ΣΗΜΕΙΩΣΕΙΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΣΗΜΕΙΩΣΕΙΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ"

Transcript

1 Τ.Ε.Ι. ΛΑΡΙΣΑΣ ΣΧΟΛΗ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΗΜΕΙΩΣΕΙΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ρ. Ηλίας Αναστασόπουλος ΛΑΡΙΣΑ 2004

2 Περιεχόµενα Κεφάλαιο 1ο ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ- ΤΟ DNA....3 Κεφάλαιο 2 ο Τo RNA....8 Κεφάλαιο 3 ο Οι ΠΡΩΤΕΪΝΕΣ Κεφάλαιο 4 ο ΚΛΩΝΟΠΟΙΗΣΗ Κεφάλαιο 5 ο ΠΟΛΛΑΠΛΑΣΙΑΣΜΟΣ ΤΟΥ DNA. 24 Κεφάλαιο 6 ο ΜΟΡΙΑΚΗ ΧΑΡΤΟΓΡΑΦΗΣΗ ΓΟΝΙ ΙΩΜΑΤΩΝ Κεφάλαιο 7 ο ΜΟΡΙΑΚΟΙ ΕΙΚΤΕΣ 32 Κεφάλαιο 8 ο ΗΜΙΟΥΡΓΙΑ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΩΝ ΦΥΤΩΝ...39 Κεφάλαιο 9 ο ΙΑΓΟΝΙ ΙΑΚΑ ΦΥΤΑ ΑΝΘΕΚΤΙΚΑ ΣΤΟ ΠΑΓΕΤΟ.45 Κεφάλαιο 10 ο ΙΑΓΟΝΙ ΙΑΚΑ ΦΥΤΑ ΑΝΘΕΚΤΙΚΑ ΣΕ ΕΝΤΟΜΑ...48 Κεφάλαιο 11 ο ΙΑΓΟΝΙ ΙΑΚΑ ΦΥΤΑ ΑΝΘΕΚΤΙΚΑ ΣΕ ΖΙΖΑΝΙΟΚΤΟΝΑ.53 Κεφάλαιο 12 ο ΙΑΓΟΝΙ ΙΑΚΑ ΦΥΤΑ ΑΝΘΕΚΤΙΚΑ ΣΕ ΙΟΥΣ...57 ΒΙΒΛΙΟΓΡΑΦΙΑ..60 2

3 ΚΕΦΑΛΑΙΟ 1ο ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ- ΤΟ DNA Τα νουκλεϊνικά οξέα είναι µακροµόρια που µετέχουν στην µεταφορά γενετικών πληροφοριών από γενιά σε γενιά και στην έκφραση αυτής της πληροφορίας µέσο της σύνθεσης πρωτεϊνών. Υπάρχουν δύο κατηγορίες νουκλεϊνικών οξέων, τα ριβοζονουκλεϊνικά (RNA) και τα δεσοξυριβοζονουκλειϊνικά οξέα (DNA). Το γενετικό υλικό των περισσοτέρων οργανισµών αποτελείται από DNA, εξαίρεση αποτελούν µόνο ορισµένοι ιοί (ρετροϊοί) που αντί για DNA έχουν RNA σαν το γενετικό τους υλικό. Το DNA βρίσκεται στον πυρήνα και στα µιτοχόνδρια ευκαρυωτικών κυττάρων, ενώ ειδικά στα φυτικά κύτταρα DNA υπάρχει και στους χλωροπλάστες. Τα προκαρυωτικά κύτταρα δεν διαθέτουν κανένα από τα παραπάνω οργανίδια. Το DNA σε αυτούς τους οργανισµούς βρίσκεται, µε τη µορφή νηµατίου, διασκορπισµένο στο κυτταρόπλασµα (περίπτωση βακτηρίων), ή ενσωµατωµένο στο καψίδιο (περίπτωση ιών). Πυρήνας Μιτοχόνδρια Χλωροπλάστες Εικόνα 1.1 Σε ένα φυτικό κύτταρο DNA υπάρχει στο πυρήνα, στα µιτοχόνδρια και στους χλωροπλάστες του. 3

4 Όλοι οι οργανισµοί δεν έχουν την ίδια ποσότητα DNA. Η συνολική ποσότητα DNA που περιέχεται στην απλοειδή οµάδα χρωµοσωµάτων ενός οργανισµού ορίζεται σαν C-value και είναι χαρακτηριστική για κάθε οργανισµό. Η δοµή του DNA λύθηκε το 1953 από τους James Watson και Francis Krieg, ενώ όπως αποδείχθηκε αρκετά χρόνια αργότερα πολύτιµη ήταν και η συµβολή της Rosalin Franklin σε αυτή την ανακάλυψη. Πρόκειται για µόριο που αποτελείται από δύο αλυσίδες (δίκλωνο µόριο) που ενώνονται µεταξύ τους σχηµατίζοντας την µορφή µίας σκάλας (ή έλικας) της οποίας κάθε σκαλί συγκροτείται από βάσεις που ενώνονται µεταξύ τους κατά παρόµοιο τρόπο µε τον οποίο κλείνει ένα φερµουάρ. Τo DNA είναι πολυµερές µόριο, του οποίου οι δοµικές µονάδες είναι τα νουκλεοτίδια. Κάθε νουκλεοτίδιο αποτελείται από ένα σάκχαρο (δεσοξυριβόζη), µία φωσφορική οµάδα και µια οργανική αζωτούχο βάση, η οποία µπορεί να είναι είτε πουρίνη (διπλός δακτύλιος), είτε πυριµιδίνη (απλός δακτύλιος). Το DNA περιέχει τις εξής πουρίνες αδενίνη (A), γουνίνη (G) και τις πυριµιδίνες κυτοσίνη (C) και θυµίνη (T). Οι δύο αλυσίδες είναι µεταξύ τους συµπληρωµατικές, δηλαδή απέναντι από κάθε αδενίνη που υπάρχει στη µία αλυσίδα υπάρχει µία θυµίνη στην άλλη αλυσίδα και απέναντι από κάθε γουανίνη που υπάρχει στην µία αλυσίδα υπάρχει µία κυτοσίνη στην άλλη αλυσίδα. Κάθε µόριο DNA έχει µία αρχή και ένα τέλος. Στην αρχή του, που καλείται 5 άκρο, υπάρχει µία φωσφορική οµάδα που είναι συνδεδεµένη στη 5 θέση του πρώτου σακχάρου. Στο τέλος του, που καλείται 3 άκρο, υπάρχει µια υδροξυλοµάδα που είναι συνδεδεµένη στη 3 θέση του τελευταίου σακχάρου. Η φωσφορική οµάδα και η οµάδα υδροξυλίου που βρίσκονται στα άκρα του DNA, του προσδίδουν χαρακτήρα διπόλου. ύο είναι οι χαρακτηριστικοί δεσµοί που απαντώνται σε ένα µόριο DNA. Οι δεσµοί υδρογόνου µεταξύ των βάσεων και οι φωσφοδιεστερικοί δεσµοί που ενώνουν φωσφρορικές οµάδες µε σάκχαρα. 4

5 Εικόνα 1.2. Α. Οι δύο αλυσίδες του DNA συγκροτούνται µεταξύ τους µέσο των δεσµών υδρογόνου που ενώνουν τις βάσεις κάθε αλυσίδας, µε τις αντίστοιχες της άλλης. Β. Τα νουκλεοτίδια ενώνονται µεταξύ τους µέσο φωσφοδιεστερικών δεσµών, προκειµένου να συγκροτήσουν κάθε αλυσίδα. Σε υψηλές θερµοκρασίες το DNA έχει την ικανότητα να απόδιατάσσεται, να ξετυλίγεται δηλαδή και να χωρίζουν οι δύο αλυσίδες του. Το ίδιο µόριο σε χαµηλές θερµοκρασίες υπόκεινται στην αντίστροφή διαδικασία, δηλαδή επαναδιατάσσεται, οι δύο αλυσίδες ενώνονται µεταξύ τους όπως πριν την αποδιάταξη. Επίσης διάφορα ένζυµα µπορούν να δράσουν πάνω στο DNA, άλλοτε καταστρέφοντας κάποιους δεσµού του, όπως π.χ. οι ενδονουκλεάσες και άλλοτε συµβάλλοντας στη δηµιουργία άλλων όπως π.χ. οι λιγάσες. (Τα ένζυµα αυτά, λόγο της ιδιαίτερης σηµασίας τους, αναλύονται διεξοδικότερα στο κεφάλαιο της κλωνοποίησης). 5

6 Το DNA δεν είναι σε όλους τους οργανισµούς ευθύγραµµο. Για παράδειγµα στα ευκαρυωτικά κύτταρα και κατά την µετάφαση βρίσκεται περιελικωµένο γύρω από συγκεκριµένες πρωτεΐνες τις ιστόνες προκειµένου να συγκροτηθούν τα χρωµοσώµατα. Αντίθετα σε ένα βακτηριακό κύτταρο µπορεί να υπάρχει σαν κυκλικό µόριο. Στο εργαστήριο, όπου µπορούµε να αποµονώσουµε DNA µόρια, η µορφή του εξαρτάται και από το διάλυµα στο οποίο βρίσκεται. Α.. Β. Ε. Γ. Ζ. Εικόνα 1.3. Το σχήµα αναφέρεται στο πώς είναι συγκροτηµένα τα χρωµοσώµατα, κατά την µετάφαση, από DNA (κόκκινη γραµµή) και πρωτεϊνες (ιστόνες) (µπλέ γραµµή). Σήµερα µπορεί να γνωρίζουµε µία-µία της βάσης από τις οποίες αποτελείται ένα DNA µόριο, εφαρµόζοντας µία διαδικασία που καλείται αλληλούχιση. Πολλοί οργανισµοί έχουν πλήρως αλληλουχηθεί µέχρι σήµερα. Τα δεδοµένα από αυτές τις αλληλουχίσεις καταχωρούνται σε ειδικές βάσεις δεδοµένων DNA, τα οποία επεξεργάζονται επιστήµονες από διαφορετικά επιστηµονικά πεδία της βιολογίας. Η µέχρι τώρα ανάλυση αυτών των δεδοµένων έχει δείξει ότι σε ορισµένους οργανισµούς το DNA είναι γεµάτο γονίδια, τα οποία µάλιστα µπορεί και να επικαλύπτουν το ένα το άλλο, ενώ στο DNA 6

7 άλλων οργανισµών, γονίδια εντοπίζονται σε αραιή διάταξη µεταξύ τους. Είναι επίσης συχνό το φαινόµενο σε κάποιους οργανισµούς, τα ίδια γονίδια να επαναλαµβάνονται για περισσότερες από µία φορές. Ανεξαρτήτως του τρόπου µε τον οποίο εµφανίζονται τα γονίδια στο DNA ενός οργανισµού, ο τρόπος µε τον οποίο µετριέται το µέγεθος νουκλεϊνικών οξέων, άρα και των γονιδίων, είναι σε ζεύγη βάσεων (bp-base pairs), ενώ άλλα µεγέθη τις ίδιας µονάδας µέτρησης είναι η Kb (kilobase) η Mb (megabase). Το DNA παράγεται µέσο µίας διαδικασίας που ονοµάζεται αντιγραφή. Σε αυτήν µετέχουν ένζυµα που καλούνται πολυµεράσες και συγκεκριµένα DNA πολυµεράσες προκειµένου να τις διακρίνουµε, από τις αντίστοιχες που µετέχουν στο πολλαπλασιασµό RNA µορίων και οι οποίες καλούνται RNA πολυµεράσες. Κάθε DNA πολυµεράση χρειάζεται ένα µικρό DNA µόριο, σαν εκκινητή, προκειµένου να αρχίσει την αντιγραφή. Επίσης χρειάζεται νουκλεοτίδια (dntps) που χρησιµεύουν σαν δοµική λίθοι για τη συγκρότηση της δίκλωνης αλυσίδας. Η DNA πολυµεράση αντιγράφει πάντοτε ξεκινώντας από το 5 ακρο του µορίου για να καταλήξει στο 3. Όλες οι πολυµεράσες δεν έχουν την ίδια πιστότητα. Ορισµένες από αυτές αναπαράγουν τα DNA µόρια κάνοντας, σχετικά, πολλά λάθη (error prone) και άλλες είναι γνωστές για το ιδιαίτερα χαµηλό ποσοστό λαθών που κάνουν κατά την αντιγραφή των ίδιων µορίων. Σηµειώνεται ότι εκτός των πολυµερασών που παράγουν DNA µόρια, υπάρχουν και οι DNases, ένζυµα που καταστρέφουν DNA. Γι αυτό όταν θέλουµε να αποµονώσουµε DNA από κύτταρα λαµβάνουµε µέτρα καταστολής της δράσης τους. 7

8 Κεφάλαιο 2 ο To RNA Το RNA όπως και το DNA είναι πολυµέρες µόριο. Αποτελείται από το σάκχαρο, D-ριβόζη, µία φωσφορική ρίζα και µία αζωτούχο βάση. Οι αζωτούχες βάσεις διαφέρουν από αυτές του DNA γιατί αντί της θυµίνης έχουµε ουρακίλη, ενώ η αδενίνη, η κυτοσίνη και η γουανίνη υπάρχουν και στο RNA µόριο. Το RNA είναι προϊόν µεταγραφής, ενώ το DNA παράγεται µε τη διαδικασία της αντιγραφής. Κυριότερη διαφορά µεταξύ του DNA και του RNA είναι ότι συνήθως, το πρώτο είναι δίκλωνο, ενώ το δεύτερο µονόκλωνο µόριο. οµικές µονάδες του RNA είναι τα ριβοζονουκλοετίδια (rntps), ενώ στη περίπτωση του DNA έχουµε τα δεσοξυριβοζονουκλεοτίδια (dntps). Οι διαφορές τους, εκτός από την αζωτούχο βάση, έγκειται στο σάκχαρο (ριβόζη αντί δέσοξυριόζης) και σε ένα παραπάνω υδροξύλιο που έχουν στο µόριο του σακχάρου. r N T P Εικόνα 2.1. Η δοµή ενός ριβοζονουκλεοτιδίου. 8

9 Στη διαδικασία της µεταγραφής εκτός των rntps που µετέχουν σαν δοµικοί λύθοι, µετέχει και DNA που χρησιµεύει σαν µήτρα (καλούπι) και µία RNA πολυµεράση. Υπάρχουν τρις τύποι RNA πολυµερασών. Κάθε µία από αυτές παράγει και διαφορετικό τύπο RNA µορίου. Οι τρις τύποι RNA µορίων είναι, το αγγελιοφόρο (messenger RNA) mrna, το ριβοσωµικό (ribosomal RNA) rrna και το µεταφορικό (transfer RNA) trna. Το mrna µεταγράφεται από RNA polymerase II και κωδικοποιεί πρωτεΐνη. Πριν τη δηµιουργία του mrna, παράγεται ένα ενδιάµεσο µόριο το hnrna (heterologus nuclear RNA) το οποίο όµως γρήγορα µετατρέπεται σε mrna. Το rrna παράγεται από τη RNA polymerase I, µέσα στο ριβόσωµα και ο ρόλος του στη πρωτεϊνοσύνθεση είναι τόσο δοµικός όσο και λειτουργικός. Το trna παράγεται από τη RNA polymerase III και χρησιµεύει στην µεταφορά αµινοξέων στο ριβόσωµα. Αντίθετα µε την αντιγραφή που δεν διαφέρει µεταξύ των προκαρυωτικών και των ευκαρυωτικών οργανισµών, η µεταγραφή διαφέρει ουσιωδώς µεταξύ προκαρυωτικών και ευκαρυωτικών οργανισµών, όπως ουσιώδεις διαφορές υπάρχουν και µεταξύ γονιδίων προκαρυωτικών και ευκαρυωτικών οργανισµών. Στα προκαρυωτικά κύτταρα η µεταγραφή γίνεται από ένα είδος RNA πολυµεράσης, ενώ στα ευκαρυωτικά από τρις διαφορετικές. Και στους δύο τύπους κυττάρων η RNA πολυµέραση συνδέεται σε ορισµένη περιοχή του DNA προκειµένου να αρχίσει η µεταγραφή. Η περιοχή αυτή καλείται υποκινητής και βρίσκεται στο 5 άκρο των γονιδίων. Σηµειώνεται ότι ενώ στην αντιγραφή µετέχει όλο το µόριο του DNA, στη µεταγραφή µετέχουν µόνο ορισµένες περιοχές, οι περιοχές που αποτελούν γονίδια ή άλλες που ελέγχουν την έκφραση των γονιδίων. Κάθε γονίδιο είναι υπεύθυνο για το σχηµατισµό συνήθως µίας πρωτεΐνης, χωρίζεται δε, σε δύο περιοχές. Στον υποκινητή που χρησιµεύει στην µεταγραφή του γονιδίου και στην κωδικοποιούσα περιοχή του γονιδίου η οποία φέρει όλες της πληροφορίες για το σχηµατισµό της πρωτεΐνης. Σε πολλά ευκαρυωτικά γονίδια συµβαίνει η κωδικοποιούσα περιοχή τους, (αυτή που είναι υπεύθυνη για την παραγωγή πρωτεΐνης) να περιέχει εξόνια 9

10 και ιντρόνια. Μόνο τα εξόνια φέρουν πληροφορίες για το σχηµατισµό της πρωτεΐνης. Τα ιντρόνια αφαιρούνται από το hnrna µε µία διαδικασία που καλείται ωρίµανση (splicing), η οποία είναι µέρος της µεταµεταγραφικής ρύθµισης. Μπορούµε να διακρίνουµε τρις τύπους γονιδίων. Τα δοµικά γονίδια, που κωδικοποιούν καθένα και από ένα πολυπεπτίδιο. Τα ρυθµιστικά γονίδια που ρυθµίζουν ή αλλάζουν την έκφραση άλλων γονίδιων και τα ψευδογονίδια, που είναι αλληλουχίες DNA παρόµοιες µε αυτές δοµικού γονιδίου, που όµως δεν µεταγράφονται. Κάθε υποκινητής χαρακτηρίζεται από ορισµένα στοιχεία στην αλληλουχία του. Στη περίπτωση προκαρυωτικών υποκινητών τα στοιχεία αυτά είναι το Pribnow ή αλλιώς TATA box που είναι µία αλληλουχία ίδια ή παρόµοια µε την TATAAT, η οποία βρίσκεται στη 10 θέση του γονιδίου και το 35S box που βρίσκεται στη -35 θέση και αποτελείται από την αλληλουχία TTGACA. Συµβατικά η έναρξη της µεταγραφής γίνεται στο +1 σηµείο κάθε γονιδίου. Πρόκειται για τη πρώτη αδενίνη που απαντάται στο γονίδιο. Η αρίθµηση της υπόλοιπης αλληλουχίας του DNA γίνεται χρησιµοποιώντας αυτό το σηµείο σαν σηµείο αναφοράς. (Π.χ. όλες οι βάσεις που βρίσκονται 5 αυτής της αδενίνης έχουν αρνητικό πρόσηµο -1, -2 κ.λ.π., ενώ όσες βρίσκονται 3 αυτής της βάσης έχουν θετικό πρόσηµο). Ο τερµατισµός της µεταγραφής γίνεται µέσω ειδικών σηµάτων που βρίσκονται στο 3 άκρο των γονιδίων. Όπως και στην αντιγραφή έτσι και στην µεταγραφή η RNA πολυµεράση µεταγράφει µε κατεύθυνση από το 5 στο 3 κάθε DNA αλυσίδας. εδο- µένου ότι,αναλόγως του οργανισµού, γονίδια µπορεί να υπάρχουν και στις δύο DNA αλυσίδες, η κατεύθυνση της µεταγραφής για κάθε γονίδιο µπορεί να είναι διαφορετική. 10

11 χρωµόσωµα Γονίδιο 1 Γονίδιο 2 Γονίδιο 3 Γονίδιο 4 Γονίδιο 5 Πρωτεΐνη Πρωτεΐνη Πρωτεΐνη Πρωτεΐνη Πρωτεΐνη Εικόνα 2.2. Το προϊόν έκφρασης ενός γονιδίου είναι µία πρωτεΐνη. Συχνά συµβαίνει η διαδικασία της µεταγραφής να ελέγχεται από DNA στοιχεία που καλούνται ενισχυτές (enhancers) αν προκαλούν την µεταγραφή ενός γονιδίου ή σιωπητές (silencers) αν προκαλούν την καταστολή της µεταγραφής ενός γονιδίου. Τα στοιχεία αυτά εµφανίζονται στα ιντρόνια και στις περιοχές µεταξύ των γονιδίων. Η διάρκεια ζωής των mrna µορίων διαφέρει. Το mrna προκαρυωτικών οργανισµών είναι πολύ ασταθές µε µέσο όρο ζωής 2-4 min,ενώ αυτό των ευκαρυωτικών οργανισµών έχει µεγαλύτερο χρόνο ζωής. Μία σειρά µεταµεταγραφικών ρυθµίσεων επιτρέπουν στο mrna ευκαρυωτικών οργανισµών να ετοιµαστεί για το µακρύ ταξίδι του από το πυρήνα του κυττάρου στο κυτταρόπλασµα. Οι ρυθµίσεις αυτές είναι η προσθήκη µία µεθυλικής γουανοσίνης στο 5 άκρο του (CAP -7 methylguanosine), η προσθήκη µίας ουράς από αδενίνες (polya tail) στο 3 άκρο του µεταγράφου και η ωρίµανση, η αποβολή αλληλουχιών (ιντρονίων) από εσωτερικά τµήµατα RNA. Όπως οι DNases είναι υπεύθυνες για την καταστροφή DNA µορίων, έτσι και οι ριβονουκλεάσες (RNases), είναι ένζυµα που καταλύουν το σπάσιµο RNA µορίων. Οι περισσότερες απαιτούν Ca 2+, Mg 2+ σαν συµπαράγοντες, ενώ η δράση τους µπορεί να σταµατήσει µε προσθήκη EDTA. 11

12 Τελευταία έχουν βρεθεί σε ορισµένους ιούς ένζυµα που κάνουν την αντίστροφή διαδικασία της µεταγραφής, δηλαδή παράγουν DNA από RNA. Τα ένζυµα αυτά καλούνται αντίστροφες µεταγραφάσες. Τέλος ο πολλαπλασιασµός RNA ιών γίνεται από τις RNA αντιγραφάσες (replicases), οι οποίες καταλύουν το πολλαπλασιασµό RNA γονιδιωµάτων ιών, περιπτώσεων δηλαδή όπου RNA µόρια χρησιµοποιούνται σαν εκµαγεία στον πολλαπλασιασµό. 12

13 Κεφάλαιο 3 ο ΟΙ ΠΡΩΤΕΪΝΕΣ Ο Gerardus Johannes Mulder ( ), ονόµασε πρωτεΐνες, τις οργανικές ουσίες που υπάρχουν παντού στα ζώα, και όπως φάνηκε αργότερα και στα φυτά, από τη λέξη πρωτείο, θέλοντας να τονίσει τη σηµασία τους. Σε ένα τυπικό κύτταρο E. coli υπάρχουν: 70% Νερό 15% Πρωτεΐνες 7% Νουκλεϊνικά Οξέα 3% Υδατάνθρακες 2% Λιπίδια 3% Άλλα Εικόνα 3.1. Η ποσοστιαία αναλογία των συστατικών ενός κυττάρου E.coli Οι δοµικές µονάδες των πρωτεϊνών είναι τα αµινοξέα. Τα αµινοξέα φέρουν στο ένα άκρο τους µίας αµινοµάδα και στο άλλο µια καρβοξυλοµάδα. Μερικές εκατοντάδες αµινοξέα είναι γνωστά, εκ των οποίων όµως µόνο 20 αποτελούν συστατικά των πρωτεϊνών. Όλα τα αµινοξέα είναι δίπολα. Κατατάσσονται σε κατηγορίες αναλόγως των ιδιοτήτων τους, όπως όξινα και βασικά, υδρόφοβα και πολικά (υδρόφιλα). Οι ιδιότητές των πρωτεϊνών καθορίζονται σε µεγάλο βαθµό από τις ιδιότητες των αµινοξέων τους. Αντίστροφη Μεταγραφή DNA RNA Πρωτεΐνη Μεταγραφή Μετάφραση Αντιγραφή Εικόνα 3.2. Σύνοψη των βασικών µοριακών λειτουργιών. Η πρωτεϊνοσύνθεση γίνεται µε µία διαδικασία που καλείται µετάφραση. Όπως τα νουκλεϊνικά οξέα αποτελούνται από µία αλληλουχία νουκλεοτιδίων, έτσι και οι πρωτεΐνες αποτελούνται από µία αλληλουχία αµινοξέων. ύο ή περισσότερα αµινοξέα 13

14 συνδεδεµένα µεταξύ τους µε πεπτιδικούς δεσµούς συγκροτούν ένα πεπτίδιο. Όταν υπάρχουν 3 ή περισσότερα αµινοξέα ενωµένα σε σειρά µεταξύ τους, τότε προκύπτει ένα ολιγοπεπτίδιο και όταν περισσότερα αµινοξέα σχηµατίζουν µία αλυσίδα τότε προκύπτει ένα πολυπεπτίδιο ή αλλιώς µία πρωτεΐνη. Το µέγεθος των πρωτεϊνών µετριέται σε µονάδες Dalton (d), ενώ συνηθέστερα χρησιµοποιείται το Kd. Εικόνα 3.3. Ένα «φορτισµένο µόριο» trna, είναι ένα trna που µεταφέρει ένα αµινοξύ. Η σύνθεση των πρωτεϊνών από αµινοξέα γίνεται στα ριβοσώµατα του κυτταροπλάσµατος. Το ριβόσωµα είναι σύµπλοκο αποτελούµενο από rrna και πρωτεΐνες, οργανωµένο σε µικρή και µεγάλη υποµονάδες. Οι πρωτεΐνες και τα RNA στις δύο υποµονάδες διαφέρουν. Το mrna αφήνοντας τον πυρήνα, µεταφέρεται στα ριβοσώµατα, όπου µε τη βοήθεια του rrna συνδέεται µε την µικρή υποµονάδα του ριβοσώµατος. Το trna φέρνει συγκεκριµένα αµινοξέα στο ριβόσωµα, όπου ένα αντικωδικόνιο του trna συνδέεται στο κωδικόνιο του mrna. Κάθε αµινοξύ σχηµατίζει δεσµό µε το διπλανό του αµινοξύ προκειµένου να σχηµατισθεί µία αναπτυσσόµενη πολυπεπτιδική αλυσίδα. Κατόπιν το trna χωρίς το αµινοξύ απελευθερώνεται από το 14

15 ριβόσωµα, ενώ άλλα trna µεταφέρουν αµινοξέα στο ριβόσωµα για να συµπληρώσουν το πρωτεϊνικό µόριο. Κάθε trna αναγνωρίζει το σωστό κωδικόνιο στο mrna µεταφέροντας το αντίστοιχο αµινοξύ. Κάθε κωδικόνιο είναι µία οµάδα τριών νουκλεοτιδιών που κωδικοποιεί ένα αµινοξύ. Το είδος του αµινοξέος που κωδικοποιεί κάθε κωδικόνιο, εξαρτάται εν µέρει µόνο από το είδος των νουκλεοτιδίων από τα οποία αποτελείται, και τη σειρά µε την οποία είναι ενωµένα. Αυτό συµβαίνει γιατί ενώ θεωρητικά τα 4 διαφορετικά νουκλεοτίδια συνδυαζόµενα ανά 3 θα έπρεπε να µας δώσουν 4 3 κωδικόνια, στη φύση βρέθηκε ότι υπάρχουν µόνο 61 συνδυασµοί νουκλεοτιδίων (κωδικόνια) που δίνουν αµινοξέα. Επίσης πολλά κωδικόνια κωδικοποιούν για το ίδιο αµινοξύ µε αποτέλεσµα τα αµινοξέα να είναι λιγότερα από όσα θεωρητικά αναµένονται. Συγκεκριµένα είναι µόνο 20 αυτά που µετέχουν στο σχηµατισµό των πρωτεϊνών, όπως φαίνεται και από το γενετικό κώδικα, που για τους παραπάνω λόγους λέγεται εκφυλισµένος. Εικόνα Απεικόνιση της µετάφρασης ενός mrna στο ριβόσωµα. Στα προκαρυωτικά κύτταρα απαντώνται τα πολυριβοσώµατα, που είναι οµάδες ριβοσωµάτων που «διαβάζουν» το ίδιο mrna παράγοντας ταυτόχρονα πολλές πρωτεΐνες (πολυπεπτίδια). 15

16 ΕΥΤΕΡΗ ΘΕΣΗ ΚΩ ΙΚΟΝΙΟΥ T C A G Π Ρ Ω Τ T TTT Phe [F] TTC Phe [F] TTA Leu [L] TTG Leu [L] TCT Ser [S] TCC Ser [S] TCA Ser [S] TCG Ser [S] TAT Tyr [Y] TAC Tyr [Y] TAA Ter [stop] TAG Ter [stop] TGT Cys [C] TGC Cys [C] TGA Ter [stop] TGG Trp [W] T C A G Τ Ρ Ι Τ Η Η Θ Ε Σ C CTT Leu [L] CTC Leu [L] CTA Leu [L] CTG Leu [L] CCT Pro [P] CCC Pro [P] CCA Pro [P] CCG Pro [P] CAT His [H] CAC His [H] CAA Gln [Q] CAG Gln [Q] CGT Arg [R] CGC Arg [R] CGA Arg [R] CGG Arg [R] T C A G Θ Ε Σ Η Η ATT Ile [I] ACT Thr [T] AAT Asn [N] AGT Ser [S] T Κ Κ Ω Ι Κ Ο Ν Ι Ο Υ A G ATC Ile [I] ATA Ile [I] ATG Met [M] GTT Val [V] GTC Val [V] GTA Val [V] GTG Val [V] ACC Thr [T] ACA Thr [T] ACG Thr [T] GCT Ala [A] GCC Ala [A] GCA Ala [A] GCG Ala [A] AAC Asn [N] AAA Lys [K] AAG Lys [K] GAT Asp [D] GAC Asp [D] GAA Glu [E] GAG Glu [E] AGC Ser [S] AGA Arg [R] AGG Arg [R] GGT Gly [G] GGC Gly [G] GGA Gly [G] GGG Gly [G] C A G T C A G Ω Ι Κ Ο Ν Ι Ο Υ Εικόνα 3.5. Ο γενετικός κώδικας είναι εκφυλισµένος, γιατί διαφορετικά κωδικόνια µπορεί να κωδικοποιούν το ίδιο αµινοξύ. Οι πρωτεΐνες είναι τα προϊόντα έκφρασης των γονιδίων. Όλα τα γονίδια δεν εκφράζονται την ίδια χρονική στιγµή. Υπάρχουν ορισµένα γονίδια που πρέπει να εκφράζονται συνέχεια, συστατικά γονίδια (housekeeping genes) και άλλα που εκφράζονται µόνο υπό ορισµένες συνθήκες. ύο γονίδια που εκφράζονται την ίδια χρονική στιγµή δεν δίνουν κατ ανάγκη την ίδια ποσότητα προϊόντος (πρωτεΐνης). Οι διαφορές αυτές στα προϊόντα 16

17 έκφρασης γονιδίων που παρουσιάζονται οποιαδήποτε χρονική στιγµή αποδίδονται µε τον όρο διαφορική έκφραση γονιδίων. Εικόνα 3.6. Η διαφορική έκφραση δύο ή περισσοτέρων γονιδίων, αφορά διαφορές τους που παρουσιάζονται τόσο στην µεταγραφή, όσο και στην µετάφραση αυτών των γονιδίων. Η βιολογική δράση (λειτουργία) των πρωτεϊνών εξαρτάται και από την τρισδιάστατη (3D) δοµή τους. Οι πρωτεΐνες έχουν τέσσερα επίπεδα οργάνωσης. Το πρωτοταγές επίπεδο είναι η αλληλουχία των αµινοξέων, το δευτεροταγές επίπεδο καθορίζεται από τους δεσµούς υδρογόνου που συχνά συµβάλουν στο δηµιουργία σχηµάτων, όπως οι άλφα έλικες (alpha helix), οι βήτα πτυχωτές επιφάνειες (beta pleated sheets) και οι τυχαίες περιελίξεις (random coils). Το τριτοταγές επίπεδο διαµορφώνεται µε την αναδίπλωση των αµινοξικών αλυσίδων και διατηρείται εξαιτίας της ανάπτυξης δεσµών στην πρωτεΐνη, όπως δυσουλφιδικοί δεσµοί και υδρόφοβες αλληλεπιδράσεις. Τεταρτοταγές επίπεδο έχουν µόνο µεγάλες ή και πολύπλοκες πρωτεΐνες οι οποίες αποτελούνται από 17

18 υποµονάδες κάθε µία από τις οποίες σχηµατίζεται και από µία διαφορετική πολυπεπτιδική αλυσίδα. Σε κάθε µία πρωτεΐνη, αυτές οι υποµονάδες µπορεί να είναι ίδιες ή να διαφέρουν µεταξύ τους, τόσο στο µέγεθος όσο και στην πολυπλοκότητά τους. Άλλα στοιχεία της δοµής µίας πρωτεΐνης αποτελούν και οι περιοχές αναδίπλωσης (protein folding domains). Πρόκειται για µέρη της πρωτεΐνης που αναδιπλώνονται ανεξάρτητα από άλλες περιοχές της πρωτεΐνης. Την δοµή κάθε πρωτεΐνης την καθορίζουν τόσο οµοιοπολικές αλληλεπιδράσεις, όπως πεπτιδικοί και δισουλφιδικοί δεσµοί, όσο και µη οµοιοπολικές αλληλεπιδράσεις, όπως δεσµοί υδρογόνου, υδρόφοβες και ηλεκτροστατικές αλληλεπιδράσεις, καθώς και δυνάµεις van der Waals. Εικόνα 3.7. Τα διαφορετικά επίπεδα οργάνωσης µία πρωτεΐνης. Στις πρωτεΐνες µπορεί να γίνουν οµοιοπολικές προσθήκες, όπως φωσφορυλίωση και γλυκοζυλίωση, αλλά να προστεθούν και διάφοροι συµπαράγοντες (cofactors), όπως ανόργανα µεταλλικά ιόντα ή συνένζυµα (coenzymes). Επίσης οι πρωτεΐνες υπόκεινται 18

19 σε διάφορες µεταµεταφραστικές αλλαγές, όπως πρωτεόλυση (proteolytic processing) και αναδιπλώσεις (folding). Τέλος οι πρωτεΐνες αποικοδοµούνται, είτε για λόγους ανακύκλωσης των αµινοξέων τους, είτε για ρύθµιση της δράσης άλλων πρωτεϊνών, είτε για την αποµάκρυνση µη κανονικών πρωτεϊνών. Σηµειώνεται ότι υπάρχουν και ένζυµα που υδρολύουν πρωτεΐνες, τα οποία καλούνται πρωτεϊνάσες. Με την υδρόλυση των πρωτεϊνών προκύπτουν µικρά πεπτίδια. Όλα τα ένζυµα είναι πρωτεΐνες, όµως δεν έχουν όλες οι πρωτεΐνες καταλυτικό ρόλο. Υπάρχουν πρωτεΐνες που έχουν ρυθµιστικό ρόλο (ορµόνες), άλλες που έχουν προστατευτικό ρόλο (αντισώµατα), άλλες δοµικό (οι πρωτεΐνες στους µις) και άλλες αποθηκευτικό ρόλο. Η δράση κάθε πρωτεΐνης ελέγχεται από το ph του διαλύµατος στο οποίο βρίσκεται, τη θερµοκρασία, τη συγκέντρωση υποστρώµατος, από ενζυµικούς παράγοντες, και από πρωτεΐνες ελέγχου. 19

20 Κεφάλαιο 4 ο ΚΛΩΝΟΠΟΙΗΣΗ Περίπου είκοσι χρόνια µετά την ανακάλυψη της δοµής του DNA, το 1953 από τους Watson και Crick, ο Berg και οι συνεργάτες του δηµιουργούν το 1972 το πρώτο ανασυνδυασµένο µόριο, σηµατοδοτώντας την έναρξη µίας εποχής που χαρακτηρίζεται από την αλµατώδη πρόοδο της βιολογίας, στηριζόµενοι σε τεχνικές όπως αυτή της κλωνοποίησης. Τα βασικά βήµατα της κλωνοποίησης είναι τα ακόλουθα. Το γονίδιο που πρόκειται να κλωνοποιηθεί (ένθετο) ενσωµατώνεται σε ένα, συνήθως, κυκλικό DNA µόριο που καλείται φορέας κλωνοποίησης προκειµένου να δηµιουργηθεί ένα ανασυνδυασµένο DNA µόριο. Ο φορέας χρησιµοποιείται για την µεταφορά και το πολλαπλασιασµό του γονιδίου στον οργανισµό κλωνοποίησης που συνήθως είναι ένα βακτήριο. Μέσα στο βακτηριακό κύτταρο παράγονται πολλά αντίγραφα του ανασυνδυασµένου µορίου. Ο αριθµός αυτών των αντιγράφων αυξάνεται καθώς διαιρείται το κύτταρο σε άλλα κύτταρα, καθένα από τα οποία φέρει και κάποια ανασυνδυασµένα µόρια. Μετά από πολλές κυτταρικές διαιρέσεις και επώαση σε κατάλληλες συνθήκες, δηµιουργούνται αποικίες βακτηρίων, κάθε µία από τις οποίες αποτελείται από ένα µεγάλο αριθµό κυττάρων, µέσα στα οποία υπάρχουν αντίγραφα του ανασυνδυασµένου µορίου. Η διαδικασία της κλωνοποίησης αρχίζει µε την αποµόνωση του DNA (του γονιδίου που πρόκειται να κλωνοποιήσουµε). Ακολουθεί η πέψη (το κόψιµο) του φορέα που πρόκειται να δεχθεί το ένθετο. Κατόπιν ενώνονται τα δύο µόρια, προκειµένου να δηµιουργηθεί το ανασυνδυασµένο µόριο, το οποίο εισάγουµε σε ένα οργανισµό κλωνοποίησης (µετασχηµατισµός). Τέλος οι διάφορες βακτηριακές αποικίες που προκύπτουν ελέγχονται για να εντοπιστεί αυτή που περιέχει το ανασυνδυασµένο µόριο. Συνηθέστεροι φορείς κλωνοποίησης είναι τα πλασµίδια, τα οποία είναι µικρά κυκλικά µόρια DNA που περιλαµβάνουν µία περιοχή πολλαπλασιασµού τους (ori), ένα τουλάχιστον γονίδιο ανθεκτικότητας σε αντιβιοτικό, π.χ. Amp r και µία πολλαπλή περιοχή κλωνοποίησης MCS (Multiple Cloning Site). Τα πλασµίδια πολλαπλασιάζονται σε πολλά αντίγραφα, αυτόνοµα, ανεξάρτητα δηλαδή από το βακτηριακό χρωµόσωµα. Το 20

21 µέγεθος του ενθέτου που µπορεί να δεχθούν είναι µικρότερο από 30 Kb. Εκτός από τα πλασµίδια υπάρχουν και τα BACs (Bacterial Artificial Chromosomes), που χρησιµοποιούνται για την κλωνοποίηση τµηµάτων DNA µεγέθους (100 έως 300kb), τα YACs (Yeast Artificial Chromosomes) που είναι DNA ζύµης στα οποία ενσωµατώνονται (κλωνοποιούνται) µεγάλα τµήµατα γονιδιώµατος (έως 1000 Kb), το DNA βακτηριοφάγων (ιών που προσβάλουν βακτήρια) στο οποίο µπορεί να κλωνοποιηθούν ένθετα µεγέθους 23 Kb και τα κοσµίδια, υβριδικά µόρια φάγων και βακτηριακών πλασµιδίων, στα οποία µπορεί να κλωνοποιηθούν ένθετα µεγέθους µέχρι και 40 Kb. Εικόνα 4.1. Τα βασικά βήµατα της κλωνοποίησης. Τα ένζυµα που σχετίζονται µε τη διαδικασία της κλωνοποίησης χωρίζονται στις εξής κατηγορίες. Νουκλεάσες (nucleases), ένζυµα τα οποία αποικοδοµούν (κόβουν) νουκλεϊνικά οξέα, οι λιγάσες (ligases) οι οποίες συνδέουν νουκλεϊνικά µόρια µεταξύ τους, οι πολυµεράσες (polymerases) οι οποίες δηµιουργούν αντίγραφα µορίων, τα τροποποιητικά ένζυµα (modifying enzymes) τα οποία προσθέτουν ή αφαιρούν χηµικές οµάδες και οι 21

22 τοποϊσοµεράσες (topoisomerases) οι οποίες εισάγουν ή αποµακρύνουν υπερελικώσεις από κυκλικά DNA µόρια. Οι νουκλεάσες καταστρέφουν τους φωσφοδιεστερικούς δεσµούς που ενώνουν τα νουκλεοτίδια µεταξύ τους. Υπάρχουν δύο ειδών νουκλεάσες. Οι εξωνουκλεάσες, οι οποίες αφαιρούν ένα νουκλεοτίδιο κάθε φορά, αρχίζοντας από το τέλος του DNA µορίου και οι ενδονουκλεάσες, οι οποίες µπορούν και καταστρέφουν εσωτερικούς φωσφοδεστερικούς δεσµούς στο µόριο του DNA. Στην κατηγορία των ενδονουκλεασών ανήκουν και τα περιοριστικά ένζυµα, η σηµαντικότερη κατηγορία ενζύµων κλωνοποίησης. Τα περιοριστικά ένζυµα αναγνωρίζουν και κόβουν συγκεκριµένες περιοχές του DNA (περιοριστικές θέσεις). Κάθε περιοριστικό ένζυµο, όχι µόνο αναγνωρίζει ορισµένη θέση περιορισµού, αλλά την κόβει και µε ορισµένο τρόπο. Οι περισσότερες περιοριστικές θέσεις είναι παλίνδροµα αποτελούµενες από 4-, 6-, ή 8- ζεύγη βάσεων. Όσο λιγότερες είναι οι βάσεις από τις οποίες αποτελείται µία περιοριστική θέση τόσο συνηθέστερα, η θέση αυτή απαντάται στο γονιδίωµα. Τα ονόµατα των περιοριστικών ενζύµων ξεκινούν µε τρία γράµµατα που δηλώνουν τον οργανισµό από τον οποίο αποµονώνονται, π.χ. EcoRI είναι το ένζυµο που αποµονώνεται από βακτηριακά στελέχη E. coli RY13. Η βιολογική σηµασία της ύπαρξης των περιοριστικών ένζύµων σχετίζεται µε την άµυνα των βακτηρίων έναντι των ιών. Συγκεκριµένα, τα βακτήρια χρησιµοποιούν τα περιοριστικά ένζυµα για να κόβουν το DNA των ιών σε περίπτωση που µολυνθούν από αυτούς. Τα ίδια βακτήρια προστατεύουν το δικό τους DNA από τα περιοριστικά ένζυµα µεθυλιώνοντάς το. Εκτός από τα περιοριστικά ένζυµα κατά την κλωνοποίηση χρησιµοποιούνται, λιγάσες, φωσφατάσες και κινάσες. Οι λιγάσες όπως προαναφέρθηκε ενώνουν δύο DNA µόρια µεταξύ τους, ενώ ο φυσικός τους ρόλος είναι να «επισκευάζουν» οποιαδήποτε ανοίγµατα υπάρχουν σε ένα δίκλωνο DNA µόριο, προσθέτοντας φωσφοδιεστερικούς δεσµούς. Οι φωσφατάσες αποµακρύνουν φωσφορικές οµάδες από το 5 άκρο DNA µορίων, ενώ οι κινάσες κάνουν ακριβώς την αντίθετη δουλειά. 22

23 Εικόνα 4.2. Η µεθυλίωση του βακτηριακού DNA εµποδίζει τα περιοριστικά ένζυµα να κόψουν το βακτηριακό DNA, ενώ µπορούν να κόψουν το DNA του φάγου που δεν είναι µεθυλιωµένο, εξουδετερώνοντάς τον. Κατά την κλωνοποίηση χρειάζεται να βρεθεί και ένας οργανισµός στον οποίο θα εκφρασθεί η ανασυνδυασµένη πρωτεϊνη. Σαν τέτοιος µπορεί να χρησιµοποιηθεί, οποιοσδήποτε από τους παρακάτω φορείς, καθένας από τους οποίους έχει και συγκεκριµένα χαρακτηριστικά έκφρασης, όπως π.χ. ο Saccharomyces cerevisiae που δεν γλυκοζυλιώνει και δεν εκκρίνει πρωτεΐνες στο µέσο καλλιέργειας, ο Pichia pastoris που γλυκοζυλιώνει, ο Aspergillus nidulans που επίσης γλυκοζυλιώνει και εκκρίνει πρωτεΐνες στο µέσο καλλιέργειας, καθώς και το Trichoderma reesei που επίσης γλυκοζυλιώνει και εκκρίνει πρωτεΐνες στο µέσο καλλιέργειας. 23

24 Κεφάλαιο 5 ο ΠΟΛΛΑΠΛΑΣΙΑΣΜΟΣ ΤΟΥ DNA Η δεκαετία του 80 χαρακτηρίστηκε από µία ραγδαία εξάπλωση της γενετικής µηχανικής σε πολλά εργαστήρια, µε αποτέλεσµα οι επιστήµονες να χρειάζονται όλο και µεγαλύτερες ποσότητες DNA για τα πειράµατά τους. Ορισµένοι επιστήµονες σκέφτηκαν ότι θα έπρεπε να βρεθεί ένας τρόπος πολλαπλασιασµού του DNA, που θα ήταν χρήσιµος στις περιπτώσεις µικροοργανισµών των οποίων η απόδοση σε DNA είναι πολύ χαµηλή. Το 1983 ο Kary Mullis ανακοίνωσε τη πλέον ολοκληρωµένη πρόταση για το πολλαπλασιασµό του DNA, η οποία δηµοσιεύθηκε το 1985 και η οποία όπως φάνηκε τα επόµενα χρόνια, ήταν τόσο επαναστατική, ώστε το 1993 του απονεµήθηκε το βραβείο Nobel Χηµείας. Η µέθοδος που πρότεινε απαιτεί τη χρήση ενός κυκλοποιητή, µίας συσκευής που θερµαίνεται και ψύχεται µε ακρίβεια και πολύ γρήγορα. Η συσκευή αυτή χρησιµοποιείται για την εφαρµογή µίας αντίδρασης που ονοµάζεται αλυσιδωτή αντίδραση πολυµεράσης, ή PCR (Polymerase Chain Reaction). Συγκεκριµένα στην αντίδραση αυτή µετέχει µία πολυµεράση η οποία όχι µόνο πολλαπλασιάζει µόρια DNA, αλλά και δεν καταστρέφεται σε υψηλές θερµοκρασίες. Αυτή η DNA πολυµεράση ονοµάζεται Taq από το Thermus aquaticus, ένα βακτήριο θερµών πηγών, από το οποίο αποµονώθηκε. Εκτός από τη πολυµεράση στην ίδια αντίδραση µετέχουν dntps, κατάλληλο για τη δράση της πολυµεράσης ρυθµιστικό διάλυµα και εκκινητές απαραίτητοι στην αρχή κάθε αντίδρασης πολυµερισµού. Η αντίδραση γίνεται σε µικρό όγκο, µε τη προσθήκη νερού. Τα αρχικά προβλήµατα που εντοπίσθηκαν στην αλυσιδωτή αντίδραση πολυµεράσης σχετίζονταν µε το γεγονός ότι η Taq DNA πολυµεράση έκανε συχνά λάθη κατά το πολλαπλασιασµό του DNA. ιάφορες άλλες πολυµεράσες που αποµονώθηκαν τα τελευταία χρόνια είναι πολύ περισσότερο αποτελεσµατικές από τη Taq, η οποία όµως εξακολουθεί και χρησιµοποιείται σε πολλές εφαρµογές. 24

25 Εικόνα 5.1. Οι κυκλοποιητές έχουν χαρακτηριστεί και ως «µοριακές φωτοτυπικές µηχανές» εξαιτίας της δυνατότητάς τους να αναπαραγάγουν πολλά αντίγραφα του ίδιου DNA µορίου. Τα βήµατα µίας αλυσιδωτής αντίδρασης πολυµερισµού δεν έχουν αλλάξει, παρόλο που υπάρχουν πλέον πολλές παραλλαγές τους, οι οποίες εφαρµόζονται κατά περίπτωση. Σε κάθε περίπτωση πρόκειται για ένα σύνολο κύκλων οι οποίοι συνήθως κυµαίνονται από Κάθε κύκλος χωρίζεται σε τρις φάσεις. Πρώτη είναι η φάση της αποδιάταξης της δίκλωνης αλυσίδας σε δύο µονόκλωνες. Αυτό γίνεται σε θερµοκρασία o C. Στην επόµενη φάση έχουµε τη συγκόλληση των εκκινητών σε συγκεκριµένες (οµόλογες) θέσεις στο DNA, αναλόγως της αλληλουχίας τους. Στη τελευταία φάση η πολυµεράση βρίσκει τα σηµεία στα οποία είναι προσδεδεµένοι οι εκκινητές και αρχίζει από αυτά τη σύνθεση µίας δίκλωνης αλυσίδας από κάθε µονόκλωνη αλυσίδα. Στο τέλος κάθε κύκλου προκύπτουν από κάθε αλυσίδα δύο άλλες, ώστε στο τέλος όλης της αντίδρασης να προκύπτουν, συνολικά, 2 n αλυσίδες, όπου n είναι ο αριθµός των κύκλων κάθε αντίδρασης. Η αύξηση των κύκλων πάνω από έναν αριθµό συνήθως 40 κύκλων δεν συνεπάγεται και αύξηση των προϊόντων της αντίδρασης γιατί είτε κάποια από τα αντιδραστήρια τελειώνουν, είτε τα προϊόντα επανενώνονται µεταξύ τους, είτε το ένζυµο καταστρέφεται, είτε ανεπιθύµητα προϊόντα συσσωρεύονται. 25

26 ΣΥΓΚΟΛΛΗΣΗ 37 C - 65 C ΚΥΚΛΟΙ ΑΠΟ ΙΑΤΑΞΗ 93 C - 95 C ΣΥΝΘΕΣΗ 72 C Εικόνα 5.3. Τα βήµατα µίας αλυσιδωτής αντίδρασης πολυµεράσης. Η αντίδραση PCR βρίσκει εφαρµογή σε πολλούς τοµείς, κυριότεροι των οποίων είναι ο τοµέας της υγείας, της φυτοπαθολογίας, της βελτίωσης φυτών και της εγκληµατολογίας. Στο τοµές της υγείας η PCR χρησιµοποιείται για τη διάγνωση µολυσµατικών ασθενειών όπως είναι η otitis media-middle µία ασθένεια µόλυνσης του αυτιού, το AIDS, αλλά και άλλες σεξουαλικά µεταδιδόµενες ασθένειες, όπως swab-herpes, papillomarvirus, chlamydia, οι οποίες µάλιστα µπορούν και οι τρις να ανιχνευθούν σε µία αντίδραση. Επίσης η αντίδραση PCR µπορεί να χρησιµοποιηθεί για να διαπιστωθεί αν η µητέρα και το έµβρυο έχουν συµβατές οµάδες αίµατος. Η ίδια αντίδραση χρησιµοποιείται για την ανίχνευση κληρονοµικής προδιάθεσης για συγκεκριµένες ασθένειες, όπως τη διάγνωση µεταλλάξεων στο DNA που είναι χαρακτηριστικές για κάποιες µορφές καρκίνου. 26

27 Εικόνα 5.4. Ένας τυπικός κύκλος αντίδρασης PCR. Μία από τις πρώτες εφαρµογές της αντίδρασης PCR ήταν στη εγκληµατολογία, όπου από ελάχιστες ποσότητες DNA που βρίσκονται στο αίµα, σε τρίχες, στο σάλιο, και σε άλλα σωµατικά υγρά, µπορεί να πολλαπλασιασθούν µεγαλύτερες ποσότητες DNA του δράστη ενός εγκλήµατος, το οποίο χρησιµοποιείται εν είδη µοριακού αποτυπώµατος. Σε πολλά µέρη του κόσµου, ανάµεσά τους και η Ελλάδα, αναλόγως των αποτελεσµάτων της αντίδρασης PCR, υπάρχουν άτοµα που καταδικάσθηκαν για συγκεκριµένα εγκλήµατα και άλλα που αθωώθηκαν. ιάφορες αστυνοµικές αρχές στον κόσµο, ανταλλάσσουν και συγκρίνουν δείγµατα DNA σε εθνικό και διεθνές επίπεδο, συνδέουν εγκλήµατα µεταξύ τους και συσχετίζουν δείγµατα από κατά συρροή εγκληµατίες µε δείγµατα που συλλέχθηκαν από τόπους εγκληµάτων, ώστε οι εξυγνιάσεις εγκληµάτων να γίνονται γρηγορότερα και µε περισσότερη ακρίβεια. 27

28 Κεφάλαιο 6 ο ΜΟΡΙΑΚΗ ΧΑΡΤΟΓΡΑΦΗΣΗ ΓΟΝΙ ΙΩΜΑΤΩΝ To 1979 σε δύο εργαστήρια που δούλευαν ανεξάρτητα, αυτά των Maxam και Gilbert και του Sanger αναπτύχθηκαν µέθοδοι για την αλληλούχιση DNA. Το 1980 οι Botstein, Davis, Skolnick και White προτείνουν την χαρτογράφηση του ανθρώπου, ενώ το 1982 ο Wada πρότεινε την αυτόµατη αλληλούχιση οργανισµών, για την οποία, η πρώτη µηχανή ήταν έτοιµη το 1986 κατασκευασµένη από τους Hood και Smith. Σκοπός της γενοµικής είναι να περιγράψει την λειτουργία κάθε γονιδίου, τα δεδοµένα έκφρασής του, τις σχέσεις του µε άλλα µόρια και τη σχέση του µε το φαινότυπο. Ο τοµέας της γενοµικής χωρίζεται στη δοµική που έχει σαν αντικείµενό της, το που βρίσκεται κάθε αλληλουχία, την λειτουργική που αναφέρεται στο τι κάνει η συγκεκριµένη αλληλουχία και τέλος τη συγκριτική που αναφέρεται στα σηµαντικά κοινά στοιχεία ορισµένης αλληλουχίας, µε άλλες αλληλουχίες. Στις αρχές του 20 ου αιώνα ο άνθρωπος είχε αναπτύξει πολλές διαφορετικές τεχνικές για την χαρτογράφηση τόσο του γονιδιώµατός του, όσο και για τη χαρτογράφηση γονιδιωµάτων άλλων οργανισµών. Στις 15 Φεβρουάριου 2001 στο επιστηµονικό περιοδικό Nature, ανακοινώνεται ένα µεγάλο µέρος της αλληλουχίας του ανθρώπινου χρωµοσώµατος, ενώ µία µέρα αργότερα ανακοινώνονται τα αποτελέσµατα της χαρτογράφησης του ίδιου γονιδιώµατος, από µία ιδιωτική εταιρία, τη Celera, στο περιοδικό Science. Η χαρτογράφηση του ανθρώπου απεκάλυψε ένα µέγεθος γονιδιώµατος 3000 Mb, στο οποίο υπάρχουν γονίδια. Οι άνθρωποι µεταξύ µας είµαστε σε επίπεδο αληλουχίας κατά 99,9% ίδιοι. Με τις σηµερινές τεχνικές µπορούµε να γνωρίζουµε την αλληλουχία ενός ανθρώπου, και ως εκ τούτου και τη πιθανότητα να νοσήσει από συγκεκριµένες ασθένειες. Τα δεδοµένα όµως αυτά εµπίπτουν στην κατηγορία των ευαίσθητων προσωπικών δεδοµένων και εποµένως δεν επιτρέπεται, ο οποιοσδήποτε να έχει πρόσβαση σε αυτά. 28

29 Εικόνα 7.1. Τα ιστορικά εξώφυλλα των δύο περιοδικών Nature και Science στα οποία δηµοσιεύθηκαν για πρώτη φορά αλληλουχίες ανθρώπινων χρωµοσωµάτων. Η συνηθέστερη στρατηγική χαρτογράφησης περιλαµβάνει την κατασκευή µίας βιβλιοθήκης κλώνων, τη διευθέτηση των κλώνων σε σειρά, την εύρεση των υπερκαλύψεων µεταξύ των κλώνων και τέλος την αλληλούχιση κάθε κλώνου, προκειµένου να αποκαλυφθεί η πλήρης αλληλουχία του οργανισµού. Ακολουθεί η επεξεργασία αυτής της πληροφορίας σε ηλεκτρονικούς υπολογιστές, χρησιµοποιώντας λογισµικό (software) που µας επιτρέπει να αντλούµε πολύτιµες πληροφορίες σχετικές µε την αλληλουχία. Οι διαφορετικές προσεγγίσεις στη χαρτογράφηση διαφόρων γονιδιωµάτων αφορούν κυρίως του φορείς που θα χρησιµοποιηθούν για την κατασκευή της βιβλιοθήκης, καθώς και τον τρόπο µε τον οποίο θα γίνει η αλληλούχιση των κλώνων της βιβλιοθήκης. Η σύγκριση των γονιδιωµάτων διαφόρων οργανισµών, αποκάλυψε ότι σε κάθε είδος υπάρχουν συγκεκριµένα κωδικόνια που χρησιµοποιούνται περισσότερο από άλλα. Το γεγονός αυτό της επιλεκτικής χρήσης κωδικονίων (codon usage) λαµβάνεται υπ οψιν 29

30 στις περιπτώσεις που θέλουµε να εκφράσουµε ένα διαγονίδιο σε έναν οργανισµό. Προκειµένου να διευκολύνουµε την έκφραση του διαγονιδίου (transgene), του γονιδίου δηλαδή που ενδιαφερόµαστε να ενσωµατωθεί σε ένα οργανισµό έκφρασης π.χ. ένα φυτό, πρέπει να το σχεδιάσουµε κατά τέτοιο τρόπο, ώστε να χρησιµοποιούµε κωδικόνια που συνηθέστερα χρησιµοποιούνται από αυτό τον οργανισµό. Εικόνα 7.2. Τα βήµατα µίας συνήθης στρατηγική χαρτογράφησης. 30

31 Σήµερα υπάρχουν πολλές βάσεις δεδοµένων, τόσο νουκλεοτιδίων όσο και πρωτεϊνών. Σε αυτές συγκεντρώνονται όλες οι αλληλουχίες γονιδίων, αλλά και µεταγραφικών παραγόντων, ακόµα και αλληλουχιών των οποίων η λειτουργία µπορεί να µην είναι ακόµα γνωστή. Οι βάσεις αυτές βρίσκονται στο διαδίκτυο, ώστε όσο το δυνατόν περισσότεροι επιστήµονες να έχουν πρόσβαση σε αυτές. Επίσης στο διαδίκτυο υπάρχουν και πολλά προγράµµατα που χρησιµεύουν στην ανάλυση των παραπάνω αλληλουχιών. Το πρώτο φυτό που χαρτογραφήθηκε ήταν το Arabidopsis thaliana, εξαιτίας του µικρού γονιδιώµατός του, 120 Mb, του µικρού βιολογικού του κύκλου, 40 µέρες και του µικρού του µεγέθους, cm. Άλλα πλεονεκτήµατα, του ίδιου φυτού που το κατέστησαν πρώτη επιλογή για χαρτογράφηση φυτού είναι ο εύκολος πολλαπλασιασµός του και ο µικρός αριθµός των χρωµοσωµάτων του, µόνο 5. Μεγαλύτερο µειονέκτηµα του συγκεκριµένου φυτού, είναι το γεγονός ότι το Arabidopsis thaliana είναι ένα ζιζάνιο και όχι ένα καλλιεργούµενο είδος. Εικόνα 7.3. Το πρώτο φυτό που χαρτογραφήθηκε ήταν το φυτό Arabidopsis thaliana. 31

32 Κεφάλαιο 7 ο ΜΟΡΙΑΚΟΙ ΕΙΚΤΕΣ Εξαιτίας της µεγάλης προόδου που παρατηρείται τα τελευταία χρόνια στην µοριακή βιολογία, µπορούµε σήµερα να χρησιµοποιούµε µοριακές τεχνικές που µας διευκολύνουν πολύ στη προσπάθειά µας να επιλέξουµε, µέσα από ένα πληθυσµό, συγκεκριµένα άτοµα που έχουν ορισµένους επιθυµητούς χαρακτήρες. Η επιλογή αυτή γίνεται σε µοριακό επίπεδο, µε τη βοήθεια µοριακών δεικτών. Υπάρχουν δύο κατηγορίες µοριακών δεικτών. Οι DNA και οι πρωτεϊνικοί δείκτες. Οι πρώτοι αφορούν τόσο το πυρηνικό όσο και το εξωπυρηνικό (µιτοχονδριακό και χλωροπλαστικό) DNA. Τα κριτήρια επιλογής µοριακών δεικτών είναι πολλά και σχετίζονται τόσο µε αυτούς καθ αυτούς του δείκτες όπως η αφθονία, ο πολυµορφισµός, η εξειδίκευση για ορισµένο γενετικό τόπο, οι συγκυρίαρχοι αλληλόµορφοι, όσο και µε τη διαδικασία παραγωγής τους. Αναφορικά µε τη διαδικασία παραγωγής τους, θα πρέπει να δίνει επαναλήψιµα αποτελέσµατα, να έχει χαµηλές απαιτήσεις σε ανθρώπινο δυναµικό και τεχνική εξειδίκευση, να έχει µικρό κόστος εφαρµογής και εξέλιξης, να απαιτεί µικρή ποσότητα DNA, και να επιδέχεται αυτοµατισµούς. Στους πρωτεϊνικούς δείκτες, που εµφανίσθηκαν προτού εµφανισθούν οι DNA δείκτες, ανήκουν τα ισοένζυµα και τα αλλοένζυµα. Υπάρχουν µικρές διαφορές µεταξύ των ισοενζύµων και των αλλοενζύµων. Τα ισοένζυµα είναι διαφορετικές µορφές ενός ενζύµου που καταλύουν την ίδια αντίδραση, αλλά διαφέρουν ελάχιστα στην αµινοξική τους σύσταση ή στην δοµή τους, τόσο ώστε να µπορούν να διαχωριστούν µεταξύ τους µε ηλεκτροφόρηση ή χρωµατογραφία. Τα αλλοένζυµα αποτελούν διαφορετικές µορφές του ίδιου ενζύµου που κωδικοποιούνται από διαφορετικούς αλληλοµόρφους που βρίσκονται στον ίδιο γενετικό τόπο. 32

33 Πυρηνικό DNA (2n) µητρικό + πατρικό (έµβρυο) Μιτοχονδριακό DNA (n) Μητρικό (σπόρος) Χλωροπλαστικό DNA (n) Αγγειόσπερµα µητρικό (σπόρος) Γυµνόσπερµα πατρικό (γύρη) Εικόνα 7.1. Η προέλευση των διαφόρων ειδών DNA ενός φυτικού κυττάρου. Η εφαρµογή πρωτεϊνικών δεικτών έχει τα εξής πλεονεκτήµατα, δεν χρειάζεται εκκινητές ή σηµαντές, είναι γρήγορη και εύκολη, µε χαµηλό κόστος. Τα ζυµογράµµατα που προκύπτουν από την εφαρµογή πρωτεϊνικών δεικτών, µπορούν να αφορούν συγκεκριµένους γενετικούς τόπους και αλληλόµορφους. Στην περίπτωση των πρωτεϊνικών δεικτών υπάρχει συγκυριαρχία αλληλοµόρφων και τα αποτελέσµατά τους είναι επαναλήψιµα. Τα µειονεκτήµατα της εφαρµογής πρωτεϊνικών δεικτών είναι ότι δεν βρίσκονται σε αφθονία, έχουν χαµηλό πολυµορφισµό, τα ζυµογράµµατα µερικές φορές ερµηνεύονται δύσκολα εξαιτίας «ζωνών» που οφείλονται σε πολυπλοειδία ή σε γονίδια που έχουν διπλασιασθεί, οι πρωτεΐνες που έχουν όµοια ηλεκτροφορητική ικανότητα µπορεί να µην είναι οµόλογες, ενώ δεν είναι «ουδέτερη» σε επιλεκτική πίεση. 33

34 Εικόνα 7.2. Παράδειγµα εφαρµογής ισοενζύµων στη δηµιουργία δενδρογραµµάτων. Στους DNA δείκτες ανήκουν τα RFLPs (Restriction Fragment Length Polymorphisms), τα RAPDs (Randomly Amplified DNA Polymorphisms), τα AFLPs ( Amplified Fragment Length Polymorphisms), οι µινιδορυφόροι (minisatellites) και οι µικροδορυφόροι (microsatellites) ή αλλιώς SSRs (Simple Sequence Repeats). Η διαδικασία των RFLP περιλαµβάνει την αποµόνωση και τη πέψη του DNA, το διαχωρισµό των τµηµάτων του DNA µε ηλεκτροφόρηση αγαρόζης, τα οποία συνήθως έχουν µεγέθος 2-10 kb, την υβριδοποίησή τους κατά Southern µε σηµαντή ειδικό για ορισµένο γενετικό τόπο και τέλος την ανίχνευση τυχόν πολυµορφισµού µε αυτοραδιογραφία ή µη ραδιενεργή σήµανση. Οι δείκτες RFLP, υπάρχουν άφθονοι στα περισσότερα γονιδιώµατα, όπου είναι τυχαία διασκορπισµένοι, οι ζώνες που παράγουν µπορεί να αποδοθούν σε γενετικούς τόπους και αλληλοµόρφους, υπάρχει συγκυριαρχία αλληλοµόρφων, ενώ τα αποτελέσµατα που προκύπτουν είναι επαναλήψιµα. Γενικά πρόκειται για χρονοβόρα και τεχνικά δύσκολη διαδικασία, µε υψηλό κόστος εφαρµογής, και πρόσθετο κόστος σε περίπτωση που δεν υπάρχουν κατάλληλοι σηµαντές. Απαιτεί µεγάλη συγκέντρωση DNA (5-10µg), µεγάλου µοριακού βάρους, ενώ δεν επιδέχεται αυτοµατισµό. 34

35 Η διαδικασία παραγωγής των RAPDs (Random Amplified Polymorphic DNA) ξεκινάει µε την αποµόνωση και την αναπαραγωγή τµηµάτων DNA, µεγέθους kb, µε PCR, το διαχωρισµό των τµηµάτων DNA µε ηλεκτροφόρηση αγαρόζης και την ανίχνευση πολυµορφισµού µετά από χρώση βρωµιούχου εθιδίου χρησιµοποιώντας υπεριώδη ακτινοβολία Εικόνα 7.3. Μινιδορυφόροι όπως φαίνονται σε φιλµ αυτοραδιογραφίας. Τα πλεονεκτήµατα των RAPDs είναι ότι για την εφαρµογή τους απαιτείται χαµηλή συγκέντρωση DNA, 5-50 ng για κάθε αντίδραση, ενώ οι αλληλουχίες των εκκινητών που χρησιµοποιούνται είναι τυχαίες. Η δοκιµή γίνεται εύκολα και γρήγορα, µε χαµηλό κόστος. RAPD δείκτες υπάρχουν άφθονοι και τυχαία διασκορπισµένοι στο γονιδίωµα. Σε κάθε αντίδραση παράγονται συνήθως πολλές ζώνες, ενώ υπάρχει η δυνατότητα αυτοµατισµού τους. Τα µειονεκτήµατά τους είναι ότι απαιτούν καθαρό DNA, µεγάλου µοριακού βάρους. Επίσης απαιτείται ιδιαίτερη προσοχή για την αποφυγή µολύνσεων και 35

36 κανονικοποίηση των συνθηκών της αντίδρασης. ενώ οι ζώνες που αναπαράγονται δεν µπορούν να αποδοθούν σε γενετικούς τόπους και αλληλοµόρφους. Τέλος παράγουν κυρίαρχους αλληλόµορφους, έχουν µικρή επαναληψιµότητα, ενώ τµήµατα ίδιου µεγέθους µπορεί να µην είναι οµόλογα Εικόνα 7.4. είγµατα RAPDs, µε βάση τα οποία µπορούν να εντοπισθούν οµοιότητες και διαφορές µεταξύ των δειγµάτων. Η διαδικασία παραγωγής των AFLP (Amplified Fragment Length Polymorphism) ξεκινάει µε την αποµόνωση και πέψη του DNA καθώς και την πρόσδεση ολιγονουκλεοτιδίων προσαρµοστών στα τµήµατα του DNA που προκύπτουν από τη πέψη. Κατόπιν γίνεται µε PCR, επιλεκτική αναπαραγωγή τµηµάτων DNA και διαχωρισµός του µε ηλεκτροφόρηση πολυακριµαλίδης. Η ανίχνευση των ζωνών που προκύπτουν γίνεται µε αυτοραδιογραφία, χρώση µε άργυρο, ή φθωρισµό. Οι εκκινητές δεν χρειάζεται να έχουν γνωστή αλληλουχία. AFLPs βρίσκονται άφθονοι, διασκορπισµένοι στο γονιδίωµα, αν και σε µερικές περιπτώσεις εντοπίζονται γύρω από τα κεντροσωµάτια. Μπορεί να γίνει αναπαραγωγή πολλών «ζωνών» σε κάθε αντίδραση. Τα αποτελέσµατα είναι επαναλήψιµα και υπάρχει η δυνατότητα αυτοµατισµού. Απαιτούν όµως πολύ καθαρό DNA, µεγάλου µοριακού βάρους. Το DNA προφίλ δεν µπορεί να 36

37 ερµηνευθεί σχετίζοντας αλληλόµορφους και γενετικούς τόπους. Είναι κυρίαρχοι αλληλόµορφοι, ενώ παρόµοιου µεγέθους τµήµατα, µπορεί να µην είναι οµόλογα. Εικόνα 7.5. Προφίλ AFLP δεικτών. Είναι χαρακτηριστική η πληθώρα των ζωνών που υπάρχουν σε κάθε δείγµα. Οι µινιδορυφόροι παράγονται µε αποµόνωση, πέψη και διαχωρισµό των τµηµάτων DNA, µεγέθους 4-20 kb, µε ηλεκτροφόρηση αγαρόζης, υβριδοποίηση κατά Southern µε ραδιοσηµασµένο µινιδορυφορικό σηµαντή και ανίχνευση πολυµορφισµού µε αυτοραδιογραφία. Οι µινιδορυφόροι έχουν υψηλό βαθµό πολυµορφισµού, παράγουν πολλές ζώνες, ενώ τα αποτελέσµατά της εφαρµογής τους είναι επαναλήψιµα. Απαιτούν όµως µεγάλες συγκεντρώσεις DNA, 5-10µg, µεγάλου µοριακού βάρους και έχουν µεγάλο κόστος εφαρµογής. Η διαδικασία παραγωγής τους είναι χρονοβόρα και απαιτεί επιδεξιότητα. Η διασπορά των µινιδορυφόρων στο γονιδίωµα µπορεί να µην είναι τυχαία. Οι ζώνες που παράγουν δεν µπορεί να αποδοθούν σε γενετικούς τόπους και αλληλοµόρφους. Είναι κυρίαρχοι αλληλόµορφοι, ενώ ζώνες ίδιου µεγέθους µπορεί να 37

38 µην είναι οµόλογες. Επίσης είναι δύσκολο να συγκρίνει κανείς πολυµορφισµούς σε διαφορετικά πηκτώµατα, ενώ δεν επιδέχονται αυτοµατισµό. Οι µικροδορυφόροι ή αλλιώς SSRs (Simple Sequence Repeats), παράγονται µετά από αποµόνωση και αναπαραγωγή τµηµάτων DNA µε PCR. Ο διαχωρισµός «ζωνών» γίνεται µε ηλεκτροφόρηση πολυακρυλαµίδης ή αγαρόζης και η ανίχνευση του πολυµορφισµού µε αυτοραδιογραφία, χρώση µε άργυρο, φθωρισµό, ή χρώση µε βρωµιούχο εθίδιο και χρήση υπεριώδους ακτινοβολίας. Η εφαρµογή µικροδορυφόρων απαιτεί χαµηλή συγκέντρωση DNA, ng/ αντίδραση, µε την οποία παράγονται «ζώνες» που µπορούν να αποδοθούν σε γενετικούς τόπους και αλληλοµόρφους. Μικροδορυφόροι βρίσκονται σε αφθονία και διασκορπισµένοι στο γονιδίωµα. Είναι συγκυρίαρχοι αλληλόµορφοι, δίνουν επαναλήψιµα αποτελέσµατα, και υπάρχει η δυνατότητα εφαρµογής αυτοµατισµού στην παραγωγή τους. υστυχώς αν δεν υπάρχουν γνωστοί εκκινητές, το κόστος τους είναι υψηλό. Επίσης ετερόζυγα άτοµα µπορεί να θεωρηθούν οµόζυγα, όταν εµφανίζονται «µηδενικά» αλληλόµορφα, εξαιτίας µετάλλαξης σε θέση πρόσδεσης εκκινητή, ενώ «λάθος» ζώνες δυσχεραίνουν την βαθµολόγιση του πολυµορφισµού. εν είναι κυρίαρχοι αλληλόµορφοι. Παρόµοιου µεγέθους τµήµατα, µπορεί να µην είναι οµόλογα. Οι µοιριακοί δείκτες έχουν πολλές εφαρµογές στη βελτίωση φυτών. Χρησιµοποιώντας µοριακούς δείκτες που είναι στενά συνδεδεµένοι, ή βρίσκονται µέσα σε έναν ή περισσότερους γενετικούς τόπους ποσοτικών χαρακτήρων QTL (Quantitative trait loci) η επιλογή γίνεται περισσότερο αποτελεσµατική (marker-assisted selection). Άλλη εφαρµογή αποτελεί η ενσωµάτωση γονιδίων από άγρια είδη µε την βοήθεια δεικτών (marker assisted introgression). Επίσης, οι µοριακοί δείκτες µπορούν να χρησιµοποιηθούν σε µελέτες γενετικής ποικιλοµορφίας και ταξονοµικών /φυλλογενετικών αναλύσεων διαφορετικών φυτικών ειδών ή πληθυσµών συγκεκριµένων ειδών. Τέλος µπορούν να χρησιµοποιηθούν και σε µελέτες βιολογικών διεργασιών, όπως ο τρόπος αναπαραγωγής, ο διασκορπισµός της γύρης, ή των σπόρων κ.α. 38

39 Κεφάλαιο 8 ο ΗΜΙΟΥΡΓΙΑ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΩΝ ΦΥΤΩΝ Τα πρώτα διαγονιδιακά φυτά δηµιουργήθηκαν αρχές της δεκαετίας του 1990 και ήταν φυτά καπνού. Από τότε ένα πλήθος φυτών έχει µετασχηµατισθεί, όπως φυτά µεγάλης καλλιέργειας και τελευταία δενδρώδεις καλλιέργειες, µε σκοπό οι νέες καλλιέργειες να είναι ανθεκτικές σε διάφορες αβιοτικές, αλλά και βιοτικές καταπονήσεις, και πολλά άλλα χαρακτηριστικά. Πρώτα διαγονιδιακά φυτά ηµιουργία Bt καλαµποκιού Φυτά ανθεκτικά σε έντοµα και ζιζάνια διατίθενται στην αγορά Τοµάτα µε καθυστερηµένη ωρίµανση διατίθεται στην αγορά Εγκρίνεται διαγονιδιακό καλαµπόκι στην ΕΕ Εικόνα 8.1. Ορισµένες χρονολογίες ορόσηµα για την δηµιουργία και την καλλιέργεια διαγονιδιακών φυτών. Στην διάρκεια αυτών των χρόνων πολλές µέθοδοι µετασχηµατισµού των φυτών δοκιµάσθηκαν. ύο όµως από αυτές ξεχώρισαν σαν οι περισσότερο αποτελεσµατικές και αποτελούν σήµερα τις κύριες µεθόδους παραγωγής γενετικά τροποποιηµένων φυτών. Η µέθοδος του αγροβακτηρίου (Agrobacterium-mediated transformation) και η µέθοδος του εκτοξευτήρα µικροσωµατιδίων (microprojectile bombardment, particle gun technology). 39

40 Το αγροβακτήριο, Agrobacterium tumefaciens, είναι ένα παθογόνο εδάφους δικοτυλήδονων φυτών που προκαλεί τον "καρκίνο του λαιµού" (crown gall disease). Εικόνα 8.2. Όγκοι στο «λαιµό» φυτού που έχουν προκληθεί µετά από µόλυνση µε αγροβακτήριο. Η ογκογόνα δράση του αγροβακτηρίου, οφείλεται στο πλασµίδιο Ti (tumor- inducing plasmid) και συγκεκριµένα σε δύο οµάδες γονιδίων που εδράζονται σε αυτό. Η πρώτη οµάδα βρίσκεται σε µία περιοχή του Ti πλασµιδίου, που ονοµάζεται T-DNA, η οποία οριοθετείται από δύο παρόµοιες αλληλουχίες 24 νουκλεοτιδίων. Αυτές οι αλληλουχίες αποτελούν τα άκρα της T-DNA περιοχής. Η T-DNA περιοχή είναι αυτή που αποκόπτεται από το υπόλοιπο πλασµίδιο και ενσωµατώνεται σε τυχαία θέση του φυτικού χρωµοσώµατος, προκειµένου να αρχίσει ο σχηµατισµός όγκου στο φυτικό ιστό. Η T- DNA περιοχή αποτελείται από γονίδια που είναι υπεύθυνα για την βιοσύνθεση και τον µεταβολισµό συγκεκριµένων φυτορµονών που ονοµάζονται "οπίνες" (opines) και οι οποίες παράγονται σε µεγάλες ποσότητες µόνο στον καρκινικό ιστό. Εξαιτίας της υπερπαραγωγής αυτών των φυτορµονών τα µετασχηµατισµένα φυτικά κύτταρα πολλαπλασιάζονται, αδιαφοροποίητα, χωρίς έλεγχο, σχηµατίζοντας µία άµορφη µάζα κυττάρων, τον καρκινικό όγκο. 40

41 Η δεύτερη οµάδα γονιδίων που σχετίζονται µε την ογκογόνο δράση του Ti πλασµιδίου, είναι τα vir γονίδια (virulence genes), που σχετίζονται µε τη παθογόνο ικανότητα του βακτηρίου και µια σειρά άλλων γονιδίων που αναγνωρίζουν τα συνοριακά άκρα της Τ- DNA περιοχής. LB T-DNA B A D C G E vir RB Ογκογονίδια σύνθεσης οπινών Ti Καταβολισµός οπινών ori Εικόνα 8.2. Ένα Ti πλασµίδιο, στο οποίο φαίνονται η περιοχή των vir γονιδίων, η περιοχή του καταβολισµού των οπινών, η T-DNA περιοχή και τα άκρα της, αριστερό (RB) και δεξιό (LB), και τέλος η περιοχή πολαπλασιασµού του πλασµιδίου (ori-origin of replication). Τα εργαστηριακά στελέχη αγροβακτηρίου που χρησιµοποιούνται για το γενετικό µετασχηµατισµό των φυτών είναι γενετικά "αφοπλισµένα", δεν προκαλούν δηλαδή ασθένεια, ενώ διατηρούν την ικανότητά τους να µεταφέρουν γονίδια στα φυτά. Το αφοπλισµένο Ti πλασµίδιο έχει λειτουργική και ακέραιη τη vir περιοχή, καθώς και τα 41

42 άκρα της T-DNA περιοχής. Από τη Τ-DNA περιοχή όµως έχουν αφαιρεθεί τα ογκογόνα γονίδια. Η τεχνητή µεταφορά του T-DNA στο φυτό, µπορεί να γίνει µε δύο τρόπους. Είτε χρησιµοποιώντας δυαδικούς φορείς (binary vectors), είτε χρησιµοποιώντας φορείς σύντηξης (cointegrative vectors). Η στρατηγική των δυαδικών φορέων βασίζεται στη παρατήρηση ότι η T-DNA περιοχή δεν χρειάζεται να αποτελεί µέρος του Ti πλασµιδίου προκειµένου να είναι λειτουργική. Έτσι η Τ-DNA περιοχή βρίσκεται σε ένα σχετικά µικρό πλασµίδιο, ενώ η µεταφορά και ενσωµάτωση αυτής της περιοχής γίνεται από γονίδια που υπάρχουν σε ένα άλλο πλασµίδιο (αφοπλισµένο Ti πλασµίδιο). Η στρατηγική των φορέων σύντηξης είναι παρόµοια, µόνο που βασίζεται στο γενετικό ανασυνδυασµό µεταξύ δύο πλασµιδίων. Τα δύο πλασµίδια έχουν οµόλογες αλληλουχίες, οι οποίες είναι υπεύθυνες για το γενετικό ανασυνδυασµό που συµβαίνει µεταξύ των δύο. Ο ένας εκ των δύο φορέων φέρει τη T-DNA περιοχή χωρίς τα άκρα της και χωρίς την ικανότητα να πολλαπλασιάζεται και ο άλλος είναι ένα αφοπλισµένο Ti πλασµίδιο που έχει όλα τα απαραίτητα στοιχεία για την µεταφορά της και την ενσωµάτωσή της στο φυτικό χρωµόσωµα. Με το γενετικό ανασυνδυασµό δηµιουργείται ένα πλασµίδιο που έχει την ικανότητα να µεταφέρει όσα γονίδια υπάρχουν κλωνοποιηµένα στη T-DNA, περιοχή προκειµένου να ενσωµατωθούν στο φυτικό χρωµόσωµα. Όταν τα διαγονίδια ενσωµατώνονται στα χρωµοσώµατα του φυτικού κυττάρου, τότε κληρονοµούνται σαν Μενδελιανοί χαρακτήρες στις επόµενες γενεές. Υπάρχουν όµως και περιπτώσεις, όπου τα γονίδια δεν ενσωµατώνονται στο φυτικό χρωµόσωµα, µε αποτέλεσµα να µην κληρονοµούνται και η έκφρασή τους να φθίνει µε το χρόνο. Στη πρώτη περίπτωση αναφερόµαστε σε σταθερό µετασχηµατισµό (stable transformation) των φυτικών κυττάρων, ενώ στη δεύτερη περίπτωση, σε παροδική έκφραση (transient expression) των διαγονιδίων. Η µέθοδος του αγροβακτηρίου είναι σχετικά απλή και απαιτεί εξοπλισµό για ιστοκαλλιέργεια φυτών. Κύριο µειονέκτηµα της µεθόδου είναι ότι το αγροβακτήριο, µερικές φορές, παραµείνει στους ιστούς του µετασχηµατισµένου φυτού για µεγάλο χρονικό διάστηµα, παρότι δεν υπάρχει στους απογόνους του. 42

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ

Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ DNA ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Τεχνολογία ανασυνδυαζόμενου DNA ή Γενετική Μηχανική Κατασκευή τεχνητών μορίων DNA (ανασυνδυασμένο DNA) Τροποποίηση γονιδιωμάτων Μεταφορά γονιδίου/ων

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ Αµυραδάκη 20, Νίκαια (210-4903576) ΤΑΞΗ... Γ ΛΥΚΕΙΟΥ... ΜΑΘΗΜΑ...ΒΙΟΛΟΓΙΑ ΚΑΤ/ΣΗΣ... ΝΟΕΜΒΡΙΟΣ 2011 ΑΞΙΟΛΟΓΗΣΗ ΚΕΦΑΛΑΙΑ 1 ο -2 ο ΘΕΜΑ 1ο Α. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Η νέα προσέγγιση στην ταχεία προγεννητική διάγνωση των χρωµοσωµατικών ανωµαλιών του εµβρύου

Η νέα προσέγγιση στην ταχεία προγεννητική διάγνωση των χρωµοσωµατικών ανωµαλιών του εµβρύου Αµνιο-PCR Η νέα προσέγγιση στην ταχεία προγεννητική διάγνωση των χρωµοσωµατικών ανωµαλιών του εµβρύου Αγγελική Χατζάκη, PhD Γεωργία Χριστοπούλου, MSc Τµήµα Γενετικής και Μοριακής Βιολογίας Μαιευτήριο «ΜΗΤΕΡΑ»

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. ίκλωνο

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2011 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ 1 o

ÈÅÌÁÔÁ 2011 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ 1 o 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr 1 TO 1. µ, : i µ µ DNA ii µ DNA iii

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα