταρο: η βασική μονάδα της ζωής 1.2 Κύτταρο: η βασική μονάδα της ζωής Γιατί το κύτταρο χαρακτηρίζεται βασική μονάδα ζωής; Γιατί είναι η μικρότερη μονάδα που μπορεί: Να τρέφεται Να αναπνέει Να αναπαράγεται Δηλαδή εμφανίζει τα χαρακτηριστικά

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ I 1. ΕΙΣΑΓΩΓΗ ΣΤΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ ΚΕΦΑΛΑΙΟ Ι 1 Ι ΕΣΑΓΩΓΗ ΓΕΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΚΕΦΑΛΑΙΟ Ι 1 Ι ΕΣΑΓΩΓΗ ΓΕΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΚΕΦΑΛΑΙΟ I 1. ΕΙΣΑΓΩΓΗ ΣΤΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Ο όρος «µικροοργανισµός ή µικρόβιο» χρησιµοποιήθηκε πρωταρχικά από τον Γάλλο Sedillot. Τα µικρόβια είναι µικροοργανισµοί

Διαβάστε περισσότερα


3.2 ΕΝΖΥΜΑ ΒΙΟΛΟΓΙΚΟΙ ΚΑΤΑΛΥΤΕΣ ΠΕΡΙΛΗΨΗ ΣΤΟ 3 Ο ΚΕΦΑΛΑΙΟ: ΜΕΤΑΒΟΛΙΣΜΟΣ ΚΥΡΙΑΚΟΣ Γ. Β1 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Όλοι οι οργανισμοί προκειμένου να επιβιώσουν και να επιτελέσουν τις λειτουργίες τους χρειάζονται ενέργεια. Οι φυτικοί

Διαβάστε περισσότερα

ΠΕΡΙΕΧΟΜΕΝΑ. Περιεχόμενα

ΠΕΡΙΕΧΟΜΕΝΑ. Περιεχόμενα ΠΕΡΙΕΧΟΜΕΝΑ ΠΡΟΛΟΓΟΣ... 1 1. ΕΙΣΑΓΩΓΗ... 3 1.1 ΤΟ ΒΙΟΑΕΡΙΟ ΣΤΗΝ ΕΥΡΩΠΗ... 3 1.1.1 Το βιοαέριο στην Ελλάδα... 6 1.2 ΛΥΜΑΤΑ ΧΟΙΡΟΣΤΑΣΙΟΥ... 8 1.2.1 Σύσταση των λυμάτων χοιροστασίου... 8 Νερό... 8

Διαβάστε περισσότερα

Μικροοργανισμοί: είναι οι οργανισμοί ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΙ που δεν μπορούμε να Η τους ΜΙΚΡΟΒΙΑ διακρίνουμε με γυμνό μάτι (μέγεθος < 0,1 mm)

Μικροοργανισμοί: είναι οι οργανισμοί ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΙ που δεν μπορούμε να Η τους ΜΙΚΡΟΒΙΑ διακρίνουμε με γυμνό μάτι (μέγεθος < 0,1 mm) Μικροοργανισμοί: είναι οι οργανισμοί ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΙ που δεν μπορούμε να Η τους ΜΙΚΡΟΒΙΑ διακρίνουμε με γυμνό μάτι (μέγεθος < 0,1 mm) Πού και πώς ζουν 1. στο φυσικό περιβάλλον (νιτροποιητικά βακτήρια)

Διαβάστε περισσότερα


ΒΙΟΧΗΜΙΚΕΣ ΔΙΕΡΓΑΣΙΕΣ ΒΙΟΧΗΜΙΚΕΣ ΔΙΕΡΓΑΣΙΕΣ Διδάσκων: Διονύσης Μαντζαβίνος (mantzavinos@chemeng.upatras.gr) Βοηθός: Αλέξης Πάντζιαρος (alexis_panji@hotmail.com) Διδασκαλία: Δευτέρα 09:15-12:00 (Αίθουσα ΧΜ3) Φροντιστήριο: Πέμπτη

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΜΙΚΡΟΒΙΟΛΟΓΙΑ. ή μικρόβιο» χρησιμοποιήθηκε. Γάλλο Sedillot. πρωταρχικά. μικρόβια. είναι. μικροοργανισμοί μικροσκοπικού μεγέθους και απλής δομής.

ΜΙΚΡΟΒΙΟΛΟΓΙΑ. ή μικρόβιο» χρησιμοποιήθηκε. Γάλλο Sedillot. πρωταρχικά. μικρόβια. είναι. μικροοργανισμοί μικροσκοπικού μεγέθους και απλής δομής. ΜΙΚΡΟΒΙΟΛΟΓΙΑ Ο όρος «μικροοργανισμός ή μικρόβιο» χρησιμοποιήθηκε πρωταρχικά από τον Γάλλο Sedillot. Τα μικρόβια είναι μικροοργανισμοί μικροσκοπικού μεγέθους και απλής δομής. Από φυλογενετικής άποψης η

Διαβάστε περισσότερα


ΥΔΑΤΙΝΗ ΡΥΠΑΝΣΗ ΥΔΑΤΙΝΗ ΡΥΠΑΝΣΗ-ΟΡΙΣΜΟΣ Τι είναι ρύπανση: Ρύπανση μπορεί να θεωρηθεί η δυσμενής μεταβολή των φυσικοχημικών ή βιολογικών συνθηκών ενός συγκεκριμένου περιβάλλοντος ή/και η βραχυπρόθεσμη ή μακροπρόθεσμη βλάβη στην ευζωία, την ποιότητα

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Περιβαλλοντικά Συστήματα Ενότητα 8: Οικοσυστήματα (II)

Περιβαλλοντικά Συστήματα Ενότητα 8: Οικοσυστήματα (II) Περιβαλλοντικά Συστήματα Ενότητα 8: Οικοσυστήματα (II) Χαραλαμπίδης Γεώργιος Τμήμα Μηχανικών Περιβάλλοντος και Μηχανικών Αντιρρύπανσης Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης

Διαβάστε περισσότερα

Προσδιορισμός φυσικοχημικών παραμέτρων υγρών αποβλήτων και υδάτων

Προσδιορισμός φυσικοχημικών παραμέτρων υγρών αποβλήτων και υδάτων Προσδιορισμός φυσικοχημικών παραμέτρων υγρών αποβλήτων και υδάτων (DO - BOD - COD - TOC) Χ. Βασιλάτος Οργανική ύλη Αποξυγόνωση επιφανειακών και υπογείων υδάτων Οι οργανικές ύλες αποτελούν πολύ σοβαρό ρύπο,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα



Διαβάστε περισσότερα

2.4 Ρύπανση του νερού

2.4 Ρύπανση του νερού 1 Η θεωρία του μαθήματος με ερωτήσεις 2.4 Ρύπανση του νερού 4-1. Ποια ονομάζονται λύματα; Έτσι ονομάζονται τα υγρά απόβλητα από τις κατοικίες, τις βιομηχανίες, τις βιοτεχνίες και τους αγρούς. 4-2. Ποιοι

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα