Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση του ολιγοπεπτιδίου μετά από καθεμία από τις παρακάτω περιπτώσεις: α. Η G στην 3 η θέση της κωδικής αλυσίδας αντικαθίσταται από T. β. Η G στην 8 η θέση της κωδικής αλυσίδας αντικαθίσταται από A. γ. Η Α στη 14 η θέση της κωδικής αλυσίδας αντικαθίσταται από G. δ. Η C στη 10 η θέση της κωδικής αλυσίδας αντικαθίσταται από T. ε. Αφαιρείται η G στην 11 η θέση της κωδικής αλυσίδας. στ. Προστίθεται μεταξύ της A στη 14 η θέση και της A στην 15 η θέση της κωδικής αλυσίδας η T. mrna: 5 AAGCG AUG CCG CCA AGA AGC UGA CUGAAC3 Πρωτεΐνη: ΝΗ 2 -met-pro-pro-arg-ser-cooh α. Πιθανή μη φυσιολογική σύνδεση μικρής υπομονάδας ριβοσώματος με mrna. β. Το κωδικόνιο έναρξης γίνεται AUA- δεν αρχίζει η πρωτεϊνοσύνθεση. γ. Το κωδικόνιο CCA(pro) γίνεται CCG(pro)- σιωπηλή μετάλλαξη. δ. Το κωδικόνιο CCG(pro) γίνεται CUG(leu)- το νέο πεπτίδιο διαφέρει σε 1 αμινοξύ από το φυσιολογικό. ε. Το νέο πεπτίδιο είναι: ΝΗ 2 -met-pro-gln-glu-ala-asp-cooh. Έχει 1 περισσότερο αμινοξύ σε σχέση με το φυσιολογικό. στ. Το 4 ο κωδικόνιο (AGA) γίνεται κωδικόνιο λήξης (UAG). Το νέο πεπτίδιο είναι: ΝΗ 2 -met-pro-pro-cooh. Έχει 2 λιγότερα αμινοξέα σε σχέση με το φυσιολογικό. 2. Δίνεται η παρακάτω αλληλουχία βάσεων στο mrna που κωδικοποιεί ένα ολιγοπεπτίδιο: 5 AUGGGCAUGUGGCGACCAGAAUGA3 Με τη βοήθεια του γενετικού κώδικα να προσδιοριστεί ο τύπος της μετάλλαξης σε κάθε μία από τις παρακάτω περιπτώσεις: α. 5 AUGGGCAUGUGGAGACCAGAAUGA3 β. 5 AUGGGCAUGUGACGACCAGAAUGA3 γ. 5 AUGGGCUGGCGACCAGAAUGA3 δ. 5 AUGAGCAUGUGGCGACCAGAAUGA3 ε. 5 AUGGGCAUGUGGGAGCGACCAGAAUGA3 στ. 5 AUGGGCAUGUGAGCGACCAGAAUGA3 ζ. 5 AUGGGAUGUGGCGACCAGAAUGA3 α. Η C του 5 ου κωδικονίου αντικαθίσταται με Α, οπότε το κωδικόνιο CGΑ (arg) γίνεται ΑGΑ (arg)-σιωπηλή μετάλλαξη. β. Η 2 η G του 4 ου κωδικονίου αντικαθίσταται με Α. Το 4 ο κωδικόνιο (UGG) γίνεται κωδικόνιο λήξης (UGΑ). Το ολιγοπεπτίδιο έχει 4 λιγότερα αμινοξέα. γ. Έλλειψη του 3 ου κωδικονίου (ΑUG). Το ολιγοπεπτίδιο έχει 1 λιγότερο αμινοξύ. δ. Η 1 η G του 2 ου κωδικονίου αντικαθίσταται με Α. Το κωδικόνιο GGC (gly) γίνεται ΑGC (ser). Το ολιγοπεπτίδιο αλλάζει κατά 1 αμινοξύ. ε. Προσθήκη του κωδικονίου GΑG (glu) μεταξύ του 4 ου και 5 ου κωδικονίου του φυσιολογικού mrna. Το ολιγοπεπτίδιο έχει 1 περισσότερο αμινοξύ από το φυσιολογικό. στ. Προσθήκη Α μεταξύ των 2 G του 4 ου κωδικονίου. Το 4 ο κωδικόνιο (UGG) γίνεται κωδικόνιο λήξης (UGΑ). Το ολιγοπεπτίδιο έχει 4 λιγότερα αμινοξέα. ζ. Έλλειψη της C του 2 ου κωδικονίου. Δεν υπάρχει πλέον κωδικόνιο λήξης. Η πρωτεϊνοσύνθεση θα συνεχιστεί μέχρι το επόμενο κωδικόνιο λήξης ή μέχρι το τέλος της 3 αμετάφραστης περιοχής. 3. Δίνονται 2 άτομα από δύο συγγενικά είδη. Το ένα άτομο έχει 2 ζεύγη ομόλογων χρωμοσωμάτων (ΑΑΒΒ) και το άλλο άτομο έχει 3 ζεύγη ομόλογων χρωμοσωμάτων

2 (ΜΜΝΝΟΟ). Να δείξετε τους γονότυπους των ατόμων όταν αυτά εμφανίζουν μονοσωμία ή τρισωμία. 1 ο άτομο Μονοσωμία: ΑΑΒ ή ΑΒΒ Τρισωμία: ΑΑΑΒ ή ΑΒΒΒ 2 ο άτομο Μονοσωμία: ΜΝΝΟΟ ή ΜΜΝΟΟ ή ΜΜΝΝΟ Τρισωμία: ΜΜΜΝΝΟΟ ή ΜΜΝΝΝΟΟ ή ΜΜΝΝΟΟΟ 4. Το παρακάτω διάγραμμα αντιπροσωπεύει 2 μη ομόλογα χρωμοσώματα. (το σύμβολο αντιστοιχεί στο κεντρομερίδιο) Κ Λ Μ Ν Ξ Ο Π α. Ποιοι τύποι χρωμοσωμικών μεταλλάξεων απαιτούνται για να προκύψουν τα ακόλουθα χρωμοσώματα; i. Α Β Γ Δ Ε Ζ Η ii. Α Β Γ Δ Ξ Ο Π Κ Λ Μ Ν Ε Ζ Η β. Ποια είδη γαμετών μπορούν να δώσουν άτομα με τις παραπάνω μεταλλάξεις (θεωρείστε ότι ο διαχωρισμός των χρωμοσωμάτων για το σχηματισμό του γαμέτη γίνεται φυσιολογικά); γ. Εάν άτομα με τις παραπάνω μεταλλάξεις παντρευτούν με φυσιολογικά άτομα, πόσα ζυγωτά αναμένεται να έχουν κανονική ποσότητα γενετικού υλικού και πόσα είναι πιθανό να παρουσιάσουν πρόβλημα (θεωρείστε ότι γίνεται φυσιολογικά ο διαχωρισμός των χρωμοσωμάτων για το σχηματισμό των γαμετών που θα δώσουν το ζυγωτό); α. i. Μετατόπιση. ii. Αμοιβαία μετατόπιση. β. Για το άτομο με την μετατόπιση: Το ζεύγος των χρωμοσωμάτων θα είναι: Α Β Γ Δ Ε Ζ Η 4 είναι οι πιθανοί γαμέτες: 1 ο γαμέτης: Ζ Η 2 ο γαμέτης: 3 ο γαμέτης: Α Β Γ Δ Ε Ζ Η 4 ο γαμέτης: Α Β Γ Δ Ε Από τους γαμέτες αυτούς ο 2 ος είναι φυσιολογικός, ο 3 ος έχει κανονική ποσότητα γενετικού υλικού αλλά εμφανίζει διαφορετική δομή από την φυσιολογική ενώ ο 4 ος γαμέτης εμφανίζει έλλειψη. Κατά συνέπεια οι 2 από τους 4 γαμέτες μπορούν, όταν διασταυρωθούν με φυσιολογικούς, να δώσουν ζυγωτά με κανονική ποσότητα

3 γενετικού υλικού (ποσοστό 50%), ενώ ο 1 από τους 4 γαμέτες επειδή εμφανίζει έλλειψη είναι πιθανόν, όταν διασταυρωθεί με φυσιολογικό γαμέτη να δημιουργήσει ζυγωτό με πρόβλημα (ποσοστό 25%). Για το άτομο με την αμοιβαία μετατόπιση: Το ζεύγος των χρωμοσωμάτων θα είναι: Α Β Γ Δ Ξ Ο Π Κ Λ Μ Ν Ε Ζ Η 4 είναι οι πιθανοί γαμέτες: 1 ο γαμέτης: Κ Λ Μ Ν Ε Ζ Η 2 ο γαμέτης: 3 ο γαμέτης: Α Β Γ Δ Ξ Ο Π Κ Λ Μ Ν Ε Ζ Η 4 ο γαμέτης: Α Β Γ Δ Ξ Ο Π Από τους γαμέτες αυτούς ο 2 ος είναι φυσιολογικός, ο 3 ος έχει κανονική ποσότητα γενετικού υλικού αλλά εμφανίζει διαφορετική δομή από την φυσιολογική ενώ ο 1 ος και ο 4 ος γαμέτης εμφανίζουν έλλειψη. Κατά συνέπεια οι 2 από τους 4 γαμέτες μπορούν, όταν διασταυρωθούν με φυσιολογικούς, να δώσουν ζυγωτά με κανονική ποσότητα γενετικού υλικού (ποσοστό 50%), ενώ οι 2 από τους 4 γαμέτες επειδή εμφανίζουν έλλειψη είναι πιθανόν, όταν διασταυρωθούν με φυσιολογικό γαμέτη να δημιουργήσουν ζυγωτό με πρόβλημα (ποσοστό 50%). 5. Δίνεται η παρακάτω αλληλουχία αμινοξέων που είναι τμήμα μιας πολυνουκλεοτιδικής αλυσίδας: met-leu-ile-ala-tyr-gly-cys. Ποιος είναι ο τύπος μετάλλαξης που οδηγεί στην αλληλουχία αμινοξέων: met-leu-ileala, της τροποποιημένης πολυνουκλεοτιδικής αλυσίδας; Το κωδικόνιο (UΑU ή UΑC) που κωδικοποιεί το 5 ο αμινοξύ (tyr) μετατρέπεται σε κωδικόνιο λήξης. Αυτό μπορεί να συμβεί με τους εξής τρόπους: Αντικατάσταση βάσης. α. Στο κωδικόνιο UΑU αντικατάσταση της 2 ης U (Τ στην κωδική) από την G. β. Στο κωδικόνιο UΑU αντικατάσταση της 2 ης U (Τ στην κωδική) από την Α. γ. Στο κωδικόνιο UΑC αντικατάσταση της C (C στην κωδική) από την G. δ. Στο κωδικόνιο UΑC αντικατάσταση της C (C στην κωδική) από την Α. Προσθήκη βάσης. α. Στο κωδικόνιο UΑU προσθήκη G(G στην κωδική) μεταξύ Α(Α στην κωδική) και U(Τ β. Στο κωδικόνιο UΑU προσθήκη G(G στην κωδική) μεταξύ U(Τ στην κωδική) και Α(Α γ. Στο κωδικόνιο UΑU προσθήκη Α(Α στην κωδική) μεταξύ Α(Α στην κωδική) και U(Τ δ. Στο κωδικόνιο UΑU προσθήκη Α(Α στην κωδική) μεταξύ U(Τ στην κωδική) και Α(Α ε. Στο κωδικόνιο UΑC προσθήκη G(G στην κωδική) μεταξύ Α(Α στην κωδική) και C(C στ. Στο κωδικόνιο UΑC προσθήκη G(G στην κωδική) μεταξύ U(Τ στην κωδική) και Α(Α

4 ζ. Στο κωδικόνιο UΑC προσθήκη Α(Α στην κωδική) μεταξύ Α(Α στην κωδική) και C(C η. Στο κωδικόνιο UΑC προσθήκη Α(Α στην κωδική) μεταξύ U(Τ στην κωδική) και Α(Α Έλλειψη βάσης. α. Στο κωδικόνιο UΑU έλλειψη της 2 ης U(Τ Επειδή τα κωδικόνια που κωδικοποιούν την gly, που είναι το επόμενο αμινοξύ, αρχίζουν με την βάση G δημιουργείται κωδικόνιο λήξης (UΑG). β. Στο κωδικόνιο UΑC έλλειψη της C(C Επειδή τα κωδικόνια που κωδικοποιούν την gly που είναι το επόμενο αμινοξύ αρχίζουν με την βάση G δημιουργείται κωδικόνιο λήξης (UΑG). 6. Ο Γιάννης και η Μαρία έχουν 2 παιδιά με σύνδρομο Down. Ο αδελφός του Γιάννη έχει σύνδρομο Down ενώ η αδελφή του έχει 2 παιδιά με σύνδρομο Down. Ποια από τα παρακάτω είναι σωστά: α. Ο Γιάννης έχει 47 χρωμοσώματα. β. Η Μαρία έχει 47 χρωμοσώματα. γ. Τα παιδιά τους έχουν το καθένα από 47 χρωμοσώματα. δ. Η αδελφή του Γιάννη έχει 45 χρωμοσώματα. ε. Ο Γιάννης έχει 46 χρωμοσώματα. στ. Η Μαρία έχει 45 χρωμοσώματα. ζ. Ο αδελφός του Γιάννη έχει 45 χρωμοσώματα. Είναι δυνατό οι γονείς του Γιάννη να έχουν σύνδρομο Down; Εξηγήστε. Σωστές είναι η γ και ε. Ο γονότυπος του ατόμου με σύνδρομο Down θα είναι 45ΧΧ ή 45ΧΥ P: 45ΧΧ Χ 45ΧΥ Γαμέτες: 22Χ, 23Χ 22Χ, 23Υ, 23Χ, 22Υ F 1 : 44ΧΧ, 45ΧΥ, 44ΧΥ, 45ΧΧ, 45ΧΧ, 46ΧΥ, 45ΧΥ, 46ΧΧ 1 στα 4 θηλυκά και 1 στα 4 αρσενικά είναι δυνατόν να είναι φυσιολογικά από γονείς που και οι 2 έχουν το σύνδρομο Down. 7. Το παρακάτω γενεαλογικό δένδρο δείχνει την κληρονόμηση της αιμορροφιλίας σε μια οικογένεια. Να γράψετε τους γονότυπους των ατόμων και να αιτιολογήσετε την άποψή σας. Η αιμορροφιλία οφείλεται σε υπολειπόμενο φυλοσύνδετο γονίδιο. Έστω Χ Α =φυσιολογικό, Χ α =αιμορροφιλία, όπου Χ Α >Χ α Οι γονότυποι των ατόμων είναι οι εξής: Ι1: Χ Α Χ α, Ι2: Χ α Υ ΙΙ1: Χ Α Υ, ΙΙ2: Χ α Χ α, ΙΙ3: Χ Α Υ ΙΙΙ1: Χ α Υ, ΙΙΙ2: Χ Α Υ, ΙΙΙ3: Χ Α Χ α, ΙΙΙ4: Χ Α Χ α Το άτομο ΙΙΙ2 κανονικά δεν μπορεί να είναι Χ Α Υ αφού η μητέρα του είναι Χ α Χ α. Κάτι τέτοιο θα μπορούσε να εξηγηθεί μόνο με την εμφάνιση χρωμοσωμικής μετάλλαξης. Πιθανή διασταύρωση γαμετών: ΙΙ2: Ο Χ ΙΙ3: Χ Α Υ ΙΙ2: Χ α Χ ΙΙ3: Χ Α Υ Γαμέτης Χ Α Υ: Ο γαμέτης Χ Α Υ στο αρσενικό άτομο προκύπτει από το μη διαχωρισμό των ομόλογων Χ και Υ χρωμοσωμάτων κατά την πρώτη μειωτική διαίρεση.

5 Γαμέτης Ο: Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων Γαμέτης Χ α : φυσιολογική μειωτική διαίρεση 8. Άνδρας, του οποίου ο γονότυπος είναι άγνωστος, αλλά οι γονείς του είναι φορείς της β-θαλασσαιμίας, παντρεύεται γυναίκα φορέα δρεπανοκυτταρικής αναιμίας. α. Ποια η πιθανότητα το 1 ο τους παιδί να είναι φορέας της β-θαλασσαιμίας; β. Ποια η πιθανότητα τα 2 πρώτα παιδιά να είναι κορίτσια με φυσιολογική β-αλυσίδα της αιμοσφαιρίνης; γ. Ποια η πιθανότητα το 1 ο τους παιδί να είναι αγόρι με μικροδρεπανοκυτταρική αναιμία (γονότυπος ββ s ); Έστω Β: φυσιολογική β-αλυσίδα, β: παθολογικό γονίδιο για τη β-θαλασσαιμία, β s :τροποποιημένη β-αλυσίδα δρεπανοκυτταρικής αναιμίας όπου Β>β και Β> β s Οι γονείς του άνδρα έχουν γονότυπο Ββ και οι πιθανοί γονότυποι του άνδρα είναι ΒΒ (πιθανότητα 1/4), Ββ (πιθανότητα 1/2) και ββ (πιθανότητα 1/4). 1 η διασταύρωση: P: Ββ s Χ ΒΒ P 1 =0 (παιδί φορέας β-θαλασσαιμίας) P 2 =1/4 1/2 1/2 = 1/16 (κορίτσι με φυσιολογική β-αλυσίδα) P 3 =0 (αγόρι με μικροδρεπανοκυτταρική αναιμία) 2 η διασταύρωση: P: Ββ s Χ Ββ P 1 =1/2 1/4=1/8 (παιδί φορέας β-θαλασσαιμίας) P 2 =1/2 1/4 1/2 = 1/16 (κορίτσι με φυσιολογική β-αλυσίδα) P 3 =1/2 1/4 1/2=1/16 (αγόρι με μικροδρεπανοκυτταρική αναιμία) 3 η διασταύρωση: P: Ββ s Χ ββ P 1 =1/4 1/2=1/8 (παιδί φορέας β-θαλασσαιμίας) P 2 =0 (κορίτσι με φυσιολογική β-αλυσίδα) P 3 =1/4 1/2 1/2=1/16 (αγόρι με μικροδρεπανοκυτταρική αναιμία) α. Pολ 1 = P 1 + P 1 + P 1 =1/4 β. Pολ 2 = P 2 + P 2 + P 3 =1/8 (για ένα κορίτσι) Για 2 κορίτσια η πιθανότητα είναι 1/8 1/8=1/64 γ. Pολ 3 = P 3 + P 3 + P 3 =1/8 9. Η ασθένεια Wilson s, η οποία προκαλεί συσσώρευση χαλκού στους ιστούς, οφείλεται σε υπολειπόμενο αυτοσωμικό γονίδιο του χρωμοσώματος 13. Φυσιολογικός άνδρας παντρεύεται γυναίκα που δεν πάσχει από την ασθένεια Wilson s εμφανίζει όμως τρισωμία 13. Η μητέρα του άνδρα και ο πατέρας της γυναίκας έπασχαν από τη συγκεκριμένη ασθένεια. Να βρείτε την αριθμητική αναλογία των γαμετών καθώς επίσης και τους γονότυπους και φαινότυπους των απογόνων. Έστω Α=φυσιολογικό, α=ασθένεια όπου Α>α Ο γονότυπος του άνδρα είναι Αα ενώ, ο γονότυπος της γυναίκας είναι ΑΑα ή Ααα 1 η περίπτωση: P: Αα Χ ΑΑα Γαμέτες: Α, α Α, Α, α, ΑΑ, Αα, Αα F 1 : 1/2 1/2 2/6 1/6 1/6 2/6 2/6 Α 1/6 α 1/6 ΑΑ 2/6 Αα 1/2 Α 2/12 ΑΑ 1/12 Αα 1/12 ΑΑΑ 2/12 ΑΑα 1/2 α 2/12 Αα 1/12 αα 1/12 ΑΑα 2/12 Ααα Γ.Α. 2/12 ΑΑ, 3/12 Αα, 1/12 αα, 1/12 ΑΑΑ, 3/12 ΑΑα, 2/12 Ααα

6 Φ.Α. 6/12 άτομα με τρισωμία 13 και φυσιολογικά 5/12 άτομα χωρίς τρισωμία 13 και φυσιολογικά 1/12 άτομα χωρίς τρισωμία 13 αλλά με την ασθένεια 2 η περίπτωση: P: Αα Χ Ααα Γαμέτες: Α, α α, α, Α, αα, Αα, Αα 1/2 1/2 2/6 1/6 1/6 2/6 F 1 : 2/6 α 1/6 Α 1/6 αα 2/6 Αα 1/2 Α 2/12 Αα 1/12 ΑΑ 1/12 Ααα 2/12 ΑΑα 1/2 α 2/12 αα 1/12 Αα 1/12 ααα 2/12 Ααα Γ.Α. 1/12 ΑΑ, 3/12 Αα, 2/12 αα, 2/12 ΑΑα, 3/12 Ααα, 1/12 ααα Φ.Α. 5/12 άτομα με τρισωμία 13 και φυσιολογικά 1/12 άτομα με τρισωμία 13 και με την ασθένεια 4/12 άτομα χωρίς τρισωμία 13 και φυσιολογικά 2/12 άτομα χωρίς τρισωμία 13 με την ασθένεια 10. Δίνονται οι παρακάτω διπλοειδής οργανισμοί (σε παρένθεση ο αριθμός των χρωμοσωμάτων τους): γάτα (38), σκύλος (78), δελφίνι (44), άλογο (64), άνθρωπος. Ποιες είναι οι θεωρητικά αναμενόμενες μονοσωμίες ή τρισωμίες που μπορούν να εμφανιστούν σε αυτούς τους οργανισμούς; Οι θεωρητικά αναμενόμενες μονοσωμίες ή τρισωμίες θα είναι σε κάθε οργανισμό ίσες με τον αριθμό των ζευγών των χρωμοσωμάτων τους. Άρα: Γάτα=19, Σκύλος=39, Δελφίνι=22, Άλογο=32, άνθρωπος=23 ΟΜΑΔΑ Β 11. Το αρχικό τμήμα του mrna του γονιδίου της β-αλυσίδας της αιμοσφαιρίνης είναι το εξής: 5 GUGCACCUGACUCCUGAGGAGAAGUCCGCC.3 α. Είναι δυνατή η κλωνοποίηση του συγκεκριμένου τμήματος του γονιδίου σε πλασμίδιο που κόπηκε με την περιοριστική ενδονουκλεάση Mstll; (Η περιοριστική ενδονουκλεάση Mstll αναγνωρίζει και κόβει την αλληλουχία 5 CTGAGG 3 ) β. Είναι δυνατή η κλωνοποίηση του αντίστοιχου τμήματος του γονιδίου που δίνει τη δρεπανοκυτταρική αναιμία σε πλασμίδιο που κόπηκε με τη συγκεκριμένη περιοριστική ενδονουκλεάση; α. Όχι. Η περιοριστική ενδονουκλεάση κόβει μέσα στο πλασμίδιο β. Ναι. Η αντικατάσταση της Α από την Τ στο 6 ο κωδικόνιο του γονιδίου (GΑG) έχει σαν αποτέλεσμα η περιοριστική ενδονουκλεάση Mstll να κόβει έξω από αυτό το τμήμα. 12. Δίνεται η παρακάτω αλληλουχία αμινοξέων που είναι τμήμα μιας πολυνουκλεοτιδικής αλυσίδας: met-val-ile-trp-cys-val-ile. α. Ποιος είναι ο τύπος μετάλλαξης που οδηγεί στην αλληλουχία αμινοξέων: met-val-ilecys-val, της τροποποιημένης πολυνουκλεοτιδικής αλυσίδας; β. Ποια τα πιθανά κωδικόνια που κωδικοποιούν τα αμινοξέα cys και val στη φυσιολογική και στην τροποποιημένη πολυνουκλεοτιδική αλυσίδα και ποια τα πιθανά κωδικόνια λήξης της τροποποιημένης πολυνουκλεοτιδικής αλυσίδας;

7 α. Επειδή μετά το 3 ο αμινοξύ αλλάζει η αλληλουχία των αμινοξέων το πιθανότερο είναι να έχει γίνει προσθήκη ή έλλειψη αζωτούχας βάσης στο 4 ο αμινοξύ, με συνέπεια την εμφάνιση νέου κωδικονίου λήξης που οδήγησε σε πρόωρη λήξη της πρωτεϊνοσύνθεσης. met- val- ile- trp- cys- val- ile ΑUG GUU ΑUU UGG UGU GUU ΑUU GUC ΑUC UGC GUC ΑUC GUΑ ΑUΑ GUΑ ΑUΑ GUG GUG Η έλλειψη της 2 ης ή 3 ης G της trp μπορεί να οδηγήσει στον σχηματισμό cys, στην συνέχεια σε val και τέλος να σχηματιστεί κωδικόνιο λήξης. (Απορρίπτονται οι άλλες περιπτώσεις προσθήκης ή έλλειψης βάσης στο 4 ο ή σε προηγούμενα κωδικόνια) β. cys. φυσιολογική και τροποποιημένη αλυσίδα: UGU val. φυσιολογική αλυσίδα: GUΑ, GUG τροποποιημένη αλυσίδα: GUG Κωδικόνια λήξης: UGΑ, UΑΑ 13. Άνδρας με δαλτωνισμό και ομάδα αίματος Ο παντρεύεται γυναίκα δαλτωνική και ομάδα αίματος ΑΒ. Να δείξετε τον τρόπο που μπορεί να γεννηθεί άτομο με σύνδρομο Turner, δαλτωνικό και με ομάδα αίματος ΑΒ και άτομο με σύνδρομο Klinefelter, δαλτωνικό και ομάδα αίματος ΑΒ. Γονότυπος ατόμου με σύνδρομο Turner, δαλτωνικό και με ομάδα αίματος ΑΒ: Χ δ ΟI Α I Β Ο ή Χ δ ΟI Α I Β i Για τον δαλτωνισμό: Γαμέτες: Ο X Χ δ Γαμέτες: Χ δ X Ο Γαμέτης Ο: Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων χρωμοσωμάτων Χ και Υ κατά την 1 η μειωτική διαίρεση, είτε από τον μη διαχωρισμό των αδελφών χρωματίδων είτε του Χ είτε του Υ κατά την 2 η μειωτική διαίρεση. Γαμέτης Ο: Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων Γαμέτης Χ δ : φυσιολογική μειωτική διαίρεση. Γαμέτης Χ δ : φυσιολογική μειωτική διαίρεση Για την ομάδα αίματος: Γαμέτες: Ο X I Α I Β Γαμέτες: i X I Α I Β Γαμέτης Ο: Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων χρωμοσωμάτων, στα οποία βρίσκεται το γονίδιο i, κατά την 1 η μειωτική διαίρεση, είτε από τον μη διαχωρισμό των αδελφών χρωματίδων του χρωμοσώματος, στο οποίο βρίσκεται το γονίδιο i κατά την 2 η μειωτική διαίρεση. Γαμέτης I Α I Β : Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων χρωμοσωμάτων, στα οποία βρίσκονται τα γονίδια I Α και I Β, κατά την 1 η μειωτική διαίρεση. Γαμέτης i: φυσιολογική μειωτική διαίρεση Άρα συνολικά οι γαμέτες που θα πρέπει να διασταυρωθούν θα είναι: Γαμέτες: ΟΟ X Χ δ I Α I Β Γαμέτες: Χ δ Ο X ΟI Α I Β Γαμέτες: Οi X Χ δ I Α I Β Γαμέτες: Χ δ i X ΟI Α I Β Γονότυπος ατόμου με σύνδρομο Klinefelter, δαλτωνικό και ομάδα αίματος ΑΒ: Χ δ Χ δ ΥI Α I Β Ο ή Χ δ Χ δ ΥI Α I Β i Για τον δαλτωνισμό: Γαμέτες: Χ δ Υ X Χ δ Γαμέτες: Υ X Χ δ Χ δ

8 Γαμέτης Χ δ Υ: Ο γαμέτης Χ δ Υ στο αρσενικό άτομο προκύπτει από το μη διαχωρισμό των ομόλογων Χ και Υ χρωμοσωμάτων κατά την πρώτη μειωτική διαίρεση. Γαμέτης Χ δ Χ δ : Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων Γαμέτης Υ: φυσιολογική μειωτική διαίρεση Γαμέτης Χ δ : φυσιολογική μειωτική διαίρεση Για την ομάδα αίματος: Γαμέτες: Ο X I Α I Β Γαμέτες: i X I Α I Β Γαμέτης Ο: Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων χρωμοσωμάτων, στα οποία βρίσκεται το γονίδιο i, κατά την 1 η μειωτική διαίρεση, είτε από τον μη διαχωρισμό των αδελφών χρωματίδων του χρωμοσώματος, στο οποίο βρίσκεται το γονίδιο i κατά την 2 η μειωτική διαίρεση. Γαμέτης I Α I Β : Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων χρωμοσωμάτων, στα οποία βρίσκονται τα γονίδια I Α και I Β, κατά την 1 η μειωτική διαίρεση. Γαμέτης i: φυσιολογική μειωτική διαίρεση Άρα συνολικά οι γαμέτες που θα πρέπει να διασταυρωθούν θα είναι: Γαμέτες: Χ δ ΥΟ X Χ δ I Α I Β Γαμέτες: Χ δ Υi X Χ δ I Α I Β Γαμέτες: ΥΟ X Χ δ Χ δ I Α I Β Γαμέτες: Υi X Χ δ Χ δ I Α I Β 14. Όταν θηλυκά άτομα Drosophila με πολύ κοντά φτερά διασταυρωθούν με αρσενικά άτομα με κανονικό φτερά τότε όλα τα θηλυκά που γεννιούνται έχουν κανονικά φτερά και όλα τα αρσενικά έχουν πολύ κοντά φτερά. Να δείξετε τον τρόπο με τον οποίον είναι δυνατόν να προκύψουν και θηλυκά άτομα με πολύ κοντά φτερά καθώς επίσης και αρσενικά με κανονικά φτερά. (Στη Drosophila άτομα με 1 Χ είναι αρσενικά και άτομα με 2 Χ και πάνω είναι θηλυκά) Οι διαφορετικές αναλογίες μεταξύ αρσενικών και θηλυκών ατόμων δείχνουν την ύπαρξη φυλοσύνδετου γονιδίου. Επειδή από αρσενικά με κανονικά φτερά όλα τα θηλυκά έχουν κανονικά φτερά αυτό σημαίνει ότι το κανονικό επικρατή έναντι του πολύ κοντού. Έστω Χ Κ =κανονικά φτερά, Χ κ =πολύ κοντά φτερά, όπου Χ Κ > Χ κ Φυσιολογικά η διασταύρωση θα είναι η εξής: P: Χ κ Χ κ Χ Χ Κ Υ F 1 : Χ Κ Χ κ, Χ κ Υ με κανονικά φτερά με πολύ κοντά φτερά Άτομα με ανεστραμμένους φαινότυπους (θηλυκά με πολύ κοντά φτερά και αρσενικά με κανονικά φτερά) μπορούν να προκύψουν ως εξής: Γονιδιακές μεταλλάξεις. Με γονιδιακή μετάλλαξη είναι δυνατόν σε κάποια θηλυκά άτομα της P γενιάς το Χ κ να γίνει Χ Κ και σε κάποια αρσενικά άτομα το Χ Κ να γίνει Χ κ. Οπότε κάποια άτομα από τους γονείς που θα διασταυρωθούν θα είναι: P: Χ Κ Χ κ Χ Χ κ Υ F 1 : Χ Κ Χ κ, Χ κ Χ κ, Χ Κ Υ, Χ κ Υ, με κανονικά φτερά με πολύ κοντά φτερά με κανονικά φτερά με πολύ κοντά φτερά Χρωμοσωμικές μεταλλάξεις. Για να προκύψουν θηλυκά με πολύ κοντά φτερά (πιθανοί γονότυποι: Χ κ Χ κ Ο ή Χ κ Χ κ Υ) οι πιθανές διασταυρώσεις γαμετών είναι: Γαμέτες: Ο X Χ κ Χ κ Γαμέτες: Υ X Χ κ Χ κ Γαμέτης Ο: Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων χρωμοσωμάτων Χ και Υ κατά την 1 η μειωτική διαίρεση, είτε από τον μη διαχωρισμό των αδελφών χρωματίδων είτε του Χ είτε του Υ κατά την 2 η μειωτική διαίρεση. Γαμέτης Χ κ Χ κ : Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων

9 Γαμέτης Υ: φυσιολογική μειωτική διαίρεση. Για να προκύψουν αρσενικά με κανονικά φτερά (πιθανοί γονότυποι: Χ Κ ΥΟ ή Χ Κ Ο) οι πιθανές διασταυρώσεις γαμετών είναι: Γαμέτες: Χ Κ Υ X Ο Γαμέτες: Χ Κ X Ο Γαμέτης Χ Κ Υ: Ο γαμέτης Χ Κ Υ στο αρσενικό άτομο προκύπτει από το μη διαχωρισμό των ομόλογων Χ και Υ χρωμοσωμάτων κατά την πρώτη μειωτική διαίρεση. Γαμέτης Ο: Μπορεί να προκύψει από τον μη διαχωρισμό των ομόλογων Γαμέτης Χ Κ : φυσιολογική μειωτική διαίρεση. 15. Στην κατάσταση «α-θαλασσαιμία 1» ή αλλιώς στίγμα της α-θαλασσαιμίας, 2 από τα 4 γονίδια της α-σφαιρίνης έχουν απενεργοποιηθεί. Άνδρας φορέας της β- θαλασσαιμίας παντρεύεται γυναίκα η οποία είναι επίσης φορέας της β-θαλασσαιμίας. Στα 2 άτομα έχουν απενεργοποιηθεί τα γονίδια της α-σφαιρίνης του ενός χρωμοσώματος. α. Ποια η πιθανότητα να παιδί που θα γεννηθεί να πεθάνει αμέσως; β. Ποια η πιθανότητα το παιδί που θα γεννηθεί να είναι αγόρι, φορέας της β- θαλασσαιμίας και με το στίγμα της α-θαλασσαιμίας; Η σύνθεση της α-αλυσίδας ελέγχεται από 4 γονίδια, δηλαδή υπάρχουν 2 γονίδια α σε κάθε ομόλογο χρωμόσωμα. Εάν συμβολίσουμε με (-) το απενεργοποιημένο γονίδιο, τότε ο γονότυπος των ατόμων για το στίγμα της α-θαλασσαιμίας θα είναι αα/- - ( τα 2 ενεργοποιημένα α είναι στο ένα χρωμόσωμα και τα 2 απενεργοποιημένα είναι στο άλλο χρωμόσωμα. Θα ισχύει: P: Ββαα/- - Χ Ββαα/- - Γαμέτες: Βαα, Β- -, βαα, β- - Βαα, Β- -, βαα, β- - Βαα Β- - βαα β- - Βαα ΒΒαααα ΒΒαα- - Ββαααα Ββαα- - Β- - ΒΒαα- - ΒΒ νεκρό Ββαα- - Ββ νεκρό βαα Ββαααα Ββαα- - ββαααα ββαα- - β- - Ββαα- - Ββ νεκρό ββαα- - ββ νεκρό α. P=1/4 β. P=1/2 1/4=1/8


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) Σχόλια Τα θέματα καλύπτουν το μεγαλύτερο μέρος της ύλης που εξεταζόταν. Απαιτούσαν πολύ καλή κατανόηση της θεωρίας και αρκετό χρόνο για την επίλυση των ασκήσεων. Στο ερώτημα Γ1 υπήρχε ασάφεια στο ζητούμενο

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Ημερομηνία: Σάββατο 22 Απριλίου 2017 Διάρκεια Εξέτασης: 3 ώρες

Ημερομηνία: Σάββατο 22 Απριλίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Σάββατο 22 Απριλίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1 Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΘΕΜΑ 1ο 1. Στην αυτοσωμική επικρατή κληρονομικότητα α. κάθε ασθενής γονέας γεννά έναν τουλάχιστον ασθενή απόγονο

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΘΗΜ / ΤΞΗ: ΙΟΛΟΓΙ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝ) ΗΜΕΡΟΜΗΝΙ: 22/01/2017 ΕΠΙΜΕΛΕΙ ΔΙΓΩΝΙΣΜΤΟΣ: ΝΟΤ ΛΖΡΚΗ ΘΕΜ Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. πό τη διασταύρωση ελέγχου

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις ΚΒφόίΙοιο 6 ΜειαΠΠά^εις 1. Ενας γενετιστής βρήκε ότι μια μετάλλαξη σε ένα γονίδιο δεν είχε επίδραση στην πολυπεπτιδική αλυσίδα που κωδικοποιείται από αυτό. Σε τι μπορεί να οφείλεται η συγκεκριμένη μετάλλαξη;

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα


ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα


3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ÏÑÏÓÇÌÏ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα


BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. Η Επιτροπή Παιδείας της ΠΕΒ

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 5 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/2015 29 12 2016 ΘΕΜΑ 1 ο Επιλέξτε τη σωστή απάντηση που συμπληρώνει τις παρακάτω προτάσεις: 1. Η περιοριστική

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό Απαντήσεις στο μάθημα της Βιολογίας Κατεύθυνσης ΘΕΜΑ 1 Ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 Ο 1.σχολικό βιβλίο σελ. 109 «Με τον όρο ζύμωση και αντιβιοτικά» 2.σχολικό βιβλίο σελ. 119-120 «Τα αντισώματα μπορούν

Διαβάστε περισσότερα

Κριτήριο αξιολόγησης-βιολογία Κατεύθυνσης

Κριτήριο αξιολόγησης-βιολογία Κατεύθυνσης ΘΕΜΑ Α. Στις παρακάτω προτάσεις από Α1 έως και Α5 να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Όταν ένας σύνθετος φάγος που έχει το πρωτεϊνικό κάλυμμα του φάγου Τ 2 και το DNA του φάγου

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 6 ΚΕΦΑΛΑΙΟ ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 6 ΚΕΦΑΛΑΙΟ 1 Να εξηγήσετε τη γέννηση ενός κοριτσιού με αιμορροφιλία από φυσιολογικούς γονείς 2 Δίνεται το γενεαλογικό δένδρο μιας οικογένειας στην οποία εμφανίζεται μια ασθένεια που

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία συµπληρώνει σωστά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Να επιλέξετε τη σωστή απάντηση: 1. Σιωπηλή μετάλλαξη λόγω αντικατάστασης βάσης δε μπορεί να επιτευχθεί στο κωδικόνιο που κωδικοποιεί: α. τη βαλίνη γ. τη μεθειονίνη

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα