ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ"

Transcript

1 ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών υποστρωμάτων από το ίδιο ένζυμο? 2. Πώς η περιεκτικότητα των μεμβρανών σε στερόλες επηρεάζει τα χαρακτηριστικά τους? 3. Γιατί το μονοξείδιο του άνθρακα έστω και σε χαμηλότατες συγκεντρώσεις είναι ιδιαίτερα τοξικό? 4.Ποια τα βασικά χαρακτηριστικά των μορφών Α, Β, Ζ του DNA? ΑΠΑΝΤΗΣΕΙΣ 1. Οι κινητικές παράμετροι K cat, K m γενικά χρησιμεύουν στη μελέτη και σύγκριση διαφορετικών ενζύμων, είτε με απλό είτε με περίπλοκο μηχανισμό αντίδρασης. Η K cat είναι η σταθερά ταχύτητας αντίστροφου χρόνου και αποκαλείται αριθμός ανακύκλωσης. Ισοδυναμεί με τον αριθμό των μορίων υποστρώματος που μετατρέπονται σε προϊόν στη μονάδα χρόνου πάνω σε ένα μόριο ενζύμου, όταν αυτό είναι κορεσμένο με υπόστρωμα.

2 Η K m είναι η σταθερά Michaelis Εξίσωση Michaelis-Menten V 0 =V max [S] K m +[S] Όπου V 0 και V max η αρχική και η μέγιστη ταχύτητα της αντίδρασης, αντίστοιχα, και το [S] η συγκέντρωση του υποστρώματος. Όταν K m =[S], τότε V 0 =1/2V max Κάθε ένζυμο έχει τιμές K cat και K m που αντικατοπτρίζουν το κυτταρικό περιβάλλον, τη συγκέντρωση του υποστρώματος στην οποία το υπόστρωμα βρίσκεται σε in vivo συνθήκες και τη χημεία της καταλυόμενης αντίδρασης, Οι παράμετροι αυτοί επιτρέπουν, επίσης, να εκτιμηθεί η κινητική αποτελεσματικότητα των ενζύμων. Καμία, από μόνη της, δεν επαρκεί για αυτό τον σκοπό. Δύο ένζυμα που καταλύουν διαφορετικές αντιδράσεις μπορεί να έχουν ίδια K cat, αλλά να επιταχύνουν διαφορετικά την αντίδραση. Ο καλύτερος τρόπος για να συγκριθεί η καταλυτική αποτελεσματικότητα διαφορετικών ενζύμων ή εναλλακτικά η ανακύκλωση διαφορετικών υποστρωμάτων στο ίδιο ένζυμο είναι να συγκριθεί ο λόγος K cat / K m για τις δύο αντιδράσεις. Αυτή η παράμετρος αποκαλείται σταθερά ειδικότητας και όταν K m >>[S], τότε V 0 = K cat K m Το πηλίκο αυτό έχει ανώτατο όριο, το οποίο επιβάλλεται από την ταχύτητα με την οποία το ένζυμο και το υπόστρωμα μπορούν να διαχυθούν μαζί σε υδατικό διάλυμα.

3 2. Οι στερόλες είναι δομικά λιπίδια που υπάρχουν στη μεμβράνη των περισσότερων ευκαρυωτικών κυττάρων. Η χαρακτηριστική δομή τους έχει ένα στεροειδή πυρήνα, που αποτελείται από τέσσερις συμπαγείς δακτυλίους, τρεις με έξι άτομα άνθρακα και έναν με πέντε άτομα άνθρακα. Ο στεροειδής πυρήνας είναι σχεδόν επίπεδος και σχετικά συμπαγής. Η χοληστερόλη, η κυριότερη στερόλη των ζωικών ιστών, είναι αμφιπολική, με μια ομάδα κεφαλής που φέρει υδροξύλιο στον C-3 (πολική ομάδα) και έναν μη πολικό υδρογονανθρακικό σκελετό με μήκος όσο ένα λιπαρό οξύ 16 ατόμων άνθρακα. Τα βακτήρια δε συνθέτουν στερόλες, αλλά κάποια είδη μπορούν να ενσωματώσουν εξωγενείς στερόλες στη μεμβράνη τους. Η δομή των στερολών επηρεάζει τη ρευστότητα της λιπιδικής διπλοστιβάδας καθώς ελατώνει την ελευθερία κίνησης των γειτονικών αλκυλομάδων με περιστροφή γύρω από τους δεσμούς άνθρακα-άνθρακα και αναγκάζει τις ακυλομάδες να υιοθετήσουν την πιο εκτεταμένη άκαμπτη δομή τους. Η παρουσία στερολών στην μεμβράνη ελαττώνει τη ρευστότητα στο κέντρο της διπλοστιβάδας και αυξάνει, επίσης, και το πάχος του φύλλου της διπλοστιβάδας στο οποίο συμμετέχει. Η χοληστερόλη συμμετέχει, επίσης, σε μικροπεριοχές χοληστερόλης-σφιγγολιπιδίων στην εξωτερική διπλοστιβάδα της κυτταρικής μεμβράνη. Οι μικροπεριοχές αυτές, επονομαζόμενες και «σχεδίες» είναι ελαφρώς παχύτερες και λιγότερο ρευστές από τις γειτονικές περιοχές της μεμβράνης. Στις «σχεδίες» αυτές συνεντοπίζονται μεμβρανικοί υποδοχείς και σηματοδοτικές πρωτεΐνες, πιθανότατα προκειμένου να αλληλεπιδράσουν. Εάν από τις «σχεδίες» αφαιρεθεί η χοληστερόλη οι δομές αυτές καταστρέφονται.

4 3. Το μονοξείδιο του άνθρακα είναι άχρωμο και άοσμο αέριο που παράγεται από ανθρώπινη δραστηριότητα (ατελής καύση οργανικών καυσίμων) αλλά και ως έλασσον παραπροϊόν του κυτταρικού μεταβολισμού. Το μονοξείδιο του άνθρακα προσδένεται στα ελεύθερα μόρια αίμης φορές ισχυρότερα από το οξυγόνο. Ωστόσο, όταν η αίμη είναι συνδεδεμένη πάνω σε πρωτεΐνη (αιμοσφαιρίνη, μυοσφαιρίνη) η πρόσδεση του CO πάνω στην αίμη είναι μόνο 200 φορές ισχυρότερη. Αυτό οφείλεται στην στερεοταξική παρεμπόδιση της περιφερικής ιστιδίνης της υπομονάδας της αιμοσφαιρίνης στο μόριο του CO το οποίο ευθυγραμμίζεται με το άτομο σιδήρου της αίμης, σε σχέση με το μόριο οξυγόνου που σχηματίζει γωνία με τον σίδηρο. Το CO, λοιπόν, προσδένεται με μεγαλύτερη συγγένεια από το οξυγόνο στην αιμοσφαιρίνη, προκαλώντας διαταραχές της μεταφοράς του προς τους περιφερικούς ιστούς. Όταν τα επίπεδα της αιμοσφαιρίνης που έχει συνδεθεί με CO υπερβούν το 60% τότε επέρχεται ο θάνατος. Η πρόσδεση του CO στην αιμοσφαιρίνη δεν προκαλεί απλώς μείωση στην ποσότητα της πρωτεΐνης που προσφέρεται για πρόσδεση οξυγόνου, αλλά αυξάνει σημαντικά τη συγγένειά της για το οξυγόνο. Έτσι, ακόμα και εάν ένα μόριο αιμοσφαιρίνης έχει προσδέσει οξυγόνο, λόγω υψηλής συγγένειας, δεν μπορεί να το αποδώσει στους ιστούς. Τα προβλήματα επιτείνονται από το γεγονός ότι το CO προσδένεται σε όσες πρωτεΐνες έχουν, ως προσθετική ομάδα, αίμη. Το CO εκτοπίζεται από υψηλή συγκέντρωση οξυγόνου. Ομάδες με μεγαλύτερη ευπάθεια είναι τα έμβρυα, καθώς η εμβρυική αιμοσφαιρίνη έχει υψηλότερη συγγένεια για το CO, οι ασθενείς με αναιμία ή καρδιοαναπνευστικά νοσήματα και οι καπνιστές.

5 4. Το DNA είναι ένα εύκαμπτο μόριο, με δυνατότητα περιστροφής γύρω από αρκετούς δεσμούς στο σακχαροφωσφορικό σκελετό. Η δομή των Watson-Crick αναφέρεται ως Β-DNA και υπό φυσιολογικές συνθήκες είναι η πιο σταθερή δομή. Σε αυτή τη διαμόρφωση το μόριο διευθετείται σε δεξιόστροφη διπλή έλικα, με διάμετρο περίπου 20Å, 10,5 ζεύγη βάσεων ανά στροφή έλικας, κλίση έλικας ανά ζεύγος 3,4Å, κλίση βάσης σε σχέση με τον άξονα της έλικας 6 ο, διαμόρφωση δεοξυριβόζης C-2 ενδο και διαμόρφωση γλυκοζιτικού δεσμού «αντί». Η δομική παραλλαγή Α-DNA ευνοείται σε διαλύματα απαλλαγμένα από νερό, άρα εμφανίζεται σε περιπτώσεις κρυστάλλωσης του DNA. Είναι άγνωστο εάν τα κύτταρα διαθέτουν αυτή τη δομική παραλλαγή. Σε αυτή τη διαμόρφωση το μόριο διευθετείται σε δεξιόστροφη διπλή έλικα, με διάμετρο περίπου 26Å, 11 ζεύγη βάσεων ανά στροφή έλικας, κλίση έλικας ανά ζεύγος 2,6Å, κλίση βάσης σε σχέση με τον άξονα της έλικας 20 ο, διαμόρφωση δεοξυριβόζης C-3 ενδο και διαμόρφωση γλυκοζιτικού δεσμού «αντί». Αυτές οι δομικές αλλαγές μεγαλώνουν την μείζονα αύλακα και μειώνουν την ελάσσονα. Η δομική παραλλαγή Ζ-DNA πιθανότατα υπάρχει σε ίχνη σε προκαρυωτικά αλλά και σε ευκαρυωτικά κύτταρα. Σε αυτή τη διαμόρφωση το μόριο διευθετείται σε αριστερόστροφη διπλή έλικα, με διάμετρο περίπου 18Å, 12 ζεύγη βάσεων ανά στροφή έλικας, κλίση έλικας ανά ζεύγος 3,7Å, κλίση βάσης σε σχέση με τον άξονα της έλικας 7 ο, διαμόρφωση δεοξυριβόζης C-3 ενδο για πουρίνες και C-2 ένδο για πυριμιδίνες και διαμόρφωση γλυκοζιτικού δεσμού «αντί» για πυριμιδίνες και «συν» για πουρίνες. Αυτές οι δομικές αλλαγές μικραίνουν εξαιρετικά την μείζονα αύλακα και κάνουν την ελάσσονα αύλακα στενή και βαθιά. Τα ίχνη Z-DNA ίσως παίζουν ρόλο στη ρύθμιση της έκφρασης των γονιδίων ή στο γενετικό ανασυνδυασμό. Η παρουσία της 5-μεθυλοκυτοσίνης σε μια εναλλασσόμενη αλληλουχία CpG (επιγενετική ρύθμιση γονιδίων) αυξάνει σημαντικά την τάση του συγκεκριμένου τμήματος DNA να αποκτήσει διαμόρφωση Ζ.

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2015-2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ 1)Πώς το φαινόμενο Bohr επηρεάζει την πρόσδεση οξυγόνου στην αιμοσφαιρίνη; Που συνδέονται τα ιόντα

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Περιήγηση στο εσωτερικό του Κυττάρου. Φώτης Καρβέλης

Περιήγηση στο εσωτερικό του Κυττάρου. Φώτης Καρβέλης Περιήγηση στο εσωτερικό του Κυττάρου Φώτης Καρβέλης Όλα τα κύτταρα οριοθετούνται από την πλασματική μεμβράνη ή το κυτταρικό τοίχωμα που την περιβάλλει. Εσωτερικά της πλασματικής μεμβράνης υπάρχουν τα οργανίδια

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική

Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Εξερευνώντας τα Βιομόρια Ένζυμα: Βασικές Αρχές και Κινητική Βιοχημεία Βιομορίων Αθήνα 2015 Γενικές Ιδιότητες Ένζυμα : Βιολογικοί Καταλύτες Τα ένζυμα είναι πρωτεϊνικά μόρια Μικρή ομάδα καταλυτικών RNA H

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2016-2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ 1) Δίνονται τα αμινοξέα σερίνη, αλανίνη, γλουταμικό, κυστεΐνη, λυσίνη, αργινίνη, διαχωρίστε τα

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 5 η ΚΥΤΤΑΡΙΚΗ ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ

Γενική Μικροβιολογία. Ενότητα 5 η ΚΥΤΤΑΡΙΚΗ ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ Γενική Μικροβιολογία Ενότητα 5 η ΚΥΤΤΑΡΙΚΗ ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο. 1.2 To αντιδραστήριο Tollens (αμμωνιακό διάλυμα AgNO 3 ) οξειδώνει την ένωση α. CH 3 CH 2 ΟΗ. β. γ. CH 3 COOH. δ. CH 3 CH=O.

ΘΕΜΑ 1 ο. 1.2 To αντιδραστήριο Tollens (αμμωνιακό διάλυμα AgNO 3 ) οξειδώνει την ένωση α. CH 3 CH 2 ΟΗ. β. γ. CH 3 COOH. δ. CH 3 CH=O. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 1 ΙΟΥΝΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

NH 2. Μονάδες Ένα υδατικό διάλυμα έχει ph=7 στους 25 ο C. Το διάλυμα αυτό μπορεί να περιέχει:

NH 2. Μονάδες Ένα υδατικό διάλυμα έχει ph=7 στους 25 ο C. Το διάλυμα αυτό μπορεί να περιέχει: ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 9 ΙΟΥΛΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) : ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο Για τις ερωτήσεις

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (22/2/2016) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια-φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΕΚΠΑ ΑΚ. ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΕΚΠΑ ΑΚ. ΕΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΕΚΠΑ ΑΚ. ΕΤΟΥΣ 2015-2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ 1. Να αναφερθούν οι μηχανισμοί αναφοράς μικρών μορίων από το εξωκυττάριο περιβάλλον στο εσωτερικό του κυττάρου. 2. Ποιος

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (10/3/2014) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (10/3/2014) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (10/3/2014) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια- Φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΘΕΜΑ A ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΑΛΕΞΑΝΔΡΟΣ Λ. ΖΩΓΡΑΦΟΣ. Λιπαρά οξέα, εστέρες Λευκοτριένια, προσταγλαδίνες Πολυαιθέρες, μακρολίδια

ΑΛΕΞΑΝΔΡΟΣ Λ. ΖΩΓΡΑΦΟΣ. Λιπαρά οξέα, εστέρες Λευκοτριένια, προσταγλαδίνες Πολυαιθέρες, μακρολίδια ΧΗΜΕΙΑ ΦΥΣΙΚΩΝ ΠΡΟΪΟΝΤΩΝ-ΓΕΝΙΚΑ ΦΥΣΙΚΑ ΠΡΟΪΟΝΤΑ: Ενώσεις που αποτελούν τους ζωντανούς οργανισμούς ή παράγονται από αυτούς. Σήμερα ο όρος φυσικά προϊόντα αναφέρεται στα προϊόντα του δευτερογενούς μεταβολισμού

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

NH 2. Μονάδες Ένα υδατικό διάλυµα έχει ph=7 στους 25 ο C. Το διάλυµα αυτό µπορεί να περιέχει: β. NaC. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

NH 2. Μονάδες Ένα υδατικό διάλυµα έχει ph=7 στους 25 ο C. Το διάλυµα αυτό µπορεί να περιέχει: β. NaC. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 9 ΙΟΥΛΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 22/05/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: XHMEIA-BIOXHMEIA ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α A1. δ A2. β A3. Λάθος

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Κεφάλαια 8 ο Ένζυμα και κατάλυση

Κεφάλαια 8 ο Ένζυμα και κατάλυση Κεφάλαια 8 ο Ένζυμα και κατάλυση Τα ένζυμα είναι βιομόρια που μεσολαβούν στους χημικούς μετασχηματισμούς και στη μετατροπή της ενέργειας Κύρια χαρακτηριστικά τους η ισχύς και η εξειδίκευση Πλέον θα τα

Διαβάστε περισσότερα

Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά

Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά Το ένζυμο Καρβοξυπεπτιδάση Α έχει τα εξής χαρακτηριστικά Είναι απλή πολυπεπτιδική αλυσίδα 307 αμινοξέων Είναι συμπαγής και έχει σχήμα ελλειψοειδές διαστάσεων 50 x 42 x 38 A Περιέχει περιοχές α-έλικος 38%

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τίτλος Μαθήματος: Ενζυμολογία Ενότητα: Εισαγωγή Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τμήμα: Χημείας 8 1. EIΣAΓΩΓH Tα ένζυμα είναι οι καταλύτες της ζώσης ύλης. Καταλύουν τις χημικές αντιδράσεις,

Διαβάστε περισσότερα

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1.

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 21 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες ΠΡΩΤΕΙΝΕΣ Οι πρωτεΐνες είναι πολυμερείς ουσίες με κυρίαρχο και πρωταρχικό ρόλο στη ζωή. Πρωτεΐνες είναι οι ουσίες που κυρίως δομούν και λειτουργούν τους οργανισμούς. Λέγονται και λευκώματα λόγω του λευκού

Διαβάστε περισσότερα

Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης

Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης Καθώς το οξυγόνο χρησιμοποιείται στους ιστούς παράγεται CO2 το οποίο πρέπει να μεταφερθεί πίσω στους πνεύμονες ή τα βράγχια

Διαβάστε περισσότερα

ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ

ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΠΡΟΣΛΗΨΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΤΟΥ ΝΕΡΟΥ ΣΤΑ ΦΥΤΑ Θερινό εξάμηνο 2011 Ο ρόλος του νερού στο φυτό Βασικότερο συστατικό των ιστών

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις:

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

οµή και Λειτουργία της Κυτταρικής Μεµβράνης

οµή και Λειτουργία της Κυτταρικής Μεµβράνης οµή και Λειτουργία της Κυτταρικής Μεµβράνης Αποµόνωση του κυττάρου από το περιβάλλον 10.1-membrane_fluidity.mov Λειτουργίες της κυτταρικής µεµβράνης 1. Ρυθµίζει τη διεύλευση ουσιών 2. Αναγνωρίζει χηµικά

Διαβάστε περισσότερα

Καθηγητής Δ. Μόσιαλος

Καθηγητής Δ. Μόσιαλος Μικροβιολογία-Ιολογία Επίκουρος Καθηγητής Καθηγητής Δ. Μόσιαλος Βιοενεργητική μικροβίων Βακτηριακή Γενετική Επισκόπηση Βακτηριοφάγων Προκαρυωτική ποικιλότητα (Βακτήρια) Προκαρυωτική ποικιλότητα (Αρχαία)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Χημεία Βιοχημεία Τεχνολογικής Κατεύθυνσης. Ημ/νία: 04 Ιουνίου 2014

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Χημεία Βιοχημεία Τεχνολογικής Κατεύθυνσης. Ημ/νία: 04 Ιουνίου 2014 Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Χημεία Βιοχημεία Τεχνολογικής Κατεύθυνσης Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. γ Α2. δ Α3. α. Σ β. Λ γ. Λ 𝐻! 𝚨𝟒. 𝛂)

Διαβάστε περισσότερα

Κεφάλαιο 3 ΜΕΤΑΒΟΛΙΣΜΟΣ

Κεφάλαιο 3 ΜΕΤΑΒΟΛΙΣΜΟΣ Κεφάλαιο 3 ΜΕΤΑΒΟΛΙΣΜΟΣ 3.1 Ενέργεια και οργανισμοί Όλοι οι οργανισμοί, εκτός από αυτούς από αυτούς που έχουν την ικανότητα να φωτοσυνθέτουν, εξασφαλίζουν ενέργεια διασπώντας τις θρεπτικές ουσιές που περιέχονται

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ

ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα

Γκύζη 14-Αθήνα Τηλ : 210.64.52.777

Γκύζη 14-Αθήνα Τηλ : 210.64.52.777 ΘΕΜΑ Α Α1. α Α2. γ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

Χαρακτηριστικά της δομής της Μυοσφαιρίνης

Χαρακτηριστικά της δομής της Μυοσφαιρίνης Χαρακτηριστικά της δομής της Μυοσφαιρίνης Η μυοσφαιρίνη είναι ενα εξαιρετικά συμπαγές μόριο.οι διαστάσεις είναι 45Χ35Χ25 Α και υπαρχει πολύ λίγος αδειος χώρος στο εσωτερικό τού μορίου Γυρω στα 75% της

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια

Οργανική Χημεία. Κεφάλαιο 28: Βιομόρια-λιπίδια Οργανική Χημεία Κεφάλαιο 28: Βιομόρια-λιπίδια 1. Γενικά Λιπίδια: οργανικά μόρια που απαντούν στη φύση και απομονώνονται κατά την εκχύληση κυττάρων ή ιστών με άπολους οργανικούς διαλύτες Δύο γενικές κατηγορίες

Διαβάστε περισσότερα

Μεταλλάξεις DNA. Επιδιόρθωση DNA. Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA

Μεταλλάξεις DNA. Επιδιόρθωση DNA. Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA Μεταλλάξεις DNA Επιδιόρθωση DNA Μοριακή βάση µεταλλαξεων και επιδιόρθωσης του DNA 1 Tι είναι µετάλλαξη Τι προκαλεί τις µεταλλάξεις Τύποι των µεταλλάξεων Tύποι των µεταλλαξογόνων Μεταλλάξεις και ασθένειες

Διαβάστε περισσότερα

ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 1ο ΒΙΟΤΕΧΝΟΛΟΓΙΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΒΟΛΟΥ 2010-11 ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 1 ο : ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ ΚΑΙ ΒΙΟΧΗΜΕΙΑ 1. Τι είναι η Βιοχημεία και με ποιες ενώσεις ασχολείται. 2. Πόσα και ποια στοιχεία

Διαβάστε περισσότερα

Εργασία Βιολογίας. Β. Γιώργος. Εισαγωγή 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ. Μεταφορά ενέργειας στα κύτταρα

Εργασία Βιολογίας. Β. Γιώργος. Εισαγωγή 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ. Μεταφορά ενέργειας στα κύτταρα Εργασία Βιολογίας Β. Γιώργος Εισαγωγή Η ενεργεια εχει πολυ μεγαλη σημασια για εναν οργανισμο, γιατι για να κανει οτιδηποτε ενας οργανισμος ειναι απαραιτητη. Ειναι απαραιτητη ακομη και οταν δεν κανουμε

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΥ ΓΕΝΙΚΥ ΛΥΚΕΙΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΥ 2013 ΕΞΕΤΑΖΜΕΝ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΧΗΜΕΙΑ ΤΕΧΝΛΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΣ ΤΕΧΝΛΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΛ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες

Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες Οι πρωτεΐνες συμμετέχουν σε όλες τις κυτταρικές λειτουργίες Γένωμα vs Πρωτέωμα Όλη η αλληλουχία βάσεων στο DNA Τι είναι δυνατόν Συγκεκριμένο Στατικό Οι πρωτεΐνες που κωδικοποιούνται από το γένωμα Τι είναι

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ

ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Β ΤΡΙΜΗΝΟ ΚΟΝΤΟΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Γ2 Ιανουάριος 2015 ΕΙΣΑΓΩΓΗ Ο ι Watson και Crick, το 1953, διατύπωσαν το μοντέλο της διπλής έλικας

Διαβάστε περισσότερα

ΠΤΡΗΝΑ ΣΟΤ ΚΤΣΣΑΡΟΤ: ΔΟΜΗ, ΛΕΙΣΟΤΡΓΙΑ, ΔΙΑΚΙΝΗΗ ΤΣΑΣΙΚΩΝ ΔΙΑΜΕΟΤ ΣΗ ΠΤΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ

ΠΤΡΗΝΑ ΣΟΤ ΚΤΣΣΑΡΟΤ: ΔΟΜΗ, ΛΕΙΣΟΤΡΓΙΑ, ΔΙΑΚΙΝΗΗ ΤΣΑΣΙΚΩΝ ΔΙΑΜΕΟΤ ΣΗ ΠΤΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΤΡΗΝΑ ΣΟΤ ΚΤΣΣΑΡΟΤ: ΔΟΜΗ, ΛΕΙΣΟΤΡΓΙΑ, ΔΙΑΚΙΝΗΗ ΤΣΑΣΙΚΩΝ ΔΙΑΜΕΟΤ ΣΗ ΠΤΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΓΤΜΝΑΙΟ ΚΕΡΑΣΕΑ ΦΟΛ. ΕΣΟ 2011-12 ΣΜΗΜΑ Γ3 ΟΡΥΑΝΙΔΗ ΓΙΩΡΓΟ ΙΔΕΡΗ ΒΑΓΓΕΛΗ Σο κύτταρο είναι η μικρότερη ζωντανή μονάδα,

Διαβάστε περισσότερα

Δομή πλασματικής μεμβράνης & διαπερατότητα ΕΥΚΑΡΥΩΤΙΚO ΚYΤΤΑΡΟ

Δομή πλασματικής μεμβράνης & διαπερατότητα ΕΥΚΑΡΥΩΤΙΚO ΚYΤΤΑΡΟ Δομή πλασματικής μεμβράνης & διαπερατότητα ΕΥΚΑΡΥΩΤΙΚO ΚYΤΤΑΡΟ ΚΥΤΤΑΡΟ Κύτταρο: Βασική μονάδα της ζωής με δυνατότητα αναπαραγωγής Μονοκύτταροι Πολλαπλασιασμός με απλή διχοτόμηση Πολυκύτταροι Πολλαπλασιασμός

Διαβάστε περισσότερα

ΗΝΟ 3 ΝΗ 3 Η 2 Ο Μονάδες 3 β) Ποιο από τα παραπάνω ζεύγη, στο ίδιο υδατικό διάλυµα, µπορεί να αποτελέσει ρυθµιστικό διάλυµα; Μονάδες 2 ΑΠ.

ΗΝΟ 3 ΝΗ 3 Η 2 Ο Μονάδες 3 β) Ποιο από τα παραπάνω ζεύγη, στο ίδιο υδατικό διάλυµα, µπορεί να αποτελέσει ρυθµιστικό διάλυµα; Μονάδες 2 ΑΠ. ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 12 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΕΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Α4. Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες:

Α4. Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ)

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ)

1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ) Θάνος Α. Β1 ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟ ΤΡΙΤΟ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Όλοι οι οργανισμοί προκειμένου να επιβιώσουν και να επιτελέσουν τις λειτουργίες τους χρειάζονται ενέργεια. Οι φυτικοί οργανισμοί μετατρέπουν

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016 Ε Λ Λ Η Ν Ι Κ Η ΗΜΟΚΡΑΤΙΑ ΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Θ Ρ Α Κ Η Σ ΠΑΝΕΠΙΣΤΗΜΙΟΥΠΟΛΗ 6 Ο χλµ AΛΕΞ/ΠΟΛΗΣ-ΜΑΚΡΗΣ 68100 ΑΛΕΞΑΝ ΡΟΥΠΟΛΗ Τ Μ Η ΜΑ Ι Α Τ Ρ Ι Κ Η Σ Γ Ρ Α Μ Μ Α Τ Ε Ι Α H E L L E N I C R E P U B L I

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 4 ΙΟΥΝΙΟΥ 2014 ΕΚΦΩΝΗΣΕΙΣ ÓÕÃ ÑÏÍÏ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 4 ΙΟΥΝΙΟΥ 2014 ΕΚΦΩΝΗΣΕΙΣ ÓÕÃ ÑÏÍÏ Θέµα Α ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 4 ΙΟΥΝΙΟΥ 2014 ΕΚΦΩΝΗΣΕΙΣ Στις προτάσεις Α1 και Α2 να γράψετε στο τετράδιό σας τον αριθµό της πρότασης και, δίπλα,

Διαβάστε περισσότερα

συμπεριφέρεται ως α. βάση. β. οξύ. γ. πρωτονιοδότης. δ. αμφολύτης. Μονάδες 5

συμπεριφέρεται ως α. βάση. β. οξύ. γ. πρωτονιοδότης. δ. αμφολύτης. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ ΒΙΟΧΗΜΕΙΑ ΤΗΣ ΑΣΚΗΣΗΣ Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΔΙΑΛΕΞΗ 1 - ΓΡΗΓΟΡΗ ΑΝΑΣΚΟΠΗΣΗ ΒΑΣΙΚΩΝ ΓΝΩΣΕΩΝ A. Το Περιβάλλον του

Διαβάστε περισσότερα

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ

ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ ΜΑΘΗΜΑ 3ο ΜΕΡΟΣ Β ΔΙΑΒΙΒΑΣΗ ΣΤΗ ΝΕΥΡΟΜΥΪΚΗ ΣΥΝΑΨΗ Η νευρομυϊκή σύναψη αποτελεί ιδιαίτερη μορφή σύναψης μεταξύ του κινητικού νευρώνα και της σκελετικής μυϊκής ίνας Είναι ορατή με το οπτικό μικροσκόπιο Στην

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Ενότητα: ΕΥΚΑΡΥΩΤΙΚΑ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ

Ενότητα: ΕΥΚΑΡΥΩΤΙΚΑ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Τίτλος Μαθήματος: Γενική Μικροβιολογία Ενότητα: ΕΥΚΑΡΥΩΤΙΚΑ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Διδάσκων: Καθηγητής Ιωάννης Σαββαΐδης Τμήμα: Χημείας ΚΕΦΑΛΑΙΟ 3 Ευκαρυωτικά και Προκαρυωτικά Κύτταρα Οι διάφορες βιοχημικές

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών

Βιοϋλικά. Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά. Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Βιοϋλικά Ενότητα 5: Πρωτεΐνες, Κύτταρα, Ιστοί Αλληλεπίδραση με Βιοϋλικά Ελευθέριος Αμανατίδης Πολυτεχνική Σχολή Τμήμα Χημικών Μηχανικών Περιεχόμενα ενότητας Πρωτεΐνες Δομή και είδη Λειτουργίες πρωτεϊνών

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ. ΛΙΠΙΔΙΑ Τι είναι; - Λειτουργίες. Η. ΜΥΛΩΝΗΣ Κλινική Χημεια Λιπίδια-Λιποπρωτεϊνες - May 12, 2015 ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ

ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ. ΛΙΠΙΔΙΑ Τι είναι; - Λειτουργίες. Η. ΜΥΛΩΝΗΣ Κλινική Χημεια Λιπίδια-Λιποπρωτεϊνες - May 12, 2015 ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ Είδη ιπιδίων Ιδιότητες Λιποπρωτείνες Ταξινόμηση Σύσταση σε ιπίδια και αποπρωτείνες Μεταβοισμός Επιθυμητές τιμές οριακές τιμές Δυσιπιδαιμίες - Υπεριποπρωτεϊναιμίες

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Ζήτηµα 1ο Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 1 ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 18 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ Θέμα Α ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

Περίληψη Βιολογίας Κεφάλαιο 3

Περίληψη Βιολογίας Κεφάλαιο 3 Περίληψη Βιολογίας Κεφάλαιο 3 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Η σημασία της ενέργειας στους οργανισμούς. Η ενέργεια είναι ένας παράγοντας σημαντικός για τους οργανισμούς γιατί όλες οι λειτουργίες τους απαιτούν

Διαβάστε περισσότερα

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΛΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΑΠΑΝΤΗΣΕΙΣ

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΑΠΑΝΤΗΣΕΙΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 16/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΟΚΤΩ (8) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χηµεία Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει µόνο άτοµα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα