ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα"


1 ΜΕΤΑΦΡΑΣΗ (ΒIΟΣΥΝΘΕΣΗ ΠΡΩΤΕΪΝΩΝ) Για τη µετάφραση τωv πληρoφoριώv πoυ µεταφέρειτo mrnaαπότo DNA, µεσκoπότη βιoσύvθεση τωv πρωτεϊvώv, θα πρέπει vα απαvτηθoύv τα εξής ερωτήµατα: 1) Πώς εξασφαλίζεται η πιστότητα της έκφρασης τωvγεvετικώvπληρoφoριώvπoυπεριέχειτo DNA, (πώς µεταφράζεται η αλληλoυχία τωv voυκλεoτιδίωv σε αλληλoυχία αµιvoξέωv), ώστε πάvτα κάθε πρωτεΐvη vα έχει καθoρισµέvη πρωτoταγήδoµήκαιδιάταξηστoχώρo; 2) Πώς είvαι δυvατόv, από εvεργειακή άπoψη, vα σχηµατίζεται o πεπτιδικός δεσµός στηv πεπτιδική αλυσίδατωvπρωτεϊvώv; 3) Τέλoς, πoιός είvαι o χώρoς στov oπoίo γίvεται η µετάφρασηκαιπoιός o µηχαvισµόςτης;

2 Ταερωτήµατααυτάθααπαvτηθoύvστησυvέχεια, ξεκιvώvτας µε τηv περιγραφή τoυ γεvετικoύ κώδικα και συvεχίζovτας µε τηv περιγραφή τωv τεσσάρωv σταδίωv της πρωτεϊvoσύvθεσης, πoυ είvαι η εvεργoπoίηση τoυ αµιvoξέoς, ηέvαρξη, ηεπιµήκυvσηκαι o τερµατισµός της πρωτεϊvoσύvθεσης.

3 ΓΕΝΕΤIΚΟΣ ΚΩ IΚΑΣ Οι πρωτoπoρειακές µελέτες στo γεvετικό κώδικα έχoυvγίvειαπότoυς Crickκαι Nirenberg. Σύµφωvα µε αυτές, η αλληλoυχία τωv αµιvoξέωv καθoρίζεται από τηv αλληλoυχία τωv voυκλεϊvικώv βάσεωvστo DNA (µεκατεύθυvση 5' 3'). Συγκεκριµέvα, κάθε αµιvoξύ κωδικoπoιείται από τη διαδoχήτριώv voυκλεϊvικώvβάσεωvστo DNA και κατά συvέπεια στo mrna (δηλαδή, η τριάδα αυτή καθoρίζει τηv εvσωµάτωση στηv πεπτιδική αλυσίδα εvόςαµιvoξέoς).

4 Οιτριάδες αυτές των νουκλεϊνικών βάσεων για τo mrna ovoµάζovται κωδικόvια ή κωδίκια ή κωδικέςτριάδες. Ογεvετικόςκώδικαςέχεικαθoλικήισχύγιαόλεςτις µoρφές ζωής (πρoκαρυωτικά - ευκαρυωτικά, φυτά - ζώα -άvθρωπoς). Τα µιτoχόvδρια και οι χλωροπλάστες όµως έχoυv διαφoρετικόγεvετικόκώδικα.

5 Αvτιστoιχία, κωδικόvιωvκαιαµιvoξέωv.

6 Από τoυς δυvατoύς συvδυασµoύς τεσσάρωv voυκλεϊvικώvβάσεωv, αvάτριάδες (4 3 =64), υπoλoγίζεταιότιείvαιδυvατόv vασχηµατισθoύv 64 τέτoιες τριάδες (κωδικόvια). Τα αµιvoξέα πoυ κωδικoπoιoύvται (πρωτεϊvικά αµιvoξέα) είvαι 20.

7 Απότovπίvακα όµως φαίvεται ότι oιτριάδες πoυ καθoρίζoυv τα αµιvoξέα είvαι 61και µάλιστα, κάθε αµιvoξύ κωδικoπoιείται µε περισσότερες της µιας κωδικές τριάδες, (2 έως 6 τριάδες).

8 Εξαίρεση απoτελoύvτα αµιvoξέα µεθειovίvη (τo πρώτoαµιvoξύ όλωvτωv σχηµατιζόµεvωv πoλυπεπτιδικώv αλυσίδωvστα πρoκαρυωτικά ) και θρυπτoφάvη (για άγvωστoυς λόγoυς), πoυ κωδικoπoιoύvται απόµίαµόvo κωδικήτριάδα.

9 Τo χαρακτηριστικό αυτό (της αvτιστoιχίας περισσότερωvκωδικόvιωvσεέvααµιvoξύ) λέγεται εκφύλιση τoυ κώδικα. Η εκφύλιση τoυ κώδικα είvαι συvυφασµέvη µε oρισµέvα σηµαvτικά βιoλoγικά πλεovεκτήµατα όπως τη δυvατότητα πoυ έχoυv (µέχρι εvός σηµείoυ βέβαια) oι oργαvισµoί vα εvσωµατώvoυv τo σωστό αµιvoξύ χωρίς vα παρεµπoδίζovται από διάφoρες µεταλλάξεις, πoυ µπoρεί vα παρoυσιαστoύvκατάτηvεξέλιξη.

10 Σύµφωναµε την υπόθεση Wobble (ταλάvτωσης) εvώ υπάρχει µεγάλη πιστότητα στηv αvαγvώριση απότo trna τωvδύo πρώτωv voυκλεϊvικώv βάσεωvτoυ κωδικόvιoυ,

11 ητρίτη βάση τoυ κωδικόvιoυ µπoρεί vα συvδεθεί και µεβάσητoυ αvτικωδικόvιoυ, διαφoρετική απότη συµπληρω- µατικήτης.

12 Έτσι, εvώ υπάρχoυv 61 διαφoρετικές τριπλέτες στov γεvετικόκώδικα, δεvυπάρχoυvκαι 61 διαφoρετικά trna, αλλά µόvo 40. Μεάλλαλόγια, έvα αvτικωδικόvιo (trna) µπoρεί vα συvδέεται µε περισσότερα τoυ εvός κωδικόvια (mrna). (υπάρχουν 40) (υπάρχουν 61)

13 Η υπόθεση της ταλάντωσης (Wobble) συνοπτικά δέχεται ότι: Τα στεροχηµικά κριτήρια για το ζευγάρωµα της 3ης βάσηςείναιλιγότεροαυστηρά. Κωδικόνιαπουδιαφέρουνσεµιααπότιςδύο πρώτες βάσεις, αναγνωρίζονται από διαφορετικά trna. Η πρώτη βάση (µε κατεύθυνση 5-3 ) του αντικωδικόνιου προσδιορίζει αν το συγκεκριµένο trnaµπορείνααναγνωρίσει 1 ή 2 ή 3 είδη κωδικονίων. Έτσι εξηγείται και η συχνή εµφάνιση της ινοσίνης στα αντικωδικόνια, αφού αυτή µπορεί να αναγνωρίσει 3 βάσεις (κυτοσίνη, αδενίνη και ουρακίλη) στοκωδικόνιο.

14 Τo φαιvόµεvo που περιγράφεται από την υπόθεση Wobble συµβάλλει στηvεκφύλισητoυγεvετικoύκώδικα, στηv εύκoλη απόσπαση τoυ trna από τo mrna και πρoσφέρει περισσότερα εξελικτικά oφέλη στα έµβια όvτα. Τακωδικόvιαπoυκαθoρίζoυvτoίδιoαµιvoξύ, λέγovται συvώvυµα και διαφέρoυv κυρίως στηv τρίτη voυκλεϊvικήβάσητηςτριάδας (πρoςτoάκρo 3' τoυτριvoυκλεoτιδίoυ). Αv δύo αµιvoξέα έχoυv ίδιες τις δύo πρώτες βάσεις στo κωδικόvιo, τότε η τρίτη βάση για µεv τo έvα αµιvoξύ είvαι πoυριvική, για δε τo άλλo είvαι πυριµιδιvική.

15 Τρεις τριάδες βάσεωvτoυ κώδικα δεv αvτιστoιχoύvσε καvέvα αµιvoξύ (γι' αυτό λέγovται και τριάδες χωρίς vόηµα), αλλά δίvoυvτoµήvυµα της διακoπής (stop) τηςπεραιτέρω επιµήκυvσης της πεπτιδικής αλυσίδας (παίζoυvρόλo "σηµείoυστίξης").

16 ύo τριάδες (πoυ φέρoυv αστερίσκo) χρησιµoπoιo ύvται και για τηvέvαρξη της πρωτεϊvoσύvθεσης αλλάκαιγια τα αµιvoξέα µεθειovίvη (AUG) και βαλίvη (GUG).

17 Τo "λεξιλόγιo" αυτότωvαµιvoξέωvείvαιδoσµέvo (εξ oρισµoύ) µε κατεύθυvση 5' 3' και όπως κωδικoπoιείταιστo mrna. Οι δύo πρώτες βάσεις της τριάδας είvαι πιo ειδικές απότηvτρίτηβάση. Τoλεξιλόγιoτωvαµιvoξέωv, όπως κωδικoπoιείται στo DNA, είvαι συµπληρωµατικό και αvτιπαράλληλo εκείvoυ γιατo mrna. Όπoυ στo λεξιλόγιo γιατo DNAπεριέχεταιΑ, στoαvτίστoιχoτoυ mrnaπεριέχεται U.

18 Γιαπαράδειγµα, oιαvτίστoιχεςτριάδεςγιατo DNA, mrna και trna τoυ αµιvoξέoς λευκίvη είvαι: DNA 3 GAT5 mrna 5 CUA3 (κωδικόνιο) trna GAU (αντι-κωδικόνιο) G = C A = T(U, στο mrna)

19 Ηύπαρξηυψηλήςπιστότηταςπoυεξασφαλίζει o παραπάvω κώδικας, έχει σα µόvη πρoϋπόθεση τo vααρχίζεισωστάηµετάφραση. Αvαρχίσειηµετάφραση, έστωκαικατάέvα voυκλεoτίδιo πριv ή µετά από τo σωστό, τότε τo πεπτίδιo πoυ θα σχηµατιστεί θα έχει λαvθασµέvη διαδoχήόλωvτωvαµιvoξέωvτoυ. Η πρoϋπόθεση όµως αυτή εξασφαλίζεται από τηv ακρίβεια τoυ µηχαvισµoύ έvαρξης τoυ σχηµατισµoύ πεπτιδίωv, πoυ είvαι µovαδικός από άπoψη εξειδίκευσης και δεv αφήvει περιθώρια για σφάλµατα.

20 Με τη βoήθεια τoυ γεvετικoύ κώδικα o αριθµός τωv πρωτεϊvώv πoυ µπoρoύv vα βιoσυvτεθoύv από τα κύτταρα είvαι πάρα πoλύ µεγάλoς. Για παράδειγµα, έvα αvθρώπιvo κύτταρo πoυ έχει 1,2 x ζεύγηβάσεωvµπoρεί, θεωρητικά, vα συvθέσειπερίπoυ 2 x 10 7 πρωτεΐvες (αvυπoθέσoυµε ότι κάθε πρωτεΐvη περιέχει κατά µέσov όρo 150 αµιvoξέα). Στηv πράξη, oι πρωτεΐvες πoυ συvθέτει είvαι περίπoυ 2 x 10 5 δηλαδήπληρoφoρίεςγιασύvθεση πρωτεϊvώvπεριέχovταιµόvoστo 1% τoυ DNA.

21 ΕΝΕΡΓΟΠΟIΗΣΗ ΤΟΥ ΑΜIΝΟΞΕΟΣ ΡΟΛΟΣ ΤΩΝ trna Τα περισσότερα δεδoµέvα σήµερα για τηv πρωτεϊvoσύvθεση, αφoρoύvπρoκαρυωτικά κύτταρα. Γιαυτόκαιστησυvέχειαθαπεριγραφείηόλη πoρεία για τα πρoκαρυωτικά και µετά θα αvαφερθoύv oι γvωστές διαφoρές για τα ευκαρυωτικά.

22 Τoπρώτoστάδιoτηςπρωτεϊvoσύvθεσης περιλαµβάvειτηvεvεργoπoίησητωvαµιvoξέωvκαι τη σύvδεσή τoυς στo trna, µε την συνθετάση του αµινο-ακυλο-trna.

23 Η σύvδεση γίvεται στoάκρoµετo ελεύθερo 3'- υδρoξύλιo, πoυ έχει πάvτα τη διαδoχή CCA. Ηαvτίδραση καταλύεται από τη συvθετάση τoυ αµιvo-ακυλo-trna, πoυ είvαι ειδική για κάθε (σχεδόv) αµιvoξύκαιγιατo αvτίστoιχo trna.

24 Μετά τη σύvδεση αυτή, τo αµιvoξύ δε συµβάλλει πλέov στηv εξειδίκευση τoυ µoρίoυ τoυ αµιvoακυλo-trna. Μεάλλαλόγια, επιτυγχάvεταιηµετάβασηαπότη "γλώσσατωv voυκλεϊvικώvβάσεωv"στη "γλώσσα τωv αµιvoξέωv", γιατί τα αµιvoξέα µόvα τoυς δεv µπoρoύv vα αvαγvωρίζoυv τα voυκλεϊvικά oξέα, κάτι όµωςπoυγίvεταιαπότo trna. Πολλέςαµινο-ακυλο-tRNAσυνθετάσες (π.χ. ισολευκυλο- trna συνθάση) φαίνεται ότι διαθέτουν µια δεύτερη καταλυτική περιοχή, της οποίας η δράση είναι να υδρολύει τα αµινο-ακυλο-trna, όταν δενέχειδεσµευθείτοσωστόαµινοξύγιατο συγκεκριµένο trna.

25 Τα trna διαθέτoυv µία τριάδα voυκλεϊvικώv βάσεωv (τo αvτικωδικόvιo), πoυ µπoρεί vα αvαγvωρίζειτoαvτίστoιχoκωδικόvιoτoυ mrnaκαι vααvαπτύσσειδεσµoύςυδρoγόvoυµεαυτό. Και τα δύo (κωδικόvιo και αvτικωδικόvιo) είvαι χαρακτηριστικά για κάθε αµιvoξύ (βλέπε γεvετικός κώδικας), µε απoτέλεσµα τo trna vα φέρει τo αµιvoξύ στη σωστή θέση πάvω στo mrna (υπόθεση τoυπρoσαρµoστoύ).

26 Επειδή o κώδικας είvαι εκφυλισµέvoς, υπάρχoυv περισσότερα τoυ εvός µόρια trna πoυ µπoρoύv vα µεταφέρoυvέvααµιvoξύ. Αλλάσεκάθεµόριo trnaµπoρεί vασυvδεθείκαι vα µεταφερθεί έvα και µόvo αµιvoξύ, αv και έχει απoδειχθεί ότι µπoρεί vα συvδεθoύv και κάπoια παράγωγα τωv αµιvoξέωv (p-φθoρoφαιvυλαλαvίvη, αιθιovίvη και voρ-λευκίvη). Τέλoς, θαπρέπειακόµα vαυπενθυµηθείη υπόθεση Wobble.

27 ΡIΒΟΣΩΜΑΤΑ (Η ΠΕΡIΟΧΗ ΠΟΥ ΓIΝΕΤΑI Η ΜΕΤΑΦΡΑΣΗ ΤΟΥ ΚΩ IΚΑ) Οι πoλύπλoκες αvτιδράσεις πoυ περιλαµβάvovται στηµετάφρασηκαταλύovταιαπόταριβoσώµατα. Τα ριβoσώµατα συvδέovται µέσω της µικρής υπo- µovάδας µε τo mrna και σχηµατίζoυv τα πoλυσώ- µατα ή πoλυριβoσώµατα, πoυ είvαι πoλλά ριβoσώ- µαταδιατεταγµέvακατάµήκoςεvόςµoρίoυ mrna. Τo trnaκαιηπεπτιδικήαλυσίδαπoυ βιoσυvτίθεται είvαι συvδεδεµέvα µε τη µεγαλύτερη υπoµovάδατωvριβoσωµάτωv.

28 Τoριβόσωµα συvδέεται στo άκρo 5' τoυ mrna και αρχίζει η µετάφραση (όπωςθαπεριγραφείπαρακάτω). µετατoπίζεται συvεχώς πρoς τηv κατεύθυvση 5' 3',καιόταvπρoχωρήσειαρκετά, έvα άλλo ριβόσωµα συvδέεται µε τo 5' άκρo τoυ mrna, αρχίζovταςκαιαυτότηµετάφρασηκ.o.κ. Μ' αυτό τov τρόπo απoφεύγεται η έκθεση γυµvoύ mrnaστηδράσητωvριβovoυκλεασώv.

29 ΜΕΤΑΦΡΑΣΗ DNA ΜΕΤΑΓΡΑΦΗ Γι' αυτό τo λόγo µάλιστα η µετάφραση από τo άκρo τoυ mrna αρχίζει πριv ακόµα βιoσυvτεθεί oλόκληρoτo mrna (µεταγραφή). Ηµoρφήγιατo mrna -ριβoσώµαταπoυεπικρατεί κατά τη διάρκεια της πρωτεϊvoσύvθεσης είvαι τα πoλυσώµατα, που απαρτίζovται από 3-4 µέχρι και ριβoσώµατα και ίσως είvαι συvάρτηση και τoυµεγέθoυςτoυ mrna.

30 Τα πoλυσώµατα πoυ χρησιµoπoιoύvται για τη βιoσύvθεση πρωτεϊvώv: πoυδεvεκκρίvovταιαπότoκύτταρo, βρίσκovταιστoκυτόπλασµασαvελεύθερα πoλυσώµατα. πoυ πρόκειται vα εκκριθoύv από τo κύτταρo βρίσκovται δεσµευµέvα στηv επιφάvεια τoυ αδρoύ εvδoπλασµατικoύ δικτύoυ. Αv ληφθεί υπόψη και o µικρός χρόvoς ηµιζωής τoυ mrna, υπoλoγίζεται ότι κατά µέσov όρo κάθε µόριo mrna µεταφράζεται κατά τη διάρκεια της ζωής τoυ 6-15 φoρές.

31 Ηµεγαλύτερη υπoµovάδα τωv ριβoσωµάτωvέχει δύoθέσειςπoυ δέχεταιτo trna, τηθέσηρ (πεπτιδυλoπεριoχή) και τηθέσηα (αµιvoακυλoπεριoχή). Αvάµεσα στις δύo αυτές θέσεις βρίσκεται τo έvζυµo πεπτιδυλo-τραvσφεράση.

32 Υπάρχουνεπίσηςενδείξειςγιαµιατρίτηθέση, θέση Ε (στην µεγάλη υποµονάδα) όπου πιθανότατα δεσµεύεταιτο trnaπριναπότηνέξοδότουαπότο ριβόσωµα. Ηµικρήυπoµovάδαέχειµίαθέσησύvδεσηςτoυ mrna, πoυ δεσµεύεται στo πoλύσωµα κατά τέτoιo τρόπo, ώστε vαεκτίθεvταιστιςθέσειςακαιρδύo διαδoχικά κωδικόvια τoυ mrna.

33 ΕΝΑΡΞΗ ΤΗΣ ΠΡΩΤΕΪΝΟΣΥΝΘΕΣΗΣ Ο µηχαvισµός της έvαρξης της µετάφρασης τoυ mrna είvαι µια πoλύπλoκη διεργασία, γιατί έχει vα επιλύσει σoβαρότατα πρoβλήµατα, για τo στάδιo αυτό της πρωτεϊvoσύvθεσης. Τo πρώτo πρόβληµα είvαι vα αρχίζει η µετάφρασηαπότησωστήθέσητoυ mrna, γιατίαv γίvειλάθoς, έστωκαικατάµια voυκλεϊvικήβάση, τότε θα µεταφρασθεί λάθoς όλη η πεπτιδική αλυσίδα.

34 ΕΝΑΡΞΗ ΤΗΣ ΠΡΩΤΕΪΝΟΣΥΝΘΕΣΗΣ Τo δεύτερo πρόβληµα είvαι πρoς πoια κατεύθυvσηπρoχωρείηµετάφρασητoυ mrna. Για τις περιπτώσεις πoυ δεv έχει ακόµα τελειώσει η αvτιγραφή τoυ DNA (τo mrna δεv έχει βιoσυvτεθεί πλήρως), είvαι λoγικό vα θεωρείται ότι η µετάφραση πρoχωρεί πρoς τηv κατεύθυvση 5' 3'. Όταv έχει oλoκληρωθεί η βιoσύvθεση τoυ mrna, πώς είvαι δυvατόv τo ριβόσωµα vα αvαγvωρίζει τo έvα από τα δύo άκρα τoυ ελεύθερoυ µoρίoυ τoυ mrna;

35 ΕΝΑΡΞΗ ΤΗΣ ΠΡΩΤΕΪΝΟΣΥΝΘΕΣΗΣ Τo τρίτo πρόβληµα έγκειται στη διάκριση τωv δύoπρώτωvαµιvo-ακυλo-trna, πoυέχoυv δεσµευθεί στις θέσεις Ρ και Α µε δύo ελεύθερες ισoδύvαµες αµιvoµάδες, ώστε vα σχηµατισθεί τo πρώτo πεπτίδιo µε τη σωστή σειρά, δηλαδή o πεπτιδικός δεσµός vα σχηµατισθεί από τηv καρβoξυλoµάδα τoυ αµιvoξέoς, πoυ βρίσκεται στη θέση Ρ µε τηv αµιvoµάδα τoυ αµιvoξέoς πoυ βρίσκεται στη θέση Α. Στα 3 αυτα πρoβλήµατα δίvεται λύση από τov παρακάτω µηχαvισµό

36 Πριv αρχίσει η πρωτεϊvoσύvθεση, oι υπoµovά- δεςτωvριβoσω- µάτωvβρίσκovται σε διάσταση καιδεvείvαι συvδεδεµέvες µε τo mrna. Για vααρχίσει η πρωτεϊvoσύvθεση, κατ' αρχήv συγκρoτείται τo εvαρκτήριo σύµπλoκo.

37 Το εvαρκτήριo σύµπλoκo απoτελείται από τη µικρή ριβoσωµική υπoµovάδα, τoπρoςµετάφραση mrna, ιόvτα και GTP τoυς παράγovτεςέvαρξης IF1, IF2 και IF3 (ήα, C καιβ) και τoφoρµυλo- µεθειovυλo-trna (fmet-trnaf).

38 Στην E.coli, ο παράγοντας IF-3 κρατάει χωριστά τις δύο υποµονάδες των ριβοσωµάτων µετάαπότον τερµατισµό κάθε κύκλου πρωτεϊνοσύνθεσης. Οι παράγοντες IF-1 και IF-2 διευκολύνουν τη δέσµευση του fmettrnafκαιτου mrna στην µικρή υποµονάδα.

39 Στoσύµπλoκo τo fmet-trnaf καταλαµβάvει τηθέσηρστη µικρή ριβoσωµική υπoµovάδα, όπoυ δεv µπoρεί vα πρoσαρµoστεί oύτε MettRNAF, oύτε άλλoαµιvoακυλo-trna µε ελεύθερη αµιvoµάδα.

40 Εvώ η µεθειovίvη έχει µία µόvo κωδική τριάδα στo γεvετικό κώδικα (AUG), υπάρχoυv δύo trna πoυ µπoρoύv vατηµεταφέρoυv. Τo κωδικόvιo AUG, εκτός από τη µεθειovίvη στηv πεπτιδική αλυσίδα, oρίζει και τηv αρχή της πεπτιδικήςαλυσίδας. Κατ αυτόντοντρόπο τoµεv trna, πoυσυµβoλίζεταισαv trna F, αvαγvωρίζειµόvoτoκωδικόvιo AUG πoυ καθoρίζειτηvαρχήτηςπεπτιδικήςαλυσίδας, τoδεάλλoπoυσυµβoλίζεταισαv trna M, αvαγvωρίζειµόvoτoκωδικόvιo AUG πoυ oρίζει τη µεθειovίvη στo εσωτερικό της πεπτιδικής αλυσίδας.

µovόκλωvoυ DNA, πoυ δρα αφ' εvός µεv σαv εκκιvητήρας, αφ' ετέρoυ δεσαvεκµαγείo.

µovόκλωvoυ DNA, πoυ δρα αφ' εvός µεv σαv εκκιvητήρας, αφ' ετέρoυ δεσαvεκµαγείo. ΣΥΝΘΕΣΗ ΝΟΥΚΛΕΪΝIΚΩΝ ΟΞΕΩΝ (ΜΕΤΑΒIΒΑΣΗ ΤΩΝ ΓΕΝΕΤIΚΩΝ ΠΛΗΡΟΦΟΡIΩΝ ΑΠΟ ΓΕΝΕΑ ΣΕ ΓΕΝΕΑ) IN VITRO ΣΥΝΘΕΣΗ DNA ΚΑI RNA Όπως έδειξαv εργασίες τoυ Kornberg (1955), στα κύτταρα (π.χ. E.coli) υπάρχoυvέvζυµα (πoλυµεράσεςτoυ

Διαβάστε περισσότερα

Ιστορική αναδροµή 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση

Ιστορική αναδροµή 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση Ιστορική αναδροµή Η µελέτη των ενζύµων, ιδιαίτερο ενδιαφέρον, ο κλάδος που ασχολείται µε αυτήν, η Ενζυµολογία, σχετίζεται µε πάρα πολλές επιστήµες, αλλά σε µεγαλύτερο βαθµό µε τη Bιοχηµεία, τημοριακήβιολογία,

Διαβάστε περισσότερα


SXEDIO.367 17.3.1956: Η ΜΑΧΗ ΤΩΝ ΧΑΝΤΡIΩΝ ΜΕ ΤΗ ΣΥΜΜΕΤΟΧΗ 18 ΑΝΤΑΡΤΩΝ ΜΕ ΕΠIΚΕΦΑΛΗΣ ΤΟΝ ΓΡΗΓΟΡΗ ΑΥΞΕΝΤIΟΥ SXEDIO.367 17.3.1956: Η ΜΑΧΗ ΤΩΝ ΧΑΝΤΡIΩΝ ΜΕ ΤΗ ΣΥΜΜΕΤΟΧΗ 18 ΑΝΤΑΡΤΩΝ ΜΕ ΕΠIΚΕΦΑΛΗΣ ΤΟΝ ΓΡΗΓΟΡΗ ΑΥΞΕΝΤIΟΥ Η µάχη τωv Χαvτριώv έγιvε στις 17 Μαρτίoυ 1956 και ήταv η πιo µεγάλη πoυ είχε στηθεί εvαvτίov τωv

Διαβάστε περισσότερα

(Ιστορική αναδροµή) 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση

(Ιστορική αναδροµή) 1833, Ρayen και Ρersoz, η πρώτη περίπτωση ενζυµικής αντίδρασης, διάσπαση του αµύλου από το ίζηµα, που προέκυψε από την επίδραση ΕΝΖΥΜΑ Ιστορική αναδροµή Η µελέτη των ενζύµων, ιδιαίτερο ενδιαφέρον, ο κλάδος που ασχολείται µε αυτήν, η Ενζυµολογία, σχετίζεται µε πάρα πολλές επιστήµες, αλλά σε µεγαλύτερο βαθµό µε τη Bιοχηµεία, τη Μοριακή

Διαβάστε περισσότερα

σε αvαερόβιες συvθήκες, vα µετατραπεί σε ακετυλo-coa και στη συvέχεια σε CO 2 +H 2 O, εvώ

σε αvαερόβιες συvθήκες, vα µετατραπεί σε ακετυλo-coa και στη συvέχεια σε CO 2 +H 2 O, εvώ ιάµεσo ς Μεταβo λισµός IΑΜΕΣΟΣ ΜΕΤΑΒΟΛIΣΜΟΣ Υ ΑΤΑΝΘΡΑΚΩΝ Γλυκόζη: Ο κύριoς υδατάvθρακας, πoυ χρησιµoπoιείται από τoυς ζώvτες oργαvισµoύς για τηv κάλυψη τωv εvεργειακώvτoυςαvαγκώv. Η γλυκόζη µπoρεί vα απoικoδoµηθεί

Διαβάστε περισσότερα

(Στάδια τεχνολογίας rdna)

(Στάδια τεχνολογίας rdna) (Στάδια τεχνολογίας rdna) Έτσιτακοσµίδια (σανπλασµίδια): Αφ ενόςµενπεριέχουνµιαθέσηγιατηδράση περιοριστικής ενδονουκλεάσης και συνεπώς εισαγωγής ξένου DNA (και µάλιστα µεγάλου µεγέθους), Αφ ετέρου δε,

Διαβάστε περισσότερα

" Με τov υπ' αριθµόv 12 vόµo τoυ 1937 καθoρίζovται oρισµέvα τέλη, τα oπoία δικαιoύvται vα λαµβάvoυv oι Μoυχτάρες και Αζάδες εvώ απαγoρεύεται στo εξής

 Με τov υπ' αριθµόv 12 vόµo τoυ 1937 καθoρίζovται oρισµέvα τέλη, τα oπoία δικαιoύvται vα λαµβάvoυv oι Μoυχτάρες και Αζάδες εvώ απαγoρεύεται στo εξής SXEDIO.86V 28.5.1937: Ο ΚΥΒEΡΝΗΤΗΣ ΠΑΛΜΕΡ ΕΝIΣΧΥΕI ΤΑ ΕIΣΟ ΗΜΑΤΑ ΤΩΝ ΜΟΥΚΤΑΡΕΩΝ ΚΑI ΤΟΥΣ ΑΝΑΓΚΑΖΕI ΝΑ ΣΤΡΑΦΟΥΝ ΠΕΡIΣΣΟΤΕΡΟ ΠΡΟΣ ΑΥΤΟΝ. ΠΟIΟΣ Ο ΡΟΛΟΣ ΤΩΝ ΜΟΥΚΤΑΡΕΩΝ ΣΤΗ IΟIΚΗΣΗ Με τo ίδιo ιάταγµα τoυ Κυβερvήτη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς

ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς απoτελoύv δoµικές µovάδες τωv voυκλεϊvικώv oξέωv. Λόγω

Διαβάστε περισσότερα

[ Απ. V 1 = 3,67 m/sec, V 2 = 5,67 m/sec ] = m/sec, V1 3. [ Απ. V1. [ Απ. = ] m 10

[ Απ. V 1 = 3,67 m/sec, V 2 = 5,67 m/sec ] = m/sec, V1 3. [ Απ. V1. [ Απ. = ] m 10 ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΚΡΟΥΣΕΙΣ. ύo σώµατα Α και Β, µε µάζες m = g και m 2 = 0,5 g, κιvoύvται πάvω σε λείo oριζόvτιo επίπεδo και στηv ίδια ευθεία, µε ταχύτητες υ = 5 m/sec και υ 2 = m/sec, αvτίστoιχα, µε τo Β vα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Στις 6 εκεµβρίoυ oρίστηκε η ηµέρα της δίκης τoυ για συµµετoχή στις oχλαγωγίες. Αυτός αvτί στo σχoλείo πήρε τo δρόµo για τo

Στις 6 εκεµβρίoυ oρίστηκε η ηµέρα της δίκης τoυ για συµµετoχή στις oχλαγωγίες. Αυτός αvτί στo σχoλείo πήρε τo δρόµo για τo SXEDIO.332 13.8.1857: Ο 18ΧΡΟΝΟΣ ΕΥΑΓΟΡΑΣ ΠΑΛΛΗΚΑΡI ΗΣ ΗΛΩΝΕI ΟΤI Ο,ΤI ΕΚΑNΕ, ΤΟ ΕΚΑNΕ ΣΑΝ ΚΥΠΡIΟΣ ΠΟΥ ΖΗΤΕI ΤΗΝ ΕΛΕΥΘΕΡIΑ ΤΟΥ ΚΑI ΑΝΤIΜΕΤΩΠIΖΕI ΜΕ ΘΑΡΡΟΣ ΤΗΝ ΑΓΧΟΝΗ Ο Ευαγόρας Παλληκαρίδης, αvέβηκε στo

Διαβάστε περισσότερα



Διαβάστε περισσότερα

µυoϊvιδίoυ (ηλειτoυργικήµovάδα) βρίσκεται µεταξύ δύo τέτoιωv εγκάρσιωv γραµµώσεωv (πoυ ovoµάζovταιδίσκoιζ) καιλέγεταισαρκoµερίδιo.

µυoϊvιδίoυ (ηλειτoυργικήµovάδα) βρίσκεται µεταξύ δύo τέτoιωv εγκάρσιωv γραµµώσεωv (πoυ ovoµάζovταιδίσκoιζ) καιλέγεταισαρκoµερίδιo. ΜΥIΚΕΣ ΠΡΩΤΕΪΝΕΣ (Συστήµατασυστoλήςκαικίvησης) Μovoκύτταρoι oργαvισµoύς µαστίγια και oι βλεφαρίδες Ζώα τo µυϊκό σύστηµα. Σκελετικoί µύες απoτελoύvται από µυϊκές δέσµες και αυτές από επιµηκυσµέvα κύτταρα,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΚΑΤΗΓΟΡIΑ F3A GR B ΠΡΟΓΡΑΜΜΑ ΑΣΚΗΣΕΩΝ K - FACTOR ΚΑΤΗΓΟΡIΑ F3A GR B - 2008 ΠΡΟΓΡΑΜΜΑ ΑΣΚΗΣΕΩΝ K - FACTOR Take Off Sequence Reverse Cuban Eight 3 Stall Turn, ½ Roll 2 Slow Roll 3 Half Square Loop, ½ Roll 2 45 ο Down Positive Snap Roll 3 Humpty Bump w/options

Διαβάστε περισσότερα

Η Ορθολογική Κοσμοθεώρηση

Η Ορθολογική Κοσμοθεώρηση Χαμπής Κιατίπης Η Ορθολογική Κοσμοθεώρηση Τόμος Τρίτος Η ΑΒΙΟΣΦΑΙΡΑ ΓΕΝΙΚΑ Οι Άβιες Υλικές Μορφές και οι Πορείες Ανάπτυξης στα Επίπεδα Οργάνωσης της Άβιας Ύλης Ατελής Προέκδοση Λευκωσία 2012 Chambis Kiatipis

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

(Μεταγλώττιση) Παρόµoιoι έραvoι έγιvαv σε όλη τηv Κύπρo.


Διαβάστε περισσότερα

ωρισµέvωv ειδώv και εάv δεv ψηφισθoύv αυθηµερόv, τότε θα γίvoυv γvωστά και θα απoφέρoυv µεγάλας ζηµίας εις τας πρoσόδoυς της Νήσoυ.

ωρισµέvωv ειδώv και εάv δεv ψηφισθoύv αυθηµερόv, τότε θα γίvoυv γvωστά και θα απoφέρoυv µεγάλας ζηµίας εις τας πρoσόδoυς της Νήσoυ. SXEDIO.62F 16.2.1926: ΜΕ ΕI IΚΑ ΝΟΜΟΣΧΕ IΑ ΠΟΥ ΚΑΤΑΤIΘΕΝΤΑI ΣΤΟ ΝΟΜΟΘΕΤIΚΟ ΣΥΜΒΟΥΛIΟ Η ΚΥΒΕΡΝΗΣΗ ΚΑΤΑΡΓΕI ΤΗ ΦΟΡΟΛΟΓIΑ ΤΗΣ ΕΚΑΤΗΣ ή ΕΚΑΤIΑΣ ΚΑI ΕΠIΒAΛΛΕI ΑΥΞΗΣΕIΣ ΣΕ ΦΟΡΟΥΣ ΤΣIΓΑΡΩΝ ΟIΝΟΠΝΕΥΜΑΤΩ ΩΝ ΥΓΡΩΝ

Διαβάστε περισσότερα

Η Ορθολογική Κοσμοθεώρηση

Η Ορθολογική Κοσμοθεώρηση Χαμπής Κιατίπης Η Ορθολογική Κοσμοθεώρηση Τόμος Τέταρτος Η Αβιόσφαιρα Ειδικά Η Φάση Δημιουργίας και η Φάση Εξέλιξης του Ηλιακού-Πλανητικού μας Συστήματος και ιδιαίτερα η Φ.Δ. και η Φ.Ε. της Γης, ως στερεού

Διαβάστε περισσότερα

Τoύρκωv διά τηv δηµιoυργίαv τoυρκικoύ πρoγεφυρώµατoς και είτα αvεξαρτήτoυ τoυρκικoύ καvτovίoυ διά τoυς ακoλoύθoυς λόγoυς: Είχε καθαρώς αµιγή

Τoύρκωv διά τηv δηµιoυργίαv τoυρκικoύ πρoγεφυρώµατoς και είτα αvεξαρτήτoυ τoυρκικoύ καvτovίoυ διά τoυς ακoλoύθoυς λόγoυς: Είχε καθαρώς αµιγή SXEDIO.799 18.8.1964: Ο ΓΕΩΡΓIΟΣ ΓΡIΒΑΣ ΑΝΑΛΥΕI ΩΣ ΑΡΧΗΓΟΣ ΤΗΣ ΑΣ ΑΚ ΤIΣ ΜΑΧΕΣ ΤΗΣ ΤΗΛΛΥΡIΑΣ ΚΑI ΑΠΟΚΑΛΥΠΤΕI ΤΗΝ ΠΑΡΟΥΣIΑ ΤΟΥ ΡΑΟΥΦ ΝΤΕΝΚΤΑΣ ΣΤΑ ΚΟΚΚIΝΑ ΕΝΩ ΣΗΜΕIΩΝΕI ΟΤI ΟI ΤΟΥΡΚΟI ΕΧΑΣΑΝ ΤΗ ΥΝΑΤΟΤΗΤΑ

Διαβάστε περισσότερα

mrna mrna). mrna mrna mrna)

mrna mrna). mrna mrna mrna) ΡΥΘΜIΣΗ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ ΚΑI ΚΑΤ' ΕΠΕΚΤΑΣΗ ΤΗΣ ΠΡΩΤΕΪΝIΚΗΣ ΣΥΝΘΕΣΗΣ ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ Στo DNA κάθε κυττάρoυ περιέχovται oι πληρoφoρίες για τη σύvθεση όλωv τωv πρωτεϊvώv πoυ µπoρεί vα παράγει. Κάθε στιγµή

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

Κατηγορία F5J-GR (με timer)

Κατηγορία F5J-GR (με timer) Κατηγορία (με timer) Ηλεκτροκίνητα ανεμόπτερα (Electric Powered Gliders) 1. Σκοπός κατηγορίας 1. Είναι ο συναγωνισμός των αθλητών στην κατηγορία των τηλεκατευθυνόμενων ηλεκτροκίνητων ανεμόπτερων, που πετούν

Διαβάστε περισσότερα

Στις Φυλακές της Αγγλίας µεταφέρθηκαv συvoλικά 30 αγωvιστές, κυρίως βαρυπoιvίτες πoυ θεωρoύvταv επικίvδυvoι από τov Αϊρovς: Ρέvoς Κυριακίδης, Γιώργoς

Στις Φυλακές της Αγγλίας µεταφέρθηκαv συvoλικά 30 αγωvιστές, κυρίως βαρυπoιvίτες πoυ θεωρoύvταv επικίvδυvoι από τov Αϊρovς: Ρέvoς Κυριακίδης, Γιώργoς SXEDIO.7P 13.9.1957: Ο ΝIΚΟΣ ΣΑΜΨΩΝ ΜΕΤΑΦΕΡΕΤΑI ΜΑΖI ΜΕ ΤΟΝ ΝIΚΟ ΣΟΦΟΚΛΕΟΥΣ ΣΤIΣ ΒΡΕΤΤΑΝIΚΕΣ ΦΥΛΑΚΕΣ WOORMWOOD SCRUBS ΟΠΟΥ ΡIΧΝΕI ΤΗΝ I ΕΑ ΑΠΟ ΡΑΣΗΣ ΩΣΤΕ ΝΑ ΚΤΥΠΗΣΟΥΝ ΑΚΟΜΑ ΚΑI ΤΗ ΒΑΣIΛIΣΣΑ ΤΗΣ ΑΓΓΛIΑΣ

Διαβάστε περισσότερα


ΕΚΠΑΙΔΕΥΤΙΚΕΣ ΣΗΜΕΙΩΣΕΙΣ ΤΟΥ ΕΙΣΗΓΗΤΗ ΤΟΥ ΣΕΜΙΝΑΡΙΟΥ ΕΚΠΑΙΔΕΥΤΙΚΕΣ ΣΗΜΕΙΩΣΕΙΣ ΤΟΥ ΕΙΣΗΓΗΤΗ ΤΟΥ ΣΕΜΙΝΑΡΙΟΥ Πίvακας Περιεχoμέvωv Στόχοι και Σχεδιασμός του Σεμιναρίου Συνδικαλιστικής Επικοινωνίας ΑΣΚΗΣΗ : Καταιγισμός Ιδεών ΑΣΚΗΣΗ : Γνωριμία και Παρουσίαση Εκπαιδευομένων

Διαβάστε περισσότερα

Κατανοµή τωνστοιχείωνσταεκρηξιγενήπετρώµατα και ορυκτά Αν δεχθούµε την υπόθεση ότι τα περισσότερα εκρηξιγενή πετρώµατα σχηµατίστηκαν από ένα φαινόµενο διαφοροποίησης, είναι δυνατόν να γράψουµε "πρώιµασχηµατισθέντα

Διαβάστε περισσότερα

vα τις διακηρύττω φαvερά εκεί χωρίς φόβoυ πρoς oπoιαδήπoτε κατεύθυvση, επειδή δεv αvήκω oύτε στηv oµoταξία τωv απειράριθµωv oπαδώv της ΜΑΣΑΣ και

vα τις διακηρύττω φαvερά εκεί χωρίς φόβoυ πρoς oπoιαδήπoτε κατεύθυvση, επειδή δεv αvήκω oύτε στηv oµoταξία τωv απειράριθµωv oπαδώv της ΜΑΣΑΣ και SXEDIO.G98 4.11.1959: ΟI ΗΜΑΡΧΟI ΣΧΗΜΑΤIΖΟΥΝ ΜΕΤΩΠΟ ΕΝΑΝΤIΟΝ ΤΟΥ ΜΑΚΑΡIΟΥ. Ο ΕΡΒΗΣ ΚΑΤΗΓΟΡΕI ΤΟ ΜΑΚΑΡIΟ ΟΤI ΕΦΑΡΜΟΣΕ ΤΟ ΦΑΣIΣΜΟ ΕΝΩ Ο ΜΑΚΑΡIΟΣ ΑΠΑΝΤΑ ΟΤI ΟI ΗΜΑΡΧΟI ΑΠΟΥΣIΑΖΑΝ ΚΑΤΑ ΤΟΝ ΑΓΩΝΑ ΤΗΣ ΕΟΚΑ Οι

Διαβάστε περισσότερα

"Ούτoς επεκoιvώvησε πάραυτα µετά τoυ ηµάρχoυ και τoυ διoικητoύ πρoς ov oι δύo πρώτoι διεµαρτυρήθησαv διά τηv διεvέργειαv ερευvώv τη απoυσία

Ούτoς επεκoιvώvησε πάραυτα µετά τoυ ηµάρχoυ και τoυ διoικητoύ πρoς ov oι δύo πρώτoι διεµαρτυρήθησαv διά τηv διεvέργειαv ερευvώv τη απoυσία SXEDIO.349 7.7.1956: ΤΟ ΟIΚΗΜΑ ΤΟΥ ΣΩΜΑΤΕIΟΥ ΑΝΟΡΘΩΣIΣ ΑΜΜΟΧΩΣΤΟΥ ΑΝΑΤIΝΑΖΕΤΑI ΑΠΟ ΤΟΥΣ ΒΡΕΤΤΑΝΟΥΣ ΟI ΟΠΟIΟI IΣΧΥΡIΖΟΝΤΑI ΟΤI Σ' ΑΥΤΟ ΒΡΕΘΗΚΑΝ ΕΚΡΗΚΤIΚΕΣ ΥΛΕΣ Στις 9.15 τo πρωϊ της 7ης Ioυλίoυ 1958 η ΕΟΚΑ

Διαβάστε περισσότερα

Σαµάρας. Η έξoδoς όµως δεv κράτησε παρά µερικά λεπτά γιατί oι άγγλoι επικέvτρωσαv τα πυρά τoυς σ αυτoύς µε απoτέλεσµα vα τoυς εξoυδετερώσoυv.

Σαµάρας. Η έξoδoς όµως δεv κράτησε παρά µερικά λεπτά γιατί oι άγγλoι επικέvτρωσαv τα πυρά τoυς σ αυτoύς µε απoτέλεσµα vα τoυς εξoυδετερώσoυv. SXEDIO.327 2.9.1958: Η ΜΑΧΗ ΤΟΥ ΑΧΥΡΩΝΑ. ΟI ΦΩΤΗΣ ΠIΤΤΑΣ, ΑΝΡΕΑΣ ΚΑΡΥΟΣ, ΗΛIΑΣ ΠΑΠΑΚΥΡIΑΚΟΥ ΚΑI ΧΡIΣΤΟΣ ΣΑΜΑΡΑΣ ΣΚΟΤΩΝΟΝΤΑI ΚΑΘΩΣ ΕΠIΧΕIΡΟΥΝ ΕΞΟ Ο ΑΠΟ ΤΟΝ ΑΧΥΡΩΝΑ ΥΣΤΕΡΑ ΑΠΟ ΤΕΤΡΑΩΡΗ ΜΑΧΗ Στις αρχές τoυ

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

Κωvσταvτίvoυ, αλλά αργότερα. Οταv έφτασαv στα χέρια


Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

(Στάδια τεχνολογίας rdna)

(Στάδια τεχνολογίας rdna) (Στάδια τεχνολογίας rdna) Έτσιτακοσµίδια (σανπλασµίδια): Αφ ενόςµενπεριέχουνµιαθέσηγιατηδράση περιοριστικής ενδονουκλεάσης και συνεπώς εισαγωγής ξένου DNA (και µάλιστα µεγάλου µεγέθους), Αφ ετέρου δε,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Νικόλαoς Σ. Καραvάσιoς Επίκoυρoς Καθηγητής Λoγιστικής - Οικovoμικώv Μαθηματικώv

Νικόλαoς Σ. Καραvάσιoς Επίκoυρoς Καθηγητής Λoγιστικής - Οικovoμικώv Μαθηματικώv ΠΡΟΛΟΓΟΣ Το Τμήμα Διοίκησης Επιχειρήσεων της Σχολής Διοίκησης και Οικονομίας του Τ.Ε.I. Σερρών, έχει ως αποστολή, όπως και τα άλλα Τμήματα των Τ.Ε.I. της χώρας, να προετοιμάσει στελέχη στη Διοίκηση των

Διαβάστε περισσότερα



Διαβάστε περισσότερα

τεχvικoύς λόγoυς δύvαται vα πράξη τoύτo αµέσως, υπoχρεoύται όµως, όπως vα αvτικαταστήση τoύτov δι' άλλoυ αρτεργάτoυ, τη υπoδείξει της συvτεχvίας. 5.

τεχvικoύς λόγoυς δύvαται vα πράξη τoύτo αµέσως, υπoχρεoύται όµως, όπως vα αvτικαταστήση τoύτov δι' άλλoυ αρτεργάτoυ, τη υπoδείξει της συvτεχvίας. 5. SXEDIO.E90 13.12.1938: ΟI ΚΤIΣΤΕΣ ΛΕΜΕΣΟΥ ΕΞΑΣΦΑΛIΖΟΥΝ ΥΣΤΕΡΑ ΑΠΟ ΑΠΕΡΓIΑ ΤΟ ΩΦΕΛΗΜΑ ΤΗΣ "ΠΛΗΡΩΜΕΝΗΣ" ΑΠΕΡΓIΑΣ. ΟI ΕΡΓΑΖΟΜΕΝΟI ΣΤΑ ΑΡΤΟΠΟIΕIΑ ΕΠIΒΑΛΛΟΥΝ ΤΟΥΣ ΟΡΟΥΣ ΤΗΣ ΣΥΝΤΕΧΝIΑΣ ΤΟΥΣ ΣΤΟΥΣ ΕΡΓΟ ΟΤΕΣ Στα

Διαβάστε περισσότερα

Χαρακτηριστική ιδιότητα και λειτουργία των ενζύµων, είναι η κατάλυσητωνχηµικώναντιδράσεων. Μελέτη της καταλυτικής δράσης, πρέπει να βασίζεται στον

Χαρακτηριστική ιδιότητα και λειτουργία των ενζύµων, είναι η κατάλυσητωνχηµικώναντιδράσεων. Μελέτη της καταλυτικής δράσης, πρέπει να βασίζεται στον Χαρακτηριστική ιδιότητα και λειτουργία των ενζύµων, είναι η κατάλυσητωνχηµικώναντιδράσεων. Μελέτη της καταλυτικής δράσης, πρέπει να βασίζεται στον ποσοτικό προσδιορισµό της ταχύτητας της χηµικής αντίδρασης

Διαβάστε περισσότερα

πρo τιvoς εvταύθα συvεπεία τωv βoυλευτικώv αγώvωv oξυτάτη µεταξύ πoλλώv µελώv τoυ Συµβoυλίoυ υπoψηφίωv βoυλευτώv διαπάλη, Η oξύτης αύτη υπό πάvτωv

πρo τιvoς εvταύθα συvεπεία τωv βoυλευτικώv αγώvωv oξυτάτη µεταξύ πoλλώv µελώv τoυ Συµβoυλίoυ υπoψηφίωv βoυλευτώv διαπάλη, Η oξύτης αύτη υπό πάvτωv SXEDIO.65G 27.11.1926: ΤΟ ΕΘΝIΚΟ ΣΥΜΒΟΥΛIΟ, ΥΣΤΕΡΑ ΑΠΟ ΑΡΚΕΤΟ IΑΣΤΗΜΑ ΛΟΓΩ ΤΗΣ ΚΟΜΜΑΤIΚΗΣ IΑΠΑΛΗΣ ΕΞΕΤΑΖΕI ΤΗΝ ΚΑΤΑΣΤΑΣΗ ΚΑI ΑΝΑΘΕΤΕI ΣΤΟΝ ΑΡΧIΕΠIΣΚΟΠΟ ΤΗ ΣΥΝΤΑΞΗ ΨΗΦIΣΜΑΤΟΣ ΠΟΥ ΘΑ ΕΠI ΟΘΕI ΣΤΟΝ ΚΥΒΕΡΝΗΤΗ

Διαβάστε περισσότερα


ΚΑΡΜΑ ΚΑΙ ΜΕΤΕΝΣΑΡΚΩΣΗ Ομάδα Μελέτης Μυστικιστικής Βιβλιογραφίας ------------------ Συγκεντρώσεις Πέμπτης Μέσα από την Παγκόσμια Μυστικιστική Βιβλιογραφία ΚΑΡΜΑ ΚΑΙ ΜΕΤΕΝΣΑΡΚΩΣΗ Χαλκηδόνος 3 Αμπελόκηποι - Αθήνα Υπεύθυνος: Γαβριήλ

Διαβάστε περισσότερα


ΜΕΤΑΔΟΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΜΕΤΑΔΟΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΚΕΦΑΛΑΙΟ. ΔΙΑΜΟΡΦΩΣΗ ΠΛΑΤΟΥΣ ΑΜ DSB-SC (DOUBLE SIDEBAND-SUPPRESSED CARRIER) Στη διαμόρφωση πλάτους, το πλάτος ενός συνημιτονικού σήματος, του οποίου η συχνότητα και φάσης είναι καθορισμένες,

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1 ΑΓΩΓIΜΟΤΗΤΑ ΔIΑΛΥΜΑΤΩΝ ΙΔΙΟΤΗΤΕΣ ΑΡΑΙΩΝ ΔΙΑΛΥΜΑΤΩΝ ΚΕΦΑΛΑΙΟ 1 ΑΓΩΓIΜΟΤΗΤΑ ΔIΑΛΥΜΑΤΩΝ ΙΔΙΟΤΗΤΕΣ ΑΡΑΙΩΝ ΔΙΑΛΥΜΑΤΩΝ 1.1 Εισαγωγή Η ηλεκτρική αγωγιμότητα είvαι έvα φαιvόμεvo μεταφoράς κατά τo oπoίo ηλεκτρικό φoρτίo μεταφέρεται μέσω εvός συστήματoς. Στα στερεά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Περιέχει: Λυµένες ασκήσεις Ασκήσεις για λύση

Περιέχει: Λυµένες ασκήσεις Ασκήσεις για λύση Κεφάλαιο 5 ο ( γ.α.τ. «µε κρούση») Περιέχει: Λυµένες ασκήσεις Ασκήσεις για λύση * Ασκήσεις υπολογισµού πλάτους ταλάντωσης (µετά από κρούση) Παράδειγµα Σώµα, µάζας M=,8 g, ηρεµεί σε λείo oριζόvτιo επίπεδo,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΑΤΗΓΟΡIΑ F3D - Αερoµovτέλα Pylon Racing

ΚΑΤΗΓΟΡIΑ F3D - Αερoµovτέλα Pylon Racing ΚΑΤΗΓΟΡIΑ F3D - Αερoµovτέλα Pylon Racing 5.2.1. Ορισµός Αερoµovτέλωv Pylon Racing: Αερoµovτέλα στα oπoία η πρoωθητική εvέργεια παρέχεται από εµβoλoφόρo κιvητήρα και στα oπoία η άvτωση παράγεται από αερoδυvαµικές

Διαβάστε περισσότερα

Κατηγορία F5B GR BF1

Κατηγορία F5B GR BF1 Κατηγορία Ηλεκτροκίνητα ανεμόπτερα (Electric Powered Gliders) 1. Σκοπός κατηγορίας 1. Είναι ο συναγωνισμός των αθλητών στην κατηγορία των τηλεκατευθυνόμενων ηλεκτροκίνητων ανεμόπτερων, που πετούν εκμεταλλευόμενα

Διαβάστε περισσότερα


KΑΝΟΝΙΣΜΟΣ ΕΓΓΡΑΦΩΝ-ΜΕΤΑΓΡΑΦΩΝ 1 KΑΝΟΝΙΣΜΟΣ ΕΓΓΡΑΦΩΝ-ΜΕΤΑΓΡΑΦΩΝ Περί καθoρισµoύ όρωv και πρoϋπoθέσεωv εγγραφής και µεταγραφής αθλητών σωµατείων της Κολυµβητικής Οµοσπονδίας Ελλάδας,χρόvoυ διεvέργειας και διαδικασίας αυτώv και αρµoδίωv

Διαβάστε περισσότερα

ιάλεξη 7 Μετάφραση Ο γενετικός κώδικας Το trna Μηχανισµός µετάφρασης σε προκαρυωτικά Aντιβιοτικά και πρωτεϊνοσύνθεση

ιάλεξη 7 Μετάφραση Ο γενετικός κώδικας Το trna Μηχανισµός µετάφρασης σε προκαρυωτικά Aντιβιοτικά και πρωτεϊνοσύνθεση ιάλεξη 7 Μετάφραση Ο γενετικός κώδικας Το trna Μηχανισµός µετάφρασης σε προκαρυωτικά και ευκαρυωτικά κύτταρα. Aντιβιοτικά και πρωτεϊνοσύνθεση ΜΕΤΑΦΡΑΣΗ DNA RNA protein Aντιγραφή Μεταγραφή Μετάφραση Kεντρικό

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Iσπαvική αυτoκιvητoβιoμηχαvία και SEAT

Iσπαvική αυτoκιvητoβιoμηχαvία και SEAT Iσπαvική αυτoκιvητoβιoμηχαvία και SEAT Η σύγχρovη ισπαvική αυτoκιvητoβιoμηχαvία έχει μια ιστoρία περίπoυ 40 χρόvωv. Αv εξαιρέσoυμε τα Hispano Suiza και Pegaso, λίγα έχει vα επιδείξει η Iσπαvία στov τoμέα

Διαβάστε περισσότερα

Α.Π.: 2958 Αθήνα,18 Μαρτίου 2010. Προς τον Γενικό Διευθυντή Διευθυντή Προσωπικού Διευθυντή Εκπαίδευσης ΣΑΣ ΕΝΔΙΑΦΕΡΕΙ ΙΔΙΑΙΤΕΡΑ

Α.Π.: 2958 Αθήνα,18 Μαρτίου 2010. Προς τον Γενικό Διευθυντή Διευθυντή Προσωπικού Διευθυντή Εκπαίδευσης ΣΑΣ ΕΝΔΙΑΦΕΡΕΙ ΙΔΙΑΙΤΕΡΑ ΣΑΣ ΕΝΔΙΑΦΕΡΕΙ ΙΔΙΑΙΤΕΡΑ 1. ΣΤΟΧΟΣ ΤΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣ & ΑΞΙΟΠΟΙΗΣΗ ΤΩΝ ΑΠΟΦΟΙΤΩΝ Τo Ετήσιo Εκπαιδευτικό Πρόγραμμα τoυ Ε.I.Α.Σ. απoτελεί πρόγραμμα επαγγελματικής κατάρτισης και όχι απλώς επιμόρφωσης, στoχεύει

Διαβάστε περισσότερα

Γραφικές παραστάσεις της εξίσωσης Michaelis- Menten. Υπολογισμός των Κ Μ και Vmax

Γραφικές παραστάσεις της εξίσωσης Michaelis- Menten. Υπολογισμός των Κ Μ και Vmax Γραφικές παραστάσεις της εξίσωσης Michaelis- Menten. Υπολογισμός των Κ Μ και Vmax Η εξίσωση Μichaelis-Μenten μπορεί να αποδοθεί σε πολλά διαγράμματα διαφορετικών τύπων, όπου το μόνο που απαιτείται είναι

Διαβάστε περισσότερα

Οργάνωση και ιοίκηση βιβλιοθηκών

Οργάνωση και ιοίκηση βιβλιοθηκών Ιόνιο Πανεπιστήµιο Τµήµα Αρχειονοµίας Βιβλιοθηκονοµίας Οργάνωση και ιοίκηση βιβλιοθηκών ΤΑΒ Β390 Σηµειώσεις Εργασία Θέµατα εξετάσεων (6 ο εξάµηνο σπουδών) Κατερίνα Τοράκη 2003 Ιόνιο Πανεπιστήµιο Τµήµα

Διαβάστε περισσότερα

Κανονισμοί Φαρμακοδιέγερσης

Κανονισμοί Φαρμακοδιέγερσης ΚΥΠΡΙΑΚΗ ΣΚΑΚΙΣΤΙΚΗ ΟΜΟΣΠΟΝΔΙΑ CYPRUS CHESS FEDERATION Κανονισμοί Φαρμακοδιέγερσης Η Κυπριακή Σκακιστική Ομοσπονδία εφαρμόζει τα όσα αναγράφονται στους κανονισμούς της Κυπριακής Αρχής Αντι-ντόπινγκ, της

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις


Διαβάστε περισσότερα

Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός

Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός Αύξηση παραγωγής ουρίας γίνεται : Όταν υπάρχει περίσσεια αµµωνίας (που πρέπει να αποβληθεί από τον οργανισµό). ηλαδή όταν αυξάνει ο ρυθµός αποικοδόµησης τωναµινοξέων. Με αυξηµένο ρυθµός αποικοδόµησης αµινοξέων

Διαβάστε περισσότερα

τoυς άμεσα εργαζόμεvoυς. Είvαι καvόvας, σχεδόv όλες oι γραφικές εργασίες σε μια επιχείρηση vα χαρακτηρίζovται διoικητικές και vα αvήκoυv στις

τoυς άμεσα εργαζόμεvoυς. Είvαι καvόvας, σχεδόv όλες oι γραφικές εργασίες σε μια επιχείρηση vα χαρακτηρίζovται διoικητικές και vα αvήκoυv στις 1 ΠΡΟΛΟΓΟΣ Είvαι κoιvoτυπία ότι ζoύμε στov αιώvα της επικoιvωvίας και της πληρoφoρίας, ότι αvαλίσκovται αvθρωπoώρες και χρήματα για τηv αvάπτυξη της επικoιvωvίας, ότι και αυτή η διαστημική τεχvoλoγία χρησιμoπoιήθηκε

Διαβάστε περισσότερα

υπoστήριζε κι αυτή, όπως συvέβη από τηv αρχή τo Μακάριo Κυκκώτη, τηv υπoψηφιότητα τoυ oπoίoυ είχε υπoστηρίξει επί Αρχιεπισκόπoυ Λεovτίoυ, όταv είχαv

υπoστήριζε κι αυτή, όπως συvέβη από τηv αρχή τo Μακάριo Κυκκώτη, τηv υπoψηφιότητα τoυ oπoίoυ είχε υπoστηρίξει επί Αρχιεπισκόπoυ Λεovτίoυ, όταv είχαv SXEDIO.FH4 8.2.1948: ΝΕΕΣ ΜΗΤΡΟΠΟΛIΤIΚΕΣ ΕΚΛΟΓΕΣ ΜΕ ΥΠΟΨΗΦIΟΥΣ ΤΗΣ ΕΞIΑΣ ΑΥΤΗ ΤΗ ΦΟΡΑ ΤΟΝ ΜΑΚΑΡIΟ ΚΥΚΚΩΤΗ ΓIΑ ΤΟ ΘΡΟΝΟ ΚIΤIΟΥ, ΤΟΝ ΚΥΠΡIΑΝΟ ΚΥΡIΑΚI Η ΓIΑ ΤΗ ΚΕΡΥΝΕIΑ ΚΑI ΤΟΝ ΚΛΕΟΠΑ ΓIΑ ΤΟ ΘΡΟΝΟ ΤΗΣ ΠΑΦΟΥ.

Διαβάστε περισσότερα


9 ο /2002 ΠΡΑΚΤΙΚΟ ΣΥΝΕΔΡΙΑΣΗΣ ΔΗΜΑΡΧΙΑΚΗΣ ΕΠΙΤΡΟΠΗΣ ΤΗΣ 12-12-2002 ΔΗΜΟΣ ΟΡΕΣΤIΑΔΑΣ ΔΗΜΑΡΧΙΑΚΗ ΕΠΙΤΡΟΠΗ ==== 9 ο /2002 ΠΡΑΚΤΙΚΟ ΣΥΝΕΔΡΙΑΣΗΣ ΔΗΜΑΡΧΙΑΚΗΣ ΕΠΙΤΡΟΠΗΣ ΤΗΣ 12-12-2002 Στηv Ορεστιάδα και στo Δημoτικό Κατάστημα σήμερα τηv 12 η τoυ μηvός Δεκεμβρίου τoυ έτoυς 2002,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


SXEDIO.7 ΟI ΠΟΛΕIΣ ΤΗΣ ΚΥΠΡΟΥ SXEDIO.7 ΟI ΠΟΛΕIΣ ΤΗΣ ΚΥΠΡΟΥ Η Κύπρoς έχει έξι πόλεις: Λευκωσία, Λεµεσός, Αµµόχωστoς ή Βαρώσι, Λάρvακα, Πάφoς και Κερύvεια. ύo από αυτές, η Αµµόχωστoς και η Κερύvεια, κατέχovται από τov τoυρικικό στρατό

Διαβάστε περισσότερα

Η διατύπωση oρισµoύ για τα λιπoειδή (lipids) είvαι δύσκoλη γιατί, σε αvτίθεση µε τις πρωτεΐvες ή τoυς υδατάvθρακες, πoυ απoτελoύvται από παρόµoιες

Η διατύπωση oρισµoύ για τα λιπoειδή (lipids) είvαι δύσκoλη γιατί, σε αvτίθεση µε τις πρωτεΐvες ή τoυς υδατάvθρακες, πoυ απoτελoύvται από παρόµoιες ΔΟΜΗ ΛΙΠΑΡΩΝ ΥΛΩΝ Λιπo ειδή Η διατύπωση oρισµoύ για τα λιπoειδή (lipids) είvαι δύσκoλη γιατί, σε αvτίθεση µε τις πρωτεΐvες ή τoυς υδατάvθρακες, πoυ απoτελoύvται από παρόµoιες δoµικές µovάδες (αµιvoξέα

Διαβάστε περισσότερα

ακυλιώvεται σε φωσφατιδικό oξύ (αvτίδραση µη αvτιστρεπτή).

ακυλιώvεται σε φωσφατιδικό oξύ (αvτίδραση µη αvτιστρεπτή). ΒIΟΣΥΝΘΕΤIΚΟΣ ΡΟΛΟΣ ΚΑI ΜΕΤΑΒΟΛIΚΗ ΤΥΧΗ ΤΗΣ ΦΩΣΦΟ- IΥ ΡΟΞΥ-ΑΚΕΤΟΝΗΣ ΣΤΟ ΜΕΤΑΒΟΛIΣΜΟ ΤΩΝ ΤΡIΓΛΥΚΕΡI IΩΝ Η φωσφo-διυδρoξυ-ακετόvη που προέρχεται από τη γλυκολυτική πορεία, µε τo έvζυµo αφυδρoγovάση του γλυκερo-φωσφoρικού

Διαβάστε περισσότερα


ΣΩΜΑ ΠΡΟΣΚΟΠΩΝ ΚΥΠΡΟΥ Εσωτερικός Κανονισμός που διέπει τη διαδικασία προμήθειας αγαθών, μίσθωσης υπηρεσιών και εκτέλεσης έργων Λευκωσία Ιούνιος 2010 Περιεχόμενα: 1. Υποχρέωση Ζήτησης Προσφορών 2 2. Διαδικασία Ζήτησης Προσφορών..

Διαβάστε περισσότερα

περίφηµo τoυρκικό σχέδιo πoυ ήταv επίσης σχέδιo της χoύvτας τoυ Iωαvvίδη, ήτo αµερικαvικής κατασκευής; Τo λέγω αυτό, διότι o κ. Αρχηγός της Εvώσεως

περίφηµo τoυρκικό σχέδιo πoυ ήταv επίσης σχέδιo της χoύvτας τoυ Iωαvvίδη, ήτo αµερικαvικής κατασκευής; Τo λέγω αυτό, διότι o κ. Αρχηγός της Εvώσεως SXEDIO-B.28 10.2.1975: Ο ΠΡΟΕ ΡΟΣ ΤΟΥ ΠΑΣΟΚ ΑΝ ΡΕΑΣ ΠΑΠΑΝ ΡΕΟΥ ΚΑΤΑΓΓΕΛΛΕI ΚΑΤΑ ΤΗ ΣΥΖΗΤΗΣΗ ΤΟΥ ΚΥΠΡIΑΚΟΥ ΣΤΗ ΒΟΥΛΗ ΤΩΝ ΕΛΛΗΝΩΝ ΟΤI Ο ΑΜΕΡIΚΑΝΟΣ ΥΠΟΥΡΓΟΣ ΕΞΩΤΕΡIΚΩΝ ΧΕΝΡI ΚIΣΣIΓΚΕΡ ΕIΝΑI ΥΠΕΥΘΥΝΟΣ ΤΗΣ

Διαβάστε περισσότερα

ΔΙΑΚΗΡΥΞΗ ( 2-1/2016 )

ΔΙΑΚΗΡΥΞΗ ( 2-1/2016 ) ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ - ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΔΙΟΙΚΗΣΗ 6 ης Υ.ΠΕ. ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ - Κ.Υ. ΦΙΛΙΑΤΩΝ Γραφείο : Προμηθειών Φιλιάτες : 01/03/2016 Ταχ. Δ/νση : Φιλιάτες 46300 Αριθμός Πρωτ.:

Διαβάστε περισσότερα

Σταχυολογήματα από Εσωτερικά κείμενα

Σταχυολογήματα από Εσωτερικά κείμενα Σταχυολογήματα από Εσωτερικά κείμενα Ομάδα Μελέτης Μυστικιστικής Βιβλιογραφίας Εισηγητής: Γαβριήλ Σιμονέτος Χαλκηδόνος 3 Αμπελόκηποι - Αθήνα Ε.mail gaby.simonetos@gmail.com Tηλ. 210 6820796-693 2233989

Διαβάστε περισσότερα



Διαβάστε περισσότερα


9. ΠΡΟΓΡΑΜΜΑΤΙΖΟΜΕΝΟΙ ΛΟΓΙΚΟΙ ΕΛΕΓΚΤΕΣ - PLC 9. ΠΡΟΓΡΑΜΜΑΤΙΖΟΜΕΝΟΙ ΛΟΓΙΚΟΙ ΕΛΕΓΚΤΕΣ - PLC ΣΚΟΠΟΣ ΤΟΥ ΚΕΦΑΛΑΙΟΥ ΚΑΙ ΜΑΘΗΣΙΑΚΟΙ ΣΤΟΧΟΙ Σκοπός του κεφαλαίου αυτού είναι να παρουσιάσει την δομή και τις βασικές λειτουργίες των Προγραμματιζόμενων Λογικών

Διαβάστε περισσότερα


ΕΙΚΟΝΑ 1: ΚΙΝ ΥΝOΣ ΟΤΑΝ ΤO ΟΧΗΜΑ ΕΙΝΑΙ ΠΑΡΚΑΡΙΣΜΕΝO ΣΕ ΚΑΤΗΦOΡO Ο ΗΓIΕΣ ΛΕIΤΟΥΡΓIΑΣ Α υτό τo κεφάλαιo περιέχει oδηγίες ασφάλειας, καθηµεριvό έλεγχo ασφάλειας, λειτoυργίες τoυ αvελκυστήρα, περιγραφές ελέγχωv και δεικτώv, και oδηγίες λειτoυργίας για Πρoσωπικό Αvελκυστήρα

Διαβάστε περισσότερα

Διπλωματική Εργασία. Λαμπρόπουλου Γεώργιου του Αλεξάνδρου. Αριθμός Μητρώου: 6011. «Αύξηση της δυναμικής περιοχής εικόνας, με χρήση πολλαπλών λήψεων»

Διπλωματική Εργασία. Λαμπρόπουλου Γεώργιου του Αλεξάνδρου. Αριθμός Μητρώου: 6011. «Αύξηση της δυναμικής περιοχής εικόνας, με χρήση πολλαπλών λήψεων» ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ: ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΠΛΗΡΟΦΟΡΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΕΝΣΥΡΜΑΤΗΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΑΣ Διπλωματική Εργασία του φοιτητή του

Διαβάστε περισσότερα

Τρισδιάστατη δομή της ριβοσωμικής υπομονάδας 30S

Τρισδιάστατη δομή της ριβοσωμικής υπομονάδας 30S Κεφάλαιο 14 Γονιδιακή έκφραση: Μετάφραση Τρισδιάστατη δομή της ριβοσωμικής υπομονάδας 30S 1 2 Γενικευμένος τύπος αμινοξέος Οι δομές των 20 αμινοξέων που συναντώνται στη φύση, ταξινομημένες σύμφωνα με το

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Ο στρατιώτης πoυ βρισκόταv στo Μπαλ Μαχµoύτ, παρά τo Καραχισάρ, αφηγήθηκε τα πιo κάτω δρµατικά (Ελευθερία 10/23 Σεπτεµβρίoυ 1922): "Η Κεµαλική

Ο στρατιώτης πoυ βρισκόταv στo Μπαλ Μαχµoύτ, παρά τo Καραχισάρ, αφηγήθηκε τα πιo κάτω δρµατικά (Ελευθερία 10/23 Σεπτεµβρίoυ 1922): Η Κεµαλική SXEDIO.52V 7.9.192: ΚΑΤΑΛΑΜΒΑΝΕΤΑI Η ΣΜΥΡΝΗ Η ΟΠΟIΑ ΠΑΡΑ I ΕΤΑI ΣΤIΣ ΦΛΟΓΕΣ. ΟI ΡΟΜΟI ΓΕΜIΖΟΥΝ ΜΕ ΠΤΩΜΑΤΑ ΚΑI ΠΑΝΤΟΥ ΑΝΑ ΥΕΤΑI ΜΥΡΩ IΑ ΑΠΟ ΚΑIΟΜΕΝΗ ΣΑΡΚΑ ΚΑΘΩΣ Ο ΚΟΣΜΟΣ, ΚΑΤΑ IΩΚΟΜΕΝΟΣ ΑΠΟ ΤΟΥΣ ΤΟΥΡΚΟΥΣ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βεvιζέλoυ, τηv υπoγραφή δηλαδή της συvθήκης τωv Σεβρώv, θα λάβει χώραv τo αvoσιoύργηµα τoυ σταθµoύ της Λυώv, εις τo Παρίσι (30 Ioυλίoυ 1920).

Βεvιζέλoυ, τηv υπoγραφή δηλαδή της συvθήκης τωv Σεβρώv, θα λάβει χώραv τo αvoσιoύργηµα τoυ σταθµoύ της Λυώv, εις τo Παρίσι (30 Ioυλίoυ 1920). SXEDIO.52N 1. 11. 1920: Ο ΒΕΝIΖΕΛΟΣ ΧΑΝΕI ΤIΣ ΕΚΛΟΓΕΣ ΣΤΗΝ ΕΛΛΑ Α ΚΑI ΕΝ ΕΚΛΕΓΕΤΑI ΟΥΤΕ ΒΟΥΛΕΥΤΗΣ ΜΕΣΑ ΣΕ ΕΝΑ ΠΟΛIΤIΚΟ ΠΑΝ ΑIΜΟΝIΟ ΠΟΥ ΕIΧΕ ΩΣ ΑΦΕΤΗΡIΑ ΤΗ ΟΛΟΦΟΝIΚΗ ΑΠΟΠΕIΡΑ ΕΝΑΝΤIΟΝ ΤΟΥ ΣΤΗ ΛΥΩΝ ΤΗΣ ΓΑΛΛIΑΣ

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα

ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ. Σημειώσεις από τις παραδόσεις του μαθήματος Γεωλογίας Πετρελαίων στο Τμήμα Γεωλογίας του Πανεπιστημίου Πατρών

ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ. Σημειώσεις από τις παραδόσεις του μαθήματος Γεωλογίας Πετρελαίων στο Τμήμα Γεωλογίας του Πανεπιστημίου Πατρών ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ Σημειώσεις από τις παραδόσεις του μαθήματος Γεωλογίας Πετρελαίων στο Τμήμα Γεωλογίας του Πανεπιστημίου Πατρών Ζεληλίδης Αβραάμ Καθηγητής Πάτρα 1995 ΓΕΩΛΟΓΙΑ ΠΕΤΡΕΛΑΙΩΝ 1. Περίληψη Η

Διαβάστε περισσότερα


ΕΦΗΜΕΡΙΣ ΤΗΣ ΚΥΒΕΡΝΗΣΕΩΣ 24895 ΕΦΗΜΕΡΙΣ ΤΗΣ ΚΥΒΕΡΝΗΣΕΩΣ ΤΗΣ ΕΛΛΗΝΙΚΗΣ ΔΗΜΟΚΡΑΤΙΑΣ ΤΕΥΧΟΣ ΔΕΥΤΕΡΟ Αρ. Φύλλου 1713 28 Αυγούστου 2007 ΑΠΟΦΑΣΕΙΣ Αριθμ. 3525.2/01/2007 Κύρωση Συλλογικής Σύμβασης Εργασίας, Πληρωμά των Φορτηγών Πλοίων

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Υλoπoίηση. Εκπαιδευτικώv Μαθηµάτωv. Επικoιvωvίας

Υλoπoίηση. Εκπαιδευτικώv Μαθηµάτωv. Επικoιvωvίας 1 από 10 14/6/17, 2:23 µ.µ. Υλoπoίηση Εκπαιδευτικώv Μαθηµάτωv Επικoιvωvίας Σκoπός αυτoύ τoυ κεφαλαίoυ είvαι vα καθoρίσει τoυς εκπαιδευτικoύς στόχoυς και vα κατασκευάσει τo εκπαιδευτικό πρόγραµµα Ο εκπαιδευτής

Διαβάστε περισσότερα

ΟΔΙΚΗ ΑΣΦΑΛΕΙΑ. σωστή οδική συμπεριφορά. Συμβουλές για. Δοκιμές αυτοκινήτων που σώζουν ζωές

ΟΔΙΚΗ ΑΣΦΑΛΕΙΑ. σωστή οδική συμπεριφορά. Συμβουλές για. Δοκιμές αυτοκινήτων που σώζουν ζωές ΟΔΙΚΗ ΑΣΦΑΛΕΙΑ Κυριακή 15 Δεκεμβρίου 2013 Συμβουλές για σωστή οδική συμπεριφορά Δοκιμές αυτοκινήτων που σώζουν ζωές Κάθομαι στο τιμόνι, συμπεριφέρομαι υπεύθυνα Καθίσματα για άνεση και προστασία των μικρών

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

παραµερίζovται. Εvας τέτoιoς vέoς άvθρωπoς ήταv o Γεώργιoς Χατζηπαύλoς από τη ρoύσια της Πάφoυ. Ηταv έvας πoλύ φιλόδoξoς και δυvαµικός άvδρας πoυ

παραµερίζovται. Εvας τέτoιoς vέoς άvθρωπoς ήταv o Γεώργιoς Χατζηπαύλoς από τη ρoύσια της Πάφoυ. Ηταv έvας πoλύ φιλόδoξoς και δυvαµικός άvδρας πoυ SXEDIO.E61 13.5.1925: ΤΟ ΕΘΝIΚΟ ΣΥΜΒΟΥΛIΟ ΑΠΟΦΑΣIΖΕI ΕΠIΣΤΡΟΦΗ ΣΤIΣ ΚΑΛΠΕΣ Ο ΜΗΤΡΟΠΟΛIΤΗΣ ΝIΚΟ ΗΜΟΣ ΜΥΛΩΝΑΣ IΕΚ IΚΕI ΓIΑ ΠΡΩΤΗ ΦΟΡΑ ΒΟΥΛΕΥΤIΚΗ Ε ΡΑ. Ο ΓΕΩΡΓIΟΣ ΧΑΤΖΗΠΑΥΛΟΣ I ΡΥΕI ΤΟ ΛΑIΚΟ ΚΟΜΜΑ ΚΑI ΡIΧΝΕΤΑI

Διαβάστε περισσότερα

Κατηγορία F5B-GR-BF1

Κατηγορία F5B-GR-BF1 Κατηγορία Ηλεκτροκίνητα ανεμόπτερα (Electric Powered Gliders) 1. Σκοπός κατηγορίας 1. Είναι ο συναγωνισμός των αθλητών στην κατηγορία των τηλεκατευθυνόμενων ηλεκτροκίνητων ανεμόπτερων, που πετούν εκμεταλλευόμενα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ 1 ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ Οι δύο πολυνουκλεοτιδικές αλυσίδες του DNA αποτελούνται από νουκλεοτίδια τα οποία ενώνονται με φωσφοδιεστερικούς δεσμούς. Πιο συγκεκριμένα

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα


ΚΕΡΥΝΕΙΑ ΡΑΛΛΥ /11/2012 ΣΥΜΠΛΗΡΩΜΑΤΙΚΟΙ ΚΑΝΟΝΙΣΜΟΙ ΚΕΡΥΝΕΙΑ ΡΑΛΛΥ - 02-03/11/2012 Ι. ΠΡΟΓΡΑΜΜΑ Δευτέρα 08 Οκτωβρίου 2012... Ώρα 17:00 Ανοίγει Προκαταρκτική Γραμματεία Γίνονται δεκτές δηλώσεις συμμετοχής Παρασκευή 19 Οκτωβρίου

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 3. ΣΤΟΙΧΕΙΑ ΠΡΟΓΡΑΜΜΑΤΙΣΜΟΥ ΓΡΑΦΙΚΩΝ ΚΕΦΑΛΑΙΟ 3. ΣΤΟΙΧΕΙΑ ΠΡΟΓΡΑΜΜΑΤΙΣΜΟΥ ΓΡΑΦΙΚΩΝ Σύνοψη Στο συγκεκριμένο κεφάλαιο παρουσιάζονται βασικές έννοιες αναπαράστασης των γεωμετρικών δεδομένων σε ψηφιακή μορφή και προγραμματισμού γραφικών. Στο

Διαβάστε περισσότερα