ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΜΙΚΡΟΒΙΑΚΗΣ ΠΟΙΚΙΛΟΤΗΤΑΣ ΣΤΗ ΛΙΜΝΗ ΤΗΣ ΚΑΣΤΟΡΙΑΣ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΜΙΚΡΟΒΙΑΚΗΣ ΠΟΙΚΙΛΟΤΗΤΑΣ ΣΤΗ ΛΙΜΝΗ ΤΗΣ ΚΑΣΤΟΡΙΑΣ"

Transcript

1 ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ : ΕΦΑΡΜΟΣΜΕΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΜΙΚΡΟΒΙΑΚΗΣ ΠΟΙΚΙΛΟΤΗΤΑΣ ΣΤΗ ΛΙΜΝΗ ΤΗΣ ΚΑΣΤΟΡΙΑΣ ΣΑΡΤΣΙΔΗΣ ΑΝΑΣΤΑΣΙΟΣ ΒΙΟΛΟΓΟΣ Επιβλέπων: Καθ. Ζαχαρίας Σκούρας Συνεπιβλέπων: Αναπλ.Καθ. Κων/νος Μπούρτζης ΘΕΣΣΑΛΟΝΙΚΗ 2009

2 ARISTOTLE UNIVERSITY OF THESSALONIKI FACULTY OF SCIENCES SCHOOL OF BIOLOGY POSTGRADUATE STUDIES APPLIED GENETICS & BIOTECHNOLOGY MASTER THESIS MICROBIAL DIVERSITY IN THE LAKE OF KASTORIA SARTSIDIS ANASTASIOS BIOLOGIST THESSALONIKI

3 Μέλη Εξεταστικής επιτροπής: 1. Σκούρας Ζαχαρίας, Καθηγητής Τμήματος Βιολογίας Α.Π.Θ. 2. Γιάγκου Μηνάς, Αναπλ. Καθηγητής Τμήματος Βιολογίας Α.Π.Θ. 3. Δροσοπούλου Ελένη, Λέκτορας Τμήματος Βιολογίας Α.Π.Θ

4 ΠΡΟΛΟΓΟΣ Η παρούσα μεταπτυχιακή εργασία πραγματοποιήθηκε στον Τομέα Γενετικής, Ανάπτυξης και Μοριακής Βιολογίας του Τμήματος Βιολογίας, του Αριστοτέλειου Πανεπιστήμιου Θεσσαλονίκης κατά το ακαδημαϊκό έτος Η εργασία εκπονήθηκε στα πλαίσια της Μεταπτυχιακής Διπλωματικής Εργασίας της κατεύθυνσης «Εφαρμοσμένη Γενετική και Βιοτεχνολογία» του Προγράμματος Μεταπτυχιακών Σπουδών του τμήματος. Ευχαριστίες: Στον Καθηγητή του τμήματος κ. Ζαχαρία Σκούρα, ο οποίος μου ανέθεσε την εκπόνηση της παρούσας εργασίας και την επέβλεπε καθ όλη τη διάρκειά της εκφράζω τις ειλικρινείς μου ευχαριστίες. Εκφράζω, επίσης, τις ειλικρινείς μου ευχαριστίες στην Λέκτορα του τμ. Βιολογίας κ. Ελένη Δροσοπούλου, η οποία επέβλεπε την πορεία της εργασίας και με την οποία είχα άψογη συνεργασία και ήταν πρόθυμη να με βοηθήσει όπου είχα πραγματικά ανάγκη. Επίσης, θα ήθελα μαζί με τους προαναφερθέντες να ευχαριστήσω τον αναπληρωτή Καθηγητή του τμήματος κ. Μηνά Γιάγκου, για την ολοπρόθυμη συμμετοχή τους στην εξεταστική επιτροπή της παρούσας εργασίας. Θα ήθελα να ευχαριστήσω θερμά τον αναπληρωτή Καθηγητή του Τμήματος Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων του Πανεπιστημίου Ιωαννίνων κ. Κων/νο Μπούρτζη για την φιλοξενία στο εργαστήριό του κατά την εκμάθηση των τεχνικών για την μελέτη της μικροβιακής ποικιλότητας. Την διδάκτορα του τμήματος Χρύσα Παντζαρτζή, τον υποψήφιο διδάκτορα Σπύρο Βήττα ευχαριστώ για την συνεργασία και βοήθεια τους στο εργαστήριο. Επίσης την μεταπτυχιακή φοιτήτρια Ευαγγελία Βαρθολομαίου και τους προπτυχιακούς φοιτητές Σωτηρία Μακρή, Ένη Μηλιαρά και Ιωάννη Πράττη για την άψογη συνεργασία και συνύπαρξη στο χώρο του εργαστηρίου. Επίσης θα ήθελα να ευχαριστήσω τον διευθυντή του Κέντρου Περιβαλλοντικής Εκπαίδευσης Καστοριάς, κ. Θεόδωρο Μαρδίρη, καθώς και τους υπόλοιπους εργαζομένους στο κέντρο για την παραχώρηση του εργαστηρίου Χημείας του κέντρου την περίοδο των δειγματοληψιών. Τέλος, θα ήθελα να ευχαριστήσω θερμά την ιχθυολόγο Νίκη Ματζαφλέρη, χωρίς την βοήθεια της οποίας δεν θα ήταν δυνατή η πραγματοποίηση των δειγματοληψιών

5 ΠΕΡΙΛΗΨΗ Η λίμνη της Καστοριάς εντοπίζεται στον ομώνυμο νομό και ένα από τα βασικά της χαρακτηριστικά είναι ο υπερεύτροφος χαρακτήρας της, λόγω αυξημένης εισροής ανόργανων θρεπτικών ως αποτέλεσμα ανθρώπινων δραστηριοτήτων στην λεκάνη απορροής. Επίσης, η παρουσία της πόλης της Καστοριάς στις όχθες αποτελεί πηγή ρύπων για τη λίμνη (όμβρια ύδατα κ.α.). Για το λόγο αυτό η λίμνη της Καστοριάς αποτελεί ένα ιδιαίτερα ενδιαφέρον οικοσύστημα για τον προσδιορισμό της μικροβιακής σύστασης. Στην παρούσα εργασία έγινε μια πρώτη καταγραφή της μικροβιακής ποικιλότητας στο ίζημα της λίμνης σχετικά με την παρουσία Archaea και Bacteria. Πραγματοποιήθηκαν τέσσερις εποχιακές δειγματοληψίες κατά την διάρκεια του έτους 2009 (Ιανουάριος, Απρίλιος, Ιούλιος και Οκτώβριος) σε τέσσερα σημεία της λίμνης (ίζημα και επιφανειακό νερό). Έγινε μέτρηση φυσικοχημικών παραγόντων οι οποίοι αποδεικνύουν τον υπερεύτροφο χαρακτήρα της λίμνης. Τα υψηλά επίπεδα της χλωροφύλλης, ιδιαίτερα τον μήνα Οκτώβριο (~ mg/m 3 ) και η μικρή διαφάνεια του νερού (<2m τους μήνες Ιούλιο και Οκτώβριο), δείχνουν συνθήκες υπερευτροφισμού στη λίμνη. Με την χρήση κατάλληλων παγκόσμιων εκκινητών ενισχύθηκε το 16S rrna των Archaea και Bacteria σε δείγματα απομονωμένου DNA από τα τέσσερα σημεία της λίμνης και κατασκευάστηκαν 16S βιβλιοθήκες για τα Archaea και τα Bacteria των ιζημάτων των σταθμών 2, 3 και 4 από την δειγματοληψία του Απριλίου Από την 16S βιβλιοθήκη για τα Bacteria του ιζήματος του σταθμού 2 αναλύθηκαν μέχρι στιγμής 54 κλώνοι που αντιστοιχούν σε 40 OTUs και οι οποίες κατατάσσονται σε 10 φύλα (Verrucomicrobia, Actinobacteria, Flavobacteria, Acidobacteria, Fusobacteria, Planctomycetes, Firmicutes, Cyanobacteria, Gemmatimonadetes και τα πέντε υπο-φύλα (α- έως ε-) των Proteobacteria, με τα τελευταία να εμφανίζονται σε μεγαλύτερη συχνότητα (38%). Ωστόσο, απαιτείται ανάλυση μεγαλύτερου αριθμού κλώνων ώστε να εκπροσωπούνται όλα τα Bacteria του δείγματος. Από την 16S βιβλιοθήκη για τα Archaea του ιζήματος του σταθμού 2 αναλύθηκαν συνολικά 39 κλώνοι που αντιστοιχούν σε 21 OTUs που ανήκουν στα φύλα Euryarchaeota και Crenarchaeota, με εντονότερη παρουσία (84%) των τάξεων Methanomicrobiales και Methanosarcinales, που συνίστανται από μεθανογόνα στελέχη

6 ABSTRACT The Kastoria Lake is located in the north-west Greece, in the prefecture of Kastoria. It is a polymictic lake with 28 km 2 surface area and 9 m maximum depth. The excessive use of fertilizers in the surrounding area and the presence of Kastoria city on the coast have an important effect on the lake ecosystem which is characterized as eutrophic. In this context, the study of the microbial community of the lake, as well as the correlation of the observed diversity with physical or anthropogenic parameters presents particular interest. During 2009, seasonal samplings of both surface water and sediment have been performed at selected stations. Physicochemical parameters (temperature, ph, dissolved oxygen concentration etc.) have been measured in situ and the concentrations of anorganic nutrients and chlorophyll a have been determined spectrophotometrically. The high levels of chlorophyll a detected, especially in October (~ mg/m 3 ), as well as the limited transparency of the water (<2m depth) indicate hypertrophic conditions in the lake.. Universal primers for Bacteria (27F, 1391R) and Archaea (4F, 1492R) have been used to amplify part of the16s rrna gene, and 16S clone libraries have been constructed from sediment samples. 54 bacterial and 39 archaean clones have been sequenced and bioinformatically analyzed. The above analysis revealed the presence of 40 bacterial OTUs belonging to 10 phyla: Verrucomicrobia, Actinobacteria, Flavobacteria, Acidobacteria, Fusobacteria, Planctomycetes, Firmicutes, Cyanobacteria, Gemmatimonadetes and the five sub-phyla of Proteobacteria which were the most abundant (38%). Furthermore, Archaea belonging to two phyla (Euryarchaeota and Crenarchaeota), have been detected with strains of Methanomicrobiales and Methanosarcinales being by far the most frequent (84%). These two orders consist of methanogens, which are widely prevalent in lake sediments

7 ΠΕΡΙΕΧΟΜΕΝΑ 1. ΕΙΣΑΓΩΓΗ Γενικά για τους μικροοργανισμούς Ανακάλυψη μικροοργανισμών Κατηγορίες μικροοργανισμών Προκαρυωτικοί μικροοργανισμοί Γενετικοί τόποι ως εργαλεία ταξινόμησης των προκαρυωτικών μικροοργανισμών Το φυλογενετικό δέντρο της ζωής κατά Woese Μικροβιακή ποικιλότητα Η λίμνη της Καστοριάς Σκοπός της εργασίας ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ Δειγματοληψία Επί τόπου μέτρηση φυσικοχημικών παραμέτρων Ποσοτικός προσδιορισμός χλωροφύλλης α Ποσοτικός προσδιορισμός ανόργανων θρεπτικών συστατικών (αζωτούχων και φωσφορικών) Διήθηση περιβαλλοντικών δειγμάτων και ανάκτηση μικροοργανισμών Απομόνωση DNA από τους μικροοργανισμούς Προσδιορισμός της ποσότητας του απομονωμένου DNA από τα περιβαλλοντικά δείγματα Ενίσχυση τμήματος της αλληλουχίας του 16S rrna γονιδίου των Bacteria και Archaea Κλωνοποίηση των προϊόντων της PCR Κατασκευή 16S βιβλιοθηκών Επιλογή λευκών - μπλε αποικιών ( blue-white screening) Ανάλυση κλώνων από τις 16S βιβλιοθήκες των Archaea και Bacteria του ιζήματος του σταθμού ΑΠΟΤΕΛΕΣΜΑΤΑ ΣΥΖΗΤΗΣΗ Επί τόπου μέτρηση φυσικοχημικών παραγόντων (θερμοκρασία, ph, αλατότητα, συγκέντρωση διαλυμένου οξυγόνου, αγωγιμότητα, ολικά στερεά) και διαφάνειας ύδατος

8 3.2 Ποσοτικός προσδιορισμός χλωροφύλλης α Ποσοτικός προσδιορισμός ανόργανων αζωτούχων και φωσφορικών θρεπτικών Κατασκευή βιβλιοθηκών 16S Ανάλυση μικροβιακής κοινότητας ΒΙΒΛΙΟΓΡΑΦΙΑ

9 1. ΕΙΣΑΓΩΓΗ - 9 -

10 1.1 Γενικά για τους μικροοργανισμούς Μικροοργανισμοί (μικρός + οργανισμοί) ή μικρόβια χαρακτηρίζονται οι οργανισμοί που δεν μπορούν να γίνουν διακριτοί με γυμνό μάτι και απαιτείται η χρήση μικροσκοπίου για την παρατήρησή τους. Τα είδη των μικροοργανισμών ποικίλουν: συμπεριλαμβάνονται τα βακτήρια, οι μύκητες, τα Archaea, τα Protista, μικροσκοπικά φυτά καθώς και ζώα (ζωοπλαγκτόν, Planaria). Ορισμένοι μικροβιολόγοι κατατάσσουν στους μικροοργανισμούς και τους ιούς, ωστόσο υπάρχει μια έντονη διχογνωμία για το αν οι ιοί είναι ζωντανοί οργανισμοί ή όχι (Rybicki 1990). Οι μικροοργανισμοί αποτελούν την πρώτη μορφή ζωής που εμφανίστηκε στη γη, πριν από περίπου 3,5 δισεκατομμύριο χρόνια (Schopf 2006). Για περισσότερα από 3 δισεκατομμύρια χρόνια, καθ όλη την διάρκεια της Προκάμβριας περιόδου, αποτελούσαν τους μοναδικούς ζωντανούς οργανισμούς (Delong & Pace 2001). Βακτήρια, φύκη και μύκητες έχουν παρατηρηθεί σε ήλεκτρο που χρονολογείται περίπου στα 220 εκατομμύρια χρόνια (τριασσική περίοδος) με χαρακτηριστική ομοιότητα σε σχέση με τους σημερινούς μικροοργανισμούς. Οι μικροοργανισμοί απαντώνται σε όλα τα σημεία της βιόσφαιρας: σε όλα τα υδάτινα οικοσυστήματα, στο έδαφος, στον πυθμένα των ωκεανών, από τα υψηλά στρώματα της ατμόσφαιρας έως τα πετρώματα του εξωτερικού φλοιού της γης. Είναι χαρακτηριστικό ότι έχουν βρεθεί ζωντανοί μικροοργανισμοί σε θερμοπηγές με θερμοκρασία 130 C, ενώ αντίστοιχα έχουν εντοπιστεί και σε χαμηλές θερμοκρασίες (-17 C). Επίσης, ορισμένοι μικροοργανισμοί μπορούν να επιβιώσουν σε ιδιαίτερα υψηλές πιέσεις ( atm), ενώ έχουν εντοπιστεί και σε συνθήκες «κενού του διαστήματος», 0 atm (Horneck 1981). Οι περισσότεροι μικροοργανισμοί είναι μονοκύτταροι (εικ.1), ωστόσο εξαίρεση στον κανόνα αποτελεί η ύπαρξη πολυκύτταρων μικροοργανισμών (ορισμένα Myxozoa). Επίσης, παρόλο που η συντριπτική πλειοψηφία των μονοκύτταρων οργανισμών δεν είναι ορατοί με γυμνό οφθαλμό, υπάρχουν βακτήρια, όπως το Thiomargarita namibiensis, το οποίο είναι μακροσκοπικά διακριτό

11 Εικόνα 1. Αποικία βακτηρίων E.coli (μεγέθυνση 10000Χ) (ηλεκτρονική πηγή 1). 1.2 Ανακάλυψη μικροοργανισμών Παρόλο που η ουσιαστική ανακάλυψη των μικροοργανισμών έλαβε χώρα μόλις τον 17 ο αιώνα, η ύπαρξη τους αποτελούσε θέμα συζήτησης αρκετούς αιώνες πριν. Η πρώτη αναφορά στους μικροοργανισμούς έγινε από τον Ρωμαίο Marcus Terentius Varro τον 1 ο αιώνα π.x. στο σύγγραμμα του On Agriculture, στο οποίο κάνει λόγο για «όντα που δεν μπορούμε να δούμε με γυμνό οφθαλμό, τα οποία αιωρούνται στην ατμόσφαιρα και εισέρχονται μέσω του στόματος και της μύτης στο σώμα μας προκαλώντας σοβαρές ασθένειες». Όταν η βουβωνική χολέρα έφτασε στην Ανδαλουσία της Ισπανίας τον 14 ο αιώνα μ.x., ο Ibn Khatima έγραψε ότι οι μεταδοτικές ασθένειες προκαλούνται μεταδοτικά μικροσκοπικά όντα («minute bodies»), τα οποία εισέρχονται στο ανθρώπινο σώμα (Syed 2002). Αργότερα, το 1546, ο Girolamo Fracastoro, πρότεινε ότι οι επιδημίες προκαλούνται από μεταφερόμενες σποριόμορφες οντότητες, οι οποίες μπορούν να μεταδώσουν την μόλυνση είτε με άμεση επαφή, είτε από μεγάλη απόσταση. Ο Anton van Leeuwenhoek (εικ.2) ήταν ο πρώτος που παρατήρησε μικροοργανισμούς, χρησιμοποιώντας μικροσκόπιο δικής του κατασκευής, το Πριν την ανακάλυψη των μικροοργανισμών από τον Leeuwenhoek, αποτελούσε μυστήριο ο τρόπος με τον οποίο τα σταφύλια μετατρέπονταν σε κρασί, το γάλα σε τυρί ή ο λόγος που αλλοιωνόταν το φαγητό. Ο Leeuwenhoek, παρόλο που δεν έκανε την συσχέτιση ανάμεσα στους μικροοργανισμούς και στις προαναφερθείσες

12 διαδικασίες, χρησιμοποιώντας ένα μικροσκόπιο απέδειξε ότι υπάρχουν μορφές ζωής που δεν είναι ορατές με γυμνό οφθαλμό. Η παρατήρηση των μικροοργανισμών από τον Leeuwenhoek, καθώς και τα πειράματα των Spallanzani και Pasteur, έδωσαν τέλος στην μακραίωνη θεωρία ότι η ζωή εμφανίζεται αυτόματα από μη ζώντα συστατικά κατά την διαδικασία «φθοράς» της ύλης (spoilage process), και σε συνδυασμό με τα αξιώματα του Koch, αποτελούν τους πρωτεργάτες της θεωρίας ότι οι μικροοργανισμοί είναι υπεύθυνοι για την πλειοψηφία των ασθενειών (germ theory) (Madigan & Martinko 2005). Εικόνα 2. Ο Anton van Leeuwenhoek, ο πρώτος μικροβιολόγος και ο πρώτος που παρατήρησε μικροοργανισμούς χρησιμοποιώντας μικροσκόπιο (ηλεκτρονική πηγή 1). 1.3 Κατηγορίες μικροοργανισμών Οι μικροοργανισμοί διαχωρίζονται σε δύο κύριες κατηγορίες, ανάλογα με την παρουσία πυρήνα ή όχι στο κυτταρόπλασμά τους: τους προκαρυωτικούς μικροοργανισμούς και τους ευκαρυωτικούς μικροοργανισμούς. Στους προκαρυωτικούς μικροοργανισμούς ανήκουν δύο ομάδες, τα Bacteria και τα Archaea, τα οποία αποτελούν και το αντικείμενο μελέτης της παρούσας εργασίας και για το λόγο αυτό θα αναλυθούν εκτενώς στη συνέχεια. Στους ευκαρυωτικούς μικροοργανισμούς ανήκουν τα Protista, μικροσκοπικά ζώα, μύκητες (Fungi), καθώς και διάφορα μικροσκοπικά φυτά

13 1.4 Προκαρυωτικοί μικροοργανισμοί Όπως προαναφέρθηκε, οι προκαρυωτικοί μικροοργανισμοί περιλαμβάνουν δύο ομάδες, τα Bacteria και τα Archaea. Είναι αποκλειστικά μονοκύτταροι οργανισμοί, ωστόσο σε διάφορα στάδια της ζωής τους συναθροίζονται σε σύνθετες δομές, όπως τα Myxobacteria. Οι προκαρυωτικοί μικροοργανισμοί είναι η πιο ποικιλόμορφη και άφθονη ομάδα οργανισμών στη γη και απαντώνται σχεδόν σε όλα τα περιβάλλοντα όπου είναι διαθέσιμο το νερό, έστω και σε ελάχιστες ποσότητες και η θερμοκρασία είναι χαμηλότερη από 140 C. Ουσιαστικά, όλες οι επιφάνειες που δεν έχουν αποστειρωθεί είναι καλυμμένες από προκαρυωτικούς μικροοργανισμούς. Ο αριθμός των προκαρυωτικών μικροοργανισμών υπολογίζεται σε 5 X άτομα σε όλη τη γη Bacteria Παρόλο που τα Bacteria ανακαλύφθηκαν από τον Anton van Leeuwenhoek το 1676, η ονομασία τους δόθηκε από τον Christian Gottfried Ehrenberg το Παρουσιάζουν ένα μεγάλο εύρος σχήματος και μεγεθών. Τα βακτηριακά κύτταρα κατά μέσο όρο είναι δέκα φορές μικρότερα από τα ευκαρυωτικά κύτταρα, με εύρος μήκους 0,5 5 μm (εικ.3). Ωστόσο, μερικά είδη, όπως τα Thiomargarita namibiensis και Epulopiscium fishelsoni φθάνουν σε μέγεθος 500 μm. Αντίθετα, μεταξύ των μικρότερων σε μέγεθος βακτηρίων ανήκουν στελέχη του γένους Mycoplasma, που φτάνουν σε μέγεθος μόλις τα 0,3 μm, μικρότερα και από τους μεγάλους ιούς. Τα περισσότερα είδη των Bacteria είναι είτε σφαιρικά, οπότε ονομάζονται κόκκοι, είτε ραβδόμορφα, οπότε ονομάζονται βάκιλοι. Ορισμένα είδη έχουν τετραεδρικό ή κυβοειδές σχήμα (Wanger et al. 2008). Επίσης, παρόλο που τα περισσότερα Bacteria απαντώνται στο περιβάλλον ως μονήρη κύτταρα, έχουν παρατηρηθεί και σε άλλες διαμορφώσεις: το γένος Neisseria απαντάται σε ζεύγη κυττάρων, το γένος Streptococcus σχηματίζει αλυσίδες και το γένος Staphylococcus σχηματίζει μια δομή «τσαμπιού σταφυλιού». Τέλος, ορισμένα στελέχη μπορούν να επιμηκύνονται σχηματίζοντας νημάτια με χαρακτηριστική περίπτωση τα Actinobacteria. Στην εικόνα 3 παρουσιάζονται οι διάφοροι τύποι μορφολογίας των Bacteria

14 Εικόνα 3. Τα Bacteria παρουσιάζουν μεγάλο εύρος μορφολογίας και κυτταρικών διαμορφώσεων (ηλεκτρονική πηγή 1). - Ταξινόμηση των Bacteria Η ταξινόμηση των Bacteria γίνεται με βάση την κυτταρική δομή (μελέτη με μικροσκόπιο και κατάταξη), τον μεταβολισμό των κυττάρων (βιοχημική προσέγγιση) ή με βάση διαφορές που παρατηρούνται σε συστατικά των κυττάρων όπως στο DNA, τα λιπαρά οξέα, χρωστικές, αντιγόνα και ένζυμα. Ωστόσο, αυτές οι διαφορές δεν είναι ξεκάθαρο αν αντιπροσωπεύουν διαφορές ανάμεσα σε ξεχωριστά είδη ή ανάμεσα σε στελέχη του ίδιου είδους. Ένα φαινόμενο που διαδραματίζει σημαντικό ρόλο στη δυσκολία ταξινόμησης των μικροοργανισμών είναι η οριζόντια μεταφορά γενετικού υλικού ανάμεσα σε στελέχη που δεν ανήκουν στο ίδιο είδος (Woese et al. 1994). Εξαιτίας της οριζόντιας μεταφοράς γενετικού υλικού, στενά συγγενικά άτομα είναι δυνατόν να παρουσιάζουν διαφορετική μορφολογία και μεταβολισμό. Για να υπερνικηθεί αυτό το εμπόδιο στην συστηματική κατάταξη των Bacteria δίνεται ιδιαίτερη έμφαση στη χρήση μοριακών εργαλείων ταξινόμησης όπως η σύγκριση του λόγου A+T / G+C (GC ratio) μεταξύ διαφορετικών στελεχών, ποσοστό υβριδισμού μεταξύ γονιδιωμάτων, η χρήση γενετικών τόπων στους οποίους δεν έχει παρατηρηθεί

15 ή έχει παρατηρηθεί ελάχιστα οριζόντια μεταφορά γενετικού υλικού, όπως το γονίδιο που κωδικοποιεί για το 16S rrna (βλ. παρακάτω). Για την ταξινόμηση των Bacteria έχει συσταθεί η Διεθνής Επιτροπή Συστηματικής Βακτηριολογίας (International Committee on Systematic Bacteriology, ICSB ), η οποία θέτει τους κανόνες για την ονοματολογία των Bacteria και των taxa και την κατάταξη τους στον Διεθνή Κώδικα Ονοματολογίας των Bacteria ( International Code of Nomenclature of Bacteria) Archaea Τα Archaea αποτελούν την δεύτερη ομάδα προκαρυωτικών μικροοργανισμών. Αρχικά τα Archaea αποτελούσαν ένα ξεχωριστό φύλο των βακτηρίων και ονομάζονταν Αρχαιοβακτήρια (Archaebacteria), ωστόσο ο Carl Woese μετά από φυλογενετικές μελέτες με βάση το 16S rrna τα κατέταξε στο ξεχωριστό Βασίλειο των Archaea, προτείνοντας το «φυλογενετικό δέντρο της ζωής» των τριών ομάδων (three domain tree), μαζί με τα Βασίλεια των Bacteria και των Eucaryota (βλ. παρακάτω) (Woese et al. 2000) (εικ.4). Τα Archaea διαιρούνται περαιτέρω σε τέσσερα αναγνωρισμένα φύλα, με βασικότερα τα Euryarchaeota και Crenarchaeota. Τα υπόλοιπα δύο φύλα, τα οποία δεν έχουν μελετηθεί αρκετά, είναι τα Nanoarchaeota και Korarchaeota. Αρχικά, τα Archaea θεωρούνταν προκαρυωτικοί οργανισμοί που απαντώνται σε ακραία περιβάλλοντα όπως θερμοπηγές και λίμνες με υψηλές συγκεντρώσεις αλατότητας. Σήμερα, έχει αποδειχθεί ότι απαντώνται σε ένα ευρύ φάσμα ενδιαιτημάτων όπως στο έδαφος και στους ωκεανούς. Πιο συγκεκριμένα, τα Archaea που απαντώνται σε πλαγκτονικούς πληθυσμούς αποτελούν μια από τις πιο άφθονες ομάδες οργανισμών στον πλανήτη. Γενικότερα, τα Archaea αναγνωρίζονται ως ένα σημαντικό τμήμα της βιόσφαιρας και διαδραματίζουν σημαντικό ρόλο σε πολλούς τομείς όπως π.χ. στους κύκλους του αζώτου και του άνθρακα. Τα Archaea αναπαράγονται ασεξουαλικά με διχοτόμηση, πολλαπλή διάσπαση ή εκβλάστηση. Σε αντίθεση με τα Bacteria που έχουν την δυνατότητα σχηματισμού ενδοσπορίων ως απόκριση σε ακραίες περιβαλλοντικές συνθήκες, στα Archaea δεν έχει παρατηρηθεί αυτό το φαινόμενο. Αντίθετα, ορισμένα Haloarhaea έχουν την δυνατότητα να μεταβάλλουν την μορφολογία των κυττάρων τους ως απόκριση στην ωσμωτική πίεση και με αυτό τον τρόπο μπορούν να επιβιώνουν σε υδάτινα περιβάλλοντα με χαμηλή συγκέντρωση αλάτων

16 Εικόνα 4.Φυλογενετικό δέντρο που δείχνει τη σχέση των Archaea με τους υπόλοιπους οργανισμούς. Πράσινο : Archaea, Κόκκινο : Eucaryota, Μπλε : Bacteria (ηλεκτρονική πηγή 1) Διαφορές Bacteria Archaea Εκτός από τις διαφορές στο γενότυπο ανάμεσα σε Bacteria και Archaea, στις οποίες βασίστηκε κατά κύριο λόγο ο Carl Woese για να προτείνει το φυλογενετικό δέντρο των τριών κύριων φυλογενετικών ομάδων (Bacteria, Archaea και Eucaryota), παρατηρούνται αρκετές φαινοτυπικές διαφορές ανάμεσα στα δύο Βασίλεια. Οι διαφορές αυτές είναι οι εξής: 1. Το κυτταρικό τοίχωμα των Bacteria περιέχει πεπτιδογλυκάνη, ενώ δεν απαντάται στο κυτταρικό τοίχωμα των Archaea. 2. Στα λιπίδια της πλασματικής μεμβράνης η σύνδεση των πλευρικών αλυσίδων με τις πολικές κεφαλές γίνεται με εστερικούς δεσμούς στα Bacteria, ενώ στα Archaea γίνεται με αιθερικούς δεσμούς. 3. Στα Bacteria απαντάται μια RNA πολυμεράση, που αποτελείται από τέσσερις υπομονάδες, ενώ από τα Archaea έχουν απομονωθεί αρκετές διαφορετικές πολυμεράσες με πολλές υπομονάδες. 4. Το εναρκτήριο trna κατά τη μετάφραση είναι στα Bacteria η φορμυλμεθειονίνη, σε αντίθεση με τα Archaea, που είναι η μεθειονίνη. Στον πίνακα 1 συνοψίζονται οι παραπάνω φαινοτυπικές διαφορές ανάμεσα στα Bacteria, τα Archaea και τα Eucaryota. Είναι εμφανές ότι τα Archaea, αν και προκαρυωτικοί οργανισμοί, παρουσιάζουν σε πολλά χαρακτηριστικά περισσότερες ομοιότητες με τα Eucaryota παρά με τα Bacteria (Κολιάης 2001)

17 Πίνακας 1. Φαινοτυπικές διαφορές μεταξύ Bacteria, Archaea και Eucaryota (Κολιάης 2001) Bacteria Archaea Eucaryota Εστερικοί δεσμοί Αιθερικοί δεσμοί Εστερικοί δεσμοί Λιπίδια πλασματικής μεταξύ πλευρικών μεταξύ πλευρικών μεταξύ πλευρικών μεμβράνης αλυσίδων και πολικών αλυσίδων και πολικών αλυσίδων και πολικών κεφαλών κεφαλών κεφαλών RNA πολυμεράση Μία (4 υπομονάδες) Πολλές (8-12 υπομονάδες) Τρεις (~14 υπομονάδες) Κυτταρικό τοίχωμα Περιέχει πεπτιδογλυκάνη Δεν περιέχει πεπτιδογλυκάνη Δεν περιέχει πεπτιδογλυκάνη (όταν υπάρχει) Αρχικό trna στη μετάφραση Φορμυλ-μεθειονίνη Μεθειονίνη Μεθειονίνη 1.5 Γενετικοί τόποι ως εργαλεία ταξινόμησης των προκαρυωτικών μικροοργανισμών. Η συστηματική κατάταξη των μικροοργανισμών, όπως προαναφέρθηκε, γίνεται με βάση: α) μορφολογικούς χαρακτήρες (μικροσκοπική παρατήρηση), β) βιοχημικούς χαρακτήρες (ένζυμα, πρωτεΐνες κ.α.) και γ) γενετικούς τόπους. Χαρακτηριστικά γονίδια, που ενώ εμπεριέχουν αξιόλογη πληροφορία για την φυλογένεση των προκαρυωτικών μικροοργανισμών αλλά δεν έχουν χρησιμοποιηθεί είναι αυτά που κωδικοποιούν για το ένζυμο DNA γυράση την σαπερονίνη-60 την β-υπομονάδα της RNA πολυμεράσης την β-υπομονάδα της ATPάσης τον παράγοντα επιμήκυνσης EF-Tu τις πρωτεΐνες DnaK, HscA (Hsc66), και HscC (Hsc62) της πρωτεϊνικής οικογένειας Hsp70 σ70 παράγοντα της RNA πολυμεράσης trna συνθετάσες, με βασικότερη της αμινο-ακυλ-trna συνθετάσης και τις πρωτεΐνες RadA (Archaea) / RecA (Bacteria), που συμμετέχουν στην διαδικασία του ομόλογου ανασυνδυασμού (Riesenfeld et al. 2004)

18 Από την άλλη πλευρά, τα γονίδια που κωδικοποιούν για τα μόρια rrna και κυρίως για το 16S rrna έχουν χρησιμοποιηθεί ευρέως ως εργαλεία για την ταξινόμηση και φυλογένεση τόσο των προκαρυωτικών όσο και των ευκαρυωτικών οργανισμών Γονίδια που κωδικοποιούν μόρια rrna Τα γονίδια που κωδικοποιούν μόρια rrna ανήκουν στα γονίδια βασικών λειτουργιών (housekeeping genes). Στους προκαρυωτικούς μικροοργανισμούς απαντώνται 3 μόρια rrna, 5S, 16S και 23S. Αρχικά, για την συστηματική κατάταξη των μικροοργανισμών χρησιμοποιήθηκε η αλληλουχία του γονιδίου 5S rrna. Ωστόσο, το μικρό μήκος της αλληλουχίας (120 bp) αποτελούσε σημαντικό μειονέκτημα στη χρήση του ως εργαλείο φυλογένεσης. Αντιθέτως, τα γονίδιο για το 16S rrna (συστατικό της μικρής ριβοσωμικής υπομονάδας, ~1500 bp) και το 23S (~2900 bp) περιέχουν πολλή περισσότερη «φυλογενετική» πληροφορία. Καθώς όμως το γονίδιο για το 16S rrna είναι πιο εύχρηστο στα πειράματα από το γονίδιο για το 23S, η επιστημονική κοινότητα έχει επικεντρωθεί κατά κύριο λόγο στην μελέτη της αλληλουχίας του πρώτου (Rudi et al. 2007) Το γονίδιο 16S rrna ως εργαλείο για την ταξινόμηση και φυλογένεση των προκαρυωτικών μικροοργανισμών. Στην προηγούμενη παράγραφο έγινε αναφορά στις διαφορές που υπάρχουν ανάμεσα στα γονίδια που κωδικοποιούν τα μόρια rrna των προκαρυωτικών οργανισμών (εικ.5). Ωστόσο, το γονίδιο για το 16S rrna έχει ορισμένες ιδιότητες που το καθιστούν γενικότερα ένα πολύ χρήσιμο εργαλείο για την μελέτη των μικροοργανισμών. Οι ιδιότητες αυτές είναι οι εξής: Το μήκος της αλληλουχίας είναι αρκετά μεγάλο ώστε να χρησιμοποιηθεί για φυλογενετική ανάλυση Είναι γονίδιο που απαντάται σε όλους τους μικροοργανισμούς Η αλληλουχία του είναι υψηλά συντηρημένη με μια σχετική ποικιλομορφία Δεν έχει παρατηρηθεί ή έχει παρατηρηθεί σπάνια ενδοειδική ή διαειδική μεταφορά του γονιδίου με οριζόντια μεταφορά γενετικού υλικού (horizontal gene transfer, HGT) (Woese 1987, Woese 2000, Rudi et al. 2007)

19 Ωστόσο η παρουσία περισσότερων τους ενός αντιγράφων του 16S rrna γονιδίου στο γονιδίωμα των προκαρυωτικών οργανισμών (αριθμός αντιγράφων 1-15), δημιουργεί πολλές φορές προβλήματα στην ταυτοποίηση τους. Αυτό μπορεί να οφείλεται τόσο σε διαφορετικές αλληλουχίες των επιμέρους γονιδίων για το 16S rrna, όσο και στον διαφορετικό αριθμό αντιγράφων ανά οργανισμό οπότε δεν υπάρχει ισότιμη εκπροσώπηση των μικροοργανισμών στις 16S βιβλιοθήκες (βλ. παρακάτω) (Riesenfeld et al. 2004). Εικόνα 5. Δευτεροταγής δομή του 16S rrna των προκαρυωτικών μικροοργανισμών (ηλ. πηγή 2). 1.6 Το φυλογενετικό δέντρο της ζωής κατά Woese Ο Carl Woese ήταν ο πρώτος εξελικτικός που βασίστηκε σε βάθος σε μοριακούς - γενετικούς δείκτες για να εξάγει συμπεράσματα σχετικά με τις εξελικτικές σχέσεις μεταξύ των οργανισμών και πιο ειδικά των προκαρυωτικών μικροοργανισμών (Woese & Fox 1977). Για τις μελέτες του βασίστηκε στο 16S rrna, για τους λόγους που αναφέρθηκαν στην προηγούμενη ενότητα. Το πιο σημαντικό αποτέλεσμα αυτών των μελετών είναι η ανακάλυψη ενός νέου Βασιλείου μικροοργανισμών, του Βασιλείου των Archaea, που μέχρι τότε ονομάζονταν αρχαιοβακτήρια και θεωρούνταν ομάδα του Βασιλείου των Μονήρων μαζί με τα υπόλοιπα βακτήρια (Eubacteria) (Woese et al. 1978). Τα Archaea ισαπέχουν εξελικτικά από τους υπόλοιπους προκαρυωτικούς μικροοργανισμούς και τα Eucaryota. Η εξελικτική διαφοροποίηση των Archaea οδήγησε τον Woese στο συμπέρασμα ότι όλοι οι ζωντανοί οργανισμοί μπορούν να καταταγούν σε τρεις κύριες ομάδες Βασίλεια : i. Eucaryota, όπου ανήκουν όλοι οι ευκαρυωτικοί μικροοργανισμοί

20 ii. Archaea, όπου ανήκουν τα μέχρι πρότινος αρχαιοβακτήρια, και iii. Bacteria, όπου ανήκουν οι υπόλοιποι προκαρυωτικοί μικροοργανισμοί (Woese et al. 1990) (εικ.7). Το συγκεκριμένο φυλογενετικό δέντρο είναι σχετικά απλό από άποψη δομής, ωστόσο, αποτελεί πηγή σημαντικών συμπερασμάτων. Με μια πρώτη ματιά, το φυλογενετικό δέντρο που πρότεινε ο Woese και οι συνεργάτες του δείχνει ότι η μερίδα του λέοντος όσον αφορά την βιοποικιλότητα ανήκει στους προκαρυωτικούς οργανισμούς, σε αντίθεση με τους ευκαρυωτικούς που εμφανίζουν σαφώς μικρότερη ποικιλότητα και αποτελούν τους πιο πρόσφατους τελευταίους οργανισμούς της εξελικτικής ιστορίας (εικ.6). Αυτό γίνεται ιδιαίτερα κατανοητό αν λάβουμε υπόψη τα 3,8 δισεκατομμύρια χρόνια παρουσίας των προκαρυωτικών οργανισμών στον πλανήτη σε αντίθεση με τα 2 δισεκατομμύρια χρόνια παρουσίας των ευκαρυωτικών οργανισμών και τα μόλις 600 εκατομμύρια χρόνια παρουσίας των ανώτερων ζωικών οργανισμών (DeLong & Pace 2001). Εικόνα 6. Παρουσία των οργανισμών στη γη (ηλεκτρονική πηγή 3)

21 Εικόνα 7. Το φυλογενετικό δέντρο της ζωής με βάση την αλληλουχία της μικρής ριβοσωμικής υπομονάδας (16S / 18S rrna) (από Barns et al. 1996). 1.7 Μικροβιακή ποικιλότητα Η μελέτη της μικροβιακής ποικιλότητας στο περιβάλλον αποτελεί ένα από τα γνωστικά αντικείμενα της περιβαλλοντικής μικροβιολογίας. Ουσιαστικά, αποβλέπει στην μελέτη της σύνθεσης και φυσιολογίας των μικροβιακών κοινοτήτων στο περιβάλλον. Η μικροβιακή ποικιλότητα στοιχειοθετείται από δύο χαρακτηριστικά: αφθονία και ομοιογένεια. Κατά συνέπεια, ο υψηλότερος βαθμός ποικιλότητας εντοπίζεται σε μικροβιακές κοινότητες με όσο το δυνατόν περισσότερα διαφορετικά είδη μικροοργανισμών (αφθονία) σε σχετικά ίσους πληθυσμούς (ομοιογένεια) (Kapur & Kumar Jain 2004). Το εύρος της μικροβιακής ποικιλότητας σχετίζεται με μια πληθώρα περιβαλλοντικών παραγόντων. Όσον αφορά τις λίμνες, χαρακτηριστικοί

22 περιβαλλοντικοί παράγοντες που επηρεάζουν την σύσταση των μικροβιακών κοινοτήτων αποτελούν η πρωτογενής παραγωγή, η θερμοκρασία, το ph, η διαπερατότητα του ηλιακού φωτός, η ποσότητα του διαλυμένου οξυγόνου κ.α (Liu et al. 2009) Εκτίμηση μικροβιακής ποικιλότητας Μέχρι τα μέσα του προηγούμενου αιώνα, όταν ακόμα η μοριακή βιολογία δεν είχε αναπτυχθεί σε τέτοιο βαθμό ώστε να χρησιμοποιείται στην ταξινόμηση των μικροοργανισμών, ο μόνος τρόπος για την ταυτοποίηση ενός μικροβίου από περιβαλλοντικό δείγμα ήταν η απομόνωση και καλλιέργεια του στο εργαστήριο και η χρήση μικροσκοπίου ή βιοχημικών μεθόδων. Κατά συνέπεια, έως σχετικά πρόσφατα, η γνώση που είχαμε για τους μικροοργανισμούς του περιβάλλοντος περιοριζόταν αποκλειστικά σε αυτούς που έχουν την δυνατότητα καλλιέργειας στο εργαστήριο. Σύμφωνα με τους Ammann et al.,(1995), μόλις το 0,001-0,1% των θαλάσσιων μικροοργανισμών, το 0,25% των μικροοργανισμών εσωτερικών υδάτων και το 0,3% των μικροοργανισμών του εδάφους μπορούν να καλλιεργηθούν στο εργαστήριο με τις υπάρχουσες μέχρι στιγμής μεθόδους καλλιέργειας. Το γεγονός αυτό οδηγεί στο συμπέρασμα ότι δεν γνωρίζουμε προσεγγιστικά το 99% των μικροοργανισμών που υπάρχουν στον πλανήτη! Το πρόβλημα αυτό μπορεί να λυθεί με την απευθείας απομόνωση και κλωνοποίηση ολόκληρων γονιδιωμάτων ή συγκεκριμένων τμημάτων όλων των μικροοργανισμών που απαντώνται σε ένα περιβαλλοντικό δείγμα χωρίς να απαιτείται απομόνωση και καλλιέργεια των μικροοργανισμών αυτών. Η προσέγγιση αυτή στην μελέτη της μικροβιακής ποικιλότητας λαμβάνει χώρα την τελευταία περίπου εικοσαετία και συνιστά τον κλάδο της μεταγονιδιωματικής (metagenomics) στην περιβαλλοντική μικροβιολογία (Riesenfeld et al. 2004, Schloss & Handelsman 2005, Langer et al. 2006,). Μεταγονιδίωμα, ουσιαστικά, είναι το σύνολο του γενετικού υλικού ενός περιβαλλοντικού δείγματος, από όλους τους οργανισμούς, που έχει απομονωθεί χωρίς να έχει προηγηθεί καλλιέργεια των μικροοργανισμών αυτών. Με την μεταγονιδιωματική προσέγγιση, πέραν του προσδιορισμού της μικροβιακής ποικιλότητας επιτυγχάνεται και η μελέτη της φυσιολογίας μιας μικροβιακής κοινότητας, καθώς καθίσταται δυνατή η απομόνωση και ταυτοποίηση γονιδίων με σημαντικές ιδιότητες (ογκογονίδια, γονίδια που συμμετέχουν στο μεταβολισμό ρύπων κ.α.)

23 Το πρώτο και άμεσο συμπέρασμα που προέκυψε με την εφαρμογή της μεταγονιδιωματικής προσέγγισης στο πεδίο της περιβαλλοντικής μικροβιολογίας, όπως προαναφέρθηκε, είναι η ανακάλυψη του πλούτου των μικροοργανισμών που δεν μπορούν να καλλιεργηθούν. Χαρακτηριστικό είναι ότι μέχρι τον Απρίλιο του 2004, η βάση δεδομένων GenBank (www.ncbi.nlm.nih.gov) περιείχε αλληλουχίες του γονιδίου 16S rrna από προκαρυωτικούς οργανισμούς που μπορούν να καλλιεργηθούν και από που δεν μπορούν να καλλιεργηθούν (Rappe & Giovannoni 2003). Πριν προτείνει ο Woese την χρήση του 16S rrna για την φυλογένεση των οργανισμών, ήταν αναγνωρισμένα 12 βακτηριακά φύλα, τα οποία είχαν τουλάχιστον από 1 αντιπρόσωπο με δυνατότητα καλλιέργειας. Με την χρήση του 16S rrna, έχουν αναγνωριστεί 14 επιπλέον φύλα με αντιπροσώπους με δυνατότητα καλλιέργειας. Επιπλέον, έχουν προταθεί 26 υποψήφια φύλα, τα οποία δεν έχουν κανένα αντιπρόσωπο που να μπορεί να καλλιεργηθεί με τις μέχρι στιγμής μεθόδους καλλιέργειας. Αυτό δείχνει την σημασία της χρήσης μεθόδων που δεν απαιτούν καλλιέργεια για τον προσδιορισμό της μικροβιακής ποικιλότητας Γιατί μελετάμε την μικροβιακή ποικιλότητα Στο σημείο αυτό εγείρεται το ερώτημα: για ποιο λόγο είναι σημαντικό να ανακαλύψουμε αυτόν τον τεράστιο και σχεδόν ανεξερεύνητο μικροβιακό πλούτο; Είναι ευρέως γνωστό ότι τα προκαρυωτικά κύτταρα υπερτερούν αριθμητικά των ευκαρυωτικών κατά πολλές τάξεις μεγέθους. Χαρακτηριστικό παράδειγμα αποτελεί το ανθρώπινο σώμα όπου τα βακτηριακά κύτταρα είναι φορές ( ) περισσότερα από τα κύτταρα του σώματος (10 13 ). Επίσης πρόσφατες εκτιμήσεις υποδηλώνουν ότι η βιομάζα των προκαρυωτικών οργανισμών ξεπερνά κατά πολύ την βιομάζα του συνόλου των ευκαρυωτικών κυττάρων. Εκτιμάται ότι περίπου 500 δισεκατομμύρια τόνοι άνθρακα είναι ενσωματωμένοι στα κύτταρα των προκαρυωτικών οργανισμών και αποτελεί την μισή ποσότητα άνθρακα που απαντάται στη βιόσφαιρα (Whitman et al. 1998). Από τους αριθμούς και μόνο γίνεται κατανοητή η σημασία της μελέτης της μικροβιακής ποικιλότητας. Ωστόσο, κάποιες ιδιότητες των προκαρυωτικών μικροοργανισμών καθιστούν την ανάγκη της μελέτης αυτής ακόμη πιο επιτακτική (Schleifer 2004): Οι προκαρυωτικοί μικροοργανισμοί αποτελούν το θεμέλιο της βιόσφαιρας. Είναι οι πρώτοι ζωντανοί οργανισμοί που εμφανίστηκαν στη γη και χωρίς την παρουσία τους οι υπόλοιπες μορφές ζωής δεν θα είχαν εξελιχθεί και δεν

24 θα μπορούσαν να υπάρξουν. Επίσης οι προκαρυωτικοί μικροοργανισμοί δημιούργησαν ένα περιβάλλον πλούσιο σε οξυγόνο που είναι απαραίτητο για την γένεση και επιβίωση των ανώτερων μορφών ζωής Οι βιογεωχημικοί κύκλοι θα ήταν ατελείς χωρίς την συνεισφορά των μικροβίων. Πιο συγκεκριμένα, η ολοκλήρωση των κύκλων του αζώτου και του θείου όπως επίσης και η οξείδωση και αναγωγή των μετάλλων θα ήταν αδύνατη χωρίς την παρουσία των μικροβίων. Οι προκαρυωτικοί μικροοργανισμοί αποκτούν ενέργεια για την ανάπτυξη τους μεταφέροντας ηλεκτρόνια σε ένα μεγάλο αριθμό βλαβερών μετάλλων όπως ουράνιο, χρώμιο, αρσενικό και πλουτώνιο. Τα όρια της ζωής καθορίζονται επίσης από τους προκαρυωτικούς μικροοργανισμούς. Μπορούν να επιβιώσουν και να αναπτυχθούν στις πιο ακραίες περιβαλλοντικές συνθήκες, σε θερμοπηγές με θερμοκρασία νερού 121 C (Kashefi & Lovley 2003) ή σε παγωμένο νερό λίμνης τέσσερα χιλιόμετρα κάτω από τον πάγο στην ανατολική Ανταρκτική (Karl et al. 1999). Πολλοί προκαρυωτικοί μικροοργανισμοί είναι ενδοσυμβιωτικοί σε άλλους ανώτερους οργανισμούς και διαδραματίζουν σημαντικό ρόλο στην επιβίωση τους. Φέρουν σε πέρας βιοχημικές αντιδράσεις που δεν μπορούν να επιτελέσουν οι ξενιστές όπως η βιοσύνθεση αμινοξέων, βιταμινών ή η αποικοδόμηση ορισμένων μακρομορίων. Οι προκαρυωτικοί μικροοργανισμοί αποτελούν τους «διαχειριστές» της γης, καθώς αποικοδομούν τους νεκρούς οργανισμούς και συμβάλλουν έτσι στην ανακύκλωση της ύλης. Επίσης, καταστρέφουν ρυπαντές, συμβάλλοντας έτσι στην προστασία του περιβάλλοντος (Colwell 1997). Φέρουν γονίδια που ομόλογα τους παρατηρούνται σε πολλούς ανώτερους οργανισμούς και έτσι αποτελούν αντικείμενο μελέτης της εξέλιξης Τέλος, οι μικροοργανισμοί αποτελούν σημαντικά εργαλεία στη βιοτεχνολογία και πηγή νέων προϊόντων και βιοτεχνολογικών εφαρμογών. Με βάση τις παραπάνω ιδιότητες, και όχι μόνο αυτές, την τελευταία εικοσαετία παρατηρείται μια έντονη επιστημονική δραστηριότητα στο χώρο της περιβαλλοντικής μικροβιολογίας και συγκεκριμένα της μικροβιακής οικολογίας. Με την βοήθεια των εφαρμογών της μοριακής βιολογίας και της γενετικής μηχανικής, είναι πλέον

25 ευκολότερο να προσδιοριστεί η μικροβιακή ποικιλότητα και να ανακαλυφθεί ο τεράστιος παγκόσμιος μικροβιακός πλούτος. 1.8 Η λίμνη της Καστοριάς Η λίμνη της Καστοριάς βρίσκεται στη δυτική Μακεδονία, στον νομό Καστοριάς (40 31 N, E ) σε υψόμετρο 620μ. Έχει σχήμα νεφροειδές (εικ.8) και καλύπτει έκταση 28 km 2. Η λίμνη έχει μέσο βάθος 5 m και μέγιστο βάθος 8,5 m (Mourkides & Tsiouris, 1984). Η λίμνη αποτελεί κατάλοιπο παλιάς εκτεταμένης λίμνης με έκταση 164 km 2 και μέγιστο βάθος μεγαλύτερο από 50 m (Τεταρτογενές). Είναι τεκτονικής προέλευσης και υπολογίζεται ότι σχηματίστηκε πριν από έτη (Μειόκαινο). Η λεκάνη απορροής της λίμνης έχει έκταση 253 απ όπου μέσω 8 χειμάρρων τροφοδοτείται η λίμνη. Εκτός από τα ρέματα η λίμνη τροφοδοτείται και από το νερό της βροχής καθώς και από πολλές υπολίμνιες πηγές. Εικόνα 8. Πανοραμική άποψη της πόλης της Καστοριάς και της ομώνυμης λίμνης. Οι υψηλές συγκεντρώσεις θρεπτικών όπως του ανόργανου αζώτου και του φωσφόρου και οι υψηλές τιμές βιομάζας της ομάδας των κυανοβακτηρίων, υποδηλώνουν ένα υπερεύτροφο σύστημα που χαρακτηρίζεται από συχνές ανθίσεις του νερού (waterblooms) κατά τη διάρκεια του χρόνου, με μεγαλύτερη συχνότητα εμφάνισης κατά τη θερμή περίοδο (Κατσιάπη 2007). Τα είδη που δημιουργούν αυτές τις ανθίσεις στην λίμνη είναι τα Microcystis aeruginosa, M. flos-aquae, M. novacekii,

26 M. wesenbergii, καθώς και τα Anabaena flos-aquae και A. viguieri. Επίσης, άλλα κυανοβακτηριακά είδη που επικρατούν στη λίμνη της Καστοριάς είναι τα Limnothrix redekei και Cylindrospermopsis raciborskii (Βαρδάκα 2001). Η λίμνη της Καστοριάς εμφανίζει τις εξής «ιδιαιτερότητες»: Για πολλές δεκαετίες, μέχρι και το 1995 (το 1996 γίνεται έναρξη της λειτουργίας μονάδας βιολογικού καθαρισμού στη περιοχή της Καστοριάς) δεχόταν αστικά λύματα, τα οποία ουσιαστικά διαμόρφωσαν τον υπερεύτροφο χαρακτήρα της με συνέπεια την εμφάνιση ανθίσεων του νερού σε όλη τη διάρκεια του έτους. Επίσης κατά καιρούς, πραγματοποιήθηκαν διάφορες επεμβάσεις σε αυτή είτε με στόχο την αύξηση των ιχθυαποθεμάτων (εμπλουτισμός με κυπρινοειδή) ή για αισθητικούς λόγους (κοπή των μακροφύτων, χρήση φυτοφαρμάκων για τη μείωση των κυανοβακτηρίων), οι οποίες ουσιαστικά ευνόησαν ακόμη περισσότερο την εμφάνιση ανθίσεων του νερού. Ο υπερεύτροφος χαρακτήρας της λίμνης, σε συνδυασμό με την παρουσία της πόλης της Καστοριάς αλλά και άλλων οικισμών στις όχθες της, την καθιστούν ένα ιδιαίτερο οικοσύστημα για τον προσδιορισμό της μικροβιακής ποικιλότητας. 1.9 Σκοπός της εργασίας Σκοπός της παρούσας εργασίας ήταν η καταγραφή της μικροβιακής ποικιλότητας στη λίμνη της Καστοριάς, τόσο στην υδάτινη φάση όσο και στο ίζημα. Πιο συγκεκριμένα, στη συγκεκριμένη εργασία οι επιμέρους στόχοι ήταν: Ο προσδιορισμός της σύστασης των προκαρυωτικών μικροοργανισμών (Archaea & Bacteria) σε συγκεκριμένα σημεία της λίμνης, η μελέτη της δυναμικής των μικροβιακών κοινοτήτων κατά την διάρκεια του έτους 2009 και η συσχέτιση της μικροβιακής σύστασης με φυσικούς και ανθρωπογενείς περιβαλλοντικούς παράγοντες

27 2. ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ

28 2.1 Δειγματοληψία Επί τόπου μέτρηση φυσικοχημικών παραμέτρων Κατά την διάρκεια του έτους 2009 πραγματοποιήθηκαν 4 εποχιακές δειγματοληψίες (Ιανουάριος, Απρίλιος, Ιούλιος, Οκτώβριος) σε τέσσερα συγκεκριμένα σημεία της λίμνης (εικ.9). Σ 1 Σ 4 Σ 2 Σ 3 Εικόνα 9. Η λίμνη της Καστοριάς (εικόνα από δορυφόρο). Η επιλογή των σταθμών δειγματοληψίας έγινε με βάση ορισμένα χαρακτηριστικά που έγιναν γνωστά από προηγούμενες υδροβιολογικές μελέτες (Μουστάκα και συν. 2000). Τα χαρακτηριστικά κάθε σταθμού δειγματοληψίας είναι τα εξής: Σταθμός 1. Στον συγκεκριμένο σταθμό έχουν παρατηρηθεί οι υψηλότερες συγκεντρώσεις θρεπτικών συστατικών (αζωτούχων και φωσφορικών ενώσεων) στη λίμνη, λόγω των παρακείμενων γεωργικών εκτάσεων (καλλιέργειες μήλου και φασολιού). Σταθμός 2. Ο συγκεκριμένος σταθμός έχει σχεδόν τα ίδια χαρακτηριστικά με το σταθμό 1 και επιπλέον βρίσκεται κοντά στις εκβολές του χειμάρρου «Ξηροποτάμου», που αποτελεί τον μεγαλύτερο σε ποσότητα νερού χείμαρρο της λεκάνης απορροής της λίμνης

29 Σταθμός 3. Στον συγκεκριμένο σταθμό έχουν παρατηρηθεί οι χαμηλότερες συγκεντρώσεις θρεπτικών συστατικών στη λίμνη. Επιλέχθηκε ως ένα σημείο με τη σχετικά μικρότερη επιβάρυνση από λιπάσματα και φυτοφάρμακα, ενώ βρίσκεται κοντά στην περιοχή του θηροφράγματος, από το οποίο απομακρύνεται ελεγχόμενα ποσότητα νερού όταν η στάθμη φτάσει σε υψηλά επίπεδα. Σταθμός 4. Ο συγκεκριμένος σταθμός βρίσκεται στον μικρό κόλπο που περιβάλλεται από την πόλη της Καστοριάς. Στο σημείο αυτό καταλήγουν τα όμβρια ύδατα από την πόλη της Καστοριάς, ενώ πριν λειτουργήσει ο βιολογικός καθαρισμός κατέληγαν στο σημείο αυτό και τα αστικά λύματα. Σε κάθε σταθμό έγινε δειγματοληψία 5 L επιφανειακού νερού (για την ακρίβεια νερού βάθους 0,5 m) με χρήση κατάλληλου δειγματολήπτη ( δειγματολήπτης νερού KC Ruttner, 0,7 L) και ιζήματος με κατάλληλο δειγματολήπτη ιζήματος (Ekman Birge δειγματολήπτης) (εικ.10). Εικόνα 10. Δειγματολήπτης ιζήματος Ekman - Birge (αριστερά) και δειγματολήπτης νερού KC - Ruttner (δεξιά) (ηλεκτρονικές πηγές 4 και 5). Επίσης, σε κάθε σταθμό δειγματοληψίας έγινε λήψη 2 L νερού τόσο από βάθος 0,5 m όσο και από το νερό ακριβώς πάνω από τον πυθμένα για ποσοτικό προσδιορισμό χλωροφύλλης α και θρεπτικών συστατικών (αζωτούχων και φωσφορικών)

30 Με την χρήση κατάλληλου οργάνου μέτρησης (YSI 556 Handheld Multiparameter) έγινε in situ μέτρηση της θερμοκρασίας, ph, συγκέντρωσης διαλυμένου οξυγόνου, αλατότητας, αγωγιμότητας και συγκέντρωσης ολικών στερεών. Επίσης, με την χρήση του δίσκου Secchi (εικ.11) μετρήθηκε η διαφάνεια του νερού (με βάση το μέγιστο βάθος στο οποίο εξακολουθεί να είναι ορατός ο δίσκος). Εικόνα 11. Ο δίσκος Secchi, με τον οποίο υπολογίζεται η διαφάνεια του νερού σε υδάτινα συστήματα (ηλεκτρονική πηγή 6). Για τον σωστό ποσοτικό προσδιορισμό της χλωροφύλλης α, τα δείγματα τοποθετούνταν σε μαύρες σακούλες, ώστε να μην μετατρέπεται η χλωροφύλλη α υπό την επίδραση της ηλιακής ακτινοβολίας σε άλλες μορφές (φαιοφυτίνη κ.α.). Ακολούθησε μεταφορά των δειγμάτων στο εργαστήριο και άμεσος ποσοτικός προσδιορισμός της συγκέντρωσης της χλωροφύλλης α και των θρεπτικών συστατικών (αζωτούχων και φωσφορικών)

31 2.2 Ποσοτικός προσδιορισμός χλωροφύλλης α Ο ποσοτικός προσδιορισμός της χλωροφύλλης α πραγματοποιούνταν εντός 24 ωρών από την στιγμή της δειγματοληψίας. Η διαδικασία για τον ποσοτικό προσδιορισμό της χλωροφύλλης α είναι η εξής (APHA,1999) : I. Διήθηση 1000 ml δείγματος μέσω φίλτρων ινών υάλου Whatman ( Whatman Grade GF/F, cat # ). Για κάθε δείγμα χρησιμοποιείται μόνο ένα φίλτρο. II. Μεταφορά του κάθε φίλτρου σε σωλήνα falcon όπου έχει τοποθετηθεί διάλυμα ακετόνης 90% III. Μεταφορά τους 4 C για 20 ώρες περίπου. IV. Μεταφορά των διαλυμάτων χωρίς τα φίλτρα σε νέα σωληνάκια falcon, καταγραφή του όγκου (extract volume) και φυγοκέντρηση στις 2500 rpm για 20 λεπτά. V. Μέτρηση συγκέντρωσης της χλωροφύλλης α με φασματοφωτομέτρηση. Πιο συγκεκριμένα, υπολογίζεται η οπτική πυκνότητα του υπερκειμένου σε τρία διαφορετικά μήκη κύματος, 664nm,647nm και 630nm, οπότε η συγκέντρωση της χλωροφύλλης στο υπερκείμενο προκύπτει από τον τύπο : C α = 11,85 Χ (OD664) 1,54 X (OD647) 0,08 Χ (OD630), όπου OD = Optical Density, Οπτική Πυκνότητα. Η συγκέντρωση της χλωροφύλλης στο αρχικό περιβαλλοντικό δείγμα προκύπτει από τον τύπο: C chla = C α Χ extract volume / διηθούμενος όγκος δείγματος 2.3 Ποσοτικός προσδιορισμός ανόργανων θρεπτικών συστατικών (αζωτούχων και φωσφορικών) Ο ποσοτικός προσδιορισμός των ανόργανων αζωτούχων και φωσφορικών συστατικών έγινε με την μέθοδο της φασματοφωτομέτρησης με την χρήση του φασματοφωτόμετρου Smart της εταιρίας LaMotte (Model No. LMC202 Rev E) (εικ.12)

32 Εικόνα 12. Το φασματοφωτόμετρο Smart της εταιρίας LaMotte (ηλεκτρονική πηγή 7). Για τον ποσοτικό προσδιορισμό των θρεπτικών συστατικών χρησιμοποιήθηκαν 4 kit της ίδιας εταιρίας : Για τον ποσοτικό προσδιορισμό των αμμωνιακών αζωτούχων χρησιμοποιήθηκε το kit με κωδικό SC, που βασίζεται στη μέθοδο του σαλικυλικού άλατος. Για τον ποσοτικό προσδιορισμό των νιτρικών αζωτούχων χρησιμοποιήθηκε το kit με κωδικό 3649-SC, που βασίζεται στη μέθοδο αναγωγής του καδμίου. Για τον ποσοτικό προσδιορισμό των νιτρωδών αζωτούχων χρησιμοποιήθηκε το kit με κωδικό 3650-SC, που βασίζεται στη μέθοδο diazotization. Για τον ποσοτικό προσδιορισμό των φωσφορικών χρησιμοποιήθηκε το kit με κωδικό 3653-SC, που βασίζεται στη μέθοδο αναγωγής του ασκορβικού οξέος. Σε όλες τις παραπάνω μεθόδους, μετά από κατάλληλες αντιδράσεις, παράγεται μια χρωστική, η ένταση της οποίας είναι ανάλογη της συγκέντρωσης του κάθε θρεπτικού στο δείγμα (www.lamotte.com). 2.4 Διήθηση περιβαλλοντικών δειγμάτων και ανάκτηση μικροοργανισμών Η ανάκτηση των μικροοργανισμών από κάθε δείγμα πραγματοποιήθηκε με διαδοχικές διηθήσεις του δείγματος και συγκέντρωση τους σε κατάλληλα φίλτρα. Πιο συγκεκριμένα, για την ανάκτηση των μικροοργανισμών από δείγμα του ιζήματος η διαδικασία που ακολουθήθηκε είναι η εξής : 1. Επαναιώρηση 150g από την λάσπη του ιζήματος σε 2 L απιονισμένου νερού ή νερού από τον πυθμένα, πάνω από το ίζημα

33 2. Διήθηση του δείγματος 2-3 φορές από υδρόφιλο βαμβάκι 3. Διήθηση του δείγματος από φίλτρο με διάμετρο πόρου 20μm (Millipore, cat# NY ) με χρήση αντλίας κενού (εικ.14) 4. Διήθηση του δείγματος από φίλτρο με διάμετρο πόρου 3μm (Whatman Grade GF/D, cat# ) 5. Τελική διήθηση για συγκράτηση βακτηριακών κυττάρων από φίλτρα διαμέτρου 0,45μm (Whatman Mixed cellulose ester filters, cat# ) (εικ.13). Εικόνα 13. Φίλτρα Whatman με διάμετρο πόρου 0,45μm για την συγκράτηση μικροοργανισμών. 6. Τοποθέτηση των φίλτρων ανά 4 σε σωλήνες φυγοκέντρου των 50ml και αποθήκευση στην κατάψυξη για εξαγωγή DNA Για την ανάκτηση των μικροοργανισμών από δείγμα της υδάτινης στήλης (επιφάνειας) ακολουθείται η ίδια διαδικασία με την διαφορά ότι διηθείται ποσότητα δείγματος ίση με 5 L και δεν γίνεται διήθηση από υδρόφιλο βαμβάκι. Εικόνα 14. Η διάταξη που χρησιμοποιήθηκε για την διήθηση των δειγμάτων (ηλ.πηγή 8)

34 2.5 Απομόνωση DNA από τους μικροοργανισμούς Για την απομόνωση DNA από τους μικροοργανισμούς που έχουν συγκρατηθεί στα φίλτρα εφαρμόστηκε το εξής πρωτόκολλο: 1. Προσθήκη ml διαλύματος TE Buffer ph 8 (10mM Tris HCl ph 8, 1mM EDTA ph 8) και έντονη ανάδευση (vortex) ώστε να απομακρυνθούν οι μικροοργανισμοί από τα φίλτρα, 2. Μεταφορά του περιεχομένου σε σωλήνα φυγοκέντρησης και φυγοκέντρηση για 20 λεπτά στους 4 C (13000 rpm). 3. Απομάκρυνση υπερκειμένου και επαναδιάλυση του ιζήματος σε 600 μl διαλύματος ΤΕ Buffer. 4. Προσθήκη 36 μl διαλύματος 10% SDS και 11 μl πρωτεϊνάσης Κ (10mg/ml). Ανάδευση και επώαση στους 37 C για 45 λεπτά. 5. Προσθήκη 120 μl διαλύματος 5M NaCl και ελαφριά ανάδευση. 6. Προσθήκη 100 μl διαλύματος απομόνωσης CTAB και επώαση στους 10 C για 15 λεπτά. 7. Προσθήκη ίσης ποσότητας διαλύματος χλωροφορμίου/ισοαμυλικής αλκοόλης (24 : 1) και καλή ανάδευση. 8. Φυγοκέντρηση στους 4 C για 10 λεπτά (13000 rpm) 9. Μεταφορά 500 μl από το υπερκείμενο σε νέο σωλήνα και προσθήκη 700 μl ισοπροπανόλης. 10. Μεταφορά στους -20 C overnight. 11. Φυγοκέντρηση για 15 λεπτά (14000 rpm) στους 4 C. 12. Απομάκρυνση υπερκειμένου και προσθήκη 1 ml αιθανόλης 70%. 13. Φυγοκέντρηση στους 4 C για 10 λεπτά (13000 rpm). 14. Απομάκρυνση υπερκειμένου 15. Απομάκρυνση καταλοίπων αιθανόλης και επαναδιάλυση του ιζήματος σε 30 μl διαλύματος TE Buffer. 16. Αποθήκευση στους 4 C

35 2.6 Προσδιορισμός της ποσότητας του απομονωμένου DNA από τα περιβαλλοντικά δείγματα. Μετά την απομόνωση του DNA, έγινε ηλεκτροφόρηση συγκεκριμένης ποσότητας των δειγμάτων σε πηκτή αγαρόζης, ώστε να προσδιοριστεί η συγκέντρωση του απομονωμένου DNA. Χρησιμοποιήθηκε πηκτή με συγκέντρωση αγαρόζης 0,7% w/v, ενώ ως μάρτυρας μοριακών βαρών χρησιμοποιήθηκε ο Lambda DNA/EcoRI+HindIII Marker 3 της εταιρίας Fermentas. 2.7 Ενίσχυση τμήματος της αλληλουχίας του 16S rrna γονιδίου των Bacteria και Archaea. Το ολικό γονιδιωματικό DNA που απομονώθηκε από κάθε δείγμα αντιστοιχεί στην πλειονότητα, αν όχι στο σύνολο, των μικροοργανισμών που απαντώνται σε κάθε δείγμα. Με την χρήση κατάλληλων παγκόσμιων εκκινητών έγινε ενίσχυση τμήματος της αλληλουχίας του 16S rrna γονιδίου για τα Bacteria και τα Archaea που απαντώνται σε κάθε δείγμα. Στον πίνακα 2 παρουσιάζονται τα ζεύγη των εκκινητών που χρησιμοποιήθηκαν με κάποιες ιδιότητες τους (JGI 2008). Πίνακας 2. Τα ζεύγη των εκκινητών που χρησιμοποιήθηκαν για την ενίσχυση τμήματος των γονιδίων 16S rrna των Bacteria και Archaea Οργανισμός Bacteria Όνομα εκκινητή Αλληλουχία εκκινητή (5 3 ) Μήκος Μέγεθος προϊόντος 27F AGAGTTTGATCCTGGCTCAG R GACGGGCGGTGWGTRCA 17 ~1400 bp Archaea 4F TCCGGTTGATCCTGCCRG R GGTTACCTTGTTACGACTT 19 ~1500 bp Ως υπόστρωμα για την αντίδραση της PCR χρησιμοποιήθηκε, όπως προαναφέρθηκε, απομονωμένο DNA από τα περιβαλλοντικά δείγματα. Η ποσότητα του κυμαινόταν μεταξύ 0,08 και 1,2 ng, όπως προέκυψε μετά από ένα αριθμό δοκιμαστικών αντιδράσεων (αραίωση 1:50). Η αντίδραση έγινε σε τελικό όγκο 20 μl. Χρησιμοποιήθηκε, εκτός του υποστρώματος, η θερμοανθεκτική DNA πολυμεράση GoTaq Flexi της εταιρίας Promega μαζί με το PCR Buffer και MgCl 2, dntp s της

36 εταιρείας Invitrogen και τα ζεύγη εκκινητών της εταιρίας Operon. Οι συγκεντρώσεις του κάθε συστατικού στην αντίδραση παρουσιάζονται στον πίνακα 3. Πίνακας 3. Συγκεντρώσεις των συστατικών της PCR για την ενίσχυση τμήματος του 16S rrna γονιδίου των Archaea και Bacteria Συστατικό Τελική συγκέντρωση PCR buffer 1 MgCl 2 1,5 dntp s 0,125 Forward Primer (27F / 4F) 0,3 Reverse Primer (1391R / 1492R) 0,3 GoTaq Flexi DNA πολυμεράση Υπόστρωμα 1U 0,08 1,2 ng Η αντίδραση έγινε στον θερμικό κυκλοποιητή CreaCon T-CY. Το πρόγραμμα που ακολουθήθηκε ήταν κοινό για τα Archaea και τα Bacteria. Χαρακτηριστικό είναι ότι για κάθε δείγμα έγιναν τρεις αντιδράσεις PCR με θερμοκρασίες υβριδισμού 50 C, 53 C και 57 C. Αυτό έγινε ώστε να είναι δυνατή η ενίσχυση του τμήματος 16S rrna από όσο το δυνατόν περισσότερα στελέχη. Στον πίνακα 4 παρουσιάζεται το πρόγραμμα της PCR που ακολουθήθηκε. Πίνακας 4. Το πρόγραμμα της PCR που εφαρμόστηκε για την ενίσχυση τμήματος του 16S rrna γονιδίου των Archaea και Bacteria Στάδιο Θερμοκρασία Χρόνος Αριθμός κύκλων Αρχική αποδιάταξη 95 C 5 Αποδιάταξη 95 C 30 Υβριδισμός 50 C,53 C,57 C 40 Χ 35 Επιμήκυνση 72 C 120 Τελική επιμήκυνση 72 C

37 2.8 Κλωνοποίηση των προϊόντων της PCR Κατασκευή 16S βιβλιοθηκών Το επόμενο στάδιο ήταν η κλωνοποίηση των προϊόντων της PCR σε κατάλληλο πλασμιδιακό φορέα και η δημιουργία 16S rrna βιβλιοθηκών για Archaea και Bacteria για τα δείγματα ιζήματος των σταθμών Σ2, Σ3 και Σ4 από την δειγματοληψία του Απριλίου Πριν την διαδικασία της κλωνοποίησης, έγινε καθαρισμός των προϊόντων PCR από τους εκκινητές και την περίσσεια dntps. Για τον σταθμό Σ2 έγινε καθαρισμός τόσο με gel extraction όσο και απευθείας καθαρισμός με χρήση του κατάλληλου πρωτοκόλλου. Αντίθετα, για τους σταθμούς Σ3 και Σ4 έγινε καθαρισμός μόνο με χρήση του κατάλληλου πρωτοκόλλου. Για τον καθαρισμό των PCR προϊόντων με gel extraction εφαρμόστηκε το πρωτόκολλο Protocol for DNA extraction from agarose gels Nucleospin Extract II της εταιρίας Macherey Nagel, ενώ για τον καθαρισμό των προϊόντων PCR το πρωτόκολλο Protocol for PCR clean-up - Nucleospin Extract II της εταιρίας Macherey Nagel (www.macherey-nagel.com) Για κλωνοποίηση των προϊόντων PCR χρησιμοποιήθηκε το kit pgem -T Easy Vector Systems της εταιρίας Promega (www.promega.com), σύμφωνα με το πρωτόκολλο που το συνοδεύει. Τα στάδια της διαδικασίας περιγράφονται αναλυτικά στη συνέχεια : -Σύνδεση ενθέματος (PCR προϊόντος) με τον φορέα κλωνοποίησης ( Ligation ). Η διαδικασία σύνδεσης έχει ως εξής : i. Ξεπάγωμα των 2X Rapid Ligation Buffer(ρυθμιστικό διάλυμα για την αντίδραση σύνδεσης), pgem-t Easy Vector (πλασμίδιο - φορέας κλωνοποίησης) (εικ.15) και της DNA λιγάσης T4. ii. Ανάμιξη των αντιδραστηρίων για την αντίδραση σύνδεσης σύμφωνα με τον πίνακα 5 iii. Ανάμιξη και επώαση overnight στους 4 C Πίνακας 5. Συστατικά της αντίδρασης σύνδεσης του προϊόντος PCR με τον πλασμιδιακό φορέα Συστατικό αντίδρασης Όγκος 2X Rapid Ligation Buffer pgem-t Easy Vector Προϊόν PCR T4 DNA λιγάση H 2 O Σύνολο 5 μl 1 μl 100 ng 1 μl 3 μl 10 μl

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

6 CO 2 + 6H 2 O C 6 Η 12 O 6 + 6 O2

6 CO 2 + 6H 2 O C 6 Η 12 O 6 + 6 O2 78 ΠΑΡΑΓΩΓΙΚΟΤΗΤΑ ΥΔΑΤΙΝΩΝ ΟΙΚΟΣΥΣΤΗΜΑΤΩΝ ΦΥΤΙΚΟΙ ΟΡΓΑΝΙΣΜΟΙ (μακροφύκη φυτοπλαγκτόν) ΠΡΩΤΟΓΕΝΕΙΣ ΠAΡΑΓΩΓΟΙ ( μετατρέπουν ανόργανα συστατικά σε οργανικές ενώσεις ) φωτοσύνθεση 6 CO 2 + 6H 2 O C 6 Η 12

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ - ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΑΣ ΦΥΤΩΝ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ - ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΑΣ ΦΥΤΩΝ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ - ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΑΣ ΦΥΤΩΝ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ: ΟΙΚΟΛΟΓΙΑ-ΔΙΑΧΕΙΡΙΣΗ & ΠΡΟΣΤΑΣΙΑ ΦΥΣΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Διατριβή Μεταπτυχιακού Διπλώματος Ειδίκευσης

Διαβάστε περισσότερα

Ποιοτικά Χαρακτηριστικά Λυµάτων

Ποιοτικά Χαρακτηριστικά Λυµάτων Ποιοτικά Χαρακτηριστικά Λυµάτων µπορούν να καταταχθούν σε τρεις κατηγορίες: Φυσικά Χηµικά Βιολογικά. Πολλές από τις παραµέτρους που ανήκουν στις κατηγορίες αυτές αλληλεξαρτώνται π.χ. η θερµοκρασία που

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr OΙΚΟΛΟΓΙΑ 1. Όσο το ποσό της ενέργειας: α) μειώνεται προς τα ανώτερα

Διαβάστε περισσότερα

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια Τεχνικές διεργασίες Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια ΓΕΩΡΓΙΑ Γενετική βελτίωση ποικιλιών φυτών για αντοχή στις ασθένειες, ξηρασία, αφιλόξενα εδάφη Μαζική παραγωγή κλώνων Ανάπτυξη βιο-εντομοκτόνων

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Η ΡΥΠΑΝΣΗ ΤΟΥ ΝΕΡΟΥ. Σοφοκλής Λογιάδης

Η ΡΥΠΑΝΣΗ ΤΟΥ ΝΕΡΟΥ. Σοφοκλής Λογιάδης Η ΡΥΠΑΝΣΗ ΤΟΥ ΝΕΡΟΥ Σοφοκλής Λογιάδης Τι ειναι ρυπανση του νερου -ορισμος Το νερό είναι η πηγή ζωής στον πλανήτη μας. Περίπου το 70% της επιφάνειας του σκεπάζεται με νερό. Από το συνολικό διαθέσιμο νερό

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΘΑΛΑΣΣΙΑ ΡΥΠΑΝΣΗ ΣΤΟΝ ΚΟΛΠΟ ΤΗΣ ΕΛΕΥΣΙΝΑΣ. Μ.Δασενάκης ΣΥΛΛΟΓΟΣ ΕΛΛΗΝΩΝ

ΘΑΛΑΣΣΙΑ ΡΥΠΑΝΣΗ ΣΤΟΝ ΚΟΛΠΟ ΤΗΣ ΕΛΕΥΣΙΝΑΣ. Μ.Δασενάκης ΣΥΛΛΟΓΟΣ ΕΛΛΗΝΩΝ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ, ΤΜΗΜΑ ΧΗΜΕΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΧΗΜΕΙΑΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΘΑΛΑΣΣΙΑ ΡΥΠΑΝΣΗ ΣΤΟΝ ΚΟΛΠΟ ΤΗΣ ΕΛΕΥΣΙΝΑΣ Μ.Δασενάκης ΣΥΛΛΟΓΟΣ ΕΛΛΗΝΩΝ Ο ΣΑΡΩΝΙΚΟΣ ΚΟΛΠΟΣ Επιφάνεια: 2600 km 2 Μέγιστο βάθος: 450 m

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Προσδιορισμός φυσικοχημικών παραμέτρων υγρών αποβλήτων και υδάτων

Προσδιορισμός φυσικοχημικών παραμέτρων υγρών αποβλήτων και υδάτων Προσδιορισμός φυσικοχημικών παραμέτρων υγρών αποβλήτων και υδάτων (DO - BOD - COD - TOC) Χ. Βασιλάτος Οργανική ύλη Αποξυγόνωση επιφανειακών και υπογείων υδάτων Οι οργανικές ύλες αποτελούν πολύ σοβαρό ρύπο,

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Να συμπληρωθεί το παρακάτω φυλλάδιο με βάση τις οδηγίες σε κάθε θέμα. Να απαντήσετε σε όλες τις ερωτήσεις. Σας ευχόμαστε επιτυχία!

Να συμπληρωθεί το παρακάτω φυλλάδιο με βάση τις οδηγίες σε κάθε θέμα. Να απαντήσετε σε όλες τις ερωτήσεις. Σας ευχόμαστε επιτυχία! Διαγώνισμα ΒΙΟΛΟΓΙΑΣ Γενικής Παιδείας ΗΜΕΡΟΜΗΝΙΑ 15/3/2015 Να συμπληρωθεί το παρακάτω φυλλάδιο με βάση τις οδηγίες σε κάθε θέμα. Να απαντήσετε σε όλες τις ερωτήσεις. Σας ευχόμαστε επιτυχία! ΘΕΜΑ Α Να αντιγράψετε

Διαβάστε περισσότερα

ΦΥΣΙΚΟΧΗΜΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΝΕΡΟΥ

ΦΥΣΙΚΟΧΗΜΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΝΕΡΟΥ ΦΥΣΙΚΟΧΗΜΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΝΕΡΟΥ Η ΡΟΗ ΤΟΥ ΝΕΡΟΥ Η ροή του νερού μεταξύ των άλλων καθορίζει τη ζωή και τις λειτουργίες των έμβιων οργανισμών στο ποτάμι. Διαμορφώνει το σχήμα του σώματός τους, τους

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ Το πρόγραμμα σπουδών του τμήματος Γεωπονικής Βιοτεχνολογίας πρέπει να ανταποκρίνεται στην εξαγωγή επιστημόνων Γεωπόνων Βιοτεχνολόγων ικανών να μελετούν, να αντιμετωπίζουν και να προτείνουν

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Φυσιολογία των μικροοργανισμών. Κεφάλαιο 3 από το βιβλίο «Εισαγωγή στην Γενική Μικροβιολογία»

Φυσιολογία των μικροοργανισμών. Κεφάλαιο 3 από το βιβλίο «Εισαγωγή στην Γενική Μικροβιολογία» Φυσιολογία των μικροοργανισμών Κεφάλαιο 3 από το βιβλίο «Εισαγωγή στην Γενική Μικροβιολογία» BIOΛOΓIA TΩN MIKPOOPΓANIΣMΩN ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ 1. Μικροβιακή αύξηση (ή ανάπτυξη): αυξάνεται ο

Διαβάστε περισσότερα

Ορισμός το. φλψ Στάδια επεξεργασίας λυμάτων ΘΕΜΑ: ΒΙΟΛΟΓΙΚΟΣ ΚΑΘΑΡΙΣΜΟΣ ΣΤΗΝ ΚΩ ΤΙ ΕΙΝΑΙ Ο ΒΙΟΛΟΓΙΚΟΣ ΚΑΘΑΡΙΣΜΟΣ?

Ορισμός το. φλψ Στάδια επεξεργασίας λυμάτων ΘΕΜΑ: ΒΙΟΛΟΓΙΚΟΣ ΚΑΘΑΡΙΣΜΟΣ ΣΤΗΝ ΚΩ ΤΙ ΕΙΝΑΙ Ο ΒΙΟΛΟΓΙΚΟΣ ΚΑΘΑΡΙΣΜΟΣ? ΘΕΜΑ: ΒΙΟΛΟΓΙΚΟΣ ΚΑΘΑΡΙΣΜΟΣ ΣΤΗΝ ΚΩ ΤΙ ΕΙΝΑΙ Ο ΒΙΟΛΟΓΙΚΟΣ ΚΑΘΑΡΙΣΜΟΣ? Ο βιολογικος καθαρισμος αφορα την επεξεργασια λυματων, δηλαδη τη διαδικασια μεσω της οποιας διαχωριζονται οι μολυσματικες ουσιες από

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΚΟΙ ΜΗΧΑΝΙΣΜΟΙ ΥΠΟΒΑΘΜΙΣΗΣ ΤΡΟΦΙΜΩΝ - 2

ΒΙΟΛΟΓΙΚΟΙ ΜΗΧΑΝΙΣΜΟΙ ΥΠΟΒΑΘΜΙΣΗΣ ΤΡΟΦΙΜΩΝ - 2 31-7-14 ΒΙΟΛΟΓΙΚΟΙ ΜΗΧΑΝΙΣΜΟΙ ΥΠΟΒΑΘΜΙΣΗΣ ΤΡΟΦΙΜΩΝ - 2 Στο σχήμα 1 του άρθρου που δημοσιεύσαμε την προηγούμενη φορά φαίνεται η καθοριστικός ρόλος των μικροοργανισμών για την ύπαρξη της ζωής, αφού χωρίς

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ)

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) Ι) ΠΡΟΑΠΑΙΤΟΥΜΕΝΕΣ ΓΝΩΣΕΙΣ ΚΑΙ ΔΕΞΙΟΤΗΤΕΣ Οι μαθητές θα πρέπει : Να γνωρίζουν ποιο μόριο είναι ο φορέας της γενετικής

Διαβάστε περισσότερα

Σύσταση του αυγού Λευκό Κρόκος Βάρος 38 g 17 g Πρωτείνη 3,9 g 2,7 g Υδατάνθρακες 0,3 g 0,3 g Λίπος 0 6 g Χοληστερόλη 0 213 mg

Σύσταση του αυγού Λευκό Κρόκος Βάρος 38 g 17 g Πρωτείνη 3,9 g 2,7 g Υδατάνθρακες 0,3 g 0,3 g Λίπος 0 6 g Χοληστερόλη 0 213 mg Αυγό Τα αυγά αποτελούνται από το κέλυφος (10 %), το ασπράδι ή λευκό (50-60 %), τον κρόκο ή κίτρινο (30 %). Το κέλυφος αποτελείται κατά 95 % από ανόργανα συστατικά όπως ανθρακικό ασβέστιο, ανθρακικό μαγνήσιο

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

ΘΕΜΑ: ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ Δευτέρα, 20 Μαΐου 2013

ΘΕΜΑ: ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ Δευτέρα, 20 Μαΐου 2013 Αθήνα, 20/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Η

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Εργαλεία & Υλικά Διαλύματα Χρωστικές

Εργαλεία & Υλικά Διαλύματα Χρωστικές Ενότητα Ροή γενετικής πληροφορίας Φύλλο εργασίας 2 Απομόνωση νουκλεϊκών οξέων από φυτικά κύτταρα Βιολογία Γ Γυμνασίου Ονοματεπώνυμο Τμήμα Ημερομηνία. Τα νουκλεϊκά οξέα, όπως και οι πρωτεΐνες, είναι μακρομοριακές

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΠΙΜΕΛΕΙΑ: Κ. ΔΗΜΗΤΡΙΟΣ ΤΜΗΜΑ:Β 1 ΚΕΦΑΛΑΙΟ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Είναι γνωστό πως οποιοσδήποτε οργανισμός, για να λειτουργήσει χρειάζεται ενέργεια. Η ενέργεια αυτή βρίσκεται

Διαβάστε περισσότερα

Φοιτητες: Σαμακός Φώτιος Παναγιώτης 7442 Ζάπρης Αδαμάντης 7458

Φοιτητες: Σαμακός Φώτιος Παναγιώτης 7442 Ζάπρης Αδαμάντης 7458 Φοιτητες: Σαμακός Φώτιος Παναγιώτης 7442 Ζάπρης Αδαμάντης 7458 1.ΕΙΣΑΓΩΓΗ 2.ΣΤΟΙΧΕΙΑΡΥΠΑΝΣΗΣ 2.1 ΠΑΘΟΦΟΝΟΙ ΜΙΚΡΟΟΡΓΑΝΙΣΜΟΙ 2.1.1 ΒΑΚΤΗΡΙΑ 2.1.2 ΙΟΙ 2.1.3 ΠΡΩΤΟΖΩΑ 2.2 ΑΝΟΡΓΑΝΕΣ ΚΑΙ ΟΡΓΑΝΙΚΕΣ ΔΙΑΛΥΤΕΣ ΣΤΟ

Διαβάστε περισσότερα

ΑΝΑΚΤΗΣΗ ΦΩΣΦΟΡΟΥ ΑΠΟ ΤΑ ΣΤΡΑΓΓΙΣΜΑΤΑ ΤΗΣ ΑΦΥΔΑΤΩΣΗΣ ΙΛΥΟΣ ΜΕΣΩ ΚΑΤΑΚΡΗΜΝΙΣΗΣ ΣΤΡΟΥΒΙΤΗ

ΑΝΑΚΤΗΣΗ ΦΩΣΦΟΡΟΥ ΑΠΟ ΤΑ ΣΤΡΑΓΓΙΣΜΑΤΑ ΤΗΣ ΑΦΥΔΑΤΩΣΗΣ ΙΛΥΟΣ ΜΕΣΩ ΚΑΤΑΚΡΗΜΝΙΣΗΣ ΣΤΡΟΥΒΙΤΗ ΑΝΑΚΤΗΣΗ ΦΩΣΦΟΡΟΥ ΑΠΟ ΤΑ ΣΤΡΑΓΓΙΣΜΑΤΑ ΤΗΣ ΑΦΥΔΑΤΩΣΗΣ ΙΛΥΟΣ ΜΕΣΩ ΚΑΤΑΚΡΗΜΝΙΣΗΣ ΣΤΡΟΥΒΙΤΗ Αλίκη Κόκκα και Ευάγγελος Διαμαντόπουλος Τμήμα Μηχανικών Περιβάλλοντος Πολυτεχνείο Κρήτης PhoReSe: Ανάκτηση Φωσφόρου

Διαβάστε περισσότερα

Θρεπτικά συστατικά στο θαλάσσιο οικοσύστημα 51. Πηγή: Raven, Berg & Johnson, 1993, σ.486.

Θρεπτικά συστατικά στο θαλάσσιο οικοσύστημα 51. Πηγή: Raven, Berg & Johnson, 1993, σ.486. Θρεπτικά συστατικά στο θαλάσσιο οικοσύστημα 51 Πηγή: Raven, Berg & Johnson, 1993, σ.486. Εικόνα 2. Σχηματική αναπαράσταση της δομής και λειτουργίας εγκατάστασης δευτερογενούς επεξεργασίας λυμάτων. 3. Όμως

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΟΙ ΥΔΡΙΤΕΣ ΚΑΙ Η ΣΗΜΑΣΙΑ ΤΟΥΣ ΩΣ ΚΑΥΣΙΜΗ ΥΛΗ ΤΟΥ ΜΕΛΛΟΝΤΟΣ. ΤΟ ΕΡΕΥΝΗΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ANAXIMANDER. Από Δρ. Κωνσταντίνο Περισοράτη

ΟΙ ΥΔΡΙΤΕΣ ΚΑΙ Η ΣΗΜΑΣΙΑ ΤΟΥΣ ΩΣ ΚΑΥΣΙΜΗ ΥΛΗ ΤΟΥ ΜΕΛΛΟΝΤΟΣ. ΤΟ ΕΡΕΥΝΗΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ANAXIMANDER. Από Δρ. Κωνσταντίνο Περισοράτη ΟΙ ΥΔΡΙΤΕΣ ΚΑΙ Η ΣΗΜΑΣΙΑ ΤΟΥΣ ΩΣ ΚΑΥΣΙΜΗ ΥΛΗ ΤΟΥ ΜΕΛΛΟΝΤΟΣ. ΤΟ ΕΡΕΥΝΗΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ANAXIMANDER Από Δρ. Κωνσταντίνο Περισοράτη Οι υδρίτες (εικ. 1) είναι χημικές ενώσεις που ανήκουν στους κλειθρίτες, δηλαδή

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Εργασία Βιολογίας 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ

Εργασία Βιολογίας 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ Εργασία Βιολογίας Καθηγητής: Πιτσιλαδής Β. Μαθητής: Μ. Νεκτάριος Τάξη: Β'2 Υλικό: Κεφάλαιο 3 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ Την ενέργεια και τα υλικά που οι οργανισμοί εξασφαλίζουν από το περιβάλλον

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

ΔΑΣΙΚΑ & ΥΔΑΤΙΝΑ ΟΙΚΟΣΥΣΤΗΜΑΤΑ ΠΡΟΣΤΑΣΙΑ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗ. ΕΡΓΑΣΤΗΡΙΟ 13/06/2013 Δήμος Βισαλτίας

ΔΑΣΙΚΑ & ΥΔΑΤΙΝΑ ΟΙΚΟΣΥΣΤΗΜΑΤΑ ΠΡΟΣΤΑΣΙΑ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗ. ΕΡΓΑΣΤΗΡΙΟ 13/06/2013 Δήμος Βισαλτίας ΔΑΣΙΚΑ & ΥΔΑΤΙΝΑ ΟΙΚΟΣΥΣΤΗΜΑΤΑ ΠΡΟΣΤΑΣΙΑ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗ ΕΡΓΑΣΤΗΡΙΟ 13/06/2013 Δήμος Βισαλτίας Τί είναι ένα Οικοσύστημα; Ένα οικοσύστημα είναι μια αυτο-συντηρούμενη και αυτορυθμιζόμενη κοινότητα ζώντων

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

Πρόγραμμα Παρακολούθησης Υδάτων Λίμνης Παμβώτιδας. (Lake Pamvotis Water Monitoring Programm) ΑΠΟΤΕΛΕΣΜΑΤΑ

Πρόγραμμα Παρακολούθησης Υδάτων Λίμνης Παμβώτιδας. (Lake Pamvotis Water Monitoring Programm) ΑΠΟΤΕΛΕΣΜΑΤΑ Πρόγραμμα Παρακολούθησης Υδάτων Λίμνης Παμβώτιδας (Lake Pamvotis Water Monitoring Programm) ΑΠΟΤΕΛΕΣΜΑΤΑ ΘΕΡΜΟΚΡΑΣΙΑ Min-Max Επιφάνειας: 7,6 (Φεβ) 28,5 (Ιουλ) Min-Max Πυθμένα: 6,1 (Φεβ) 25,3 (Ιουλ) Jun_Temperature_S3

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι

Μικροβιολογία Τροφίμων Ι Μικροβιολογία Τροφίμων Ι Ενότητα 6: Ενδογενείς Παράγοντες Ενεργότητα Ύδατος (1/2), 2ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Γεώργιος - Ιωάννης Νύχας Ευστάθιος Πανάγου Μαθησιακοί

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ. Βιολογία

Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ. Βιολογία Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ Βιολογία ΘΕΜΑ 1 Στις ερωτήσεις 1 5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ποιο

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος

BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος Ετσι αρχισε η Ζωη? To δεντρο της Ζωης Και τι µας νοιαζει αν υπαρχουν µικροοργανισµοι η οχι? H ανυπολόγιστη αξία της Mικροβιολογίας για τη Βιολογια Το

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Απώλειες των βιταμινών κατά την επεξεργασία των τροφίμων

Απώλειες των βιταμινών κατά την επεξεργασία των τροφίμων Απώλειες των βιταμινών κατά την επεξεργασία των τροφίμων Αποφλοίωση και καθαρισμός Πολλά φυτικά προϊόντα π.χ, μήλα, πατάτες χρειάζονται αποφλοίωση ή καθαρισμό μερικών τμημάτων τους πριν από την κατεργασία.

Διαβάστε περισσότερα

Επιλέξτε τη σωστή απάντηση, βάζοντας σε κύκλο το αντίστοιχο γράμμα:

Επιλέξτε τη σωστή απάντηση, βάζοντας σε κύκλο το αντίστοιχο γράμμα: ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Γ ΛΥΚΕΙΟΥ Κυριακή 10 Οκτωβρίου 2010 ΘΕΜΑ 1 ο: Επιλέξτε τη σωστή απάντηση, βάζοντας σε κύκλο το αντίστοιχο γράμμα: 1. Ανήκουν στους ευκαρυωτικούς οργανισμούς Α. το τοξόπλασμα

Διαβάστε περισσότερα

«Ο ΤΥΠΟΣ ΤΟΥ HIRAYAMA

«Ο ΤΥΠΟΣ ΤΟΥ HIRAYAMA 1 Τ.Ε.Ι. ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΑΛΙΕΙΑΣΥΔΑΤΟΚΑΛΛΙΕΡΓΕΙΩΝ ΜΑΘΗΜΑ: ΥΔΑΤΟΚΑΛΛΙΕΡΓΕΙΕΣ ΙΙ «Ο ΤΥΠΟΣ ΤΟΥ HIRAYAMA 1. ΒΙΟΛΟΓΙΚΟ ΦΙΛΤΡΑΡΙΣΜΑ Τρεις τύποι φιλτραρίσµατος χρησιµοποιούνται στα αυτόνοµα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Αποσάθρωση. Κεφάλαιο 2 ο. ΣΧΗΜΑΤΙΣΜΟΣ ΕΔΑΦΩΝ

Αποσάθρωση. Κεφάλαιο 2 ο. ΣΧΗΜΑΤΙΣΜΟΣ ΕΔΑΦΩΝ Κεφάλαιο 2 ο. ΣΧΗΜΑΤΙΣΜΟΣ ΕΔΑΦΩΝ Αποσάθρωση Ονομάζουμε τις μεταβολές στο μέγεθος, σχήμα και την εσωτερική δομή και χημική σύσταση τις οποίες δέχεται η στερεά φάση του εδάφους με την επίδραση των παραγόντων

Διαβάστε περισσότερα

Κατηγορίες παραγόντων. Μικροβιολογία Τροφίµων. Μικροβιακή αύξηση. Παράγοντες ανάπτυξης. Επίδραση της θερµοκρασίας. Θεµελιώδεις Θερµοκρασίες

Κατηγορίες παραγόντων. Μικροβιολογία Τροφίµων. Μικροβιακή αύξηση. Παράγοντες ανάπτυξης. Επίδραση της θερµοκρασίας. Θεµελιώδεις Θερµοκρασίες Κατηγορίες παραγόντων Μικροβιολογία Τροφίµων Παράγοντες που επηρεάζουν την ανάπτυξη και την επιβίωση των µικροοργανισµών στα τρόφιµα. Η ανάπτυξη και η επιβίωση των µικροοργανισµών στα τρόφιµα εξαρτάται

Διαβάστε περισσότερα

ΠΙΛΟΤΙΚΟ ΣΥΣΤΗΜΑ ΠΑΡΑΚΟΛΟΥΘΗΣΗΣ ΔΙΑΣΥΝΟΡΙΑΚΗΣ ΛΕΚΑΝΗΣ ΠΟΤΑΜΟΥ ΝΕΣΤΟΥ

ΠΙΛΟΤΙΚΟ ΣΥΣΤΗΜΑ ΠΑΡΑΚΟΛΟΥΘΗΣΗΣ ΔΙΑΣΥΝΟΡΙΑΚΗΣ ΛΕΚΑΝΗΣ ΠΟΤΑΜΟΥ ΝΕΣΤΟΥ INTERREG IIIA / PHARE CBC ΕΛΛΑΔΑ ΒΟΥΛΓΑΡΙΑ: ΠΙΛΟΤΙΚΟ ΣΥΣΤΗΜΑ ΠΑΡΑΚΟΛΟΥΘΗΣΗΣ ΔΙΑΣΥΝΟΡΙΑΚΗΣ ΛΕΚΑΝΗΣ ΠΟΤΑΜΟΥ ΝΕΣΤΟΥ Καθηγητής Βασίλειος A. Τσιχριντζής Διευθυντής, Εργαστήριο Οικολογικής Μηχανικής και Τεχνολογίας

Διαβάστε περισσότερα

Εξάτμιση και Διαπνοή

Εξάτμιση και Διαπνοή Εξάτμιση και Διαπνοή Εξάτμιση, Διαπνοή Πραγματική και δυνητική εξατμισοδιαπνοή Μέθοδοι εκτίμησης της εξάτμισης από υδάτινες επιφάνειες Μέθοδοι εκτίμησης της δυνητικής και πραγματικής εξατμισοδιαπνοής (ΕΤ)

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμο καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Μεζούρες (λευκό καπάκι) Μαρκαδόρος

Μεζούρες (λευκό καπάκι) Μαρκαδόρος 1. Κυτταρική αναπνοή στο μύκητα Saccharomyces cerevisiae. 2. Παράγοντες που επηρεάζουν το ρυθμό της ανάπτυξης και της κυτταρικής αναπνοής του μύκητα. 3. Μικροσκοπική παρατήρηση του μύκητα και της αναπαραγωγής

Διαβάστε περισσότερα

ΙΑΜΟΡΙΑΚΕΣ ΥΝΑΜΕΙΣ ΚΑΤΑΣΤΑΣΕΙΣ ΤΗΣ ΥΛΗΣ ΠΡΟΣΘΕΤΙΚΕΣ Ι ΙΟΤΗΤΕΣ

ΙΑΜΟΡΙΑΚΕΣ ΥΝΑΜΕΙΣ ΚΑΤΑΣΤΑΣΕΙΣ ΤΗΣ ΥΛΗΣ ΠΡΟΣΘΕΤΙΚΕΣ Ι ΙΟΤΗΤΕΣ ΙΑΜΟΡΙΑΚΕΣ ΥΝΑΜΕΙΣ ΚΑΤΑΣΤΑΣΕΙΣ ΤΗΣ ΥΛΗΣ ΠΡΟΣΘΕΤΙΚΕΣ Ι ΙΟΤΗΤΕΣ εσµός Υδρογόνου 1) Τι ονοµάζεται δεσµός υδρογόνου; εσµός ή γέφυρα υδρογόνου : είναι µια ειδική περίπτωση διαµοριακού δεσµού διπόλου-διπόλου,

Διαβάστε περισσότερα

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων ΑΝΑΚΟΙΝΩΣΗ Από το Τμήμα Ιατρικής ανακοινώνεται ότι για το ακαδημαϊκό έτος 2014-2015 στο Τμήμα Ιατρικής κατατάσσονται : Οι πτυχιούχου Πανεπιστημίου, Τ.Ε.Ι. ή ισοτίμων προς αυτά, Α.ΣΠΑΙ.Τ.Ε., της Ελλάδος

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΠΑΡΕΧΟΜΕΝΕΣ ΥΠΗΡΕΣΙΕΣ ΕΡΓΑΣΤΗΡΙΟΥ ΥΓΙΕΙΝΗΣ & ΕΠΙΔΗΜΙΟΛΟΓΙΑΣ

ΠΑΡΕΧΟΜΕΝΕΣ ΥΠΗΡΕΣΙΕΣ ΕΡΓΑΣΤΗΡΙΟΥ ΥΓΙΕΙΝΗΣ & ΕΠΙΔΗΜΙΟΛΟΓΙΑΣ Π Α Ν ΕΕ Π ΙΙ ΣΣ ΤΤ Η Μ ΙΙ Ο Θ ΕΕ ΣΣ ΣΣ Α Λ ΙΙ Α ΣΣ ΣΣ ΧΧ ΟΟ ΛΛ ΗΗ ΕΕ ΠΠ ΙΙ ΣΣ ΤΤ ΗΗ ΜΜ ΩΩ ΝΝ ΥΥ ΓΓ ΕΕ ΙΙ ΑΑ ΣΣ ΤΤ Μ Η Μ Α ΙΙ Α ΤΤ Ρ ΙΙ Κ Η ΣΣ ΕΡΓΑΣΤΗΡΙΟ ΥΓΙΕΙΝΗΣ & ΕΠΙΔΗΜΙΟΛΟΓΙΑΣ ΠΑΡΕΧΟΜΕΝΕΣ ΥΠΗΡΕΣΙΕΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΚΕΣ ΙΔΙΟΤΗΤΕΣ ΤΩΝ ΔΑΣΙΚΩΝ

ΒΙΟΛΟΓΙΚΕΣ ΙΔΙΟΤΗΤΕΣ ΤΩΝ ΔΑΣΙΚΩΝ ΒΙΟΛΟΓΙΚΕΣ ΙΔΙΟΤΗΤΕΣ ΤΩΝ ΔΑΣΙΚΩΝ ΕΔΑΦΩΝ Οργανική ουσία Αποτελείται από πολύπλοκες ενώσεις οι οποίες παράγονται από τα υπολείμματα των φυτικών και ζωικών οργανισμών, με την επίδραση βιολογικών, χημικών

Διαβάστε περισσότερα

DANAHER. DANAHER το 1999.

DANAHER. DANAHER το 1999. HACH LANGE Η συνεργασία δύο κορυφαίων οικογενειακών επιχειρήσεων που ακόµη µεγαλώνει!!! Ιδρύθηκε το 1942 από τους Clifford και Kathryn Hach στην Αϊόβα, στις Η.Π.Α. Ιδρύθηκε το 1933 από τον Dr Bruno Lange

Διαβάστε περισσότερα

Η οδηγία για τα νερά κολύμβησης και η επίδραση της μυδοκαλλιέργειας στην ποιότητα νερών του Θερμαϊκού κόλπου (Βόρειο. Αιγαίο)

Η οδηγία για τα νερά κολύμβησης και η επίδραση της μυδοκαλλιέργειας στην ποιότητα νερών του Θερμαϊκού κόλπου (Βόρειο. Αιγαίο) Η οδηγία για τα νερά κολύμβησης και η επίδραση της μυδοκαλλιέργειας στην ποιότητα νερών του Θερμαϊκού κόλπου (Βόρειο Αιγαίο) Δρ. Σοφία Γαληνού-Μητσούδη Αλεξάνδρειο ΤΕΙ Θεσσαλονίκης Τμήμα Τεχνολογίας Αλιείας

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΤΡΟΦΙΚΑ ΠΛΕΓΜΑΤΑ-ΑΛΥΣΙΔΕΣ-ΠΥΡΑΜΙΔΕΣ 1. Αντλώντας στοιχεία από το διπλανό τροφικό πλέγμα να βρεθούν τα εξής: α. Πόσες και ποιες τροφικές αλυσίδες δημιουργούνται;

Διαβάστε περισσότερα

Περιβαλλοντική Διαχείριση Εκβολών & Παράκτιας Ζώνης π. Νέστου

Περιβαλλοντική Διαχείριση Εκβολών & Παράκτιας Ζώνης π. Νέστου Περιβαλλοντική Διαχείριση Εκβολών & Παράκτιας Ζώνης π. Νέστου Γ. Συλαίος 1, Ν. Καμίδης 1,2, & Β. Τσιχριντζής 1 1 Εργαστήριο Οικολογικής Μηχανικής & Τεχνολογίας, Τμήμα Μηχανικών Περιβάλλοντος, Δημοκρίτειο

Διαβάστε περισσότερα

Σύντομη περιγραφή του πειράματος

Σύντομη περιγραφή του πειράματος Σύντομη περιγραφή του πειράματος Παρασκευή διαλυμάτων ορισμένης περιεκτικότητας και συγκέντρωσης, καθώς επίσης και παρασκευή διαλυμάτων συγκεκριμένης συγκέντρωσης από διαλύματα μεγαλύτερης συγκέντρωσης

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ).

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Αθήνα, 20/5/2015 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Γενικής Παιδείας των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδας Β ). Η

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ 2η έκδοση βιολογία Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ περιεχόμενα Κεφάλαιο 1 Το γενετικό υλικό...13 Κεφάλαιο 2 Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας... 65 Κεφάλαιο 3 Ιοί...127

Διαβάστε περισσότερα

Δρ. Θ.Γ.ΣΩΤΗΡΟΥΔΗΣ Ινστιτούτο Βιολογίας, Φαρμακευτικής Χημείας και Βιοτεχνολογίας, Εθνικό Ίδρυμα Ερευνών, Αθήνα

Δρ. Θ.Γ.ΣΩΤΗΡΟΥΔΗΣ Ινστιτούτο Βιολογίας, Φαρμακευτικής Χημείας και Βιοτεχνολογίας, Εθνικό Ίδρυμα Ερευνών, Αθήνα To μικροφύκος Σπειρουλίνα (Αρθροσπείρα) : Ένα «πράσινο εργοστάσιο» παραγωγής πολύτιμων ουσιών με δυνητικά οφέλη για την ανθρώπινη υγεία Δρ. Θ.Γ.ΣΩΤΗΡΟΥΔΗΣ Ινστιτούτο Βιολογίας, Φαρμακευτικής Χημείας και

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ 3η εξεταστική περίοδος από 29/03/15 έως 19/04/15 γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητής: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Ανακαλύπτοντας τον μικρόκοσμο των ζωντανών οργανισμών

Ανακαλύπτοντας τον μικρόκοσμο των ζωντανών οργανισμών Μυστήριο στο σχολείο Πέπλο μυστηρίου καλύπτει τη μαζική απουσία μαθητών/τριών από το σχολείο. Ιδιαίτερα, τα τμήματα Α8 και Γ9 έχουν, σχεδόν αδειάσει. Μη φανταστείτε ότι άρχισαν να απουσιάζουν όλοι ταυτόχρονα.

Διαβάστε περισσότερα

Όσα υγρά απόβλητα μπορούν να επαναχρησιμοποιηθούν, πρέπει να υποστούν

Όσα υγρά απόβλητα μπορούν να επαναχρησιμοποιηθούν, πρέπει να υποστούν 7. Επαναχρησιμοποίηση νερού στο δήμο μας! Όσα υγρά απόβλητα μπορούν να επαναχρησιμοποιηθούν, πρέπει να υποστούν επεξεργασία πριν την επανάχρησή τους. Ο βαθμός επεξεργασίας εξαρτάται από την χρήση για την

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΑΝΙΧΝΕΥΣΗ ΛΙΠΩΝ, ΠΡΩΤΕΪΝΩΝ, ΣΑΚΧΑΡΩΝ ΚΑΙ ΑΜΥΛΟΥ ΣΕ ΤΡΟΦΙΜΑ (άσκηση 10 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος:

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα