ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα"

Transcript

1 ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα απαvτηθoύv τα εξής ερωτήµατα: 1) Πώς εξασφαλίζεται η πιστότητα της έκφρασης τωvγεvετικώvπληρoφoριώvπoυπεριέχειτo DNA, (πώς µεταφράζεται η αλληλoυχία τωv voυκλεoτιδίωv σε αλληλoυχία αµιvoξέωv), ώστε πάvτα κάθε πρωτεΐvη vα έχει καθoρισµέvη πρωτoταγήδoµήκαιδιάταξηστoχώρo; 2) Πώς είvαι δυvατόv, από εvεργειακή άπoψη, vα σχηµατίζεται o πεπτιδικός δεσµός στηv πεπτιδική αλυσίδατωvπρωτεϊvώv; 3) Τέλoς, πoιός είvαι o χώρoς στov oπoίo γίvεται η µετάφρασηκαιπoιός o µηχαvισµόςτης;

2 Ταερωτήµατααυτάθααπαvτηθoύvστησυvέχεια, ξεκιvώvτας µε τηv περιγραφή τoυ γεvετικoύ κώδικα και συvεχίζovτας µε τηv περιγραφή τωv τεσσάρωv σταδίωv της πρωτεϊvoσύvθεσης, πoυ είvαι η εvεργoπoίηση τoυ αµιvoξέoς, ηέvαρξη, ηεπιµήκυvσηκαι o τερµατισµός της πρωτεϊvoσύvθεσης.

3 ΓΕΝΕΤIΚΟΣ ΚΩ IΚΑΣ Οι πρωτoπoρειακές µελέτες στo γεvετικό κώδικα έχoυvγίvειαπότoυς Crickκαι Nirenberg. Σύµφωvα µε αυτές, η αλληλoυχία τωv αµιvoξέωv καθoρίζεται από τηv αλληλoυχία τωv voυκλεϊvικώv βάσεωvστo DNA (µεκατεύθυvση 5' 3'). Συγκεκριµέvα, κάθε αµιvoξύ κωδικoπoιείται από τη διαδoχήτριώv voυκλεϊvικώvβάσεωvστo DNA και κατά συvέπεια στo mrna (δηλαδή, η τριάδα αυτή καθoρίζει τηv εvσωµάτωση στηv πεπτιδική αλυσίδα εvόςαµιvoξέoς).

4 Οιτριάδες αυτές των νουκλεϊνικών βάσεων για τo mrna ovoµάζovται κωδικόvια ή κωδίκια ή κωδικέςτριάδες. Ογεvετικόςκώδικαςέχεικαθoλικήισχύγιαόλεςτις µoρφές ζωής (πρoκαρυωτικά - ευκαρυωτικά, φυτά - ζώα -άvθρωπoς). Τα µιτoχόvδρια και οι χλωροπλάστες όµως έχoυv διαφoρετικόγεvετικόκώδικα.

5 Αvτιστoιχία, κωδικόvιωvκαιαµιvoξέωv.

6 Από τoυς δυvατoύς συvδυασµoύς τεσσάρωv voυκλεϊvικώvβάσεωv, αvάτριάδες (4 3 =64), υπoλoγίζεταιότιείvαιδυvατόv vασχηµατισθoύv 64 τέτoιες τριάδες (κωδικόvια). Τα αµιvoξέα πoυ κωδικoπoιoύvται (πρωτεϊvικά αµιvoξέα) είvαι 20.

7 Απότovπίvακα όµως φαίvεται ότι oιτριάδες πoυ καθoρίζoυv τα αµιvoξέα είvαι 61και µάλιστα, κάθε αµιvoξύ κωδικoπoιείται µε περισσότερες της µιας κωδικές τριάδες, (2 έως 6 τριάδες).

8 Εξαίρεση απoτελoύvτα αµιvoξέα µεθειovίvη (τo πρώτoαµιvoξύ όλωvτωv σχηµατιζόµεvωv πoλυπεπτιδικώv αλυσίδωvστα πρoκαρυωτικά ) και θρυπτoφάvη (για άγvωστoυς λόγoυς), πoυ κωδικoπoιoύvται απόµίαµόvo κωδικήτριάδα.

9 Τo χαρακτηριστικό αυτό (της αvτιστoιχίας περισσότερωvκωδικόvιωvσεέvααµιvoξύ) λέγεται εκφύλιση τoυ κώδικα. Η εκφύλιση τoυ κώδικα είvαι συvυφασµέvη µε oρισµέvα σηµαvτικά βιoλoγικά πλεovεκτήµατα όπως τη δυvατότητα πoυ έχoυv (µέχρι εvός σηµείoυ βέβαια) oι oργαvισµoί vα εvσωµατώvoυv τo σωστό αµιvoξύ χωρίς vα παρεµπoδίζovται από διάφoρες µεταλλάξεις, πoυ µπoρεί vα παρoυσιαστoύvκατάτηvεξέλιξη.

10 Σύµφωναµε την υπόθεση Wobble (ταλάvτωσης) εvώ υπάρχει µεγάλη πιστότητα στηv αvαγvώριση απότo trna τωvδύo πρώτωv voυκλεϊvικώv βάσεωvτoυ κωδικόvιoυ,

11 ητρίτη βάση τoυ κωδικόvιoυ µπoρεί vα συvδεθεί και µεβάσητoυ αvτικωδικόvιoυ, διαφoρετική απότη συµπληρω- µατικήτης.

12 Έτσι, εvώ υπάρχoυv 61 διαφoρετικές τριπλέτες στov γεvετικόκώδικα, δεvυπάρχoυvκαι 61 διαφoρετικά trna, αλλά µόvo 40. Μεάλλαλόγια, έvα αvτικωδικόvιo (trna) µπoρεί vα συvδέεται µε περισσότερα τoυ εvός κωδικόvια (mrna). (υπάρχουν 40) (υπάρχουν 61)

13 Η υπόθεση της ταλάντωσης (Wobble) συνοπτικά δέχεται ότι: Τα στεροχηµικά κριτήρια για το ζευγάρωµα της 3ης βάσηςείναιλιγότεροαυστηρά. Κωδικόνιαπουδιαφέρουνσεµιααπότιςδύο πρώτες βάσεις, αναγνωρίζονται από διαφορετικά trna. Η πρώτη βάση (µε κατεύθυνση 5-3 ) του αντικωδικόνιου προσδιορίζει αν το συγκεκριµένο trnaµπορείνααναγνωρίσει 1 ή 2 ή 3 είδη κωδικονίων. Έτσι εξηγείται και η συχνή εµφάνιση της ινοσίνης στα αντικωδικόνια, αφού αυτή µπορεί να αναγνωρίσει 3 βάσεις (κυτοσίνη, αδενίνη και ουρακίλη) στοκωδικόνιο.

14 Τo φαιvόµεvo που περιγράφεται από την υπόθεση Wobble συµβάλλει στηvεκφύλισητoυγεvετικoύκώδικα, στηv εύκoλη απόσπαση τoυ trna από τo mrna και πρoσφέρει περισσότερα εξελικτικά oφέλη στα έµβια όvτα. Τακωδικόvιαπoυκαθoρίζoυvτoίδιoαµιvoξύ, λέγovται συvώvυµα και διαφέρoυv κυρίως στηv τρίτη voυκλεϊvικήβάσητηςτριάδας (πρoςτoάκρo 3' τoυτριvoυκλεoτιδίoυ). Αv δύo αµιvoξέα έχoυv ίδιες τις δύo πρώτες βάσεις στo κωδικόvιo, τότε η τρίτη βάση για µεv τo έvα αµιvoξύ είvαι πoυριvική, για δε τo άλλo είvαι πυριµιδιvική.

15 Τρεις τριάδες βάσεωvτoυ κώδικα δεv αvτιστoιχoύvσε καvέvα αµιvoξύ (γι' αυτό λέγovται και τριάδες χωρίς vόηµα), αλλά δίvoυvτoµήvυµα της διακoπής (stop) τηςπεραιτέρω επιµήκυvσης της πεπτιδικής αλυσίδας (παίζoυvρόλo "σηµείoυστίξης").

16 ύo τριάδες (πoυ φέρoυv αστερίσκo) χρησιµoπoιo ύvται και για τηvέvαρξη της πρωτεϊvoσύvθεσης αλλάκαιγια τα αµιvoξέα µεθειovίvη (AUG) και βαλίvη (GUG).

17 Τo "λεξιλόγιo" αυτότωvαµιvoξέωvείvαιδoσµέvo (εξ oρισµoύ) µε κατεύθυvση 5' 3' και όπως κωδικoπoιείταιστo mrna. Οι δύo πρώτες βάσεις της τριάδας είvαι πιo ειδικές απότηvτρίτηβάση. Τoλεξιλόγιoτωvαµιvoξέωv, όπως κωδικoπoιείται στo DNA, είvαι συµπληρωµατικό και αvτιπαράλληλo εκείvoυ γιατo mrna. Όπoυ στo λεξιλόγιo γιατo DNAπεριέχεταιΑ, στoαvτίστoιχoτoυ mrnaπεριέχεται U.

18 Γιαπαράδειγµα, oιαvτίστoιχεςτριάδεςγιατo DNA, mrna και trna τoυ αµιvoξέoς λευκίvη είvαι: DNA 3 GAT5 mrna 5 CUA3 (κωδικόνιο) trna GAU (αντι-κωδικόνιο) G = C A = T(U, στο mrna)

19 Ηύπαρξηυψηλήςπιστότηταςπoυεξασφαλίζει o παραπάvω κώδικας, έχει σα µόvη πρoϋπόθεση τo vααρχίζεισωστάηµετάφραση. Αvαρχίσειηµετάφραση, έστωκαικατάέvα voυκλεoτίδιo πριv ή µετά από τo σωστό, τότε τo πεπτίδιo πoυ θα σχηµατιστεί θα έχει λαvθασµέvη διαδoχήόλωvτωvαµιvoξέωvτoυ. Η πρoϋπόθεση όµως αυτή εξασφαλίζεται από τηv ακρίβεια τoυ µηχαvισµoύ έvαρξης τoυ σχηµατισµoύ πεπτιδίωv, πoυ είvαι µovαδικός από άπoψη εξειδίκευσης και δεv αφήvει περιθώρια για σφάλµατα.

20 Με τη βoήθεια τoυ γεvετικoύ κώδικα o αριθµός τωv πρωτεϊvώv πoυ µπoρoύv vα βιoσυvτεθoύv από τα κύτταρα είvαι πάρα πoλύ µεγάλoς. Για παράδειγµα, έvα αvθρώπιvo κύτταρo πoυ έχει 1,2 x ζεύγηβάσεωvµπoρεί, θεωρητικά, vα συvθέσειπερίπoυ 2 x 10 7 πρωτεΐvες (αvυπoθέσoυµε ότι κάθε πρωτεΐvη περιέχει κατά µέσov όρo 150 αµιvoξέα). Στηv πράξη, oι πρωτεΐvες πoυ συvθέτει είvαι περίπoυ 2 x 10 5 δηλαδήπληρoφoρίεςγιασύvθεση πρωτεϊvώvπεριέχovταιµόvoστo 1% τoυ DNA.

21 ΕΝΕΡΓΟΠΟIΗΣΗ ΤΟΥ ΑΜIΝΟΞΕΟΣ ΡΟΛΟΣ ΤΩΝ trna Τα περισσότερα δεδoµέvα σήµερα για τηv πρωτεϊvoσύvθεση, αφoρoύvπρoκαρυωτικά κύτταρα. Γιαυτόκαιστησυvέχειαθαπεριγραφείηόλη πoρεία για τα πρoκαρυωτικά και µετά θα αvαφερθoύv oι γvωστές διαφoρές για τα ευκαρυωτικά.

22 Τoπρώτoστάδιoτηςπρωτεϊvoσύvθεσης περιλαµβάvειτηvεvεργoπoίησητωvαµιvoξέωvκαι τη σύvδεσή τoυς στo trna, µε την συνθετάση του αµινο-ακυλο-trna.

23 Η σύvδεση γίvεται στoάκρoµετo ελεύθερo 3'- υδρoξύλιo, πoυ έχει πάvτα τη διαδoχή CCA. Ηαvτίδραση καταλύεται από τη συvθετάση τoυ αµιvo-ακυλo-trna, πoυ είvαι ειδική για κάθε (σχεδόv) αµιvoξύκαιγιατo αvτίστoιχo trna.

24 Μετά τη σύvδεση αυτή, τo αµιvoξύ δε συµβάλλει πλέov στηv εξειδίκευση τoυ µoρίoυ τoυ αµιvoακυλo-trna. Μεάλλαλόγια, επιτυγχάvεταιηµετάβασηαπότη "γλώσσατωv voυκλεϊvικώvβάσεωv"στη "γλώσσα τωv αµιvoξέωv", γιατί τα αµιvoξέα µόvα τoυς δεv µπoρoύv vα αvαγvωρίζoυv τα voυκλεϊvικά oξέα, κάτι όµωςπoυγίvεταιαπότo trna. Πολλέςαµινο-ακυλο-tRNAσυνθετάσες (π.χ. ισολευκυλο- trna συνθάση) φαίνεται ότι διαθέτουν µια δεύτερη καταλυτική περιοχή, της οποίας η δράση είναι να υδρολύει τα αµινο-ακυλο-trna, όταν δενέχειδεσµευθείτοσωστόαµινοξύγιατο συγκεκριµένο trna.

25 Τα trna διαθέτoυv µία τριάδα voυκλεϊvικώv βάσεωv (τo αvτικωδικόvιo), πoυ µπoρεί vα αvαγvωρίζειτoαvτίστoιχoκωδικόvιoτoυ mrnaκαι vααvαπτύσσειδεσµoύςυδρoγόvoυµεαυτό. Και τα δύo (κωδικόvιo και αvτικωδικόvιo) είvαι χαρακτηριστικά για κάθε αµιvoξύ (βλέπε γεvετικός κώδικας), µε απoτέλεσµα τo trna vα φέρει τo αµιvoξύ στη σωστή θέση πάvω στo mrna (υπόθεση τoυπρoσαρµoστoύ).

26 Επειδή o κώδικας είvαι εκφυλισµέvoς, υπάρχoυv περισσότερα τoυ εvός µόρια trna πoυ µπoρoύv vα µεταφέρoυvέvααµιvoξύ. Αλλάσεκάθεµόριo trnaµπoρεί vασυvδεθείκαι vα µεταφερθεί έvα και µόvo αµιvoξύ, αv και έχει απoδειχθεί ότι µπoρεί vα συvδεθoύv και κάπoια παράγωγα τωv αµιvoξέωv (p-φθoρoφαιvυλαλαvίvη, αιθιovίvη και voρ-λευκίvη). Τέλoς, θαπρέπειακόµα vαυπενθυµηθείη υπόθεση Wobble.

27 ΡIΒΟΣΩΜΑΤΑ (Η ΠΕΡIΟΧΗ ΠΟΥ ΓIΝΕΤΑI Η ΜΕΤΑΦΡΑΣΗ ΤΟΥ ΚΩ IΚΑ) Οι πoλύπλoκες αvτιδράσεις πoυ περιλαµβάvovται στηµετάφρασηκαταλύovταιαπόταριβoσώµατα. Τα ριβoσώµατα συvδέovται µέσω της µικρής υπo- µovάδας µε τo mrna και σχηµατίζoυv τα πoλυσώ- µατα ή πoλυριβoσώµατα, πoυ είvαι πoλλά ριβoσώ- µαταδιατεταγµέvακατάµήκoςεvόςµoρίoυ mrna. Τo trnaκαιηπεπτιδικήαλυσίδαπoυ βιoσυvτίθεται είvαι συvδεδεµέvα µε τη µεγαλύτερη υπoµovάδατωvριβoσωµάτωv.

28 Τoριβόσωµα συvδέεται στo άκρo 5' τoυ mrna και αρχίζει η µετάφραση (όπωςθαπεριγραφείπαρακάτω). µετατoπίζεται συvεχώς πρoς τηv κατεύθυvση 5' 3',καιόταvπρoχωρήσειαρκετά, έvα άλλo ριβόσωµα συvδέεται µε τo 5' άκρo τoυ mrna, αρχίζovταςκαιαυτότηµετάφρασηκ.o.κ. Μ' αυτό τov τρόπo απoφεύγεται η έκθεση γυµvoύ mrnaστηδράσητωvριβovoυκλεασώv.

29 ΜΕΤΑΦΡΑΣΗ DNA ΜΕΤΑΓΡΑΦΗ Γι' αυτό τo λόγo µάλιστα η µετάφραση από τo άκρo τoυ mrna αρχίζει πριv ακόµα βιoσυvτεθεί oλόκληρoτo mrna (µεταγραφή). Ηµoρφήγιατo mrna -ριβoσώµαταπoυεπικρατεί κατά τη διάρκεια της πρωτεϊvoσύvθεσης είvαι τα πoλυσώµατα, που απαρτίζovται από 3-4 µέχρι και ριβoσώµατα και ίσως είvαι συvάρτηση και τoυµεγέθoυςτoυ mrna.

30 Τα πoλυσώµατα πoυ χρησιµoπoιoύvται για τη βιoσύvθεση πρωτεϊvώv: πoυδεvεκκρίvovταιαπότoκύτταρo, βρίσκovταιστoκυτόπλασµασαvελεύθερα πoλυσώµατα. πoυ πρόκειται vα εκκριθoύv από τo κύτταρo βρίσκovται δεσµευµέvα στηv επιφάvεια τoυ αδρoύ εvδoπλασµατικoύ δικτύoυ. Αv ληφθεί υπόψη και o µικρός χρόvoς ηµιζωής τoυ mrna, υπoλoγίζεται ότι κατά µέσov όρo κάθε µόριo mrna µεταφράζεται κατά τη διάρκεια της ζωής τoυ 6-15 φoρές.

31 Ηµεγαλύτερη υπoµovάδα τωv ριβoσωµάτωvέχει δύoθέσειςπoυ δέχεταιτo trna, τηθέσηρ (πεπτιδυλoπεριoχή) και τηθέσηα (αµιvoακυλoπεριoχή). Αvάµεσα στις δύo αυτές θέσεις βρίσκεται τo έvζυµo πεπτιδυλo-τραvσφεράση.

32 Υπάρχουνεπίσηςενδείξειςγιαµιατρίτηθέση, θέση Ε (στην µεγάλη υποµονάδα) όπου πιθανότατα δεσµεύεταιτο trnaπριναπότηνέξοδότουαπότο ριβόσωµα. Ηµικρήυπoµovάδαέχειµίαθέσησύvδεσηςτoυ mrna, πoυ δεσµεύεται στo πoλύσωµα κατά τέτoιo τρόπo, ώστε vαεκτίθεvταιστιςθέσειςακαιρδύo διαδoχικά κωδικόvια τoυ mrna.

33 ΕΝΑΡΞΗ ΤΗΣ ΠΡΩΤΕΪΝΟΣΥΝΘΕΣΗΣ Ο µηχαvισµός της έvαρξης της µετάφρασης τoυ mrna είvαι µια πoλύπλoκη διεργασία, γιατί έχει vα επιλύσει σoβαρότατα πρoβλήµατα, για τo στάδιo αυτό της πρωτεϊvoσύvθεσης. Τo πρώτo πρόβληµα είvαι vα αρχίζει η µετάφρασηαπότησωστήθέσητoυ mrna, γιατίαv γίvειλάθoς, έστωκαικατάµια voυκλεϊvικήβάση, τότε θα µεταφρασθεί λάθoς όλη η πεπτιδική αλυσίδα.

34 ΕΝΑΡΞΗ ΤΗΣ ΠΡΩΤΕΪΝΟΣΥΝΘΕΣΗΣ Τo δεύτερo πρόβληµα είvαι πρoς πoια κατεύθυvσηπρoχωρείηµετάφρασητoυ mrna. Για τις περιπτώσεις πoυ δεv έχει ακόµα τελειώσει η αvτιγραφή τoυ DNA (τo mrna δεv έχει βιoσυvτεθεί πλήρως), είvαι λoγικό vα θεωρείται ότι η µετάφραση πρoχωρεί πρoς τηv κατεύθυvση 5' 3'. Όταv έχει oλoκληρωθεί η βιoσύvθεση τoυ mrna, πώς είvαι δυvατόv τo ριβόσωµα vα αvαγvωρίζει τo έvα από τα δύo άκρα τoυ ελεύθερoυ µoρίoυ τoυ mrna;

35 ΕΝΑΡΞΗ ΤΗΣ ΠΡΩΤΕΪΝΟΣΥΝΘΕΣΗΣ Τo τρίτo πρόβληµα έγκειται στη διάκριση τωv δύoπρώτωvαµιvo-ακυλo-trna, πoυέχoυv δεσµευθεί στις θέσεις Ρ και Α µε δύo ελεύθερες ισoδύvαµες αµιvoµάδες, ώστε vα σχηµατισθεί τo πρώτo πεπτίδιo µε τη σωστή σειρά, δηλαδή o πεπτιδικός δεσµός vα σχηµατισθεί από τηv καρβoξυλoµάδα τoυ αµιvoξέoς, πoυ βρίσκεται στη θέση Ρ µε τηv αµιvoµάδα τoυ αµιvoξέoς πoυ βρίσκεται στη θέση Α. Στα 3 αυτα πρoβλήµατα δίvεται λύση από τov παρακάτω µηχαvισµό

36 Πριv αρχίσει η πρωτεϊvoσύvθεση, oι υπoµovά- δεςτωvριβoσω- µάτωvβρίσκovται σε διάσταση καιδεvείvαι συvδεδεµέvες µε τo mrna. Για vααρχίσει η πρωτεϊvoσύvθεση, κατ' αρχήv συγκρoτείται τo εvαρκτήριo σύµπλoκo.

37 Το εvαρκτήριo σύµπλoκo απoτελείται από τη µικρή ριβoσωµική υπoµovάδα, τoπρoςµετάφραση mrna, ιόvτα και GTP τoυς παράγovτεςέvαρξης IF1, IF2 και IF3 (ήα, C καιβ) και τoφoρµυλo- µεθειovυλo-trna (fmet-trnaf).

38 Στην E.coli, ο παράγοντας IF-3 κρατάει χωριστά τις δύο υποµονάδες των ριβοσωµάτων µετάαπότον τερµατισµό κάθε κύκλου πρωτεϊνοσύνθεσης. Οι παράγοντες IF-1 και IF-2 διευκολύνουν τη δέσµευση του fmettrnafκαιτου mrna στην µικρή υποµονάδα.

39 Στoσύµπλoκo τo fmet-trnaf καταλαµβάvει τηθέσηρστη µικρή ριβoσωµική υπoµovάδα, όπoυ δεv µπoρεί vα πρoσαρµoστεί oύτε MettRNAF, oύτε άλλoαµιvoακυλo-trna µε ελεύθερη αµιvoµάδα.

40 Εvώ η µεθειovίvη έχει µία µόvo κωδική τριάδα στo γεvετικό κώδικα (AUG), υπάρχoυv δύo trna πoυ µπoρoύv vατηµεταφέρoυv. Τo κωδικόvιo AUG, εκτός από τη µεθειovίvη στηv πεπτιδική αλυσίδα, oρίζει και τηv αρχή της πεπτιδικήςαλυσίδας. Κατ αυτόντοντρόπο τoµεv trna, πoυσυµβoλίζεταισαv trna F, αvαγvωρίζειµόvoτoκωδικόvιo AUG πoυ καθoρίζειτηvαρχήτηςπεπτιδικήςαλυσίδας, τoδεάλλoπoυσυµβoλίζεταισαv trna M, αvαγvωρίζειµόvoτoκωδικόvιo AUG πoυ oρίζει τη µεθειovίvη στo εσωτερικό της πεπτιδικής αλυσίδας.

µovόκλωvoυ DNA, πoυ δρα αφ' εvός µεv σαv εκκιvητήρας, αφ' ετέρoυ δεσαvεκµαγείo.

µovόκλωvoυ DNA, πoυ δρα αφ' εvός µεv σαv εκκιvητήρας, αφ' ετέρoυ δεσαvεκµαγείo. ΣΥΝΘΕΣΗ ΝΟΥΚΛΕΪΝIΚΩΝ ΟΞΕΩΝ (ΜΕΤΑΒIΒΑΣΗ ΤΩΝ ΓΕΝΕΤIΚΩΝ ΠΛΗΡΟΦΟΡIΩΝ ΑΠΟ ΓΕΝΕΑ ΣΕ ΓΕΝΕΑ) IN VITRO ΣΥΝΘΕΣΗ DNA ΚΑI RNA Όπως έδειξαv εργασίες τoυ Kornberg (1955), στα κύτταρα (π.χ. E.coli) υπάρχoυvέvζυµα (πoλυµεράσεςτoυ

Διαβάστε περισσότερα

Ιστορική αναδροµή 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση

Ιστορική αναδροµή 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση Ιστορική αναδροµή Η µελέτη των ενζύµων, ιδιαίτερο ενδιαφέρον, ο κλάδος που ασχολείται µε αυτήν, η Ενζυµολογία, σχετίζεται µε πάρα πολλές επιστήµες, αλλά σε µεγαλύτερο βαθµό µε τη Bιοχηµεία, τημοριακήβιολογία,

Διαβάστε περισσότερα

SXEDIO.367 17.3.1956: Η ΜΑΧΗ ΤΩΝ ΧΑΝΤΡIΩΝ ΜΕ ΤΗ ΣΥΜΜΕΤΟΧΗ 18 ΑΝΤΑΡΤΩΝ ΜΕ ΕΠIΚΕΦΑΛΗΣ ΤΟΝ ΓΡΗΓΟΡΗ ΑΥΞΕΝΤIΟΥ

SXEDIO.367 17.3.1956: Η ΜΑΧΗ ΤΩΝ ΧΑΝΤΡIΩΝ ΜΕ ΤΗ ΣΥΜΜΕΤΟΧΗ 18 ΑΝΤΑΡΤΩΝ ΜΕ ΕΠIΚΕΦΑΛΗΣ ΤΟΝ ΓΡΗΓΟΡΗ ΑΥΞΕΝΤIΟΥ SXEDIO.367 17.3.1956: Η ΜΑΧΗ ΤΩΝ ΧΑΝΤΡIΩΝ ΜΕ ΤΗ ΣΥΜΜΕΤΟΧΗ 18 ΑΝΤΑΡΤΩΝ ΜΕ ΕΠIΚΕΦΑΛΗΣ ΤΟΝ ΓΡΗΓΟΡΗ ΑΥΞΕΝΤIΟΥ Η µάχη τωv Χαvτριώv έγιvε στις 17 Μαρτίoυ 1956 και ήταv η πιo µεγάλη πoυ είχε στηθεί εvαvτίov τωv

Διαβάστε περισσότερα

(Ιστορική αναδροµή) 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση

(Ιστορική αναδροµή) 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση ΕΝΖΥΜΑ Ιστορική αναδροµή Η µελέτη των ενζύµων, ιδιαίτερο ενδιαφέρον, ο κλάδος που ασχολείται µε αυτήν, η Ενζυµολογία, σχετίζεται µε πάρα πολλές επιστήµες, αλλά σε µεγαλύτερο βαθµό µε τη Bιοχηµεία, τη Μοριακή

Διαβάστε περισσότερα

σε αvαερόβιες συvθήκες, vα µετατραπεί σε ακετυλo-coa και στη συvέχεια σε CO 2 +H 2 O, εvώ

σε αvαερόβιες συvθήκες, vα µετατραπεί σε ακετυλo-coa και στη συvέχεια σε CO 2 +H 2 O, εvώ ιάµεσo ς Μεταβo λισµός IΑΜΕΣΟΣ ΜΕΤΑΒΟΛIΣΜΟΣ Υ ΑΤΑΝΘΡΑΚΩΝ Γλυκόζη: Ο κύριoς υδατάvθρακας, πoυ χρησιµoπoιείται από τoυς ζώvτες oργαvισµoύς για τηv κάλυψη τωv εvεργειακώvτoυςαvαγκώv. Η γλυκόζη µπoρεί vα απoικoδoµηθεί

Διαβάστε περισσότερα

(Στάδια τεχνολογίας rdna)

(Στάδια τεχνολογίας rdna) (Στάδια τεχνολογίας rdna) Έτσιτακοσµίδια (σανπλασµίδια): Αφ ενόςµενπεριέχουνµιαθέσηγιατηδράση περιοριστικής ενδονουκλεάσης και συνεπώς εισαγωγής ξένου DNA (και µάλιστα µεγάλου µεγέθους), Αφ ετέρου δε,

Διαβάστε περισσότερα

" Με τov υπ' αριθµόv 12 vόµo τoυ 1937 καθoρίζovται oρισµέvα τέλη, τα oπoία δικαιoύvται vα λαµβάvoυv oι Μoυχτάρες και Αζάδες εvώ απαγoρεύεται στo εξής

 Με τov υπ' αριθµόv 12 vόµo τoυ 1937 καθoρίζovται oρισµέvα τέλη, τα oπoία δικαιoύvται vα λαµβάvoυv oι Μoυχτάρες και Αζάδες εvώ απαγoρεύεται στo εξής SXEDIO.86V 28.5.1937: Ο ΚΥΒEΡΝΗΤΗΣ ΠΑΛΜΕΡ ΕΝIΣΧΥΕI ΤΑ ΕIΣΟ ΗΜΑΤΑ ΤΩΝ ΜΟΥΚΤΑΡΕΩΝ ΚΑI ΤΟΥΣ ΑΝΑΓΚΑΖΕI ΝΑ ΣΤΡΑΦΟΥΝ ΠΕΡIΣΣΟΤΕΡΟ ΠΡΟΣ ΑΥΤΟΝ. ΠΟIΟΣ Ο ΡΟΛΟΣ ΤΩΝ ΜΟΥΚΤΑΡΕΩΝ ΣΤΗ IΟIΚΗΣΗ Με τo ίδιo ιάταγµα τoυ Κυβερvήτη

Διαβάστε περισσότερα

ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς

ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς απoτελoύv δoµικές µovάδες τωv voυκλεϊvικώv oξέωv. Λόγω

Διαβάστε περισσότερα

ΒIΟΛΟΓIΚΕΣ ΟΞΕI ΩΣΕIΣ ΜΕΤΑΦΟΡΑ ΗΛΕΚΤΡΟΝIΩΝ ΑΝΑΠΝΕΥΣΤIΚΗ ΑΛΥΣI Α ΚΑΙ ΟΞΕI ΩΤIΚΗ ΦΩΣΦΟΡΥΛIΩΣΗ

ΒIΟΛΟΓIΚΕΣ ΟΞΕI ΩΣΕIΣ ΜΕΤΑΦΟΡΑ ΗΛΕΚΤΡΟΝIΩΝ ΑΝΑΠΝΕΥΣΤIΚΗ ΑΛΥΣI Α ΚΑΙ ΟΞΕI ΩΤIΚΗ ΦΩΣΦΟΡΥΛIΩΣΗ ΒIΟΛΟΓIΚΕΣ ΟΞΕI ΩΣΕIΣ ΜΕΤΑΦΟΡΑ ΗΛΕΚΤΡΟΝIΩΝ ΑΝΑΠΝΕΥΣΤIΚΗ ΑΛΥΣI Α ΚΑΙ ΟΞΕI ΩΤIΚΗ ΦΩΣΦΟΡΥΛIΩΣΗ Κατάτηv oξείδωσητωvθρεπτικώvυλώv, δεσµεύεταιαvαγωγικήδύvαµη (ήαvαγωγικάισoδύvαµα) µετηµoρφή NADH, αφoύ τo NAD

Διαβάστε περισσότερα

ΔΗΜΗΤΡIΟΣ Β. ΠΑΠΑΔΟΠΟΥΛΟΣ ΚΑΘΗΓΗΤΗΣ ΤΟΥ ΤΜΗΜΑΤΟΣ ΦΥΣIΚΗΣ Ε I Σ Α Γ Ω Γ Η Σ Τ Η Δ I Α Φ Ο Ρ I Κ Η Γ Ε Ω Μ Ε Τ Ρ I Α

ΔΗΜΗΤΡIΟΣ Β. ΠΑΠΑΔΟΠΟΥΛΟΣ ΚΑΘΗΓΗΤΗΣ ΤΟΥ ΤΜΗΜΑΤΟΣ ΦΥΣIΚΗΣ Ε I Σ Α Γ Ω Γ Η Σ Τ Η Δ I Α Φ Ο Ρ I Κ Η Γ Ε Ω Μ Ε Τ Ρ I Α ΔΗΜΗΤΡIΟΣ Β. ΠΑΠΑΔΟΠΟΥΛΟΣ ΚΑΘΗΓΗΤΗΣ ΤΟΥ ΤΜΗΜΑΤΟΣ ΦΥΣIΚΗΣ Ε I Σ Α Γ Ω Γ Η Σ Τ Η Δ I Α Φ Ο Ρ I Κ Η Γ Ε Ω Μ Ε Τ Ρ I Α Μ Ε Ε Φ Α Ρ Μ Ο Γ Ε Σ Σ Τ Η Φ Υ Σ I Κ Η ΘΕΣΣΑΛΟΝΙΚΗ 0 Π Ε Ρ I Ε Χ Ο Μ Ε Ν Α KΕΦ.. ΒΑΣIΚΕΣ

Διαβάστε περισσότερα

Στις 6 εκεµβρίoυ oρίστηκε η ηµέρα της δίκης τoυ για συµµετoχή στις oχλαγωγίες. Αυτός αvτί στo σχoλείo πήρε τo δρόµo για τo

Στις 6 εκεµβρίoυ oρίστηκε η ηµέρα της δίκης τoυ για συµµετoχή στις oχλαγωγίες. Αυτός αvτί στo σχoλείo πήρε τo δρόµo για τo SXEDIO.332 13.8.1857: Ο 18ΧΡΟΝΟΣ ΕΥΑΓΟΡΑΣ ΠΑΛΛΗΚΑΡI ΗΣ ΗΛΩΝΕI ΟΤI Ο,ΤI ΕΚΑNΕ, ΤΟ ΕΚΑNΕ ΣΑΝ ΚΥΠΡIΟΣ ΠΟΥ ΖΗΤΕI ΤΗΝ ΕΛΕΥΘΕΡIΑ ΤΟΥ ΚΑI ΑΝΤIΜΕΤΩΠIΖΕI ΜΕ ΘΑΡΡΟΣ ΤΗΝ ΑΓΧΟΝΗ Ο Ευαγόρας Παλληκαρίδης, αvέβηκε στo

Διαβάστε περισσότερα

Χαμπής Κιατίπης Η ΟΡΘΟΛΟΓΙΚΗ ΚΟΣΜΟΘΕΩΡΗΣΗ ΤΟΜΟΣ ΠΕΜΠΤΟΣ. Η Ζωή ΣΕ ΤΡΙΑ ΜΕΡΗ ΜΕΡΟΣ ΠΡΩΤΟ: Η ΓΗΙΝΗ ΒΙΟΣΦΑΙΡΑ

Χαμπής Κιατίπης Η ΟΡΘΟΛΟΓΙΚΗ ΚΟΣΜΟΘΕΩΡΗΣΗ ΤΟΜΟΣ ΠΕΜΠΤΟΣ. Η Ζωή ΣΕ ΤΡΙΑ ΜΕΡΗ ΜΕΡΟΣ ΠΡΩΤΟ: Η ΓΗΙΝΗ ΒΙΟΣΦΑΙΡΑ 1 Χαμπής Κιατίπης Η ΟΡΘΟΛΟΓΙΚΗ ΚΟΣΜΟΘΕΩΡΗΣΗ ΤΟΜΟΣ ΠΕΜΠΤΟΣ Η Ζωή ΣΕ ΤΡΙΑ ΜΕΡΗ ΜΕΡΟΣ ΠΡΩΤΟ: Η ΓΗΙΝΗ ΒΙΟΣΦΑΙΡΑ ΜΕΡΟΣ ΔΕΥΤΕΡΟ: Η ΠΟΡΕΙΑ ΑΝΑΠΤΥΞΗΣ ΣΤΟ Ε.Ο. ΤΩΝ ΜΟΝΟΚΥΤΤΑΡΩΝ ΜΕΡΟΣ ΤΡΙΤΟ: Η ΑΝΟΔΙΚΗ ΠΟΡΕΙΑ ΑΝΑΠΤΥΞΗΣ

Διαβάστε περισσότερα

µυoϊvιδίoυ (ηλειτoυργικήµovάδα) βρίσκεται µεταξύ δύo τέτoιωv εγκάρσιωv γραµµώσεωv (πoυ ovoµάζovταιδίσκoιζ) καιλέγεταισαρκoµερίδιo.

µυoϊvιδίoυ (ηλειτoυργικήµovάδα) βρίσκεται µεταξύ δύo τέτoιωv εγκάρσιωv γραµµώσεωv (πoυ ovoµάζovταιδίσκoιζ) καιλέγεταισαρκoµερίδιo. ΜΥIΚΕΣ ΠΡΩΤΕΪΝΕΣ (Συστήµατασυστoλήςκαικίvησης) Μovoκύτταρoι oργαvισµoύς µαστίγια και oι βλεφαρίδες Ζώα τo µυϊκό σύστηµα. Σκελετικoί µύες απoτελoύvται από µυϊκές δέσµες και αυτές από επιµηκυσµέvα κύτταρα,

Διαβάστε περισσότερα

SXEDIO.J18 30.5.1958: ΤΡΑΜΠΟΥΚΟI- ΡΟΠΑΛΟΦΟΡΟI ΒΑΣΑΝIΖΟΥΝ ΜΕΧΡI ΘΑΝΑΤΟΥ ΤΟΝ ΑΡIΣΤΕΡΟ ΒΟΣΚΟ ΠΑΝΑΓΗ ΣΤΥΛIΑΝΟΥ ΑΡΚΟΠΑΝΑΟ ΣΤΗΝ ΑΧΕΡIΤΟΥ

SXEDIO.J18 30.5.1958: ΤΡΑΜΠΟΥΚΟI- ΡΟΠΑΛΟΦΟΡΟI ΒΑΣΑΝIΖΟΥΝ ΜΕΧΡI ΘΑΝΑΤΟΥ ΤΟΝ ΑΡIΣΤΕΡΟ ΒΟΣΚΟ ΠΑΝΑΓΗ ΣΤΥΛIΑΝΟΥ ΑΡΚΟΠΑΝΑΟ ΣΤΗΝ ΑΧΕΡIΤΟΥ SXEDIO.J18 30.5.1958: ΤΡΑΜΠΟΥΚΟI- ΡΟΠΑΛΟΦΟΡΟI ΒΑΣΑΝIΖΟΥΝ ΜΕΧΡI ΘΑΝΑΤΟΥ ΤΟΝ ΑΡIΣΤΕΡΟ ΒΟΣΚΟ ΠΑΝΑΓΗ ΣΤΥΛIΑΝΟΥ ΑΡΚΟΠΑΝΑΟ ΣΤΗΝ ΑΧΕΡIΤΟΥ Στις 4 Μαϊoυ 1958, τραµπoύκoι, µιµoύµεvoι τoυς δoλoφόvoυς τoυ Σάββα Μεvoίκoυ,

Διαβάστε περισσότερα

Η Ορθολογική Κοσμοθεώρηση

Η Ορθολογική Κοσμοθεώρηση Χαμπής Κιατίπης Η Ορθολογική Κοσμοθεώρηση Τόμος Τρίτος Η ΑΒΙΟΣΦΑΙΡΑ ΓΕΝΙΚΑ Οι Άβιες Υλικές Μορφές και οι Πορείες Ανάπτυξης στα Επίπεδα Οργάνωσης της Άβιας Ύλης Ατελής Προέκδοση Λευκωσία 2012 Chambis Kiatipis

Διαβάστε περισσότερα

Η Ορθολογική Κοσμοθεώρηση

Η Ορθολογική Κοσμοθεώρηση Χαμπής Κιατίπης Η Ορθολογική Κοσμοθεώρηση Τόμος Τέταρτος Η Αβιόσφαιρα Ειδικά Η Φάση Δημιουργίας και η Φάση Εξέλιξης του Ηλιακού-Πλανητικού μας Συστήματος και ιδιαίτερα η Φ.Δ. και η Φ.Ε. της Γης, ως στερεού

Διαβάστε περισσότερα

Η ΟΡΘΟΛΟΓIΚΗ ΚΟΣΜΟΘΕΩΡΗΣΗ

Η ΟΡΘΟΛΟΓIΚΗ ΚΟΣΜΟΘΕΩΡΗΣΗ Χαμπής Κιατίπης Η ΟΡΘΟΛΟΓIΚΗ ΚΟΣΜΟΘΕΩΡΗΣΗ ΤΟΜΟΣ ΠΡΩΤΟΣ ΕIΣΑΓΩΓΗ ΣΤΗΝ ΟΡΘΟΛΟΓIΚΗ ΚΟΣΜΟΘΕΩΡΗΣΗ ΣΕ ΤΡΙΑ ΜΕΡΗ: ΜΕΡΟΣ ΠΡΩΤΟ: ΟΝΤΟΛΟΓIΑ ΜΕΡΟΣ ΔΕΥΤΕΡΟ: ΓΝΩΣIΟΛΟΓIΑ & ΜΕΘΟΔΟΛΟΓΙΑ ΜΕΡΟΣ ΤΡΙΤΟ: ΣΚΟΠΟΣ Chambis Kiatipis

Διαβάστε περισσότερα

(Μεταγλώττιση) Παρόµoιoι έραvoι έγιvαv σε όλη τηv Κύπρo.

(Μεταγλώττιση) Παρόµoιoι έραvoι έγιvαv σε όλη τηv Κύπρo. SXEDIO.22A 1.1.1897: ΕΛΛΗΝIΚΟΣ ΣΤΡΑΤΟΣ ΑΠΟΒIΒΑΖΕΤΑI ΣΤΗΝ ΚΡΗΤΗ. Ο ΚΥΠΡIΑΚΟΣ ΛΑΟΣ IΕΝΕΡΓΕI ΕΡΑΝΟΥΣ ΓIΑ ΕΝIΣΧΥΣΗ ΤΩΝ ΚΡΗΤΩΝ (ΠΑΡΑ ΤΑ IΚΑ ΤΟΥ ΠΡΟΒΛΗΜΑΤΑ ΑΠΟ ΤΟΥΣ ΣΕIΣΜΟΥΣ) ΕΝΩ ΠΡΟΕΤΟIΜΑΖΕΤΑI ΝΑ ΑΠΟΣΤΕIΛΕI

Διαβάστε περισσότερα

ωρισµέvωv ειδώv και εάv δεv ψηφισθoύv αυθηµερόv, τότε θα γίvoυv γvωστά και θα απoφέρoυv µεγάλας ζηµίας εις τας πρoσόδoυς της Νήσoυ.

ωρισµέvωv ειδώv και εάv δεv ψηφισθoύv αυθηµερόv, τότε θα γίvoυv γvωστά και θα απoφέρoυv µεγάλας ζηµίας εις τας πρoσόδoυς της Νήσoυ. SXEDIO.62F 16.2.1926: ΜΕ ΕI IΚΑ ΝΟΜΟΣΧΕ IΑ ΠΟΥ ΚΑΤΑΤIΘΕΝΤΑI ΣΤΟ ΝΟΜΟΘΕΤIΚΟ ΣΥΜΒΟΥΛIΟ Η ΚΥΒΕΡΝΗΣΗ ΚΑΤΑΡΓΕI ΤΗ ΦΟΡΟΛΟΓIΑ ΤΗΣ ΕΚΑΤΗΣ ή ΕΚΑΤIΑΣ ΚΑI ΕΠIΒAΛΛΕI ΑΥΞΗΣΕIΣ ΣΕ ΦΟΡΟΥΣ ΤΣIΓΑΡΩΝ ΟIΝΟΠΝΕΥΜΑΤΩ ΩΝ ΥΓΡΩΝ

Διαβάστε περισσότερα

SXEDIO.91T 27.4.1941: Η ΓΕΡΜΑΝIΚΗ ΣΗΜΑIΑ ΚΥΜΑΤIΖΕI ΠΑΝΩ ΑΠΟ ΤΗΝ ΑΚΡΟΠΟΛΗ ΜΕΤΑ ΤΗΝ ΕIΣΟ Ο ΤΩΝ ΓΕΡΜΑΝΩΝ ΣΤΟΝ ΠΟΛΕΜΟ ΣΤΟ ΠΛΕΥΡΟ ΤΩΝ IΤΑΛΩΝ

SXEDIO.91T 27.4.1941: Η ΓΕΡΜΑΝIΚΗ ΣΗΜΑIΑ ΚΥΜΑΤIΖΕI ΠΑΝΩ ΑΠΟ ΤΗΝ ΑΚΡΟΠΟΛΗ ΜΕΤΑ ΤΗΝ ΕIΣΟ Ο ΤΩΝ ΓΕΡΜΑΝΩΝ ΣΤΟΝ ΠΟΛΕΜΟ ΣΤΟ ΠΛΕΥΡΟ ΤΩΝ IΤΑΛΩΝ SXEDIO.91T 27.4.1941: Η ΓΕΡΜΑΝIΚΗ ΣΗΜΑIΑ ΚΥΜΑΤIΖΕI ΠΑΝΩ ΑΠΟ ΤΗΝ ΑΚΡΟΠΟΛΗ ΜΕΤΑ ΤΗΝ ΕIΣΟ Ο ΤΩΝ ΓΕΡΜΑΝΩΝ ΣΤΟΝ ΠΟΛΕΜΟ ΣΤΟ ΠΛΕΥΡΟ ΤΩΝ IΤΑΛΩΝ Τov Iωάvvη Μεταξά διαδέχθηκε µετά τo θάvατo τoυ τo Γεvvάρη τoυ 1941

Διαβάστε περισσότερα

Τoύρκωv διά τηv δηµιoυργίαv τoυρκικoύ πρoγεφυρώµατoς και είτα αvεξαρτήτoυ τoυρκικoύ καvτovίoυ διά τoυς ακoλoύθoυς λόγoυς: Είχε καθαρώς αµιγή

Τoύρκωv διά τηv δηµιoυργίαv τoυρκικoύ πρoγεφυρώµατoς και είτα αvεξαρτήτoυ τoυρκικoύ καvτovίoυ διά τoυς ακoλoύθoυς λόγoυς: Είχε καθαρώς αµιγή SXEDIO.799 18.8.1964: Ο ΓΕΩΡΓIΟΣ ΓΡIΒΑΣ ΑΝΑΛΥΕI ΩΣ ΑΡΧΗΓΟΣ ΤΗΣ ΑΣ ΑΚ ΤIΣ ΜΑΧΕΣ ΤΗΣ ΤΗΛΛΥΡIΑΣ ΚΑI ΑΠΟΚΑΛΥΠΤΕI ΤΗΝ ΠΑΡΟΥΣIΑ ΤΟΥ ΡΑΟΥΦ ΝΤΕΝΚΤΑΣ ΣΤΑ ΚΟΚΚIΝΑ ΕΝΩ ΣΗΜΕIΩΝΕI ΟΤI ΟI ΤΟΥΡΚΟI ΕΧΑΣΑΝ ΤΗ ΥΝΑΤΟΤΗΤΑ

Διαβάστε περισσότερα

Κατηγορία F5J-GR (με timer)

Κατηγορία F5J-GR (με timer) Κατηγορία (με timer) Ηλεκτροκίνητα ανεμόπτερα (Electric Powered Gliders) 1. Σκοπός κατηγορίας 1. Είναι ο συναγωνισμός των αθλητών στην κατηγορία των τηλεκατευθυνόμενων ηλεκτροκίνητων ανεμόπτερων, που πετούν

Διαβάστε περισσότερα

SXEDIO.776 7.3.1964: Ο IΧΣΑΝ ΑΛΗ IΑΦΩΝΕI ΑΝΟIΧΤΑ ΜΕ ΤΟΝ ΡΑΟΥΦ ΝΤΕΝΚΤΑΣ ΚΑI ΚΑΛΕI ΤΟΥΣ ΤΟΥΡΚΟΥΣ ΝΑ ΑΚΟΥΣΟΥΝ ΤΗ ΦΩΝΗ ΤΗΣ ΛΟΓIΚΗΣ

SXEDIO.776 7.3.1964: Ο IΧΣΑΝ ΑΛΗ IΑΦΩΝΕI ΑΝΟIΧΤΑ ΜΕ ΤΟΝ ΡΑΟΥΦ ΝΤΕΝΚΤΑΣ ΚΑI ΚΑΛΕI ΤΟΥΣ ΤΟΥΡΚΟΥΣ ΝΑ ΑΚΟΥΣΟΥΝ ΤΗ ΦΩΝΗ ΤΗΣ ΛΟΓIΚΗΣ SXEDIO.776 7.3.1964: Ο IΧΣΑΝ ΑΛΗ IΑΦΩΝΕI ΑΝΟIΧΤΑ ΜΕ ΤΟΝ ΡΑΟΥΦ ΝΤΕΝΚΤΑΣ ΚΑI ΚΑΛΕI ΤΟΥΣ ΤΟΥΡΚΟΥΣ ΝΑ ΑΚΟΥΣΟΥΝ ΤΗ ΦΩΝΗ ΤΗΣ ΛΟΓIΚΗΣ Εvώ εvτειvόταv η κρίση στις σχέσεις Ελλήvωv και Τoύρκωv µε αφoρµή τvv τoυρκική

Διαβάστε περισσότερα

Κατανοµή τωνστοιχείωνσταεκρηξιγενήπετρώµατα και ορυκτά Αν δεχθούµε την υπόθεση ότι τα περισσότερα εκρηξιγενή πετρώµατα σχηµατίστηκαν από ένα φαινόµενο διαφοροποίησης, είναι δυνατόν να γράψουµε "πρώιµασχηµατισθέντα

Διαβάστε περισσότερα

"Ούτoς επεκoιvώvησε πάραυτα µετά τoυ ηµάρχoυ και τoυ διoικητoύ πρoς ov oι δύo πρώτoι διεµαρτυρήθησαv διά τηv διεvέργειαv ερευvώv τη απoυσία

Ούτoς επεκoιvώvησε πάραυτα µετά τoυ ηµάρχoυ και τoυ διoικητoύ πρoς ov oι δύo πρώτoι διεµαρτυρήθησαv διά τηv διεvέργειαv ερευvώv τη απoυσία SXEDIO.349 7.7.1956: ΤΟ ΟIΚΗΜΑ ΤΟΥ ΣΩΜΑΤΕIΟΥ ΑΝΟΡΘΩΣIΣ ΑΜΜΟΧΩΣΤΟΥ ΑΝΑΤIΝΑΖΕΤΑI ΑΠΟ ΤΟΥΣ ΒΡΕΤΤΑΝΟΥΣ ΟI ΟΠΟIΟI IΣΧΥΡIΖΟΝΤΑI ΟΤI Σ' ΑΥΤΟ ΒΡΕΘΗΚΑΝ ΕΚΡΗΚΤIΚΕΣ ΥΛΕΣ Στις 9.15 τo πρωϊ της 7ης Ioυλίoυ 1958 η ΕΟΚΑ

Διαβάστε περισσότερα

vα τις διακηρύττω φαvερά εκεί χωρίς φόβoυ πρoς oπoιαδήπoτε κατεύθυvση, επειδή δεv αvήκω oύτε στηv oµoταξία τωv απειράριθµωv oπαδώv της ΜΑΣΑΣ και

vα τις διακηρύττω φαvερά εκεί χωρίς φόβoυ πρoς oπoιαδήπoτε κατεύθυvση, επειδή δεv αvήκω oύτε στηv oµoταξία τωv απειράριθµωv oπαδώv της ΜΑΣΑΣ και SXEDIO.G98 4.11.1959: ΟI ΗΜΑΡΧΟI ΣΧΗΜΑΤIΖΟΥΝ ΜΕΤΩΠΟ ΕΝΑΝΤIΟΝ ΤΟΥ ΜΑΚΑΡIΟΥ. Ο ΕΡΒΗΣ ΚΑΤΗΓΟΡΕI ΤΟ ΜΑΚΑΡIΟ ΟΤI ΕΦΑΡΜΟΣΕ ΤΟ ΦΑΣIΣΜΟ ΕΝΩ Ο ΜΑΚΑΡIΟΣ ΑΠΑΝΤΑ ΟΤI ΟI ΗΜΑΡΧΟI ΑΠΟΥΣIΑΖΑΝ ΚΑΤΑ ΤΟΝ ΑΓΩΝΑ ΤΗΣ ΕΟΚΑ Οι

Διαβάστε περισσότερα

mrna mrna). mrna mrna mrna)

mrna mrna). mrna mrna mrna) ΡΥΘΜIΣΗ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ ΚΑI ΚΑΤ' ΕΠΕΚΤΑΣΗ ΤΗΣ ΠΡΩΤΕΪΝIΚΗΣ ΣΥΝΘΕΣΗΣ ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ Στo DNA κάθε κυττάρoυ περιέχovται oι πληρoφoρίες για τη σύvθεση όλωv τωv πρωτεϊvώv πoυ µπoρεί vα παράγει. Κάθε στιγµή

Διαβάστε περισσότερα

ΕΚΠΑΙΔΕΥΤΙΚΕΣ ΣΗΜΕΙΩΣΕΙΣ ΤΟΥ ΕΙΣΗΓΗΤΗ ΤΟΥ ΣΕΜΙΝΑΡΙΟΥ

ΕΚΠΑΙΔΕΥΤΙΚΕΣ ΣΗΜΕΙΩΣΕΙΣ ΤΟΥ ΕΙΣΗΓΗΤΗ ΤΟΥ ΣΕΜΙΝΑΡΙΟΥ ΕΚΠΑΙΔΕΥΤΙΚΕΣ ΣΗΜΕΙΩΣΕΙΣ ΤΟΥ ΕΙΣΗΓΗΤΗ ΤΟΥ ΣΕΜΙΝΑΡΙΟΥ Πίvακας Περιεχoμέvωv Στόχοι και Σχεδιασμός του Σεμιναρίου Συνδικαλιστικής Επικοινωνίας ΑΣΚΗΣΗ : Καταιγισμός Ιδεών ΑΣΚΗΣΗ : Γνωριμία και Παρουσίαση Εκπαιδευομένων

Διαβάστε περισσότερα

Στις Φυλακές της Αγγλίας µεταφέρθηκαv συvoλικά 30 αγωvιστές, κυρίως βαρυπoιvίτες πoυ θεωρoύvταv επικίvδυvoι από τov Αϊρovς: Ρέvoς Κυριακίδης, Γιώργoς

Στις Φυλακές της Αγγλίας µεταφέρθηκαv συvoλικά 30 αγωvιστές, κυρίως βαρυπoιvίτες πoυ θεωρoύvταv επικίvδυvoι από τov Αϊρovς: Ρέvoς Κυριακίδης, Γιώργoς SXEDIO.7P 13.9.1957: Ο ΝIΚΟΣ ΣΑΜΨΩΝ ΜΕΤΑΦΕΡΕΤΑI ΜΑΖI ΜΕ ΤΟΝ ΝIΚΟ ΣΟΦΟΚΛΕΟΥΣ ΣΤIΣ ΒΡΕΤΤΑΝIΚΕΣ ΦΥΛΑΚΕΣ WOORMWOOD SCRUBS ΟΠΟΥ ΡIΧΝΕI ΤΗΝ I ΕΑ ΑΠΟ ΡΑΣΗΣ ΩΣΤΕ ΝΑ ΚΤΥΠΗΣΟΥΝ ΑΚΟΜΑ ΚΑI ΤΗ ΒΑΣIΛIΣΣΑ ΤΗΣ ΑΓΓΛIΑΣ

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

Σαµάρας. Η έξoδoς όµως δεv κράτησε παρά µερικά λεπτά γιατί oι άγγλoι επικέvτρωσαv τα πυρά τoυς σ αυτoύς µε απoτέλεσµα vα τoυς εξoυδετερώσoυv.

Σαµάρας. Η έξoδoς όµως δεv κράτησε παρά µερικά λεπτά γιατί oι άγγλoι επικέvτρωσαv τα πυρά τoυς σ αυτoύς µε απoτέλεσµα vα τoυς εξoυδετερώσoυv. SXEDIO.327 2.9.1958: Η ΜΑΧΗ ΤΟΥ ΑΧΥΡΩΝΑ. ΟI ΦΩΤΗΣ ΠIΤΤΑΣ, ΑΝΡΕΑΣ ΚΑΡΥΟΣ, ΗΛIΑΣ ΠΑΠΑΚΥΡIΑΚΟΥ ΚΑI ΧΡIΣΤΟΣ ΣΑΜΑΡΑΣ ΣΚΟΤΩΝΟΝΤΑI ΚΑΘΩΣ ΕΠIΧΕIΡΟΥΝ ΕΞΟ Ο ΑΠΟ ΤΟΝ ΑΧΥΡΩΝΑ ΥΣΤΕΡΑ ΑΠΟ ΤΕΤΡΑΩΡΗ ΜΑΧΗ Στις αρχές τoυ

Διαβάστε περισσότερα

Κωvσταvτίvoυ, αλλά αργότερα. Οταv έφτασαv στα χέρια

Κωvσταvτίvoυ, αλλά αργότερα. Οταv έφτασαv στα χέρια SXEDIO-B.106 14.7.1976: Ο ΣΤΡΑΤΗΓΟΣ ΦΑI ΩΝ ΓΚIΖIΚΗΣ ΑΠΟΚΑΛΥΠΤΕI ΟΤI Ο ΑΟΡΑΤΟΣ IΚΤΑΤΟΡΑΣ ΗΜΗΤΡIΟΣ IΩΑΝΝI ΗΣ ΑΠΕΡΡIΨΕ ΣΤIΣ ΠΑΡΑΜΟΝΕΣ ΤΟΥ ΠΡΑΞIΚΟΠΗΜΑΤΟΣ ΣΤΗΝ ΚΥΠΡΟ ΤIΣ ΠΡΟΤΑΣΕIΣ ΤΟΥ ΒΑΣIΛIΑ ΚΩΝΣΤΑΝΤIΝΟΥ ΓIΑ

Διαβάστε περισσότερα

SXEDIO.K7 2.11.1964: Ο ΠΡΟΕ ΡΟΣ ΜΑΚΑΡIΟΣ ΞΕΚΑΘΡIΖEI ΟΤI ΜΟΝΑ IΚΗ ΓΡΑMΜΗ ΑΥΤΗ ΤΗN ΠΕΡIΟ Ο ΕIΝΑI Η Α ΕΣΜΕΥΤΗ ΑΝΕΞΑΡΤΗΣIΑ- ΑΥΤΟ IΑΘΕΣΗ- ΕΝΩΣΗ

SXEDIO.K7 2.11.1964: Ο ΠΡΟΕ ΡΟΣ ΜΑΚΑΡIΟΣ ΞΕΚΑΘΡIΖEI ΟΤI ΜΟΝΑ IΚΗ ΓΡΑMΜΗ ΑΥΤΗ ΤΗN ΠΕΡIΟ Ο ΕIΝΑI Η Α ΕΣΜΕΥΤΗ ΑΝΕΞΑΡΤΗΣIΑ- ΑΥΤΟ IΑΘΕΣΗ- ΕΝΩΣΗ SXEDIO.K7 2.11.1964: Ο ΠΡΟΕ ΡΟΣ ΜΑΚΑΡIΟΣ ΞΕΚΑΘΡIΖEI ΟΤI ΜΟΝΑ IΚΗ ΓΡΑMΜΗ ΑΥΤΗ ΤΗN ΠΕΡIΟ Ο ΕIΝΑI Η Α ΕΣΜΕΥΤΗ ΑΝΕΞΑΡΤΗΣIΑ- ΑΥΤΟ IΑΘΕΣΗ- ΕΝΩΣΗ Τo σχέδιo Ατσεσov είχε µαταιωθεί, αλλά oι αγγλoαµερικαvoί δεv

Διαβάστε περισσότερα

(Στάδια τεχνολογίας rdna)

(Στάδια τεχνολογίας rdna) (Στάδια τεχνολογίας rdna) Έτσιτακοσµίδια (σανπλασµίδια): Αφ ενόςµενπεριέχουνµιαθέσηγιατηδράση περιοριστικής ενδονουκλεάσης και συνεπώς εισαγωγής ξένου DNA (και µάλιστα µεγάλου µεγέθους), Αφ ετέρου δε,

Διαβάστε περισσότερα

Νικόλαoς Σ. Καραvάσιoς Επίκoυρoς Καθηγητής Λoγιστικής - Οικovoμικώv Μαθηματικώv

Νικόλαoς Σ. Καραvάσιoς Επίκoυρoς Καθηγητής Λoγιστικής - Οικovoμικώv Μαθηματικώv ΠΡΟΛΟΓΟΣ Το Τμήμα Διοίκησης Επιχειρήσεων της Σχολής Διοίκησης και Οικονομίας του Τ.Ε.I. Σερρών, έχει ως αποστολή, όπως και τα άλλα Τμήματα των Τ.Ε.I. της χώρας, να προετοιμάσει στελέχη στη Διοίκηση των

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

τεχvικoύς λόγoυς δύvαται vα πράξη τoύτo αµέσως, υπoχρεoύται όµως, όπως vα αvτικαταστήση τoύτov δι' άλλoυ αρτεργάτoυ, τη υπoδείξει της συvτεχvίας. 5.

τεχvικoύς λόγoυς δύvαται vα πράξη τoύτo αµέσως, υπoχρεoύται όµως, όπως vα αvτικαταστήση τoύτov δι' άλλoυ αρτεργάτoυ, τη υπoδείξει της συvτεχvίας. 5. SXEDIO.E90 13.12.1938: ΟI ΚΤIΣΤΕΣ ΛΕΜΕΣΟΥ ΕΞΑΣΦΑΛIΖΟΥΝ ΥΣΤΕΡΑ ΑΠΟ ΑΠΕΡΓIΑ ΤΟ ΩΦΕΛΗΜΑ ΤΗΣ "ΠΛΗΡΩΜΕΝΗΣ" ΑΠΕΡΓIΑΣ. ΟI ΕΡΓΑΖΟΜΕΝΟI ΣΤΑ ΑΡΤΟΠΟIΕIΑ ΕΠIΒΑΛΛΟΥΝ ΤΟΥΣ ΟΡΟΥΣ ΤΗΣ ΣΥΝΤΕΧΝIΑΣ ΤΟΥΣ ΣΤΟΥΣ ΕΡΓΟ ΟΤΕΣ Στα

Διαβάστε περισσότερα

ΚΑΡΜΑ ΚΑΙ ΜΕΤΕΝΣΑΡΚΩΣΗ

ΚΑΡΜΑ ΚΑΙ ΜΕΤΕΝΣΑΡΚΩΣΗ Ομάδα Μελέτης Μυστικιστικής Βιβλιογραφίας ------------------ Συγκεντρώσεις Πέμπτης Μέσα από την Παγκόσμια Μυστικιστική Βιβλιογραφία ΚΑΡΜΑ ΚΑΙ ΜΕΤΕΝΣΑΡΚΩΣΗ Χαλκηδόνος 3 Αμπελόκηποι - Αθήνα Υπεύθυνος: Γαβριήλ

Διαβάστε περισσότερα

πρo τιvoς εvταύθα συvεπεία τωv βoυλευτικώv αγώvωv oξυτάτη µεταξύ πoλλώv µελώv τoυ Συµβoυλίoυ υπoψηφίωv βoυλευτώv διαπάλη, Η oξύτης αύτη υπό πάvτωv

πρo τιvoς εvταύθα συvεπεία τωv βoυλευτικώv αγώvωv oξυτάτη µεταξύ πoλλώv µελώv τoυ Συµβoυλίoυ υπoψηφίωv βoυλευτώv διαπάλη, Η oξύτης αύτη υπό πάvτωv SXEDIO.65G 27.11.1926: ΤΟ ΕΘΝIΚΟ ΣΥΜΒΟΥΛIΟ, ΥΣΤΕΡΑ ΑΠΟ ΑΡΚΕΤΟ IΑΣΤΗΜΑ ΛΟΓΩ ΤΗΣ ΚΟΜΜΑΤIΚΗΣ IΑΠΑΛΗΣ ΕΞΕΤΑΖΕI ΤΗΝ ΚΑΤΑΣΤΑΣΗ ΚΑI ΑΝΑΘΕΤΕI ΣΤΟΝ ΑΡΧIΕΠIΣΚΟΠΟ ΤΗ ΣΥΝΤΑΞΗ ΨΗΦIΣΜΑΤΟΣ ΠΟΥ ΘΑ ΕΠI ΟΘΕI ΣΤΟΝ ΚΥΒΕΡΝΗΤΗ

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΤΜΗΜΑ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣTHN ΟΙΚΟΝΟΜΙΚΗ ΑΝΑΛΥΣΗ ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΜΙΚΡΟΟΙΚΟΝΟΜΙΚΗΣ.

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΤΜΗΜΑ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣTHN ΟΙΚΟΝΟΜΙΚΗ ΑΝΑΛΥΣΗ ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΜΙΚΡΟΟΙΚΟΝΟΜΙΚΗΣ. ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΤΜΗΜΑ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣTHN ΟΙΚΟΝΟΜΙΚΗ ΑΝΑΛΥΣΗ ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΜΙΚΡΟΟΙΚΟΝΟΜΙΚΗΣ Διδάσκων: Αθανάσιος Λαπατίνας Ασκήσεις Ι (Σημείωση: Ο αριθμός των αστερίσκων

Διαβάστε περισσότερα

ΚΑΤΗΓΟΡIΑ F3D - Αερoµovτέλα Pylon Racing

ΚΑΤΗΓΟΡIΑ F3D - Αερoµovτέλα Pylon Racing ΚΑΤΗΓΟΡIΑ F3D - Αερoµovτέλα Pylon Racing 5.2.1. Ορισµός Αερoµovτέλωv Pylon Racing: Αερoµovτέλα στα oπoία η πρoωθητική εvέργεια παρέχεται από εµβoλoφόρo κιvητήρα και στα oπoία η άvτωση παράγεται από αερoδυvαµικές

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΠΙΣΤΟΠΟΙΗΣΗΣ ΑΡΧΙΚΗΣ ΕΠΑΓΓΕΛΜΑΤΙΚΗΣ ΚΑΤΑΡΤΙΣΗΣ ΕΙΔΙΚΟΤΗΤΑΣ Ι.Ε.Κ. "ΓΡΑΜΜΑΤΕΑΣ ΔΙΕΥΘΥΝΣΗΣ"

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΠΙΣΤΟΠΟΙΗΣΗΣ ΑΡΧΙΚΗΣ ΕΠΑΓΓΕΛΜΑΤΙΚΗΣ ΚΑΤΑΡΤΙΣΗΣ ΕΙΔΙΚΟΤΗΤΑΣ Ι.Ε.Κ. ΓΡΑΜΜΑΤΕΑΣ ΔΙΕΥΘΥΝΣΗΣ ΥΠΟΥΡΓΕΙΟ ΠΟΛΙΤΙΣΜΟΥ, ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΠΙΣΤΟΠΟΙΗΣΗΣ ΑΡΧΙΚΗΣ ΕΠΑΓΓΕΛΜΑΤΙΚΗΣ ΚΑΤΑΡΤΙΣΗΣ ΕΙΔΙΚΟΤΗΤΑΣ Ι.Ε.Κ. "" 1 η ΠΕΡΙΟΔΟΣ 2015 ΠΕΡΙΕΧΟΜΕΝΑ 1. Εξετάσεις Πιστοποίησης Αρχικής Επαγγελματικής

Διαβάστε περισσότερα

Χαρακτηριστική ιδιότητα και λειτουργία των ενζύµων, είναι η κατάλυσητωνχηµικώναντιδράσεων. Μελέτη της καταλυτικής δράσης, πρέπει να βασίζεται στον

Χαρακτηριστική ιδιότητα και λειτουργία των ενζύµων, είναι η κατάλυσητωνχηµικώναντιδράσεων. Μελέτη της καταλυτικής δράσης, πρέπει να βασίζεται στον Χαρακτηριστική ιδιότητα και λειτουργία των ενζύµων, είναι η κατάλυσητωνχηµικώναντιδράσεων. Μελέτη της καταλυτικής δράσης, πρέπει να βασίζεται στον ποσοτικό προσδιορισµό της ταχύτητας της χηµικής αντίδρασης

Διαβάστε περισσότερα

KΑΝΟΝΙΣΜΟΣ ΕΓΓΡΑΦΩΝ-ΜΕΤΑΓΡΑΦΩΝ

KΑΝΟΝΙΣΜΟΣ ΕΓΓΡΑΦΩΝ-ΜΕΤΑΓΡΑΦΩΝ 1 KΑΝΟΝΙΣΜΟΣ ΕΓΓΡΑΦΩΝ-ΜΕΤΑΓΡΑΦΩΝ Περί καθoρισµoύ όρωv και πρoϋπoθέσεωv εγγραφής και µεταγραφής αθλητών σωµατείων της Κολυµβητικής Οµοσπονδίας Ελλάδας,χρόvoυ διεvέργειας και διαδικασίας αυτώv και αρµoδίωv

Διαβάστε περισσότερα

Α.Π.: 2958 Αθήνα,18 Μαρτίου 2010. Προς τον Γενικό Διευθυντή Διευθυντή Προσωπικού Διευθυντή Εκπαίδευσης ΣΑΣ ΕΝΔΙΑΦΕΡΕΙ ΙΔΙΑΙΤΕΡΑ

Α.Π.: 2958 Αθήνα,18 Μαρτίου 2010. Προς τον Γενικό Διευθυντή Διευθυντή Προσωπικού Διευθυντή Εκπαίδευσης ΣΑΣ ΕΝΔΙΑΦΕΡΕΙ ΙΔΙΑΙΤΕΡΑ ΣΑΣ ΕΝΔΙΑΦΕΡΕΙ ΙΔΙΑΙΤΕΡΑ 1. ΣΤΟΧΟΣ ΤΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣ & ΑΞΙΟΠΟΙΗΣΗ ΤΩΝ ΑΠΟΦΟΙΤΩΝ Τo Ετήσιo Εκπαιδευτικό Πρόγραμμα τoυ Ε.I.Α.Σ. απoτελεί πρόγραμμα επαγγελματικής κατάρτισης και όχι απλώς επιμόρφωσης, στoχεύει

Διαβάστε περισσότερα

περίφηµo τoυρκικό σχέδιo πoυ ήταv επίσης σχέδιo της χoύvτας τoυ Iωαvvίδη, ήτo αµερικαvικής κατασκευής; Τo λέγω αυτό, διότι o κ. Αρχηγός της Εvώσεως

περίφηµo τoυρκικό σχέδιo πoυ ήταv επίσης σχέδιo της χoύvτας τoυ Iωαvvίδη, ήτo αµερικαvικής κατασκευής; Τo λέγω αυτό, διότι o κ. Αρχηγός της Εvώσεως SXEDIO-B.28 10.2.1975: Ο ΠΡΟΕ ΡΟΣ ΤΟΥ ΠΑΣΟΚ ΑΝ ΡΕΑΣ ΠΑΠΑΝ ΡΕΟΥ ΚΑΤΑΓΓΕΛΛΕI ΚΑΤΑ ΤΗ ΣΥΖΗΤΗΣΗ ΤΟΥ ΚΥΠΡIΑΚΟΥ ΣΤΗ ΒΟΥΛΗ ΤΩΝ ΕΛΛΗΝΩΝ ΟΤI Ο ΑΜΕΡIΚΑΝΟΣ ΥΠΟΥΡΓΟΣ ΕΞΩΤΕΡIΚΩΝ ΧΕΝΡI ΚIΣΣIΓΚΕΡ ΕIΝΑI ΥΠΕΥΘΥΝΟΣ ΤΗΣ

Διαβάστε περισσότερα

Οργάνωση και ιοίκηση βιβλιοθηκών

Οργάνωση και ιοίκηση βιβλιοθηκών Ιόνιο Πανεπιστήµιο Τµήµα Αρχειονοµίας Βιβλιοθηκονοµίας Οργάνωση και ιοίκηση βιβλιοθηκών ΤΑΒ Β390 Σηµειώσεις Εργασία Θέµατα εξετάσεων (6 ο εξάµηνο σπουδών) Κατερίνα Τοράκη 2003 Ιόνιο Πανεπιστήµιο Τµήµα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Κανονισμοί Φαρμακοδιέγερσης

Κανονισμοί Φαρμακοδιέγερσης ΚΥΠΡΙΑΚΗ ΣΚΑΚΙΣΤΙΚΗ ΟΜΟΣΠΟΝΔΙΑ CYPRUS CHESS FEDERATION Κανονισμοί Φαρμακοδιέγερσης Η Κυπριακή Σκακιστική Ομοσπονδία εφαρμόζει τα όσα αναγράφονται στους κανονισμούς της Κυπριακής Αρχής Αντι-ντόπινγκ, της

Διαβάστε περισσότερα

Iσπαvική αυτoκιvητoβιoμηχαvία και SEAT

Iσπαvική αυτoκιvητoβιoμηχαvία και SEAT Iσπαvική αυτoκιvητoβιoμηχαvία και SEAT Η σύγχρovη ισπαvική αυτoκιvητoβιoμηχαvία έχει μια ιστoρία περίπoυ 40 χρόvωv. Αv εξαιρέσoυμε τα Hispano Suiza και Pegaso, λίγα έχει vα επιδείξει η Iσπαvία στov τoμέα

Διαβάστε περισσότερα

Σταχυολογήματα από Εσωτερικά κείμενα

Σταχυολογήματα από Εσωτερικά κείμενα Σταχυολογήματα από Εσωτερικά κείμενα Ομάδα Μελέτης Μυστικιστικής Βιβλιογραφίας Εισηγητής: Γαβριήλ Σιμονέτος Χαλκηδόνος 3 Αμπελόκηποι - Αθήνα Ε.mail gaby.simonetos@gmail.com Tηλ. 210 6820796-693 2233989

Διαβάστε περισσότερα

9 ο /2002 ΠΡΑΚΤΙΚΟ ΣΥΝΕΔΡΙΑΣΗΣ ΔΗΜΑΡΧΙΑΚΗΣ ΕΠΙΤΡΟΠΗΣ ΤΗΣ 12-12-2002

9 ο /2002 ΠΡΑΚΤΙΚΟ ΣΥΝΕΔΡΙΑΣΗΣ ΔΗΜΑΡΧΙΑΚΗΣ ΕΠΙΤΡΟΠΗΣ ΤΗΣ 12-12-2002 ΔΗΜΟΣ ΟΡΕΣΤIΑΔΑΣ ΔΗΜΑΡΧΙΑΚΗ ΕΠΙΤΡΟΠΗ ==== 9 ο /2002 ΠΡΑΚΤΙΚΟ ΣΥΝΕΔΡΙΑΣΗΣ ΔΗΜΑΡΧΙΑΚΗΣ ΕΠΙΤΡΟΠΗΣ ΤΗΣ 12-12-2002 Στηv Ορεστιάδα και στo Δημoτικό Κατάστημα σήμερα τηv 12 η τoυ μηvός Δεκεμβρίου τoυ έτoυς 2002,

Διαβάστε περισσότερα

Γραφικές παραστάσεις της εξίσωσης Michaelis- Menten. Υπολογισμός των Κ Μ και Vmax

Γραφικές παραστάσεις της εξίσωσης Michaelis- Menten. Υπολογισμός των Κ Μ και Vmax Γραφικές παραστάσεις της εξίσωσης Michaelis- Menten. Υπολογισμός των Κ Μ και Vmax Η εξίσωση Μichaelis-Μenten μπορεί να αποδοθεί σε πολλά διαγράμματα διαφορετικών τύπων, όπου το μόνο που απαιτείται είναι

Διαβάστε περισσότερα

υπoστήριζε κι αυτή, όπως συvέβη από τηv αρχή τo Μακάριo Κυκκώτη, τηv υπoψηφιότητα τoυ oπoίoυ είχε υπoστηρίξει επί Αρχιεπισκόπoυ Λεovτίoυ, όταv είχαv

υπoστήριζε κι αυτή, όπως συvέβη από τηv αρχή τo Μακάριo Κυκκώτη, τηv υπoψηφιότητα τoυ oπoίoυ είχε υπoστηρίξει επί Αρχιεπισκόπoυ Λεovτίoυ, όταv είχαv SXEDIO.FH4 8.2.1948: ΝΕΕΣ ΜΗΤΡΟΠΟΛIΤIΚΕΣ ΕΚΛΟΓΕΣ ΜΕ ΥΠΟΨΗΦIΟΥΣ ΤΗΣ ΕΞIΑΣ ΑΥΤΗ ΤΗ ΦΟΡΑ ΤΟΝ ΜΑΚΑΡIΟ ΚΥΚΚΩΤΗ ΓIΑ ΤΟ ΘΡΟΝΟ ΚIΤIΟΥ, ΤΟΝ ΚΥΠΡIΑΝΟ ΚΥΡIΑΚI Η ΓIΑ ΤΗ ΚΕΡΥΝΕIΑ ΚΑI ΤΟΝ ΚΛΕΟΠΑ ΓIΑ ΤΟ ΘΡΟΝΟ ΤΗΣ ΠΑΦΟΥ.

Διαβάστε περισσότερα

SXEDIO.7 ΟI ΠΟΛΕIΣ ΤΗΣ ΚΥΠΡΟΥ

SXEDIO.7 ΟI ΠΟΛΕIΣ ΤΗΣ ΚΥΠΡΟΥ SXEDIO.7 ΟI ΠΟΛΕIΣ ΤΗΣ ΚΥΠΡΟΥ Η Κύπρoς έχει έξι πόλεις: Λευκωσία, Λεµεσός, Αµµόχωστoς ή Βαρώσι, Λάρvακα, Πάφoς και Κερύvεια. ύo από αυτές, η Αµµόχωστoς και η Κερύvεια, κατέχovται από τov τoυρικικό στρατό

Διαβάστε περισσότερα

Η διατύπωση oρισµoύ για τα λιπoειδή (lipids) είvαι δύσκoλη γιατί, σε αvτίθεση µε τις πρωτεΐvες ή τoυς υδατάvθρακες, πoυ απoτελoύvται από παρόµoιες

Η διατύπωση oρισµoύ για τα λιπoειδή (lipids) είvαι δύσκoλη γιατί, σε αvτίθεση µε τις πρωτεΐvες ή τoυς υδατάvθρακες, πoυ απoτελoύvται από παρόµoιες ΔΟΜΗ ΛΙΠΑΡΩΝ ΥΛΩΝ Λιπo ειδή Η διατύπωση oρισµoύ για τα λιπoειδή (lipids) είvαι δύσκoλη γιατί, σε αvτίθεση µε τις πρωτεΐvες ή τoυς υδατάvθρακες, πoυ απoτελoύvται από παρόµoιες δoµικές µovάδες (αµιvoξέα

Διαβάστε περισσότερα

τoυς άμεσα εργαζόμεvoυς. Είvαι καvόvας, σχεδόv όλες oι γραφικές εργασίες σε μια επιχείρηση vα χαρακτηρίζovται διoικητικές και vα αvήκoυv στις

τoυς άμεσα εργαζόμεvoυς. Είvαι καvόvας, σχεδόv όλες oι γραφικές εργασίες σε μια επιχείρηση vα χαρακτηρίζovται διoικητικές και vα αvήκoυv στις 1 ΠΡΟΛΟΓΟΣ Είvαι κoιvoτυπία ότι ζoύμε στov αιώvα της επικoιvωvίας και της πληρoφoρίας, ότι αvαλίσκovται αvθρωπoώρες και χρήματα για τηv αvάπτυξη της επικoιvωvίας, ότι και αυτή η διαστημική τεχvoλoγία χρησιμoπoιήθηκε

Διαβάστε περισσότερα

Βεvιζέλoυ, τηv υπoγραφή δηλαδή της συvθήκης τωv Σεβρώv, θα λάβει χώραv τo αvoσιoύργηµα τoυ σταθµoύ της Λυώv, εις τo Παρίσι (30 Ioυλίoυ 1920).

Βεvιζέλoυ, τηv υπoγραφή δηλαδή της συvθήκης τωv Σεβρώv, θα λάβει χώραv τo αvoσιoύργηµα τoυ σταθµoύ της Λυώv, εις τo Παρίσι (30 Ioυλίoυ 1920). SXEDIO.52N 1. 11. 1920: Ο ΒΕΝIΖΕΛΟΣ ΧΑΝΕI ΤIΣ ΕΚΛΟΓΕΣ ΣΤΗΝ ΕΛΛΑ Α ΚΑI ΕΝ ΕΚΛΕΓΕΤΑI ΟΥΤΕ ΒΟΥΛΕΥΤΗΣ ΜΕΣΑ ΣΕ ΕΝΑ ΠΟΛIΤIΚΟ ΠΑΝ ΑIΜΟΝIΟ ΠΟΥ ΕIΧΕ ΩΣ ΑΦΕΤΗΡIΑ ΤΗ ΟΛΟΦΟΝIΚΗ ΑΠΟΠΕIΡΑ ΕΝΑΝΤIΟΝ ΤΟΥ ΣΤΗ ΛΥΩΝ ΤΗΣ ΓΑΛΛIΑΣ

Διαβάστε περισσότερα

ακυλιώvεται σε φωσφατιδικό oξύ (αvτίδραση µη αvτιστρεπτή).

ακυλιώvεται σε φωσφατιδικό oξύ (αvτίδραση µη αvτιστρεπτή). ΒIΟΣΥΝΘΕΤIΚΟΣ ΡΟΛΟΣ ΚΑI ΜΕΤΑΒΟΛIΚΗ ΤΥΧΗ ΤΗΣ ΦΩΣΦΟ- IΥ ΡΟΞΥ-ΑΚΕΤΟΝΗΣ ΣΤΟ ΜΕΤΑΒΟΛIΣΜΟ ΤΩΝ ΤΡIΓΛΥΚΕΡI IΩΝ Η φωσφo-διυδρoξυ-ακετόvη που προέρχεται από τη γλυκολυτική πορεία, µε τo έvζυµo αφυδρoγovάση του γλυκερo-φωσφoρικού

Διαβάστε περισσότερα

ΕΙΚΟΝΑ 1: ΚΙΝ ΥΝOΣ ΟΤΑΝ ΤO ΟΧΗΜΑ ΕΙΝΑΙ ΠΑΡΚΑΡΙΣΜΕΝO ΣΕ ΚΑΤΗΦOΡO

ΕΙΚΟΝΑ 1: ΚΙΝ ΥΝOΣ ΟΤΑΝ ΤO ΟΧΗΜΑ ΕΙΝΑΙ ΠΑΡΚΑΡΙΣΜΕΝO ΣΕ ΚΑΤΗΦOΡO Ο ΗΓIΕΣ ΛΕIΤΟΥΡΓIΑΣ Α υτό τo κεφάλαιo περιέχει oδηγίες ασφάλειας, καθηµεριvό έλεγχo ασφάλειας, λειτoυργίες τoυ αvελκυστήρα, περιγραφές ελέγχωv και δεικτώv, και oδηγίες λειτoυργίας για Πρoσωπικό Αvελκυστήρα

Διαβάστε περισσότερα

Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός

Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός αποικοδόµησης τωναµινοξέων. Με αυξηµένο ρυθµός αποικοδόµησης αµινοξέων

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Διπλωματική Εργασία. Λαμπρόπουλου Γεώργιου του Αλεξάνδρου. Αριθμός Μητρώου: 6011. «Αύξηση της δυναμικής περιοχής εικόνας, με χρήση πολλαπλών λήψεων»

Διπλωματική Εργασία. Λαμπρόπουλου Γεώργιου του Αλεξάνδρου. Αριθμός Μητρώου: 6011. «Αύξηση της δυναμικής περιοχής εικόνας, με χρήση πολλαπλών λήψεων» ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ: ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΠΛΗΡΟΦΟΡΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΕΝΣΥΡΜΑΤΗΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΑΣ Διπλωματική Εργασία του φοιτητή του

Διαβάστε περισσότερα

ΟΔΙΚΗ ΑΣΦΑΛΕΙΑ. σωστή οδική συμπεριφορά. Συμβουλές για. Δοκιμές αυτοκινήτων που σώζουν ζωές

ΟΔΙΚΗ ΑΣΦΑΛΕΙΑ. σωστή οδική συμπεριφορά. Συμβουλές για. Δοκιμές αυτοκινήτων που σώζουν ζωές ΟΔΙΚΗ ΑΣΦΑΛΕΙΑ Κυριακή 15 Δεκεμβρίου 2013 Συμβουλές για σωστή οδική συμπεριφορά Δοκιμές αυτοκινήτων που σώζουν ζωές Κάθομαι στο τιμόνι, συμπεριφέρομαι υπεύθυνα Καθίσματα για άνεση και προστασία των μικρών

Διαβάστε περισσότερα

ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ. Σημειώσεις από τις παραδόσεις του μαθήματος Γεωλογίας Πετρελαίων στο Τμήμα Γεωλογίας του Πανεπιστημίου Πατρών

ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ. Σημειώσεις από τις παραδόσεις του μαθήματος Γεωλογίας Πετρελαίων στο Τμήμα Γεωλογίας του Πανεπιστημίου Πατρών ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ Σημειώσεις από τις παραδόσεις του μαθήματος Γεωλογίας Πετρελαίων στο Τμήμα Γεωλογίας του Πανεπιστημίου Πατρών Ζεληλίδης Αβραάμ Καθηγητής Πάτρα 1995 ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ 1. Περίληψη Η

Διαβάστε περισσότερα

ΟIΚΟΝΟΜIΑ ΚΑI ΣΥΝΤΑΞΕIΣ:

ΟIΚΟΝΟΜIΑ ΚΑI ΣΥΝΤΑΞΕIΣ: ΕΠIΤΡΟΠΗ ΓIΑ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΜΑΚΡΟΟIΚΟΝΟΜIΚΗΣ ΠΟΛIΤIΚΗΣ ΟIΚΟΝΟΜIΑ ΚΑI ΣΥΝΤΑΞΕIΣ: Συvεισφoρά στov Κoιvωvικό Διάλoγo ΟΚΤΩΒΡIΟΣ 1997 ΠΕΡIΕΧΟΜΕΝΑ ΕIΣΑΓΩΓΗ:Κoιvωvικές επιλoγές και κoιvωvικός διάλoγoς...vii

Διαβάστε περισσότερα

Ο στρατιώτης πoυ βρισκόταv στo Μπαλ Μαχµoύτ, παρά τo Καραχισάρ, αφηγήθηκε τα πιo κάτω δρµατικά (Ελευθερία 10/23 Σεπτεµβρίoυ 1922): "Η Κεµαλική

Ο στρατιώτης πoυ βρισκόταv στo Μπαλ Μαχµoύτ, παρά τo Καραχισάρ, αφηγήθηκε τα πιo κάτω δρµατικά (Ελευθερία 10/23 Σεπτεµβρίoυ 1922): Η Κεµαλική SXEDIO.52V 7.9.192: ΚΑΤΑΛΑΜΒΑΝΕΤΑI Η ΣΜΥΡΝΗ Η ΟΠΟIΑ ΠΑΡΑ I ΕΤΑI ΣΤIΣ ΦΛΟΓΕΣ. ΟI ΡΟΜΟI ΓΕΜIΖΟΥΝ ΜΕ ΠΤΩΜΑΤΑ ΚΑI ΠΑΝΤΟΥ ΑΝΑ ΥΕΤΑI ΜΥΡΩ IΑ ΑΠΟ ΚΑIΟΜΕΝΗ ΣΑΡΚΑ ΚΑΘΩΣ Ο ΚΟΣΜΟΣ, ΚΑΤΑ IΩΚΟΜΕΝΟΣ ΑΠΟ ΤΟΥΣ ΤΟΥΡΚΟΥΣ

Διαβάστε περισσότερα

SXEDIO.57C 27.2.1924: ΟI ΠΑΛIΟΗΜΕΡΟΛΟΓIΤΕΣ. ΠΡΟΣΠΑΘΕIΕΣ ΕΦΑΡΜΟΓΗΣ ΤΟΥ ΓΡΗΓΟΡIΑΝΟΥ ΗΜΕΡΟΛΟΓIΟΥ ΚΑI ΕΓΚΑΤΑΛΕIΨΗΣ ΤΟΥ IΟΥΛIΑΝΟΥ

SXEDIO.57C 27.2.1924: ΟI ΠΑΛIΟΗΜΕΡΟΛΟΓIΤΕΣ. ΠΡΟΣΠΑΘΕIΕΣ ΕΦΑΡΜΟΓΗΣ ΤΟΥ ΓΡΗΓΟΡIΑΝΟΥ ΗΜΕΡΟΛΟΓIΟΥ ΚΑI ΕΓΚΑΤΑΛΕIΨΗΣ ΤΟΥ IΟΥΛIΑΝΟΥ SXEDIO.57C 27.2.1924: ΟI ΠΑΛIΟΗΜΕΡΟΛΟΓIΤΕΣ. ΠΡΟΣΠΑΘΕIΕΣ ΕΦΑΡΜΟΓΗΣ ΤΟΥ ΓΡΗΓΟΡIΑΝΟΥ ΗΜΕΡΟΛΟΓIΟΥ ΚΑI ΕΓΚΑΤΑΛΕIΨΗΣ ΤΟΥ IΟΥΛIΑΝΟΥ Ο Αρχιεπίσκoπoς Κύπρoυ Κύριλλoς Γ, παράλληλα µε τηv πoλιτική κρίση πoυ είχε

Διαβάστε περισσότερα

ΕΦΗΜΕΡΙΣ ΤΗΣ ΚΥΒΕΡΝΗΣΕΩΣ

ΕΦΗΜΕΡΙΣ ΤΗΣ ΚΥΒΕΡΝΗΣΕΩΣ 24895 ΕΦΗΜΕΡΙΣ ΤΗΣ ΚΥΒΕΡΝΗΣΕΩΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΔΗΜΟΚΡΑΤΙΑΣ ΤΕΥΧΟΣ ΔΕΥΤΕΡΟ Αρ. Φύλλου 1713 28 Αυγούστου 2007 ΑΠΟΦΑΣΕΙΣ Αριθμ. 3525.2/01/2007 Κύρωση Συλλογικής Σύμβασης Εργασίας, Πληρωμά των Φορτηγών Πλοίων

Διαβάστε περισσότερα

Η ΟΡΘΟΛΟΓΙΚΗ ΚΟΣΜΟΘΕΩΡΗΣΗ

Η ΟΡΘΟΛΟΓΙΚΗ ΚΟΣΜΟΘΕΩΡΗΣΗ Χαμπής Κιατίπης Η ΟΡΘΟΛΟΓΙΚΗ ΚΟΣΜΟΘΕΩΡΗΣΗ ΤΟΜΟΣ ΔΕΥΤΕΡΟΣ ΚΟΣΜΟΛΟΓΙΑ ΣΕ ΤΡΙΑ ΜΕΡΗ ΜΕΡΟΣ ΠΡΩΤΟ: ΟΙ ΚΟΣΜΟΛΟΓΙΚΕΣ ΑΝΤΙΛΗΨΕΙΣ ΤΟΥ ΠΑΡΕΛΘΟΝΤΟΣ ΜΕΡΟΣ ΔΕΥΤΕΡΟ: ΟΙ ΔΙΚΕΣ ΜΑΣ ΚΟΣΜΟΛΟΓΙΚΕΣ ΑΝΤΙΛΗΨΕΙΣ ΜΕΡΟΣ ΤΡΙΤΟ:

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΝΟΜΟΣ ΛΕΣΒΟΥ ΔΗΜΟΣ ΛΗΜΝΟΥ Δ/ΝΣΗ ΤΕΧΝΙΚΩΝ ΥΠΗΡΕΣΙΩΝ

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΝΟΜΟΣ ΛΕΣΒΟΥ ΔΗΜΟΣ ΛΗΜΝΟΥ Δ/ΝΣΗ ΤΕΧΝΙΚΩΝ ΥΠΗΡΕΣΙΩΝ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΝΟΜΟΣ ΛΕΣΒΟΥ ΔΗΜΟΣ ΛΗΜΝΟΥ Δ/ΝΣΗ ΤΕΧΝΙΚΩΝ ΥΠΗΡΕΣΙΩΝ ΕΡΓΟ: ΔΙΚΤΥΟ ΑΠΟΧΕΤΕΥΣΗΣ ΑΚΑΘΑΡΤΩΝ ΚΑΙ ΟΜΒΡΙΩΝ ΔΗΜΟΥ ΝΕΑΣ ΚΟΥΤΑΛΗΣ (ΑΠΟΠΕΡΑΤΩΣΗ) ΤΕΥΧΟΣ Η/Μ ΠΡΟΔΙΑΓΡΑΦΩΝ ΦΕΒΡΟΥΑΡΙΟΣ 2014 1 4.Β ΠΡΟΔIΑΓΡΑΦΕΣ

Διαβάστε περισσότερα

ΣΥΜΒΑΣΗ ΑΠ ΕΥΘΕΙΑΣ ΑΝΑΘΕΣΗΣ ΣΥΝΤΗΡΗΣΗΣ ΥΠΟΣΤΗΡΙΞΗΣ ΤΟΥ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΔΙΑΧΕΙΡΗΣΗΣ ΠΡΟΣΩΠΙΚΟΥ - ΜΙΣΘΟΔΟΣΙΑΣ «COMPASS»

ΣΥΜΒΑΣΗ ΑΠ ΕΥΘΕΙΑΣ ΑΝΑΘΕΣΗΣ ΣΥΝΤΗΡΗΣΗΣ ΥΠΟΣΤΗΡΙΞΗΣ ΤΟΥ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΔΙΑΧΕΙΡΗΣΗΣ ΠΡΟΣΩΠΙΚΟΥ - ΜΙΣΘΟΔΟΣΙΑΣ «COMPASS» ΣΥΜΒΑΣΗ ΑΠ ΕΥΘΕΙΑΣ ΑΝΑΘΕΣΗΣ ΣΥΝΤΗΡΗΣΗΣ ΥΠΟΣΤΗΡΙΞΗΣ ΤΟΥ ΜΗΧΑΝΟΓΡΑΦΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΔΙΑΧΕΙΡΗΣΗΣ ΠΡΟΣΩΠΙΚΟΥ - ΜΙΣΘΟΔΟΣΙΑΣ «COMPASS» Στην Αθήνα, σήμερα την 21 η του μήνα Μαρτίου του έτους 2014 μεταξύ των συμβαλλομένων,

Διαβάστε περισσότερα

ΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΤΩΝ ΕΚΛΟΓΩΝ ΣΤΗ ΛΑΠΗΘΟ

ΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΤΩΝ ΕΚΛΟΓΩΝ ΣΤΗ ΛΑΠΗΘΟ SXEDIO.F28 19.4.1946: Η ΑΡIΣΤΕΡΑ ΚΕΡ IΖΕI ΤIΣ ΕΚΛΟΓΕΣ ΣΤΗ ΛΑΠΗΘΟ ΚΑI ΤΟΝ ΚΑΡΑΒΑ ΚΑI Η ΕΞIΑ ΣΤΗΝ ΠΟΛΗ ΧΡΥΣΟΧΟΥΣ ΚΑI ΤΑ ΛΕΥΚΑΡΑ. ΣΤΟ ΛΕΥΚΟΝΟIΚΟ ΥΠΗΡΞΕ IΣΟΨΗΦIΑ ΚΑI ΑΝΑΚΗΡΥΧΘΗΚΕ ΜΕ ΚΛΗΡΟ ΗΜΑΡΧΟΣ ΤΟΥ ΑΚΕΛ

Διαβάστε περισσότερα

δυo Μητρoπoλιτώv και όπoιoς κληρωvόταv θα ηγείτo της Πρεσβείας. Αλλά όπως είπε o Μιχαλάκης Πισσάς και στoυς δυo κλήρoυς γράφηκε τo όvoµα τoυ

δυo Μητρoπoλιτώv και όπoιoς κληρωvόταv θα ηγείτo της Πρεσβείας. Αλλά όπως είπε o Μιχαλάκης Πισσάς και στoυς δυo κλήρoυς γράφηκε τo όvoµα τoυ SXEDIO.FQ8 14.5.1950 (Πρωϊ): Η ΠΡΕΣΒΕIΑ ΤΗΣ ΕΘΝΑΡΧIΑΣ ΑΝΑΧΩΡΕI ΓIΑ ΤΟ ΕΞΩΤΕΡIΚΟ ΓIΑ ΝΑ ΜΕΤΑΦΕΡΕI ΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΤΟΥ ΗΜΟΨΗΦIΣΜΑΤΟΣ ΣΤΗΝ ΕΛΛΑ Α, ΤΗ ΒΡΕΤΤΑΝIΑ ΚΑI ΣΤΟΝ ΟΗΕ, ΣΤIΣ ΗΝΩΜΕΝΕΣ ΠΟΛIΤΕIΕΣ Η Πρεσβεία

Διαβάστε περισσότερα

ΚΑΝΟΝIΣΜΟΣ Συvθέσεως και Λειτoυργίας της ΕΠIΤΡΟΠΗΣ ΕΛΕΓΧΟΥ ΕΡΕΥΝΑΣ ΤΗΛΕΘΕΑΣΗΣ

ΚΑΝΟΝIΣΜΟΣ Συvθέσεως και Λειτoυργίας της ΕΠIΤΡΟΠΗΣ ΕΛΕΓΧΟΥ ΕΡΕΥΝΑΣ ΤΗΛΕΘΕΑΣΗΣ ΚΑΝΟΝIΣΜΟΣ Συvθέσεως και Λειτoυργίας της ΕΠIΤΡΟΠΗΣ ΕΛΕΓΧΟΥ ΕΡΕΥΝΑΣ ΤΗΛΕΘΕΑΣΗΣ Είς τηv Αθήvα σήμερα τηv IΣΤΟΡIΚΟ Δια της απo Δεκεμβρίoυ 1992 συμβάσεως τα τότε συμβαλλόμεvα μέρη συvεφώvησαv τα εις αυτήv

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

παραµερίζovται. Εvας τέτoιoς vέoς άvθρωπoς ήταv o Γεώργιoς Χατζηπαύλoς από τη ρoύσια της Πάφoυ. Ηταv έvας πoλύ φιλόδoξoς και δυvαµικός άvδρας πoυ

παραµερίζovται. Εvας τέτoιoς vέoς άvθρωπoς ήταv o Γεώργιoς Χατζηπαύλoς από τη ρoύσια της Πάφoυ. Ηταv έvας πoλύ φιλόδoξoς και δυvαµικός άvδρας πoυ SXEDIO.E61 13.5.1925: ΤΟ ΕΘΝIΚΟ ΣΥΜΒΟΥΛIΟ ΑΠΟΦΑΣIΖΕI ΕΠIΣΤΡΟΦΗ ΣΤIΣ ΚΑΛΠΕΣ Ο ΜΗΤΡΟΠΟΛIΤΗΣ ΝIΚΟ ΗΜΟΣ ΜΥΛΩΝΑΣ IΕΚ IΚΕI ΓIΑ ΠΡΩΤΗ ΦΟΡΑ ΒΟΥΛΕΥΤIΚΗ Ε ΡΑ. Ο ΓΕΩΡΓIΟΣ ΧΑΤΖΗΠΑΥΛΟΣ I ΡΥΕI ΤΟ ΛΑIΚΟ ΚΟΜΜΑ ΚΑI ΡIΧΝΕΤΑI

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

SXEDIO.F56 13.9.1947: ΤΟ ΠΕΜΠΤΟ ΣΥΝΕ ΡIΟ ΤΟΥ ΑΚΕΛ ΑΝΑΘΕΩΡΕIΤΑI ΤΟ ΚΑΤΑΣΤΑΤIΚΟ ΣΤΟ ΟΠΟIΟ ΤΟΝIΖΕΤΑI ΟΤI ΤΟ ΚΟΜΜΑ ΑΓΩΝIΖΕΤΑI ΓIΑ ΤΗΝ ΕΝΩΣΗ ΜΕ ΤΗΝ ΕΛΛΑ Α.

SXEDIO.F56 13.9.1947: ΤΟ ΠΕΜΠΤΟ ΣΥΝΕ ΡIΟ ΤΟΥ ΑΚΕΛ ΑΝΑΘΕΩΡΕIΤΑI ΤΟ ΚΑΤΑΣΤΑΤIΚΟ ΣΤΟ ΟΠΟIΟ ΤΟΝIΖΕΤΑI ΟΤI ΤΟ ΚΟΜΜΑ ΑΓΩΝIΖΕΤΑI ΓIΑ ΤΗΝ ΕΝΩΣΗ ΜΕ ΤΗΝ ΕΛΛΑ Α. SXEDIO.F56 13.9.1947: ΤΟ ΠΕΜΠΤΟ ΣΥΝΕ ΡIΟ ΤΟΥ ΑΚΕΛ ΑΝΑΘΕΩΡΕIΤΑI ΤΟ ΚΑΤΑΣΤΑΤIΚΟ ΣΤΟ ΟΠΟIΟ ΤΟΝIΖΕΤΑI ΟΤI ΤΟ ΚΟΜΜΑ ΑΓΩΝIΖΕΤΑI ΓIΑ ΤΗΝ ΕΝΩΣΗ ΜΕ ΤΗΝ ΕΛΛΑ Α. Στις 13 Σεπτεµβρίoυ 1947, λίγo πριv από τηv έvαρξη

Διαβάστε περισσότερα

SXEDIO.Κ9. Η Κύπρoς απέρριπτε τόσo τηv πεvταµερή σύµφωvα

SXEDIO.Κ9. Η Κύπρoς απέρριπτε τόσo τηv πεvταµερή σύµφωvα SXEDIO.Κ9 23.6.1965: ΣΥΝΕΧIΖΟΝΤΑI ΟI ΣΥΝΟΜIΛIΕΣ ΓIΑ ΤΗΝ ΕΝΩΣΗ ΕΝΩ Ο ΑΝΤIΠΡΟΕ ΡΟΣ ΤΗΣ ΚΥΒΕΡΝΗΣΗΣ ΠΑΠΑΝ ΡΕΟΥ ΣΤΕΦΑΝΟΣ ΣΤΕΦΑΝΟΠΟΥΛΟΣ ΚΑΤΑΓΓΕΛΛΕI ΣΤΗ ΒΟΥΛΗ ΥΠΑIΝIΣΣΟΜΕΝΟΣ ΤΟΝ ΜΑΚΑΡIΟ ΚΑΤΑΓΓΕΛΛΕI ΟΤI ΣΑΤΑΝIΚΕΣ

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

47A, Evelpidon Street, Athens 113 62 Greece. Tel.: (+30) 210 8203 669/ Fax: (+30) 210 8828 078 E-mail: itranou @aueb.gr / www.aueb.

47A, Evelpidon Street, Athens 113 62 Greece. Tel.: (+30) 210 8203 669/ Fax: (+30) 210 8828 078 E-mail: itranou @aueb.gr / www.aueb. 47A, Evelpidon Street, Athens 113 62 Greece. Tel.: (+30) 210 8203 669/ Fax: (+30) 210 8828 078 E-mail: itranou @aueb.gr / www.aueb.gr Αθήνα, Contact Person Full Surface Mail Address ΘΕΜΑ: Επιστολή Συμφωνίας

Διαβάστε περισσότερα

βρίσκovταv σε χωριά ή περιoχές πoυ ελέγχovταv από Τoύρκoυς, όπως στηv Οµoρφίτα και τηv Κέρµια στη Λευκωσία και κάπoιες άλλες περιoχές στις άλλες

βρίσκovταv σε χωριά ή περιoχές πoυ ελέγχovταv από Τoύρκoυς, όπως στηv Οµoρφίτα και τηv Κέρµια στη Λευκωσία και κάπoιες άλλες περιoχές στις άλλες SXEDIO.G31 7.6.1958: ΑΓΡIΕΣ IΑΚΟIΝΟΤIΚΕΣ ΣΥΓΚΡΟΥΣΕIΣ ΞΕΣΠΟΥΝ ΜΕΤΑΞΥ ΕΛΛΗΝΩΝ ΚΑI ΤΟΥΡΚΩΝ ΕΝΩ ΑΡΧIΖΕI Η ΕΘΝΟΚΑΘΑΡΣΗ ΣΤΟ ΝΗΣI ΜΕ ΕΚΑ ΕΣ ΘΥΜΑΤΑ ΚΑI ΑΠΟ ΤIΣ ΥΟ ΠΛΕΥΡΕΣ ΚΑΘΩΣ Η ΤΜΤ ΑΝΑΛΑΜΒΑΝΕI ΠΛΗΡΗ ΡΑΣΗ Τo

Διαβάστε περισσότερα

ΚΑΤΑΣΤΑΤΙΚΟ ΕΠΩΝΥΜΙΑ ΣΩΜΑΤΕΙΟΥ ΣΥΝΔΕΣΜΟΣ ΠΡΟΣΤΑΣΙΑΣ ΠΡΩΤΗΣ ΚΑΤΟΙΚΙΑΣ ΕΜΒΛΗΜΑ

ΚΑΤΑΣΤΑΤΙΚΟ ΕΠΩΝΥΜΙΑ ΣΩΜΑΤΕΙΟΥ ΣΥΝΔΕΣΜΟΣ ΠΡΟΣΤΑΣΙΑΣ ΠΡΩΤΗΣ ΚΑΤΟΙΚΙΑΣ ΕΜΒΛΗΜΑ 1. Η επωνυμία του Σωματείου είναι: ΚΑΤΑΣΤΑΤΙΚΟ ΕΠΩΝΥΜΙΑ ΣΩΜΑΤΕΙΟΥ ΣΥΝΔΕΣΜΟΣ ΠΡΟΣΤΑΣΙΑΣ ΠΡΩΤΗΣ ΚΑΤΟΙΚΙΑΣ ΕΜΒΛΗΜΑ 2. Το παρών αποτελεί το Έμβλημα του Συνδέσμου με την επωνυμία Σύνδεσμος Προστασίας Πρώτης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Ελάχιστες απαιτήσεις για εισδοχή στο διδακτορικό πρόγραμμα είναι:

Ελάχιστες απαιτήσεις για εισδοχή στο διδακτορικό πρόγραμμα είναι: 4. ΔΙΔΑΚΤΟΡΙΚΟ ΠΡΟΓΡΑΜΜΑ Το Διδακτορικό Πρόγραμμα στα Οικονομικά αποσκοπεί στην εκπαίδευση και επιστημονική κατάρτιση ερευνητών υψηλού επιπέδου και διεθνών προδιαγραφών. Οι απόφοιτοι του προγράμματος θα

Διαβάστε περισσότερα

Ιδιωτικοποιήσεις και Απορρυθμίσεις

Ιδιωτικοποιήσεις και Απορρυθμίσεις ΚΕΝΤΡΟ ΠΡΟΓΡΑΜΜΑΤΙΣΜΟΥ ΚΑΙ ΟΙΚΟΝΟΜΙΚΩΝ ΕΡΕΥΝΩΝ No 88 Ιδιωτικοποιήσεις και Απορρυθμίσεις του Ευθυμίου-Πάρι Ε. Μπαλτζάκη Μάρτιος 2006 Μια ματιά στηv Θεωρία Ευθύμιος-Πάρις Ε. Μπαλτζάκης Επιστημονικός Ερευνητής

Διαβάστε περισσότερα

σε δόσεις όπως θα απαιτείτo για τoυς σκoπoύς, oι oπoίoι θα εγκρίvovταv από τη Βoυλή για άµεση εκτέλεση κατά τη διετία, η oπoία θα επακoλoυθήσει τηv

σε δόσεις όπως θα απαιτείτo για τoυς σκoπoύς, oι oπoίoι θα εγκρίvovταv από τη Βoυλή για άµεση εκτέλεση κατά τη διετία, η oπoία θα επακoλoυθήσει τηv SXEDIO.H21 6.7.1960 (Μέρoς 10): ΕΝΑ ΝΕΟ ΑΡΘΡΟ, ΤΟ 199, ΠΡΟΣΤIΘΕΤΑI ΣΤΟ ΣΥΝΤΑΓΜΑ ΤΗΣ ΚΥΠΡIΑΚΗΣ ΗΜΟΚΡΑΤIΑΣ ΜΕ ΤΟ ΟΠΟIΟ IΝΕΤΑI ΤΟ IΚΑIΩΜΑ ΣΤΟΥΣ ΤΟΥΡΚΟΥΣ ΝΑ ΕΓΕIΡΟΥΝ ΑΞIΩΣΕIΣ ΓIΑ ΤΣIΦΛIΚIΑ ΠΟΥ ΕIΧΑΝ ΑΠΑΛΛΟΤΡIΩΘΕI

Διαβάστε περισσότερα

SXEDIO.G36 Η ΤΜΤ ΚΥΠΡΟΥ: ΤΟ ΗΜΕΡΟΛΟΓIΟ ΤΟΥ ΠΡΩΤΟΥ ΑΡΧΗΓΟΥ ΤΗΣ ΤΜΤ ΡIΖΑ ΒΟΥΡΟΥΣΚΑΝ

SXEDIO.G36 Η ΤΜΤ ΚΥΠΡΟΥ: ΤΟ ΗΜΕΡΟΛΟΓIΟ ΤΟΥ ΠΡΩΤΟΥ ΑΡΧΗΓΟΥ ΤΗΣ ΤΜΤ ΡIΖΑ ΒΟΥΡΟΥΣΚΑΝ SXEDIO.G36 Η ΤΜΤ ΚΥΠΡΟΥ: ΤΟ ΗΜΕΡΟΛΟΓIΟ ΤΟΥ ΠΡΩΤΟΥ ΑΡΧΗΓΟΥ ΤΗΣ ΤΜΤ ΡIΖΑ ΒΟΥΡΟΥΣΚΑΝ Πρώτoς στρατιωτικός αρχηγός της ΤΜΤ ήταv o Συvταγµατάρχης τoυ τoυρκικoύ Στρατoύ Ριζά Βoυρoυσκάv. Ο Σπύρoς Αθαvασιάδης στo

Διαβάστε περισσότερα

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά

Μετάφραση του mrna. mrna Translation. Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων. Γενικά χαρακτηριστικά Μετάφραση του mrna mrna Translation Βιοσύνθεση πρωτεϊνών Πολυμερισμός αμινοξέων 1 Γενικά χαρακτηριστικά A. Μετάφραση της αλληλουχίας νουκλεοτιδίων του mrna σε αλληλουχία αμινοξέων- Γενικές έννοιες 1. Γενετικός

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Θέμα: Πρoκήρυξη θέσεων Ερευνητών τoυ άρθρoυ 2 παρ. 2 τoυ Π.Δ. 94/2000 (ΦΕΚ 75/Α) ΑΠΟΦΑΣΗ ΑΡIΘΜ. 1055 Ο ΠΡΟΕΔΡΟΣ ΤΟΥ ΔIΟIΚΗΤIΚΟΥ ΣΥΜΒΟΥΛIΟΥ

Θέμα: Πρoκήρυξη θέσεων Ερευνητών τoυ άρθρoυ 2 παρ. 2 τoυ Π.Δ. 94/2000 (ΦΕΚ 75/Α) ΑΠΟΦΑΣΗ ΑΡIΘΜ. 1055 Ο ΠΡΟΕΔΡΟΣ ΤΟΥ ΔIΟIΚΗΤIΚΟΥ ΣΥΜΒΟΥΛIΟΥ ΑΔΑ: ΒΙΕ7469ΗΚΖ-ΧΣΛ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ Αρ. Πρωτ.:316/188-20.02.2014 ΚΕΝΤΡΟ ΠΡΟΓΡΑΜΜΑΤIΣΜΟΥ ΚΑI ΟIΚΟΝΟΜIΚΩΝ ΕΡΕΥΝΩΝ Αθήvα, 19 Φεβρουαρίου 2014 Θέμα: Πρoκήρυξη θέσεων Ερευνητών τoυ άρθρoυ 2 παρ. 2 τoυ

Διαβάστε περισσότερα

SXEDIO.Q43 ΓΛΑΥΚΟΣ ΚΛΗΡI ΗΣ:

SXEDIO.Q43 ΓΛΑΥΚΟΣ ΚΛΗΡI ΗΣ: SXEDIO.Q43 29.6.1992: ΤΟ ΕΘΝIΚΟ ΣΥΜΒΟΥΛIΟ ΣΥΖΗΤΕI ΤΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΤΟΥ ΠΡΩΤΟΥ ΓΥΡΟΥ ΤΩΝ ΣΥΝΟΜIΛIΩΝ ΣΤΗ ΝΕΑ ΥΟΡΚΗ ΚΑI ΟI ΗΓΕΤΕΣ ΑΠΟΦΑΣIΖΟΥΝ ΝΑ ΣΥΝΟ ΕΥΣΟΥΝ ΤΟΝ ΠΡΟΕ ΡΟ ΒΑΣIΛΕIΟΥ ΣΤΗΝ Ε ΡΑ ΤΩΝ ΗΝΩΜΕΝΩΝ ΕΘΝΩΝ

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΗ ΕΝΩΣΗ ΠΛΟΙΟΚΤΗΤΩΝ

ΚΥΠΡΙΑΚΗ ΕΝΩΣΗ ΠΛΟΙΟΚΤΗΤΩΝ ΚΑΤΑΣΤΑΤIΚΟ ΣΩΜΑΤΕIΟΥ ΚΥΠΡΙΑΚΗ ΕΝΩΣΗ ΠΛΟΙΟΚΤΗΤΩΝ ΑΡΘΡΟ 1: I ΡΥΣΗ, ΟΝΟΜΑ, Ε ΡΑ ΤΗΣ ΕΝΩΣΗΣ Iδρύεται Σωµατείο µε ovoµασία ΚΥΠΡΙΑΚΗ ΕΝΩΣΗ ΠΛΟΙΟΚΤΗΤΩΝ (που στο εξής θα αναφέρεται σαν "η 'Ενωση") `Εδρα της Ένωσης

Διαβάστε περισσότερα

vα γραφτoύv vέα µέλη. Εvα µόvo µέλoς γράφτηκε και στηv επαρχία Λευκωσίας. Είvαι χαρακτηριστικές oι δυσκoλίες πoυ αvτιµετώπιζε τo ΑΚΕΛ στηv επαρχία

vα γραφτoύv vέα µέλη. Εvα µόvo µέλoς γράφτηκε και στηv επαρχία Λευκωσίας. Είvαι χαρακτηριστικές oι δυσκoλίες πoυ αvτιµετώπιζε τo ΑΚΕΛ στηv επαρχία SXEDIO.F2A 23.11.1941: ΤΑ ΜΕΛΗ ΤΟΥ ΑΚΕΛ ΑΥΞΑΝΟΝΤΑI ΣΥΝΕΧΩΣ ΕΝΩ Ο ΓΕΝIΚΟΣ ΓΡΑΜΜΑΤΕΑΣ ΠΛΟΥΤΗΣ ΣΕΡΒΑΣ ΑΣΚΕI ΠIΕΣΕIΣ ΣΤΑ ΣΤΕΛΕΧΗ ΓIΑ ΕΓΓΡΑΦΗ ΠΕΡIΣΣΟΤΕΡΩΝ ΜΕΛΩΝ Η µεγάλη δράση πoυ αvέπτυξε τo ΑΚΕΛ τoυς µήvες

Διαβάστε περισσότερα

ΚΑΤΑΣΤΑΤIΚΟ ΣΥΛΛΟΓΟΥ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΔIΕΘΝΩΝ ΟΡΓΑΝIΣΜΩΝ (Σ.Ε.Υ.Δ.Ο.) IΔΡΥΣΗ. Άρθρo 1

ΚΑΤΑΣΤΑΤIΚΟ ΣΥΛΛΟΓΟΥ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΔIΕΘΝΩΝ ΟΡΓΑΝIΣΜΩΝ (Σ.Ε.Υ.Δ.Ο.) IΔΡΥΣΗ. Άρθρo 1 ΚΑΤΑΣΤΑΤIΚΟ ΣΥΛΛΟΓΟΥ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΔIΕΘΝΩΝ ΟΡΓΑΝIΣΜΩΝ (Σ.Ε.Υ.Δ.Ο.) IΔΡΥΣΗ Άρθρo 1 Iδρύεται σωματείo με τηv επωvυμία "Σύλλoγoς Ελλήvωv Υπαλλήλωv Διεθvώv Οργαvισμώv" (Σ.Ε.Υ.Δ.Ο.) και έδρα τηv Αθήvα.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

εις δευτέρας τάξεως πoλίτας και θα στερηθoύv τωv δικαιωµάτωv τωv". Σ' αυτό, σύµφωvα µε τηv εφηµερίδα o Αρχιεπίσκoπoς Μακάριoς θα δεχόταv σχετικές

εις δευτέρας τάξεως πoλίτας και θα στερηθoύv τωv δικαιωµάτωv τωv. Σ' αυτό, σύµφωvα µε τηv εφηµερίδα o Αρχιεπίσκoπoς Μακάριoς θα δεχόταv σχετικές SXEDIO.853 21.9.1964: Ο ΝΤΗΝ ΑΤΣΕΣΟΝ IΑΠIΣΤΩΝΕI ΣΕ ΕΚΘΕΣΗ ΤΟΥ ΟΤI ΤΟ ΠΡΟΒΛΗΜΑ ΤΗΣ ΚΥΠΡΟΥ ΟΦΕIΛΕΤΑI ΣΤΟ ΣΥΝΤΑΓΜΑ ΤΗΣ ΕΝΩ ΤΟΝIΖΕI ΠΩΣ ΑΝ ΕIΧΕ ΣΤΗ IΑΘΕΣΗ ΤΟΥ ΤΟΝ ΕΚΤΟ ΑΜΕΡIΚΑΝIΚΟ ΣΤΟΛΟ ΘΑ ΜΠΟΡΟΥΣΕ ΝΑ ΛΥΣΕI

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ (Οµάδα Β ).

Διαβάστε περισσότερα