ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ"

Transcript

1 ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ Β. Σοφιανοπούλου Ινστιτούτο Βιολογίας, ΕΚΕΦΕ

2 ιαµεµβρανικές πρωτεΐνες υπεύθυνες για την κυτταρική επικοινωνία µέσω της εξειδικευµένης και ελεγχόµενης µεταφοράς µεταβολιτών (σάκχαρα, αµινοξέα, πεπτίδια, νουκλεοσίδια, νουκλεοτιδικές βάσεις, αζωτούχες ενώσεις, βιταµίνες, ιόντα, ορµόνες, νευροδιαβιβαστές κλπ) Μηχανισµούς αναγνώρισης και πρόσδεσης µεταβολιτών παρόµοιους µε αυτoύς των ενζύµων

3 ΙΑΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΙΝΕΣ 1. ΚΑΝΑΛΙΑ 2. ΠΡΩΤΕΙΝΕΣ ΜΕΤΑΦΟΡΕΙΣ (Saier, 2000; Mol.Biol.Rev. 64: ) Κανάλια: κανάλια µε δευτεροταγείς δοµές α-έλικας κανάλια δευτεροταγείς δοµές β-βαρελιού (πορίνες) κανάλια τοξινών κανάλια πεπτιδίων

4 Πρωτεΐνες µεταφορείς: κατατάσσονται µε κριτήριο τις ενεργειακές τους απαιτήσεις παθητικοί και ενεργητικοί πρωτογενούς ενεργότητας δευτερογενούς ενεργότητας τροποποιητές υποστρώµατος (group translocators) συµµεταφορείς αντιµεταφορείς µονοµεταφορείς

5 Ρόλος των µεταφορέων στους ανώτερους οργανισµούς Ανακατανοµή ή/και ανακύκληση ενδογενών µεταβολιτών σε διάφορους ιστούς ο µεταφερόµενος µεταβολίτης µπορεί να χρησιµεύει ως µοριακό σήµα, νευροδιαβιβαστής, µόριο άµυνας ή ορµόνη Αποµάκρυνση τοξικών µεταβολιτών και ξενοβιοτιοτικών φαρµάκων Γενετικές ασθένειες οφείλονται στη µη φυσιολογική δοµή ή λειτουργία πρωτεϊνικών µεταφορέων (κυστική ίνωση, γενική ή συγγενής µυοτονία, υπερκαλαµική περιοδική παράλυση, κληρονοµική δρεπανοκυττάρωση, δυσαπορρόφηση γλυκόζης, κυστινουρία και καλοήθη ή επιθετικά χολοστατικά σύνδροµα)

6 Βιολογικά συστήµατα µελέτης διαµεµβρανικών µεταφορέων 1. Saccharomyces cerevisiae 2. ωοκύτταρα Χenopus 3. in vitro συστήµατα (καλλιέργειες κυττάρων από έντοµα ή τον άνθρωπο) 4. Αspergillus nidulans?

7 Aspergillus nidulans µη παθογόνος ευκαρυωτικός µικροοργανισµός πρότυπο σύστηµα µελέτης πολλαπλών κυτταρικών λειτουργιών µικρός χρόνος ανάπτυξης σε απλά και φθηνά θρεπτικά µέσα σχετικά υψηλή αποδοτικότητα µετασχηµατισµού και δυνατότητα αποµόνωσης σταθερά µετασχηµατισµένων στελεχών, διαθεσιµότητα µεγάλου αριθµού µεταλλαγµένων στελεχών γνωστή και διαθέσιµη η αλληλουχία γονιδιώµατος (2.7χ10 7 bp) φυλετικό, αγενή και παραφυλετικό κύκλο ανάπτυξης ευκολία µελέτης συγκεκριµένων µεταφορέων µε απλές δοκιµασίες ανάπτυξης και µετρήσεις πρόσληψης ραδιοσηµασµένων µεταβολιτών σε καθορισµένο γενετικό υπόβαθρο

8 ATP de novo GTP AMP IMP XMP GMP αδενίνη υποξανθίνη ξανθίνη γουανίνη ουρικό οξύ αλλαντοΐνη αλλαντοϊκό οξύ ουρεΐδογλυκίνη γλυοξυλική ουρία ουρία αµµωνία

9 Η µελέτη των µεταφορέων νουκλεοτιδικών βάσεων είναι πρωταρχικής φυσιολογικής, κλινικής, φαρµακολογικής και αγροτικής σπουδαιότητας

10 Οικογένειες Μεταφορέων Νουκλεοτιδικών Βάσεων ΝΑΤ (Νucleobase Ascorbate Transporters): αρχαιοβακτήρια, ευβακτήρια, ευκάρυα (µύκητες, έντοµα, φυτά, θηλαστικά) PbuX, UraA, PyrP, UapA, UapC, hsvct1, hsvct2 ΕΝΤ (Εquilibrative Nucleoside Transporters): θηλαστικά, πρωτόζωα hεντ1-3, rent1-3 PRΤ (Purine Related Transporters): αρχαιοβακτήρια, ευβακτήρια, µύκητες CodB, FUR4, FCY2 PUP (PUrine Permeases): φυτά AtPUP1 - AtPUP15 UPS (Ureide Permeases): φυτά AtUPS1 AtUPS5

11 Μεταφορείς νουκλεοτιδικών βάσεων της οικογένειας ΝΑΤ µεταφορείς δευτερογενούς ενεργότητας συντηρηµένη περιοχή 12 αµινοξέων, αλληλουχία υπογραφής >21% ταυτότητα, > 40% οµοιότητα αµινοξικής αλληλουχίας

12 Γιατί ο Aspergillus nidulans??? Στους περισσότερους µικροοργανισµούς η πρόσληψη πουρινών και πυριµιδινών εξυπηρετεί δύο κύριες λειτουργίες: τη βιοσύνθεση νουκλεοτιδίων και νουκλεικών οξέων τη χρήση κυρίως των πουρινών ως πηγές αζώτου µετονκαταβολισµότουςσε ουρία και αµµωνία S. cerevisiae: έχει χάσει την ικανότητά του να καταβολίζει πουρίνες. Αυτό το γεγονός αντανακλάται στην εξέλιξη των συστηµάτων πρόσληψης νουκλεοτιδικών βάσεων του µύκητα, που περιλαµβάνουν µεταφορείς ειδικούς για την πρόσληψη πουρινών και πυριµιδινών που ανακυκλώνονται κατά τη βιοσύνθεση νουκλεικών οξέων ενώ δεν διαθέτουν µεταφορείς οξειδωµένων πουρινών, ουρικού οξέος και ξανθίνης που µπορούν να χρησιµοποιηθούν ως πηγές αζώτου 1. Ικανότητα χρήσης ευρέος φάσµατος νουκλεοτιδικών βάσεων ως µοναδικές πηγές αζώτου (ουρικό οξύ, ξανθίνη, αδενίνη, γουανίνη, υποξανθίνη) 2. Καλά µελετηµένο σύστηµα µεταφοράς πουρινών

13

14 Μεταφορείς πουρινών του Aspergillus nidulans UapA: υψηλής συγγένειας, υψηλής µεταφορικής ικανότητας υπεύθυνος για τη µεταφορά των οξειδωµένων πουρινών (ουρικό οξύ και ξανθίνη) UapC: υψηλής συγγένειας, µέσης/χαµηλής µεταφορικής ικανότητας γενικός µεταφορέας πουρινών και αναλόγων τους ΑzgA: υψηλής συγγένειας, υψηλής µεταφορικής ικανότητας µεταφορέας αδενίνης, γουανίνης και υποξανθίνης UapA και UapC: 62% ταύτιση αµινοξικής αλληλουχίας

15

16

17

18

19

20

21

22

23 ΝΑΤ ΜΕΤΑΦΟΡΕΙΣ ΣΤΑ ΦΥΤΑ 13 φυτικά γονίδια 1 παράλογο από το ice plant (Mesembryanthenum crystallium) 11 παράλογα από την Arabidopsis 30 EST κλώνοι (ρύζι, ντοµάτα, σόγια κλπ) LPE1 (Leaf permease1) από το καλαµπόκι

24 LPE1 πρωτεΐνη Χαρακτηριστικά των µελών της οικογένειας ΝΑΤ 487 αµινοξέα, ΜW 53.2 kd 25% ταυτότητα µε τοµεταφορέα UapA, πιθανά διαµεµβρανικά τµήµατα Όχι αλληλουχίες πρόσδεσης στο DNA Όχι σηµατοδοτικές αλληλουχίες για στόχευση σε ενδοκυτταρικές δοµές (µιτοχόνδρια, χλωροπλάστες) αλληλουχία υπογραφής ανενεργοποίηση του γονιδίου lpe1 προκαλεί δοµικές αλλαγές στους χλωροπλάστες τον κατ εξοχήν τόπο βιοσύνθεσης των πουρινών

25 Ενδείξεις ότι η πρωτεΐνη LPE1 συµµετέχει σε µονοπάτια διακίνησης των νουκλεοτιδικών βάσεων διαµέσου µεµβρανών Η µελέτη των µηχανισµών και των συστηµάτων µεταφοράς νουκλεοτιδικών βάσεων δεν είναι εύκολο να πραγµατοποιηθεί σε φυτικά κύτταρα: ο χειρισµός τους σε εργαστηριακές συνθήκες είναι σύνθετος και η παρουσία στα φυτικά κύτταρα πολλαπλών µεταφορέων ΝΑΤ ή PUT οδηγεί σε αυξηµένη πιθανότητα παρουσίας αλληλο-επικαλυπτόµενων εξειδικεύσεων στα διαφορετικά συστήµατα µεταφοράς Το γονίδιο lpe1 παρουσιάζει παρόµοια περιεκτικότητα σε GC µε το γονίδιο uapa Λειτουργική έκφραση της φυτικής πρωτεΐνης στον ασκοµύκητα (βιοχηµική και φυσιολογική λειτουργία)

26 Γενετικός µετασχηµατισµός του στελέχους ACZ (uapa - uapc - azga - argb-) µε κατάλληλο φορέα έκφρασης (pan-lpe1) SstI uapa promoter NcoI XbaI uapa terminator SalI/XhoI KpnI Φορέας έκφρασης pan-lpe1 5 και 3 ρυθµιστικές περιοχές του γονιδίου uapa το γονίδιο argb που κωδικοποιεί το ένζυµο ornithine carbamoyl transferase που εµπλέκεται στο µονοπάτι βιοσύνθεσης της αργινίνης cdna lpe1 κλώνο 1.6kb 5 UapA 3 UapA ArgB LPE1 NcoI-BamHI XbaI CCATGGATCCCGTGAAGGCCGAG//AGGTACTTCCCCTCGCTCTAGTCTAGA Fusion protein M D P V K A E //R Y F P S L * LPE1 M P P V K A E //R Y F P S L * ACZ: αυξότροφο για την αργινίνη πλήρη απώλεια λειτουργίας των ενδογενών µεταφορέων πουρινών µη ανάπτυξη σε ΜΜ παρουσία διαφορετικών πουρινών ως µοναδικές πηγές αζώτου

27 γενετικός µετασχηµατισµός στελέχους - δέκτη uapa uapc azga argb εκφράζει µη λειτουργικούς τους ενδογενείς µεταφορείς πουρινών και το ένζυµο ArgB του µονοπατιού βιοσύνθεσης της αργινίνης + κυκλικός φορέας έκφρασης αποµόνωση µετασχηµατισµένων στελεχών σε ελάχιστο θρεπτικό υλικό απουσία αργινίνης

28 Γενετικές µελέτες µετασχηµατισµένων στελεχών ACZ:pAN-Lpe1 urea NH 4 + Τα µετασχηµατισµένα µε τις φυτικές αλληλουχίες στελέχη αναπτύσσονται µε διαφορετικό ρυθµό σεουρικόοξύκαι ξανθίνη αλλά όχι παρουσία υποξανθίνης, αδενίνης ή γουανιδίνης ως µοναδικές πηγές αζώτου proline uric acid Τα στελέχη LP2 και LP5 αναπτύσσονται έχοντας συµπαγή µορφολογία ανάλογη του στελέχους φυσικού τύπου και του στελέχους που εκφράζει το µεταφορέα UapA TαστελέχηLP4 και LP6 δεν έχουν συµπαγή µορφολογία και παρουσιάζουν µειωµένο ρυθµό ανάπτυξης και σε πηγές αζώτου διαφορετικές των πουρινών uapa - uapa + LP5 LP6 LP2 LP4

29 Μοριακή Ανάλυση lpe1- Μετασχηµατισµένων Στελεχών ανάλυση κατά Southern uapa uapa+ LP2 LP5 LP4 LP6 lpe1

30 Μοριακή Ανάλυση lpe1- Μετασχηµατισµένων Στελεχών ανάλυση κατά Southern uapa uapa+ LP2 LP5 lpe1 αριθµός αντιγράφων γονιδίου lpe1 ανάλυση κατά Northern lpe1 επίπεδα έκφρασης γονιδίου lpe1 acn

31 η ικανότητα ανάπτυξης των lpe1-µετασχηµατισµένων στελεχών σε ουρικό οξύ ή ξανθίνη οφείλεται στην ενσωµάτωση των φυτικών αλληλουχιών στο γονιδίωµα τουµύκητα και την έκφρασή τους ο ρυθµός ανάπτυξης εξαρτάται από τη θέση ενσωµάτωσης των φυτικών αλληλουχιών και τον αριθµό των αντιγράφων τους, ο οποίος καθορίζει τα επίπεδα έκφρασης της αλληλουχίας lpe1

32 Αυτογονιµοποίηση-Selfing Κατά τη διάρκεια του φυλετικού κύκλου ανάπτυξης του µύκητα (µειώσεις) όταν υπάρχουν πολλαπλά αντίγραφα πλασµιδιακής αλληλουχίας ενσωµατωµένα στο γονιδίωµάτου, ευνοείται οµόλογος ανασυνδυασµός µεταξύ των αντιγράφων αυτών, που συχνά οδηγεί σε άνιση ανακατανοµή τουαριθµού τους σε µερικούς απογόνους που προέρχονται από διαφορετικά ασκοσπόρια Αποµόνωση απογόνων είτε µε µειωµένο είτε µε αυξηµένο αριθµό αντιγράφων µιας αλληλουχίας LP2 X LP2

33 Γενετικές µελέτες απόγονων στελεχών LP2, µετά από αυτογονιµοποίηση (selfing) uapa - uapa + LP5 LP2 LP2-S2 LP2-S1 LP2-S0 ουρία Ουρικό οξύ ξανθίνη

34 Ανάλυση κατά Southern Lpe1 (~9 kb) uapa - uapa + LP2 LP5 LP2-S0 LP2-S1 LP2-S2

35 Ανάλυση κατά Northern Lpe1 acn uapa + uapa - LP2 LP5 LP2-S0 LP2-S1 LP2-S2

36 τα επίπεδα έκφρασης της αλληλουχίας lpe1, που είναι ευθέως ανάλογα του αριθµού των ενσωµατωµένων πλασµιδιακών αντιγράφων, καθορίζουν την ικανότητα ανάπτυξης σε ουρικό οξύ ή ξανθίνη

37 Βιοχηµικά Χαρακτηριστικά Μεταφορέα LPΕ1 ρυθµός πρόσληψης ξανθίνης ρυθµός πρόσληψης ξανθίνης (pmol min κονίδια) 0,3 0,2 0, συγκέντρωση υποστρώµατος (µμ) K m = 30 µμ ±2.5µΜ 1/[V] (1/pmol min κονιδιοσπόρια) Γράφηµα Lineweaver-Burk y = 141,83x + 4, ,2 0,4 0,6 0,8 1 1,2 1/[S] (1/µΜ) V max = 0.22 pmol min κονιδιοσπόρια

38 ο Μεταφορέας LPE1 Είναι ευτερογενούς Ενεργότητας επίδραση ενώσεων που διαταράσσουν την ηλεκτροχηµική προωθητική δύναµητηςµεµβράνης στην πρόσληψη ξανθίνης από το µεταφορέα LPE1 LPE1 UapA % πρόσληψη 3 Η -ξανθίνης απουσία αναστολέα DCCD CCCP

39 % πρόσληψης 3 Η-ξανθίνης Προσδιορισµός της Ειδίκευσης της πρωτεΐνης LPE1 1. Πειράµατα ανταγωνισµού πρόσληψης 10µΜ 3 Η-ξανθίνης παρουσία 300µΜ µηραδιοσηµασµένου ανταγωνιστή UapA LPE1 0 καφεΐνη ουρακίλη κυτοσίνη θυµίνη γουανίνη αδενίνη υποξανθίνη ουρικό οξύ ξανθίνη

40 % πρόσληψης 3 Η-ξανθίνης 2. Πειράµατα ανταγωνισµού πρόσληψης 10µΜ 3 Η-ξανθίνης παρουσία διαφορετικών συγκεντρώσεων ασκορβικού οξέος 100 UapA LPE mM 90mM 75mM 45mM 10mM 5mM 0.3mM 35mM 22.5mM 20mM L-ασκορβικό οξύ 0.3mΜ ξανθίνη

41 το Ασκορβικό Οξύ Προσδένεται Εξειδικευµένα στο Μεταφορέα LPE LP2 % πρόσληψης 3 H-προλίνης 0 10 mm 5 mm 0.3 mm προλίνη 20 mm 35 mm 45 mm L-ασκορβικό οξύ

42 3. Ανταγωνιστική αναστολή (competitive ihhibition) της πρόσληψηςξανθίνηςαπότοασκορβικόοξύ Τιµές K m συγγένειας του µεταφορέα LPE1 για τη ξανθίνη παρουσία διαφορετικών συγκεντρώσεων ασκορβικού οξέος Συγκεντρώσεις Ασκορβικού οξέος 5 mm 10 mm 45 mm K m 34 µμ 47 µμ 59 µμ 92 µμ

43 Λειτουργικός χαρακτηρισµός της πρωτεΐνης LPE1 απότοκαλαµπόκι µε την έκφρασή της στον Aspergillus nidulans Η πρωτεΐνη LPE1 είναι ένας υψηλής συγγένειας, υψηλής µεταφορικής ικανότητας εξειδικευµένος µεταφορέας οξειδωµένων πουρινών (ξανθίνης και ουρικού οξέος) Είναι µεταφορέας δευτερογενούς ενεργότητας και λειτουργεί ως συµµεταφορέας πρωτονίων εσµεύει αλλά δεν µεταφέρει ασκορβικό οξύ Ηθέσηενσωµάτωσης, αριθµόςτωναντιγράφωνκαι τα επίπεδα έκφρασης του γονιδίου lpe1 καθορίζουν τη λειτουργική έκφραση της πρωτεΐνης LPE1

44 O Aspergillus nidulans εισάγεται ως πρότυπο σύστηµα έκφρασης ετερόλογων µεταφορέων νουκλεοτιδικών βάσεων Argyrou, Sophianopoulou, Shultes, Diallinas, Plant Cell 13, (2001)

45 ΝΑΤ ΜΕΤΑΦΟΡΕΙΣ ΣΤΟΝ ΑΝΘΡΩΠΟ (ΜΕΤΑΦΟΡΕΙΣ ΑΣΚΟΡΒΙΚΟΥ ΟΞΕΟΣ) hsvct1, hsvct2 (human Sodium-dependent Vitamin C Transporters) hsvct1(yslp3): νεφρός, έντερο, ήπαρ (Km=233,8 µμ) hsvct2 (YSLP2): στους περισσότερους από τους ιστούς που έχουν µελετηθεί (Km=22,6 µμ)

46 Γενετικός µετασχηµατισµός του στελέχους ACZ (uapa - uapc - azga - argb - ) µε κατάλληλο φορέα έκφρασης (pns335/svct2/argb) SstI uapa promoter NcoI XbaI uapa terminator SalI/XhoI KpnI 5 UapA 3 UapA ArgB SVCT2/SVCT1 NcoI / BamHI XbaI φορέας pns335/svct2/argb

47 Γενετικές και Λειτουργικές Μελέτες ACZ : hsvct2 - Μετασχηµατισµένων Στελεχών αµµωνία ουρικό οξύ WT S2 510 S5 Μετρήσεις Πρόσληψης 3 H ξανθίνης τα µετασχηµατισµένα στελέχη δεν µεταφέρουν ξανθίνη

48 Λειτουργική έκφραση του δεύτερου ανθρώπινου µεταφορέα ασκορβικού οξέος, hsvct1, στον A. nidulans απουσία ασκορβικού παρουσία ασκορβικού uapa uapa + W2 WT W1 W3

49 Μεταφορείς ασκορβικού οξέος ARGB 510 W2 W1 wt B - S3 -L-ασκορβικό οξύ + 0.5%L-ασκορβικό οξύ + 0.5%L- ασκορβικό οξύ, 100mΜ NaCl

50 o A. nidulans µπορεί να χρησιµοποιηθεί ως σύστηµα ετερόλογης έκφρασης και µελετών σχέσεων δοµής/λειτουργίας µεταφορέων ασκορβικού οξέος της οικογένειας ΝΑΤ από τα θηλαστικά

51 O Αspergillus nidulans καθιερώνεται ως πρότυπο σύστηµα για το λειτουργικό χαρακτηρισµόκαιτη µελέτη των σχέσεων δοµής λειτουργίας γονιδίων που κωδικοποιούν µεταφορείς της οικογένειας ΝΑΤ από ανώτερους οργανισµούς

52 ηµοσιεύσεις: Βιβλιογραφία: 1. G. Diallinas, J. Valdez, V. Sophianopoulou, A. Rosa and C. Scazzocchio, Chimeric purine transportersof Aspergillus nidulans define a domain critical for function and specificity conserved in bacteria, plant and metazoan homologues. EMBO J. 17 (14): E. Argyrou, V. Sophianopoulou, N. Schultes and G. Diallinas, Functional characterization of a maize purine transporter by expression in Aspergillus nidulans. Plant Cell 13 (4): G. Diallinas and V. Sophianopoulou, Nucleobase transporters as a novel tool in molecular pharmacology. Rev. Clin. Pharmacokinetics, International Edition 16: 33-35

ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ

ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ ΤΟ ΠΑΡΑ ΕΙΓΜΑ ΤΗΣ ΧΡΗΣΗΣ ΜΥΚΗΤΩΝ ΣΤΗΝ ΚΛΩΝΟΠΟΙΗΣΗ ΚΑΙ ΙΕΡΕΥΝΗΣΗ ΤΟΥ ΡΟΛΟΥ ΓΟΝΙ ΙΩΝ ΑΠΟ ΑΝΩΤΕΡΑ ΦΥΤΑ ΚΑΙ ΤΟΝ ΑΝΘΡΩΠΟ Β. Σοφιανοπούλου Ινστιτούτο Βιολογίας, ΕΚΕΦΕ Βιολογικά συστήµατα µελέτης διαµεµβρανικών

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) 1 ΔΗΜΙΟΥΡΓΙΑ ΦΥΤΩΝ ΜΕ ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ 19 Παράγοντες που συμβάλλουν σε αύξηση των εντόμων 1. Μονοκαλλιέργειες 2. Βελτίωση με κριτήριο αποκλειστικά την

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Η ανόργανη θρέψη των φυτών

Η ανόργανη θρέψη των φυτών Η ανόργανη θρέψη των φυτών Οργανικά θρεπτικά στοιχεία σάκχαρα που προέρχονται από τη διαδικασία της φωτοσύνθεσης με τις επακόλουθες μετατροπές Ανόργανα θρεπτικά στοιχεία προέρχονται από το έδαφος, με τη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

Ηδοµή των λιπαρών οξέων

Ηδοµή των λιπαρών οξέων Μεµβρανική Μεταφορά Ηδοµή των λιπαρών οξέων Λιπαρά οξέα-λιπίδια- µεµβράνες Κυτταρικές µεµβράνες: ρόλος διαχωριστικού τοίχους ιαφορετικές λειτουργίες της κυτταρικής µεµβράνης Ενδoκυτταρικές µεµβράνες

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 8 Ο ΚΕΦΑΛΑΙΟ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ 5ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΙΛΙΟΥ 1 8. Εφαρμογές της Βιοτεχνολογίας στην Ιατρική Φαρμακευτικές πρωτεΐνες Τι είναι οι φαρμακευτικές

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

Στρατηγικές αντιµετώπισης αντίξοων περιβαλλοντικών (αβιοτικών) παραγόντων από τους φωτοσυνθετικούς οργανισµούς

Στρατηγικές αντιµετώπισης αντίξοων περιβαλλοντικών (αβιοτικών) παραγόντων από τους φωτοσυνθετικούς οργανισµούς Στρατηγικές αντιµετώπισης αντίξοων περιβαλλοντικών (αβιοτικών) παραγόντων από τους φωτοσυνθετικούς οργανισµούς ρ. Κ. Σταµατάκης, Εργαστήριο Βιοφυσικής και Βιοτεχνολογίας Μεµβρανών, Ινστιτούτο Βιολογίας,

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ Αναστολή αντλίας πρωτονίων ΦΥΣΙΟΛΟΓΙΑ ΚΥΤΤΑΡΙΚΗΣ ΜΕΜΒΡΑΝΗΣ

ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ Αναστολή αντλίας πρωτονίων ΦΥΣΙΟΛΟΓΙΑ ΚΥΤΤΑΡΙΚΗΣ ΜΕΜΒΡΑΝΗΣ ΚΛΙΝΙΚΗ ΠΕΡΙΠΤΩΣΗ Αναστολή αντλίας πρωτονίων ΦΥΣΙΟΛΟΓΙΑ ΚΥΤΤΑΡΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Περιγραφή της περίπτωσης Άνδρας 43 ετών εισάγεται σε κλινική λόγω επιγαστραλγίας. Μετά από έλεγχο ετέθη η διάγνωση του πεπτικού

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος

BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος BIO111 Μικροβιολογια ιαλεξη 13 Μικροβια και Ανθρωπος Ετσι αρχισε η Ζωη? To δεντρο της Ζωης Και τι µας νοιαζει αν υπαρχουν µικροοργανισµοι η οχι? H ανυπολόγιστη αξία της Mικροβιολογίας για τη Βιολογια Το

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΓΙΑ ΤΑ ΤΜΗΜΑΤΑ ΠΓΘΤ, ΓΘΤ, ΠαΘΤ Θέμα Α Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω

Διαβάστε περισσότερα

AMINEMAX και ΤΡΟΠΟΣ ΠΑΡΑΣΚΕΥΗΣ

AMINEMAX και ΤΡΟΠΟΣ ΠΑΡΑΣΚΕΥΗΣ AMINEMAX και ΤΡΟΠΟΣ ΠΑΡΑΣΚΕΥΗΣ Το AMINΕMAX παραλαμβάνεται από κανονική ενζυματική υδρόλυση με πρώτες ύλες από σπόρους σιτηρών και καλαμποκιού σε ισορροπία με μείγμα από ειδικά ένζυμα ( Έξω πρωτει πρωτεΐνάσες-

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΜΕΤΑΒΟΛΙΣΜΟΣ ΑΝΘΡΑΚΙΚΟΥ ΣΚΕΛΕΤΟΥ ΑΜΙΝΟΞΕΩΝ

ΜΕΤΑΒΟΛΙΣΜΟΣ ΑΝΘΡΑΚΙΚΟΥ ΣΚΕΛΕΤΟΥ ΑΜΙΝΟΞΕΩΝ ΜΕΤΑΒΟΛΙΣΜΟΣ ΑΝΘΡΑΚΙΚΟΥ ΣΚΕΛΕΤΟΥ ΑΜΙΝΟΞΕΩΝ Ανασκόπηση μεταβολισμού πρωτεϊνών & αμινοξέων Ιστοί ΤΡΟΦΗ Αλανίνη & Γλουταμίνη Αμινοξέα Κυκλοφορία Πρωτεΐνες Αμινοξέα Αποκαρβοξυλίωση Βιογενείς αμίνες (νευροδιαβιβαστές,

Διαβάστε περισσότερα

Το κύτταρο και ο κυτταρικός μεταβολισμός

Το κύτταρο και ο κυτταρικός μεταβολισμός Department of Chemical Το κύτταρο και ο κυτταρικός μεταβολισμός Αναπλ. Καθηγητής Δημοσθένης Σαρηγιάννης 1 Department of Chemical Κυτταρική αναπνοή Λαμβάνει χώρα σε τρία στάδια Γλυκόλυση, ένα μόριο γλυκόζης

Διαβάστε περισσότερα