Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών υποστρωμάτων από το ίδιο ένζυμο? 2. Πώς η περιεκτικότητα των μεμβρανών σε στερόλες επηρεάζει τα χαρακτηριστικά τους? 3. Γιατί το μονοξείδιο του άνθρακα έστω και σε χαμηλότατες συγκεντρώσεις είναι ιδιαίτερα τοξικό? 4.Ποια τα βασικά χαρακτηριστικά των μορφών Α, Β, Ζ του DNA? ΑΠΑΝΤΗΣΕΙΣ 1. Οι κινητικές παράμετροι K cat, K m γενικά χρησιμεύουν στη μελέτη και σύγκριση διαφορετικών ενζύμων, είτε με απλό είτε με περίπλοκο μηχανισμό αντίδρασης. Η K cat είναι η σταθερά ταχύτητας αντίστροφου χρόνου και αποκαλείται αριθμός ανακύκλωσης. Ισοδυναμεί με τον αριθμό των μορίων υποστρώματος που μετατρέπονται σε προϊόν στη μονάδα χρόνου πάνω σε ένα μόριο ενζύμου, όταν αυτό είναι κορεσμένο με υπόστρωμα.

2 Η K m είναι η σταθερά Michaelis Εξίσωση Michaelis-Menten V 0 =V max [S] K m +[S] Όπου V 0 και V max η αρχική και η μέγιστη ταχύτητα της αντίδρασης, αντίστοιχα, και το [S] η συγκέντρωση του υποστρώματος. Όταν K m =[S], τότε V 0 =1/2V max Κάθε ένζυμο έχει τιμές K cat και K m που αντικατοπτρίζουν το κυτταρικό περιβάλλον, τη συγκέντρωση του υποστρώματος στην οποία το υπόστρωμα βρίσκεται σε in vivo συνθήκες και τη χημεία της καταλυόμενης αντίδρασης, Οι παράμετροι αυτοί επιτρέπουν, επίσης, να εκτιμηθεί η κινητική αποτελεσματικότητα των ενζύμων. Καμία, από μόνη της, δεν επαρκεί για αυτό τον σκοπό. Δύο ένζυμα που καταλύουν διαφορετικές αντιδράσεις μπορεί να έχουν ίδια K cat, αλλά να επιταχύνουν διαφορετικά την αντίδραση. Ο καλύτερος τρόπος για να συγκριθεί η καταλυτική αποτελεσματικότητα διαφορετικών ενζύμων ή εναλλακτικά η ανακύκλωση διαφορετικών υποστρωμάτων στο ίδιο ένζυμο είναι να συγκριθεί ο λόγος K cat / K m για τις δύο αντιδράσεις. Αυτή η παράμετρος αποκαλείται σταθερά ειδικότητας και όταν K m >>[S], τότε V 0 = K cat K m Το πηλίκο αυτό έχει ανώτατο όριο, το οποίο επιβάλλεται από την ταχύτητα με την οποία το ένζυμο και το υπόστρωμα μπορούν να διαχυθούν μαζί σε υδατικό διάλυμα.

3 2. Οι στερόλες είναι δομικά λιπίδια που υπάρχουν στη μεμβράνη των περισσότερων ευκαρυωτικών κυττάρων. Η χαρακτηριστική δομή τους έχει ένα στεροειδή πυρήνα, που αποτελείται από τέσσερις συμπαγείς δακτυλίους, τρεις με έξι άτομα άνθρακα και έναν με πέντε άτομα άνθρακα. Ο στεροειδής πυρήνας είναι σχεδόν επίπεδος και σχετικά συμπαγής. Η χοληστερόλη, η κυριότερη στερόλη των ζωικών ιστών, είναι αμφιπολική, με μια ομάδα κεφαλής που φέρει υδροξύλιο στον C-3 (πολική ομάδα) και έναν μη πολικό υδρογονανθρακικό σκελετό με μήκος όσο ένα λιπαρό οξύ 16 ατόμων άνθρακα. Τα βακτήρια δε συνθέτουν στερόλες, αλλά κάποια είδη μπορούν να ενσωματώσουν εξωγενείς στερόλες στη μεμβράνη τους. Η δομή των στερολών επηρεάζει τη ρευστότητα της λιπιδικής διπλοστιβάδας καθώς ελατώνει την ελευθερία κίνησης των γειτονικών αλκυλομάδων με περιστροφή γύρω από τους δεσμούς άνθρακα-άνθρακα και αναγκάζει τις ακυλομάδες να υιοθετήσουν την πιο εκτεταμένη άκαμπτη δομή τους. Η παρουσία στερολών στην μεμβράνη ελαττώνει τη ρευστότητα στο κέντρο της διπλοστιβάδας και αυξάνει, επίσης, και το πάχος του φύλλου της διπλοστιβάδας στο οποίο συμμετέχει. Η χοληστερόλη συμμετέχει, επίσης, σε μικροπεριοχές χοληστερόλης-σφιγγολιπιδίων στην εξωτερική διπλοστιβάδα της κυτταρικής μεμβράνη. Οι μικροπεριοχές αυτές, επονομαζόμενες και «σχεδίες» είναι ελαφρώς παχύτερες και λιγότερο ρευστές από τις γειτονικές περιοχές της μεμβράνης. Στις «σχεδίες» αυτές συνεντοπίζονται μεμβρανικοί υποδοχείς και σηματοδοτικές πρωτεΐνες, πιθανότατα προκειμένου να αλληλεπιδράσουν. Εάν από τις «σχεδίες» αφαιρεθεί η χοληστερόλη οι δομές αυτές καταστρέφονται.

4 3. Το μονοξείδιο του άνθρακα είναι άχρωμο και άοσμο αέριο που παράγεται από ανθρώπινη δραστηριότητα (ατελής καύση οργανικών καυσίμων) αλλά και ως έλασσον παραπροϊόν του κυτταρικού μεταβολισμού. Το μονοξείδιο του άνθρακα προσδένεται στα ελεύθερα μόρια αίμης φορές ισχυρότερα από το οξυγόνο. Ωστόσο, όταν η αίμη είναι συνδεδεμένη πάνω σε πρωτεΐνη (αιμοσφαιρίνη, μυοσφαιρίνη) η πρόσδεση του CO πάνω στην αίμη είναι μόνο 200 φορές ισχυρότερη. Αυτό οφείλεται στην στερεοταξική παρεμπόδιση της περιφερικής ιστιδίνης της υπομονάδας της αιμοσφαιρίνης στο μόριο του CO το οποίο ευθυγραμμίζεται με το άτομο σιδήρου της αίμης, σε σχέση με το μόριο οξυγόνου που σχηματίζει γωνία με τον σίδηρο. Το CO, λοιπόν, προσδένεται με μεγαλύτερη συγγένεια από το οξυγόνο στην αιμοσφαιρίνη, προκαλώντας διαταραχές της μεταφοράς του προς τους περιφερικούς ιστούς. Όταν τα επίπεδα της αιμοσφαιρίνης που έχει συνδεθεί με CO υπερβούν το 60% τότε επέρχεται ο θάνατος. Η πρόσδεση του CO στην αιμοσφαιρίνη δεν προκαλεί απλώς μείωση στην ποσότητα της πρωτεΐνης που προσφέρεται για πρόσδεση οξυγόνου, αλλά αυξάνει σημαντικά τη συγγένειά της για το οξυγόνο. Έτσι, ακόμα και εάν ένα μόριο αιμοσφαιρίνης έχει προσδέσει οξυγόνο, λόγω υψηλής συγγένειας, δεν μπορεί να το αποδώσει στους ιστούς. Τα προβλήματα επιτείνονται από το γεγονός ότι το CO προσδένεται σε όσες πρωτεΐνες έχουν, ως προσθετική ομάδα, αίμη. Το CO εκτοπίζεται από υψηλή συγκέντρωση οξυγόνου. Ομάδες με μεγαλύτερη ευπάθεια είναι τα έμβρυα, καθώς η εμβρυική αιμοσφαιρίνη έχει υψηλότερη συγγένεια για το CO, οι ασθενείς με αναιμία ή καρδιοαναπνευστικά νοσήματα και οι καπνιστές.

5 4. Το DNA είναι ένα εύκαμπτο μόριο, με δυνατότητα περιστροφής γύρω από αρκετούς δεσμούς στο σακχαροφωσφορικό σκελετό. Η δομή των Watson-Crick αναφέρεται ως Β-DNA και υπό φυσιολογικές συνθήκες είναι η πιο σταθερή δομή. Σε αυτή τη διαμόρφωση το μόριο διευθετείται σε δεξιόστροφη διπλή έλικα, με διάμετρο περίπου 20Å, 10,5 ζεύγη βάσεων ανά στροφή έλικας, κλίση έλικας ανά ζεύγος 3,4Å, κλίση βάσης σε σχέση με τον άξονα της έλικας 6 ο, διαμόρφωση δεοξυριβόζης C-2 ενδο και διαμόρφωση γλυκοζιτικού δεσμού «αντί». Η δομική παραλλαγή Α-DNA ευνοείται σε διαλύματα απαλλαγμένα από νερό, άρα εμφανίζεται σε περιπτώσεις κρυστάλλωσης του DNA. Είναι άγνωστο εάν τα κύτταρα διαθέτουν αυτή τη δομική παραλλαγή. Σε αυτή τη διαμόρφωση το μόριο διευθετείται σε δεξιόστροφη διπλή έλικα, με διάμετρο περίπου 26Å, 11 ζεύγη βάσεων ανά στροφή έλικας, κλίση έλικας ανά ζεύγος 2,6Å, κλίση βάσης σε σχέση με τον άξονα της έλικας 20 ο, διαμόρφωση δεοξυριβόζης C-3 ενδο και διαμόρφωση γλυκοζιτικού δεσμού «αντί». Αυτές οι δομικές αλλαγές μεγαλώνουν την μείζονα αύλακα και μειώνουν την ελάσσονα. Η δομική παραλλαγή Ζ-DNA πιθανότατα υπάρχει σε ίχνη σε προκαρυωτικά αλλά και σε ευκαρυωτικά κύτταρα. Σε αυτή τη διαμόρφωση το μόριο διευθετείται σε αριστερόστροφη διπλή έλικα, με διάμετρο περίπου 18Å, 12 ζεύγη βάσεων ανά στροφή έλικας, κλίση έλικας ανά ζεύγος 3,7Å, κλίση βάσης σε σχέση με τον άξονα της έλικας 7 ο, διαμόρφωση δεοξυριβόζης C-3 ενδο για πουρίνες και C-2 ένδο για πυριμιδίνες και διαμόρφωση γλυκοζιτικού δεσμού «αντί» για πυριμιδίνες και «συν» για πουρίνες. Αυτές οι δομικές αλλαγές μικραίνουν εξαιρετικά την μείζονα αύλακα και κάνουν την ελάσσονα αύλακα στενή και βαθιά. Τα ίχνη Z-DNA ίσως παίζουν ρόλο στη ρύθμιση της έκφρασης των γονιδίων ή στο γενετικό ανασυνδυασμό. Η παρουσία της 5-μεθυλοκυτοσίνης σε μια εναλλασσόμενη αλληλουχία CpG (επιγενετική ρύθμιση γονιδίων) αυξάνει σημαντικά την τάση του συγκεκριμένου τμήματος DNA να αποκτήσει διαμόρφωση Ζ.



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΕΤΑΦΟΡΑ ΑΕΡΙΩΝ ΠΡΟΣ ΚΑΙ ΑΠΟ ΤΟΥΣ ΣΤΟΥΣ ΙΣΤΟΥΣ ΜΕΤΑΦΟΡΑ ΑΕΡΙΩΝ ΠΡΟΣ ΚΑΙ ΑΠΟ ΤΟΥΣ ΣΤΟΥΣ ΙΣΤΟΥΣ Μεταφορά οξυγόνου (Ο 2 ) από τον αέρα μέσω κυψελίδων στο αίμα και ιστούς Μεταφορά διοξειδίου άνθρακα (CO 2 ) από ιστούς σε κυψελίδες Οι κλίσεις των μερικών

Διαβάστε περισσότερα

ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ <=> R

ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ <=> R ΑΙΜΟΣΦΑΙΡΙΝΗ (ΑΜΦ) ΑΙΜΟΣΦΑΙΡΙΝΗ: Hb, είναι τετραμερής πρωτείνη. ΜΕΤΑΠΤΩΣΗ ΑΠΟ Τ R ΔΕΟΞΥΑΙΜΟΣΦΑΙΡΙΝΗ ΟΞΥΑΙΜΟΣΦΑΙΡΙΝΗ (Σταθερότητα, χαμηλή συγγένεια για Ο2Εύκαμπτη, υψηλή συγγένεια για Ο2) Λόγο των

Διαβάστε περισσότερα

Περιήγηση στο εσωτερικό του Κυττάρου. Φώτης Καρβέλης

Περιήγηση στο εσωτερικό του Κυττάρου. Φώτης Καρβέλης Περιήγηση στο εσωτερικό του Κυττάρου Φώτης Καρβέλης Όλα τα κύτταρα οριοθετούνται από την πλασματική μεμβράνη ή το κυτταρικό τοίχωμα που την περιβάλλει. Εσωτερικά της πλασματικής μεμβράνης υπάρχουν τα οργανίδια

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Τύποι νουκλεϊκών οξέων

Τύποι νουκλεϊκών οξέων Τύποι νουκλεϊκών οξέων DNA ένας τύπος, μια λειτουργία RNA - 4 τύποι, 4 λειτουργίες Ριβοσωμικό RNA Αγγελιαφόρο RNA Μεταφορικό RNA Καταλυτικό RNA Βιοχημεία Ι Δ-1 Βιοχημεία Ι Δ-2 3 5 φωσφοδιεστερικός δεσμός

Διαβάστε περισσότερα

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Βιοχημεία Βιομορίων Αθήνα 2015 Γενικές Ιδιότητες Ένζυμα : Βιολογικοί Καταλύτες Τα ένζυμα είναι πρωτεϊνικά μόρια Μικρή ομάδα καταλυτικών RNA H

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 5 η ΚΥΤΤΑΡΙΚΗ ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ

Γενική Μικροβιολογία. Ενότητα 5 η ΚΥΤΤΑΡΙΚΗ ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ Γενική Μικροβιολογία Ενότητα 5 η ΚΥΤΤΑΡΙΚΗ ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 4 & 5 (29/2 & 2/3/2016) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 4 & 5 (29/2 & 2/3/2016) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες λειτουργούν ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο. 1.2 To αντιδραστήριο Tollens (αμμωνιακό διάλυμα AgNO 3 ) οξειδώνει την ένωση α. CH 3 CH 2 ΟΗ. β. γ. CH 3 COOH. δ. CH 3 CH=O.


Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα


ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα


Κεφάλαιο 2ο ΔΟΜΗ ΤΟΥ ΚΥΤΤΑΡΟΥ Κεφάλαιο 2ο ΔΟΜΗ ΤΟΥ ΚΥΤΤΑΡΟΥ 1. Κυτταρική μεμβράνη μοντέλο ρευστού μωσαϊκού κατά Singer και Nicolson Αποτελείται από διπλό στρώμα φωσφολιπιδίων με διάσπαρτα μόρια στεροειδών (χοληστερόλης) και μεγάλα

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 4 & 5 (3/3 & 6/3/2017) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 4 & 5 (3/3 & 6/3/2017) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες λειτουργούν ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές

Διαβάστε περισσότερα


ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% Ο άνθρακας, το υδρογόνο, το οξυγόνο και το άζωτο συμμετέχουν, σε σημαντικό βαθμό, στη

Διαβάστε περισσότερα

NH 2. Μονάδες Ένα υδατικό διάλυμα έχει ph=7 στους 25 ο C. Το διάλυμα αυτό μπορεί να περιέχει:


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (22/2/2016) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια-φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα


ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

Μερικά χαρακτηριστικά του ενεργού κέντρου των ενζύμων

Μερικά χαρακτηριστικά του ενεργού κέντρου των ενζύμων Μερικά χαρακτηριστικά του ενεργού κέντρου των ενζύμων Το ενεργό κέντρο καταλαμβάνει σχετικά μικρό τμήμα του ολικού όγκου του ενζύμου Το ενεργό κέντρο είναι μια τρισδιάστατη ολότητα Η ειδικότητα δέσμευσης

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Α. Εισαγωγικές έννοιες ΜΕΣΑ ΣΤΑ ΚΥΤΤΑΡΑ Μπορούμε να διακρίνουμε δύο περιβάλλοντα ΥΔΡΟΦΙΛΟ υδατικό κυτταρόπλασμα ΥΔΡΟΦΟΒΟ λιπιδικο-μεμβρανικό Δηλαδή τα μόρια χαρακτηρίζονται έτσι λόγω της υδρόφοβης φύσης

Διαβάστε περισσότερα


ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΕΚΠΑ ΑΚ. ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΕΚΠΑ ΑΚ. ΕΤΟΥΣ 2015-2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ 1. Να αναφερθούν οι μηχανισμοί αναφοράς μικρών μορίων από το εξωκυττάριο περιβάλλον στο εσωτερικό του κυττάρου. 2. Ποιος

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (10/3/2014) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (10/3/2014) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (10/3/2014) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια- Φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΛΕΞΑΝΔΡΟΣ Λ. ΖΩΓΡΑΦΟΣ. Λιπαρά οξέα, εστέρες Λευκοτριένια, προσταγλαδίνες Πολυαιθέρες, μακρολίδια

ΑΛΕΞΑΝΔΡΟΣ Λ. ΖΩΓΡΑΦΟΣ. Λιπαρά οξέα, εστέρες Λευκοτριένια, προσταγλαδίνες Πολυαιθέρες, μακρολίδια ΧΗΜΕΙΑ ΦΥΣΙΚΩΝ ΠΡΟΪΟΝΤΩΝ-ΓΕΝΙΚΑ ΦΥΣΙΚΑ ΠΡΟΪΟΝΤΑ: Ενώσεις που αποτελούν τους ζωντανούς οργανισμούς ή παράγονται από αυτούς. Σήμερα ο όρος φυσικά προϊόντα αναφέρεται στα προϊόντα του δευτερογενούς μεταβολισμού

Διαβάστε περισσότερα

ΠΡΩΤΕΪΝΕΣ. Φατούρος Ιωάννης Αναπληρωτής Καθηγητής

ΠΡΩΤΕΪΝΕΣ. Φατούρος Ιωάννης Αναπληρωτής Καθηγητής ΠΡΩΤΕΪΝΕΣ Φατούρος Ιωάννης Αναπληρωτής Καθηγητής Θέματα Διάλεξης Δομή, αριθμός και διαχωρισμός των αμινοξέων Ένωση αμινοξέων με τον πεπτιδικό δεσμό για τη δημιουργία πρωτεΐνης Λειτουργίες των πρωτεϊνών

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα


ΛΙΠΙΔΙΑ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ. 29/10/2015 Δ.Δ. Λεωνίδας ΛΙΠΙΔΙΑ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 4η ομάδα βιομορίων Δεν είναι πολυμερή, αλλά σχηματίζουν συσσωματώματα Μεγαλύτερη δομική ανομοιογένεια, κοινό χαρακτηριστικό: υδρόφοβος χαρακτήρας Βιολογικοί ρόλοι: 1. Συστατικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:


Διαβάστε περισσότερα

NH 2. Μονάδες Ένα υδατικό διάλυµα έχει ph=7 στους 25 ο C. Το διάλυµα αυτό µπορεί να περιέχει: β. NaC. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ


Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA

Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA Χρήστος Κρούπης, MSc, PhD Επίκουρος Καθηγητής Κλινικής Βιοχημείας Ιατρική Σχολή Πανεπιστημίου Αθηνών Αττικόν Πανεπιστημιακό Νοσοκομείο Lehninger

Διαβάστε περισσότερα


ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΤΡΟΦΗ Λίπη Πολυσακχαρίτες Γλυκόζη κι άλλα σάκχαρα Πρωτεΐνες Αμινοξέα Λιπαρά Οξέα Γλυκόλυση Πυροσταφυλικό Οξύ Ακέτυλο-oA Αλυσίδα μεταφοράς ηλεκτρονίων / Οξειδωτική φωσφορυλίωση

Διαβάστε περισσότερα

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια Περιγραφή μαθήματος Επανάληψη σημαντικών εννοιών από την Οργανική Χημεία Χημική σύσταση των κυττάρων Μονοσακχαρίτες Αμινοξέα Νουκλεοτίδια

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα ΚΕΦΑΛΑΙΟ 1 Οργάνωση της ζωής βιολογικά συστήματα 1.1 Τα μόρια της ζωής Καινούριες γνώσεις Ποια μόρια συμμετέχουν στη δομή και στις λειτουργίες των οργανισμών. Ποια είναι η σημασία του νερού για τη ζωή

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα


ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΤΡΟΦΗ Λίπη Πολυσακχαρίτες Γλυκόζη κι άλλα σάκχαρα Πρωτεΐνες Αμινοξέα Λιπαρά Οξέα Γλυκόλυση Πυροσταφυλικό Οξύ Ακέτυλο-CoA Αναπνευστική Αλυσίδα μεταφοράς ηλεκτρονίων / Οξειδωτική

Διαβάστε περισσότερα

Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά

Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά Είναι απλή πολυπεπτιδική αλυσίδα 307 αμινοξέων Είναι συμπαγής και έχει σχήμα ελλειψοειδές διαστάσεων 50 x 42 x 38 A Περιέχει περιοχές α-έλικος 38%

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα


ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

Κεφάλαια 8 ο Ένζυμα και κατάλυση

Κεφάλαια 8 ο Ένζυμα και κατάλυση Κεφάλαια 8 ο Ένζυμα και κατάλυση Τα ένζυμα είναι βιομόρια που μεσολαβούν στους χημικούς μετασχηματισμούς και στη μετατροπή της ενέργειας Κύρια χαρακτηριστικά τους η ισχύς και η εξειδίκευση Πλέον θα τα

Διαβάστε περισσότερα

ΒΙΟΧΗΜΕΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ. Στοιχείο O C H N Ca P K S Na Mg περιεκτικότητα % ,5 1 0,35 0,25 0,15 0,05

ΒΙΟΧΗΜΕΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ. Στοιχείο O C H N Ca P K S Na Mg περιεκτικότητα % ,5 1 0,35 0,25 0,15 0,05 ΒΙΟΧΗΜΕΙΑ Βιοχημεία: είναι η επιστήμη που ασχολείται με τη μελέτη των οργανικών ενώσεων που συναντώνται στον οργανισμό, καθώς και με τον μεταβολισμό τους. ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ 108 στοιχεία

Διαβάστε περισσότερα

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τίτλος Μαθήματος: Ενζυμολογία Ενότητα: Εισαγωγή Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τμήμα: Χημείας 8 1. EIΣAΓΩΓH Tα ένζυμα είναι οι καταλύτες της ζώσης ύλης. Καταλύουν τις χημικές αντιδράσεις,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες ΠΡΩΤΕΙΝΕΣ Οι πρωτεΐνες είναι πολυμερείς ουσίες με κυρίαρχο και πρωταρχικό ρόλο στη ζωή. Πρωτεΐνες είναι οι ουσίες που κυρίως δομούν και λειτουργούν τους οργανισμούς. Λέγονται και λευκώματα λόγω του λευκού

Διαβάστε περισσότερα

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1.


Διαβάστε περισσότερα

Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης

Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης Καθώς το οξυγόνο χρησιμοποιείται στους ιστούς παράγεται CO2 το οποίο πρέπει να μεταφερθεί πίσω στους πνεύμονες ή τα βράγχια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ

ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ Θερινό εξάμηνο 2011 Ο ρόλος του νερού στο φυτό Βασικότερο συστατικό των ιστών

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

Χαρακτηριστικά της δομής της Μυοσφαιρίνης

Χαρακτηριστικά της δομής της Μυοσφαιρίνης Χαρακτηριστικά της δομής της Μυοσφαιρίνης Η μυοσφαιρίνη είναι ενα εξαιρετικά συμπαγές μόριο.οι διαστάσεις είναι 45Χ35Χ25 Α και υπαρχει πολύ λίγος αδειος χώρος στο εσωτερικό τού μορίου Γυρω στα 75% της

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Χημεία Βιοχημεία Τεχνολογικής Κατεύθυνσης. Ημ/νία: 04 Ιουνίου 2014

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Χημεία Βιοχημεία Τεχνολογικής Κατεύθυνσης. Ημ/νία: 04 Ιουνίου 2014 Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Χημεία Βιοχημεία Τεχνολογικής Κατεύθυνσης Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. γ Α2. δ Α3. α. Σ β. Λ γ. Λ 𝐻! 𝚨𝟒. 𝛂)

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις:


Διαβάστε περισσότερα


Κεφάλαιο 3 ΜΕΤΑΒΟΛΙΣΜΟΣ Κεφάλαιο 3 ΜΕΤΑΒΟΛΙΣΜΟΣ 3.1 Ενέργεια και οργανισμοί Όλοι οι οργανισμοί, εκτός από αυτούς από αυτούς που έχουν την ικανότητα να φωτοσυνθέτουν, εξασφαλίζουν ενέργεια διασπώντας τις θρεπτικές ουσιές που περιέχονται

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Καθηγητής Δ. Μόσιαλος

Καθηγητής Δ. Μόσιαλος Μικροβιολογία-Ιολογία Επίκουρος Καθηγητής Καθηγητής Δ. Μόσιαλος Βιοενεργητική μικροβίων Βακτηριακή Γενετική Επισκόπηση Βακτηριοφάγων Προκαρυωτική ποικιλότητα (Βακτήρια) Προκαρυωτική ποικιλότητα (Αρχαία)

Διαβάστε περισσότερα


ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

οµή και Λειτουργία της Κυτταρικής Μεµβράνης

οµή και Λειτουργία της Κυτταρικής Μεµβράνης οµή και Λειτουργία της Κυτταρικής Μεµβράνης Αποµόνωση του κυττάρου από το περιβάλλον 10.1-membrane_fluidity.mov Λειτουργίες της κυτταρικής µεµβράνης 1. Ρυθµίζει τη διεύλευση ουσιών 2. Αναγνωρίζει χηµικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 5 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε υδατικά

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 12 ΛΙΠΙΔΙΑ ΚΑΙ ΚΥΤΤΑΡΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ 12 ΛΙΠΙΔΙΑ ΚΑΙ ΚΥΤΤΑΡΙΚΕΣ ΜΕΜΒΡΑΝΕΣ Λιπαρά οξέα Καρβοξυλικά λιπαρά οξέα με ζυγό αριθμό ανθράκων C16-C18 τα πιο κοινά Λίγα με αριθμό C20 Λιπαρά οξέα Κορεσμένα Δύο τύποι κορεσμένα

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 23/02/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 23/02/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 23/02/2014 1 23/02/2014 2 Τόσο τα νεκρά (µε θερµική επεξεργασία) βακτήρια S όσο και τα ζωντανά βακτήρια R δεν µπορούν να θανατώσουν ποντικούς. Όµως, η ταυτόχρονη µόλυνση µε αυτά

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΕΙΣΑΓΩΓΗ. Θερινό εξάμηνο ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων

ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΕΙΣΑΓΩΓΗ. Θερινό εξάμηνο ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΕΙΣΑΓΩΓΗ Θερινό εξάμηνο 2015 Αριστοτέλης Χ. Παπαγεωργίου Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων

Διαβάστε περισσότερα

Γκύζη 14-Αθήνα Τηλ :


Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

Δοµή και Λειτουργία της Κυτταρικής Μεµβράνης Ε. Παρασκευά 0

Δοµή και Λειτουργία της Κυτταρικής Μεµβράνης Ε. Παρασκευά 0 Δοµή και Λειτουργία της Κυτταρικής Μεµβράνης 12.11.2015 Ε. Παρασκευά 0 Η κυτταρική µεµβράνη Αποµόνωση του κυττάρου από το περιβάλλον Καθορισµός του ως οντότητα Περιβάλλει το κύτταρο Καθορίζει τα όρια του

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Η πεπτιδυλοτρανσφεράση είναι τό ενζυμο το οποίο καταλύει τον σχηματισμό του πεπτιδικού δεσμού.το ενζυμο διερευνάται εντατικά τα τελευταία 30 χρόνια και εχουν αναπτυχθεί ποικίλες απόψεις οσον αφορά την

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια Οργανική Χημεία Κεφάλαιο 28: Βιομόρια-λιπίδια 1. Γενικά Λιπίδια: οργανικά μόρια που απαντούν στη φύση και απομονώνονται κατά την εκχύληση κυττάρων ή ιστών με άπολους οργανικούς διαλύτες Δύο γενικές κατηγορίες

Διαβάστε περισσότερα


Διαβάστε περισσότερα


ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μεταλλάξεις DNA. Επιδιόρθωση DNA. Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA

Μεταλλάξεις DNA. Επιδιόρθωση DNA. Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA Μεταλλάξεις DNA Επιδιόρθωση DNA Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA 1 Tι είναι µετάλλαξη Τι προκαλεί τις µεταλλάξεις Τύποι των µεταλλάξεων Tύποι των µεταλλαξογόνων Μεταλλάξεις και ασθένειες

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

Εργασία Βιολογίας. Β. Γιώργος. Εισαγωγή 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ. Μεταφορά ενέργειας στα κύτταρα

Εργασία Βιολογίας. Β. Γιώργος. Εισαγωγή 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ. Μεταφορά ενέργειας στα κύτταρα Εργασία Βιολογίας Β. Γιώργος Εισαγωγή Η ενεργεια εχει πολυ μεγαλη σημασια για εναν οργανισμο, γιατι για να κανει οτιδηποτε ενας οργανισμος ειναι απαραιτητη. Ειναι απαραιτητη ακομη και οταν δεν κανουμε

Διαβάστε περισσότερα