ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ"

Transcript

1 ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ Β. Σοφιανοπούλου Ινστιτούτο Βιολογίας, ΕΚΕΦΕ

2 ιαµεµβρανικές πρωτεΐνες υπεύθυνες για την κυτταρική επικοινωνία µέσω της εξειδικευµένης και ελεγχόµενης µεταφοράς µεταβολιτών (σάκχαρα, αµινοξέα, πεπτίδια, νουκλεοσίδια, νουκλεοτιδικές βάσεις, αζωτούχες ενώσεις, βιταµίνες, ιόντα, ορµόνες, νευροδιαβιβαστές κλπ) Μηχανισµούς αναγνώρισης και πρόσδεσης µεταβολιτών παρόµοιους µε αυτoύς των ενζύµων

3 ΙΑΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΙΝΕΣ 1. ΚΑΝΑΛΙΑ 2. ΠΡΩΤΕΙΝΕΣ ΜΕΤΑΦΟΡΕΙΣ (Saier, 2000; Mol.Biol.Rev. 64: ) Κανάλια: κανάλια µε δευτεροταγείς δοµές α-έλικας κανάλια δευτεροταγείς δοµές β-βαρελιού (πορίνες) κανάλια τοξινών κανάλια πεπτιδίων

4 Πρωτεΐνες µεταφορείς: κατατάσσονται µε κριτήριο τις ενεργειακές τους απαιτήσεις παθητικοί και ενεργητικοί πρωτογενούς ενεργότητας δευτερογενούς ενεργότητας τροποποιητές υποστρώµατος (group translocators) συµµεταφορείς αντιµεταφορείς µονοµεταφορείς

5 Ρόλος των µεταφορέων στους ανώτερους οργανισµούς Ανακατανοµή ή/και ανακύκληση ενδογενών µεταβολιτών σε διάφορους ιστούς ο µεταφερόµενος µεταβολίτης µπορεί να χρησιµεύει ως µοριακό σήµα, νευροδιαβιβαστής, µόριο άµυνας ή ορµόνη Αποµάκρυνση τοξικών µεταβολιτών και ξενοβιοτιοτικών φαρµάκων Γενετικές ασθένειες οφείλονται στη µη φυσιολογική δοµή ή λειτουργία πρωτεϊνικών µεταφορέων (κυστική ίνωση, γενική ή συγγενής µυοτονία, υπερκαλαµική περιοδική παράλυση, κληρονοµική δρεπανοκυττάρωση, δυσαπορρόφηση γλυκόζης, κυστινουρία και καλοήθη ή επιθετικά χολοστατικά σύνδροµα)

6 Βιολογικά συστήµατα µελέτης διαµεµβρανικών µεταφορέων 1. Saccharomyces cerevisiae 2. ωοκύτταρα Χenopus 3. in vitro συστήµατα (καλλιέργειες κυττάρων από έντοµα ή τον άνθρωπο) 4. Αspergillus nidulans?

7 Aspergillus nidulans µη παθογόνος ευκαρυωτικός µικροοργανισµός πρότυπο σύστηµα µελέτης πολλαπλών κυτταρικών λειτουργιών µικρός χρόνος ανάπτυξης σε απλά και φθηνά θρεπτικά µέσα σχετικά υψηλή αποδοτικότητα µετασχηµατισµού και δυνατότητα αποµόνωσης σταθερά µετασχηµατισµένων στελεχών, διαθεσιµότητα µεγάλου αριθµού µεταλλαγµένων στελεχών γνωστή και διαθέσιµη η αλληλουχία γονιδιώµατος (2.7χ10 7 bp) φυλετικό, αγενή και παραφυλετικό κύκλο ανάπτυξης ευκολία µελέτης συγκεκριµένων µεταφορέων µε απλές δοκιµασίες ανάπτυξης και µετρήσεις πρόσληψης ραδιοσηµασµένων µεταβολιτών σε καθορισµένο γενετικό υπόβαθρο

8 ATP de novo GTP AMP IMP XMP GMP αδενίνη υποξανθίνη ξανθίνη γουανίνη ουρικό οξύ αλλαντοΐνη αλλαντοϊκό οξύ ουρεΐδογλυκίνη γλυοξυλική ουρία ουρία αµµωνία

9 Η µελέτη των µεταφορέων νουκλεοτιδικών βάσεων είναι πρωταρχικής φυσιολογικής, κλινικής, φαρµακολογικής και αγροτικής σπουδαιότητας

10 Οικογένειες Μεταφορέων Νουκλεοτιδικών Βάσεων ΝΑΤ (Νucleobase Ascorbate Transporters): αρχαιοβακτήρια, ευβακτήρια, ευκάρυα (µύκητες, έντοµα, φυτά, θηλαστικά) PbuX, UraA, PyrP, UapA, UapC, hsvct1, hsvct2 ΕΝΤ (Εquilibrative Nucleoside Transporters): θηλαστικά, πρωτόζωα hεντ1-3, rent1-3 PRΤ (Purine Related Transporters): αρχαιοβακτήρια, ευβακτήρια, µύκητες CodB, FUR4, FCY2 PUP (PUrine Permeases): φυτά AtPUP1 - AtPUP15 UPS (Ureide Permeases): φυτά AtUPS1 AtUPS5

11 Μεταφορείς νουκλεοτιδικών βάσεων της οικογένειας ΝΑΤ µεταφορείς δευτερογενούς ενεργότητας συντηρηµένη περιοχή 12 αµινοξέων, αλληλουχία υπογραφής >21% ταυτότητα, > 40% οµοιότητα αµινοξικής αλληλουχίας

12 Γιατί ο Aspergillus nidulans??? Στους περισσότερους µικροοργανισµούς η πρόσληψη πουρινών και πυριµιδινών εξυπηρετεί δύο κύριες λειτουργίες: τη βιοσύνθεση νουκλεοτιδίων και νουκλεικών οξέων τη χρήση κυρίως των πουρινών ως πηγές αζώτου µετονκαταβολισµότουςσε ουρία και αµµωνία S. cerevisiae: έχει χάσει την ικανότητά του να καταβολίζει πουρίνες. Αυτό το γεγονός αντανακλάται στην εξέλιξη των συστηµάτων πρόσληψης νουκλεοτιδικών βάσεων του µύκητα, που περιλαµβάνουν µεταφορείς ειδικούς για την πρόσληψη πουρινών και πυριµιδινών που ανακυκλώνονται κατά τη βιοσύνθεση νουκλεικών οξέων ενώ δεν διαθέτουν µεταφορείς οξειδωµένων πουρινών, ουρικού οξέος και ξανθίνης που µπορούν να χρησιµοποιηθούν ως πηγές αζώτου 1. Ικανότητα χρήσης ευρέος φάσµατος νουκλεοτιδικών βάσεων ως µοναδικές πηγές αζώτου (ουρικό οξύ, ξανθίνη, αδενίνη, γουανίνη, υποξανθίνη) 2. Καλά µελετηµένο σύστηµα µεταφοράς πουρινών

13

14 Μεταφορείς πουρινών του Aspergillus nidulans UapA: υψηλής συγγένειας, υψηλής µεταφορικής ικανότητας υπεύθυνος για τη µεταφορά των οξειδωµένων πουρινών (ουρικό οξύ και ξανθίνη) UapC: υψηλής συγγένειας, µέσης/χαµηλής µεταφορικής ικανότητας γενικός µεταφορέας πουρινών και αναλόγων τους ΑzgA: υψηλής συγγένειας, υψηλής µεταφορικής ικανότητας µεταφορέας αδενίνης, γουανίνης και υποξανθίνης UapA και UapC: 62% ταύτιση αµινοξικής αλληλουχίας

15

16

17

18

19

20

21

22

23 ΝΑΤ ΜΕΤΑΦΟΡΕΙΣ ΣΤΑ ΦΥΤΑ 13 φυτικά γονίδια 1 παράλογο από το ice plant (Mesembryanthenum crystallium) 11 παράλογα από την Arabidopsis 30 EST κλώνοι (ρύζι, ντοµάτα, σόγια κλπ) LPE1 (Leaf permease1) από το καλαµπόκι

24 LPE1 πρωτεΐνη Χαρακτηριστικά των µελών της οικογένειας ΝΑΤ 487 αµινοξέα, ΜW 53.2 kd 25% ταυτότητα µε τοµεταφορέα UapA, πιθανά διαµεµβρανικά τµήµατα Όχι αλληλουχίες πρόσδεσης στο DNA Όχι σηµατοδοτικές αλληλουχίες για στόχευση σε ενδοκυτταρικές δοµές (µιτοχόνδρια, χλωροπλάστες) αλληλουχία υπογραφής ανενεργοποίηση του γονιδίου lpe1 προκαλεί δοµικές αλλαγές στους χλωροπλάστες τον κατ εξοχήν τόπο βιοσύνθεσης των πουρινών

25 Ενδείξεις ότι η πρωτεΐνη LPE1 συµµετέχει σε µονοπάτια διακίνησης των νουκλεοτιδικών βάσεων διαµέσου µεµβρανών Η µελέτη των µηχανισµών και των συστηµάτων µεταφοράς νουκλεοτιδικών βάσεων δεν είναι εύκολο να πραγµατοποιηθεί σε φυτικά κύτταρα: ο χειρισµός τους σε εργαστηριακές συνθήκες είναι σύνθετος και η παρουσία στα φυτικά κύτταρα πολλαπλών µεταφορέων ΝΑΤ ή PUT οδηγεί σε αυξηµένη πιθανότητα παρουσίας αλληλο-επικαλυπτόµενων εξειδικεύσεων στα διαφορετικά συστήµατα µεταφοράς Το γονίδιο lpe1 παρουσιάζει παρόµοια περιεκτικότητα σε GC µε το γονίδιο uapa Λειτουργική έκφραση της φυτικής πρωτεΐνης στον ασκοµύκητα (βιοχηµική και φυσιολογική λειτουργία)

26 Γενετικός µετασχηµατισµός του στελέχους ACZ (uapa - uapc - azga - argb-) µε κατάλληλο φορέα έκφρασης (pan-lpe1) SstI uapa promoter NcoI XbaI uapa terminator SalI/XhoI KpnI Φορέας έκφρασης pan-lpe1 5 και 3 ρυθµιστικές περιοχές του γονιδίου uapa το γονίδιο argb που κωδικοποιεί το ένζυµο ornithine carbamoyl transferase που εµπλέκεται στο µονοπάτι βιοσύνθεσης της αργινίνης cdna lpe1 κλώνο 1.6kb 5 UapA 3 UapA ArgB LPE1 NcoI-BamHI XbaI CCATGGATCCCGTGAAGGCCGAG//AGGTACTTCCCCTCGCTCTAGTCTAGA Fusion protein M D P V K A E //R Y F P S L * LPE1 M P P V K A E //R Y F P S L * ACZ: αυξότροφο για την αργινίνη πλήρη απώλεια λειτουργίας των ενδογενών µεταφορέων πουρινών µη ανάπτυξη σε ΜΜ παρουσία διαφορετικών πουρινών ως µοναδικές πηγές αζώτου

27 γενετικός µετασχηµατισµός στελέχους - δέκτη uapa uapc azga argb εκφράζει µη λειτουργικούς τους ενδογενείς µεταφορείς πουρινών και το ένζυµο ArgB του µονοπατιού βιοσύνθεσης της αργινίνης + κυκλικός φορέας έκφρασης αποµόνωση µετασχηµατισµένων στελεχών σε ελάχιστο θρεπτικό υλικό απουσία αργινίνης

28 Γενετικές µελέτες µετασχηµατισµένων στελεχών ACZ:pAN-Lpe1 urea NH 4 + Τα µετασχηµατισµένα µε τις φυτικές αλληλουχίες στελέχη αναπτύσσονται µε διαφορετικό ρυθµό σεουρικόοξύκαι ξανθίνη αλλά όχι παρουσία υποξανθίνης, αδενίνης ή γουανιδίνης ως µοναδικές πηγές αζώτου proline uric acid Τα στελέχη LP2 και LP5 αναπτύσσονται έχοντας συµπαγή µορφολογία ανάλογη του στελέχους φυσικού τύπου και του στελέχους που εκφράζει το µεταφορέα UapA TαστελέχηLP4 και LP6 δεν έχουν συµπαγή µορφολογία και παρουσιάζουν µειωµένο ρυθµό ανάπτυξης και σε πηγές αζώτου διαφορετικές των πουρινών uapa - uapa + LP5 LP6 LP2 LP4

29 Μοριακή Ανάλυση lpe1- Μετασχηµατισµένων Στελεχών ανάλυση κατά Southern uapa uapa+ LP2 LP5 LP4 LP6 lpe1

30 Μοριακή Ανάλυση lpe1- Μετασχηµατισµένων Στελεχών ανάλυση κατά Southern uapa uapa+ LP2 LP5 lpe1 αριθµός αντιγράφων γονιδίου lpe1 ανάλυση κατά Northern lpe1 επίπεδα έκφρασης γονιδίου lpe1 acn

31 η ικανότητα ανάπτυξης των lpe1-µετασχηµατισµένων στελεχών σε ουρικό οξύ ή ξανθίνη οφείλεται στην ενσωµάτωση των φυτικών αλληλουχιών στο γονιδίωµα τουµύκητα και την έκφρασή τους ο ρυθµός ανάπτυξης εξαρτάται από τη θέση ενσωµάτωσης των φυτικών αλληλουχιών και τον αριθµό των αντιγράφων τους, ο οποίος καθορίζει τα επίπεδα έκφρασης της αλληλουχίας lpe1

32 Αυτογονιµοποίηση-Selfing Κατά τη διάρκεια του φυλετικού κύκλου ανάπτυξης του µύκητα (µειώσεις) όταν υπάρχουν πολλαπλά αντίγραφα πλασµιδιακής αλληλουχίας ενσωµατωµένα στο γονιδίωµάτου, ευνοείται οµόλογος ανασυνδυασµός µεταξύ των αντιγράφων αυτών, που συχνά οδηγεί σε άνιση ανακατανοµή τουαριθµού τους σε µερικούς απογόνους που προέρχονται από διαφορετικά ασκοσπόρια Αποµόνωση απογόνων είτε µε µειωµένο είτε µε αυξηµένο αριθµό αντιγράφων µιας αλληλουχίας LP2 X LP2

33 Γενετικές µελέτες απόγονων στελεχών LP2, µετά από αυτογονιµοποίηση (selfing) uapa - uapa + LP5 LP2 LP2-S2 LP2-S1 LP2-S0 ουρία Ουρικό οξύ ξανθίνη

34 Ανάλυση κατά Southern Lpe1 (~9 kb) uapa - uapa + LP2 LP5 LP2-S0 LP2-S1 LP2-S2

35 Ανάλυση κατά Northern Lpe1 acn uapa + uapa - LP2 LP5 LP2-S0 LP2-S1 LP2-S2

36 τα επίπεδα έκφρασης της αλληλουχίας lpe1, που είναι ευθέως ανάλογα του αριθµού των ενσωµατωµένων πλασµιδιακών αντιγράφων, καθορίζουν την ικανότητα ανάπτυξης σε ουρικό οξύ ή ξανθίνη

37 Βιοχηµικά Χαρακτηριστικά Μεταφορέα LPΕ1 ρυθµός πρόσληψης ξανθίνης ρυθµός πρόσληψης ξανθίνης (pmol min κονίδια) 0,3 0,2 0, συγκέντρωση υποστρώµατος (µμ) K m = 30 µμ ±2.5µΜ 1/[V] (1/pmol min κονιδιοσπόρια) Γράφηµα Lineweaver-Burk y = 141,83x + 4, ,2 0,4 0,6 0,8 1 1,2 1/[S] (1/µΜ) V max = 0.22 pmol min κονιδιοσπόρια

38 ο Μεταφορέας LPE1 Είναι ευτερογενούς Ενεργότητας επίδραση ενώσεων που διαταράσσουν την ηλεκτροχηµική προωθητική δύναµητηςµεµβράνης στην πρόσληψη ξανθίνης από το µεταφορέα LPE1 LPE1 UapA % πρόσληψη 3 Η -ξανθίνης απουσία αναστολέα DCCD CCCP

39 % πρόσληψης 3 Η-ξανθίνης Προσδιορισµός της Ειδίκευσης της πρωτεΐνης LPE1 1. Πειράµατα ανταγωνισµού πρόσληψης 10µΜ 3 Η-ξανθίνης παρουσία 300µΜ µηραδιοσηµασµένου ανταγωνιστή UapA LPE1 0 καφεΐνη ουρακίλη κυτοσίνη θυµίνη γουανίνη αδενίνη υποξανθίνη ουρικό οξύ ξανθίνη

40 % πρόσληψης 3 Η-ξανθίνης 2. Πειράµατα ανταγωνισµού πρόσληψης 10µΜ 3 Η-ξανθίνης παρουσία διαφορετικών συγκεντρώσεων ασκορβικού οξέος 100 UapA LPE mM 90mM 75mM 45mM 10mM 5mM 0.3mM 35mM 22.5mM 20mM L-ασκορβικό οξύ 0.3mΜ ξανθίνη

41 το Ασκορβικό Οξύ Προσδένεται Εξειδικευµένα στο Μεταφορέα LPE LP2 % πρόσληψης 3 H-προλίνης 0 10 mm 5 mm 0.3 mm προλίνη 20 mm 35 mm 45 mm L-ασκορβικό οξύ

42 3. Ανταγωνιστική αναστολή (competitive ihhibition) της πρόσληψηςξανθίνηςαπότοασκορβικόοξύ Τιµές K m συγγένειας του µεταφορέα LPE1 για τη ξανθίνη παρουσία διαφορετικών συγκεντρώσεων ασκορβικού οξέος Συγκεντρώσεις Ασκορβικού οξέος 5 mm 10 mm 45 mm K m 34 µμ 47 µμ 59 µμ 92 µμ

43 Λειτουργικός χαρακτηρισµός της πρωτεΐνης LPE1 απότοκαλαµπόκι µε την έκφρασή της στον Aspergillus nidulans Η πρωτεΐνη LPE1 είναι ένας υψηλής συγγένειας, υψηλής µεταφορικής ικανότητας εξειδικευµένος µεταφορέας οξειδωµένων πουρινών (ξανθίνης και ουρικού οξέος) Είναι µεταφορέας δευτερογενούς ενεργότητας και λειτουργεί ως συµµεταφορέας πρωτονίων εσµεύει αλλά δεν µεταφέρει ασκορβικό οξύ Ηθέσηενσωµάτωσης, αριθµόςτωναντιγράφωνκαι τα επίπεδα έκφρασης του γονιδίου lpe1 καθορίζουν τη λειτουργική έκφραση της πρωτεΐνης LPE1

44 O Aspergillus nidulans εισάγεται ως πρότυπο σύστηµα έκφρασης ετερόλογων µεταφορέων νουκλεοτιδικών βάσεων Argyrou, Sophianopoulou, Shultes, Diallinas, Plant Cell 13, (2001)

45 ΝΑΤ ΜΕΤΑΦΟΡΕΙΣ ΣΤΟΝ ΑΝΘΡΩΠΟ (ΜΕΤΑΦΟΡΕΙΣ ΑΣΚΟΡΒΙΚΟΥ ΟΞΕΟΣ) hsvct1, hsvct2 (human Sodium-dependent Vitamin C Transporters) hsvct1(yslp3): νεφρός, έντερο, ήπαρ (Km=233,8 µμ) hsvct2 (YSLP2): στους περισσότερους από τους ιστούς που έχουν µελετηθεί (Km=22,6 µμ)

46 Γενετικός µετασχηµατισµός του στελέχους ACZ (uapa - uapc - azga - argb - ) µε κατάλληλο φορέα έκφρασης (pns335/svct2/argb) SstI uapa promoter NcoI XbaI uapa terminator SalI/XhoI KpnI 5 UapA 3 UapA ArgB SVCT2/SVCT1 NcoI / BamHI XbaI φορέας pns335/svct2/argb

47 Γενετικές και Λειτουργικές Μελέτες ACZ : hsvct2 - Μετασχηµατισµένων Στελεχών αµµωνία ουρικό οξύ WT S2 510 S5 Μετρήσεις Πρόσληψης 3 H ξανθίνης τα µετασχηµατισµένα στελέχη δεν µεταφέρουν ξανθίνη

48 Λειτουργική έκφραση του δεύτερου ανθρώπινου µεταφορέα ασκορβικού οξέος, hsvct1, στον A. nidulans απουσία ασκορβικού παρουσία ασκορβικού uapa uapa + W2 WT W1 W3

49 Μεταφορείς ασκορβικού οξέος ARGB 510 W2 W1 wt B - S3 -L-ασκορβικό οξύ + 0.5%L-ασκορβικό οξύ + 0.5%L- ασκορβικό οξύ, 100mΜ NaCl

50 o A. nidulans µπορεί να χρησιµοποιηθεί ως σύστηµα ετερόλογης έκφρασης και µελετών σχέσεων δοµής/λειτουργίας µεταφορέων ασκορβικού οξέος της οικογένειας ΝΑΤ από τα θηλαστικά

51 O Αspergillus nidulans καθιερώνεται ως πρότυπο σύστηµα για το λειτουργικό χαρακτηρισµόκαιτη µελέτη των σχέσεων δοµής λειτουργίας γονιδίων που κωδικοποιούν µεταφορείς της οικογένειας ΝΑΤ από ανώτερους οργανισµούς

52 ηµοσιεύσεις: Βιβλιογραφία: 1. G. Diallinas, J. Valdez, V. Sophianopoulou, A. Rosa and C. Scazzocchio, Chimeric purine transportersof Aspergillus nidulans define a domain critical for function and specificity conserved in bacteria, plant and metazoan homologues. EMBO J. 17 (14): E. Argyrou, V. Sophianopoulou, N. Schultes and G. Diallinas, Functional characterization of a maize purine transporter by expression in Aspergillus nidulans. Plant Cell 13 (4): G. Diallinas and V. Sophianopoulou, Nucleobase transporters as a novel tool in molecular pharmacology. Rev. Clin. Pharmacokinetics, International Edition 16: 33-35

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Η ανόργανη θρέψη των φυτών

Η ανόργανη θρέψη των φυτών Η ανόργανη θρέψη των φυτών Οργανικά θρεπτικά στοιχεία σάκχαρα που προέρχονται από τη διαδικασία της φωτοσύνθεσης με τις επακόλουθες μετατροπές Ανόργανα θρεπτικά στοιχεία προέρχονται από το έδαφος, με τη

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Ηδοµή των λιπαρών οξέων

Ηδοµή των λιπαρών οξέων Μεµβρανική Μεταφορά Ηδοµή των λιπαρών οξέων Λιπαρά οξέα-λιπίδια- µεµβράνες Κυτταρικές µεµβράνες: ρόλος διαχωριστικού τοίχους ιαφορετικές λειτουργίες της κυτταρικής µεµβράνης Ενδoκυτταρικές µεµβράνες

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ Αναστολή αντλίας πρωτονίων ΦΥΣΙΟΛΟΓΙΑ ΚΥΤΤΑΡΙΚΗΣ ΜΕΜΒΡΑΝΗΣ

ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ Αναστολή αντλίας πρωτονίων ΦΥΣΙΟΛΟΓΙΑ ΚΥΤΤΑΡΙΚΗΣ ΜΕΜΒΡΑΝΗΣ ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ Αναστολή αντλίας πρωτονίων ΦΥΣΙΟΛΟΓΙΑ ΚΥΤΤΑΡΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Περιγραφή της περίπτωσης Άνδρας 43 ετών εισάγεται σε κλινική λόγω επιγαστραλγίας. Μετά από έλεγχο ετέθη η διάγνωση του πεπτικού

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος

BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος Ετσι αρχισε η Ζωη? To δεντρο της Ζωης Και τι µας νοιαζει αν υπαρχουν µικροοργανισµοι η οχι? H ανυπολόγιστη αξία της Mικροβιολογίας για τη Βιολογια Το

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα. Μέρος A

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα. Μέρος A ΚΕΦΑΛΑΙΟ 11 Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα Μέρος A ΠΕΡΙ ΕΝΕΡΓΕΙΑΣ Α. Η λειτουργία απλών µηχανών εξαρτάται από ενέργεια: - κίνηση αυτοκινήτου= βενζίνη / πετρέλαιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς

ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς ΜΕΤΑΒΟΛIΣΜΟΣΠΟΥΡIΝIΚΩΝΚΑI ΠΥΡIΜI IΝIΚΩΝ ΠΑΡΑΓΩΓΩΝ Όπως θα αvαφερθεί σε επόµεvo κεφάλαιo, oι πoυριvικές και πυριµιδιvικές βάσεις και τα παράγωγά τoυς απoτελoύv δoµικές µovάδες τωv voυκλεϊvικώv oξέωv. Λόγω

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

DNA, οργάνωση και δομή του γενετικού υλικού

DNA, οργάνωση και δομή του γενετικού υλικού DNA, οργάνωση και δομή του γενετικού υλικού Κιούπη Βασιλική, εκπαιδευτικός κλ.πε04.04 Μια εκπαιδευτική δραστηριότητα βασισμένη σε εκθέματα του ιδρύματος Ευγενίδου Εισαγωγικός τομέας και προκαταρτική φάση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: ευτέρα, 23 Μαΐου 2011 07:30-10:30

Διαβάστε περισσότερα

Φυσιολογία των μικροοργανισμών. Κεφάλαιο 3 από το βιβλίο «Εισαγωγή στην Γενική Μικροβιολογία»

Φυσιολογία των μικροοργανισμών. Κεφάλαιο 3 από το βιβλίο «Εισαγωγή στην Γενική Μικροβιολογία» Φυσιολογία των μικροοργανισμών Κεφάλαιο 3 από το βιβλίο «Εισαγωγή στην Γενική Μικροβιολογία» BIOΛOΓIA TΩN MIKPOOPΓANIΣMΩN ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ 1. Μικροβιακή αύξηση (ή ανάπτυξη): αυξάνεται ο

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Ελεύθερες ρίζες και αντιοξειδωτικά

Ελεύθερες ρίζες και αντιοξειδωτικά Ελεύθερες ρίζες και αντιοξειδωτικά Κατά τη διάρκεια των φυσιολογικών ανθρώπινων διεργασιών παραγωγή ενέργειας, αποτοξίνωση από τοξικές ουσίες και ανοσολογική απόκριση, παράγονται από τον οργανισµό ελεύθερες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU)

Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU) Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU) μπορεί να ορισθεί ως μια σπάνια μεταβολική διαταραχή

Διαβάστε περισσότερα

Η υδρόλυση της ATP (σε ADP και μία φωσφορική ομάδα) απελευθερώνει ενέργεια που χρησιμοποιείται στις αναβολικές αντιδράσεις

Η υδρόλυση της ATP (σε ADP και μία φωσφορική ομάδα) απελευθερώνει ενέργεια που χρησιμοποιείται στις αναβολικές αντιδράσεις Κεφάλαιο 6 ΚΑΤΑΒΟΛΙΣΜΟΣ Αποικοδόμηση (διάσπαση) πολύπλοκων μορίων σε απλούστερες ενώσεις πχ στην κυτταρική αναπνοή η διάσπαση της γλυκόζης σε CO 2 και Η 2 Ο Η ενέργεια που απελευθερώνεται χρησιμοποιείται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα

Παραγωγή φαρμακευτικών πρωτεϊνών με βιοτεχνολογικές μεθόδους Μεταφορά γονιδίων σε ευκαρυωτικά κύτταρα (Γονιδιακή θεραπεία)

Παραγωγή φαρμακευτικών πρωτεϊνών με βιοτεχνολογικές μεθόδους Μεταφορά γονιδίων σε ευκαρυωτικά κύτταρα (Γονιδιακή θεραπεία) Παραγωγή φαρμακευτικών πρωτεϊνών με βιοτεχνολογικές μεθόδους Μεταφορά γονιδίων σε ευκαρυωτικά κύτταρα (Γονιδιακή θεραπεία) Παραγωγή ινσουλίνης από βακτήρια Παρελθόν: απομόνωση ινσουλίνης από πάνγκρεας

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ Α. Εισαγωγικά Στοιχεία Βιολογίας 1. DNA (Δεοξυριβονουκλεϊκό Οξύ) Φορέας γενετικής πληροφορίας Το DNA είναι ένα επίμηκες μόριο

Διαβάστε περισσότερα

Φ ΣΙ Σ Ο Ι Λ Ο Ο Λ Γ Ο Ι Γ Α

Φ ΣΙ Σ Ο Ι Λ Ο Ο Λ Γ Ο Ι Γ Α Δηµοκρίτειο Πανεπιστήµιο Θράκης Τµήµα Αγροτικής Ανάπτυξης Οξείδωση της γλυκόζης ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ «Καταβολισµός ή ανοµοίωση» C 6 H 12 O+6O 2 +6H 2 O 12H 2 O+6CO 2 +686 Kcal/mol Πηγές ενέργειας κατά την

Διαβάστε περισσότερα

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων ΑΝΑΚΟΙΝΩΣΗ Από το Τμήμα Ιατρικής ανακοινώνεται ότι για το ακαδημαϊκό έτος 2014-2015 στο Τμήμα Ιατρικής κατατάσσονται : Οι πτυχιούχου Πανεπιστημίου, Τ.Ε.Ι. ή ισοτίμων προς αυτά, Α.ΣΠΑΙ.Τ.Ε., της Ελλάδος

Διαβάστε περισσότερα

Βιολογικές μεμβράνες

Βιολογικές μεμβράνες Κυτταρική οργάνωση ΕΞΕΤΑΣΤΕΑ ΥΛΗ 4.1 ΕΙΣΑΓΩΓΗ ΣΤΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.2 ΔΟΜΗ ΤΟΥ ΤΥΠΙΚΟΥ ΕΥΚΑΡΥΩΤΙΚΟΥ ΚΥΤΤΑΡΟΥ (απλή αναφορά) 4.3 ΑΠΟ ΤΟ ΠΡΟΚΑΡΥΩΤΙΚΟ ΣΤΟ ΕΥΚΑΡΙΩΤΙΚΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.4 Η ΚΥΤΤΑΡΙΚΗ

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΛΙΠΗ. ΘΑΝΑΣΗΣ ΤΖΙΑΜΟΥΡΤΑΣ, Ph.D., C.S.C.

MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΛΙΠΗ. ΘΑΝΑΣΗΣ ΤΖΙΑΜΟΥΡΤΑΣ, Ph.D., C.S.C. MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΛΙΠΗ ΘΑΝΑΣΗΣ ΤΖΙΑΜΟΥΡΤΑΣ, Ph.D., C.S.C.S Τα λίπη αποτελούν μια συμπυκνωμένη πηγή ενέργειας Ενεργούν σαν διαλύτες

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ Σχολή Γεωτεχνικών Επιστημών και Διαχείρισης Περιβάλλοντος Τμήμα Γεωπονικών Επιστημών, Βιοτεχνολογίας και Επιστήμης Τροφίμων ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΜΑΣΤΕΡ (MSc) ΒΙΟΤΕΧΝΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΑΔΑ: Β4169-7ΨΥ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ

ΑΔΑ: Β4169-7ΨΥ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΑΔΑ: Β4169-7ΨΥ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΕΝΙΑΙΟΣ ΔΙΟΙΚΗΤΙΚΟΣ ΤΟΜΕΑΣ ΕΥΡΩΠΑΪΚΩΝ ΠΟΡΩΝ ΕΙΔΙΚΗ ΥΠΗΡΕΣΙΑ ΔΙΑΧΕΙΡΙΣΗΣ Ε.Π. "ΕΚΠΑΙΔΕΥΣΗ & ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗ" Ταχ.

Διαβάστε περισσότερα

Χαλκός Cu. Στοιχείο µετάπτωσης, µέταλλο. Στο κυτταρικό περιβάλλον βρίσκεται σε δύο µορφές οξείδωσης. Cu + ανηγµένος χαλκός. Cu 2+ οξειδωµένος χαλκός

Χαλκός Cu. Στοιχείο µετάπτωσης, µέταλλο. Στο κυτταρικό περιβάλλον βρίσκεται σε δύο µορφές οξείδωσης. Cu + ανηγµένος χαλκός. Cu 2+ οξειδωµένος χαλκός Χαλκός Cu Στοιχείο µετάπτωσης, µέταλλο Στο κυτταρικό περιβάλλον βρίσκεται σε δύο µορφές οξείδωσης Cu + ανηγµένος χαλκός Cu 2+ οξειδωµένος χαλκός Είναι µαλακό οξύ προτιµά να προσαρτάται σε µαλακούς υποκαταστάτες

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια

Τεχνικές διεργασίες. Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια Τεχνικές διεργασίες Βιομάζα Βιομόρια Οργ. μόρια Ανοργ. μόρια ΓΕΩΡΓΙΑ Γενετική βελτίωση ποικιλιών φυτών για αντοχή στις ασθένειες, ξηρασία, αφιλόξενα εδάφη Μαζική παραγωγή κλώνων Ανάπτυξη βιο-εντομοκτόνων

Διαβάστε περισσότερα

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Με ποια πειράµατα οι επιστήµονες κατέληξαν στο συµπέρασµα ότι το DNA είναι το γενετικό υλικό του κυττάρου. Ποιες οι διαφορές

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 3. Τι γνωρίζετε για τον πυρήνα του ευκαρυωτικού κυττάρου;

ΒΙΟΛΟΓΙΑ. 3. Τι γνωρίζετε για τον πυρήνα του ευκαρυωτικού κυττάρου; ΒΙΟΛΟΓΙΑ 1,Να αντιστοιχίσετε της όρους της αριστερής στήλης με τις προτάσεις της δεξιάς στήλης: α. κυτταρική μεμβράνη 1. πολλαπλασιάζονται με εκβλάστηση β. αμοιβάδα 2.κέντρα παραγωγής ενέργειας γ. μιτοχόνδρια

Διαβάστε περισσότερα

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 2010 2 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡΙΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ Η κυτταρική ή πλασματική μεμβράνη αποτελεί το εξωτερικό όριο του κυττάρου από το περιβάλλον και περικλείει

Διαβάστε περισσότερα

ΟΙ ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ ΚΑΙ Η ΡΥΘΜΙΣΗ ΤΟΥ ΑΣΒΕΣΤΙΟΥ

ΟΙ ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ ΚΑΙ Η ΡΥΘΜΙΣΗ ΤΟΥ ΑΣΒΕΣΤΙΟΥ ΟΙ ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ ΚΑΙ Η ΡΥΘΜΙΣΗ ΤΟΥ ΑΣΒΕΣΤΙΟΥ ΔΗΜΗΤΡΗΣ Ε. ΚΟΥΤΣΟΝΙΚΟΛΑΣ ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΦΥΣΙΟΛΟΓΙΑΣ(ΧΕΙΡΟΥΡΓΟΣ ΠΑΙΔΩΝ) ΙΑΤΡΙΚΗ ΣΧΟΛΗ Α.Π.Θ ΟΙ ΠΑΡΑΘΥΡΕΟΕΙΔΕΙΣ ΑΔΕΝΕΣ ΑΝΑΤΟΜΙΚΑ ΚΑΙ ΙΣΤΟΛΟΓΙΚΑ

Διαβάστε περισσότερα

Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο 2006 2007 a 1 η Εξέταση στην Βιοχημεία. Ονοματεπώνυμο : Τυπικό εξάμηνο : Αριθμός Μητρώου :

Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο 2006 2007 a 1 η Εξέταση στην Βιοχημεία. Ονοματεπώνυμο : Τυπικό εξάμηνο : Αριθμός Μητρώου : Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο 2006 2007 a 1 η Εξέταση στην Βιοχημεία Ονοματεπώνυμο : Τυπικό εξάμηνο : Αριθμός Μητρώου : 1. Στο παρακάτω διάγραμμα του κύκλου του Krebs να σημειωθούν

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΛΕΙΤΟΥΡΓΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΥΨΗΛΗΣ ΑΝΑΛΥΣΗΣ ΟΡΓΑΝΙΣΜΩΝ ΜΟΝΤΕΛΩΝ in vivo Δρ. Γεώργιος Μαρκόπουλος, Ph.D. Βιολόγος, Μεταδιδακτορικός Ερευνητής και Ευάγγελος Κωλέττας,

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΩΔΕΚΑ (12) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων

Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων Πανεπιστημιο Κυπρου Τμημα Βιολογικων Επιστημων Σημειωσεις μαθηματος ΒΙΟ101 Ιωάννης Κυρμιτζόγλου Αν. Καθ. Λεόντιος Κωστρίκης Λευκωσια, 2007-2008 Ε Ι Σ Α Γ Ω Γ Η Σ Τ Ι Σ Σ Υ Γ Χ Ρ Ο Ν Ε Σ Β Ι Ο Λ Ο Γ Ι Κ

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα