Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:




2 ιαµεµβρανικές πρωτεΐνες υπεύθυνες για την κυτταρική επικοινωνία µέσω της εξειδικευµένης και ελεγχόµενης µεταφοράς µεταβολιτών (σάκχαρα, αµινοξέα, πεπτίδια, νουκλεοσίδια, νουκλεοτιδικές βάσεις, αζωτούχες ενώσεις, βιταµίνες, ιόντα, ορµόνες, νευροδιαβιβαστές κλπ) Μηχανισµούς αναγνώρισης και πρόσδεσης µεταβολιτών παρόµοιους µε αυτoύς των ενζύµων

3 ΙΑΜΕΜΒΡΑΝΙΚΕΣ ΠΡΩΤΕΙΝΕΣ 1. ΚΑΝΑΛΙΑ 2. ΠΡΩΤΕΙΝΕΣ ΜΕΤΑΦΟΡΕΙΣ (Saier, 2000; Mol.Biol.Rev. 64: ) Κανάλια: κανάλια µε δευτεροταγείς δοµές α-έλικας κανάλια δευτεροταγείς δοµές β-βαρελιού (πορίνες) κανάλια τοξινών κανάλια πεπτιδίων

4 Πρωτεΐνες µεταφορείς: κατατάσσονται µε κριτήριο τις ενεργειακές τους απαιτήσεις παθητικοί και ενεργητικοί πρωτογενούς ενεργότητας δευτερογενούς ενεργότητας τροποποιητές υποστρώµατος (group translocators) συµµεταφορείς αντιµεταφορείς µονοµεταφορείς

5 Ρόλος των µεταφορέων στους ανώτερους οργανισµούς Ανακατανοµή ή/και ανακύκληση ενδογενών µεταβολιτών σε διάφορους ιστούς ο µεταφερόµενος µεταβολίτης µπορεί να χρησιµεύει ως µοριακό σήµα, νευροδιαβιβαστής, µόριο άµυνας ή ορµόνη Αποµάκρυνση τοξικών µεταβολιτών και ξενοβιοτιοτικών φαρµάκων Γενετικές ασθένειες οφείλονται στη µη φυσιολογική δοµή ή λειτουργία πρωτεϊνικών µεταφορέων (κυστική ίνωση, γενική ή συγγενής µυοτονία, υπερκαλαµική περιοδική παράλυση, κληρονοµική δρεπανοκυττάρωση, δυσαπορρόφηση γλυκόζης, κυστινουρία και καλοήθη ή επιθετικά χολοστατικά σύνδροµα)

6 Βιολογικά συστήµατα µελέτης διαµεµβρανικών µεταφορέων 1. Saccharomyces cerevisiae 2. ωοκύτταρα Χenopus 3. in vitro συστήµατα (καλλιέργειες κυττάρων από έντοµα ή τον άνθρωπο) 4. Αspergillus nidulans?

7 Aspergillus nidulans µη παθογόνος ευκαρυωτικός µικροοργανισµός πρότυπο σύστηµα µελέτης πολλαπλών κυτταρικών λειτουργιών µικρός χρόνος ανάπτυξης σε απλά και φθηνά θρεπτικά µέσα σχετικά υψηλή αποδοτικότητα µετασχηµατισµού και δυνατότητα αποµόνωσης σταθερά µετασχηµατισµένων στελεχών, διαθεσιµότητα µεγάλου αριθµού µεταλλαγµένων στελεχών γνωστή και διαθέσιµη η αλληλουχία γονιδιώµατος (2.7χ10 7 bp) φυλετικό, αγενή και παραφυλετικό κύκλο ανάπτυξης ευκολία µελέτης συγκεκριµένων µεταφορέων µε απλές δοκιµασίες ανάπτυξης και µετρήσεις πρόσληψης ραδιοσηµασµένων µεταβολιτών σε καθορισµένο γενετικό υπόβαθρο

8 ATP de novo GTP AMP IMP XMP GMP αδενίνη υποξανθίνη ξανθίνη γουανίνη ουρικό οξύ αλλαντοΐνη αλλαντοϊκό οξύ ουρεΐδογλυκίνη γλυοξυλική ουρία ουρία αµµωνία

9 Η µελέτη των µεταφορέων νουκλεοτιδικών βάσεων είναι πρωταρχικής φυσιολογικής, κλινικής, φαρµακολογικής και αγροτικής σπουδαιότητας

10 Οικογένειες Μεταφορέων Νουκλεοτιδικών Βάσεων ΝΑΤ (Νucleobase Ascorbate Transporters): αρχαιοβακτήρια, ευβακτήρια, ευκάρυα (µύκητες, έντοµα, φυτά, θηλαστικά) PbuX, UraA, PyrP, UapA, UapC, hsvct1, hsvct2 ΕΝΤ (Εquilibrative Nucleoside Transporters): θηλαστικά, πρωτόζωα hεντ1-3, rent1-3 PRΤ (Purine Related Transporters): αρχαιοβακτήρια, ευβακτήρια, µύκητες CodB, FUR4, FCY2 PUP (PUrine Permeases): φυτά AtPUP1 - AtPUP15 UPS (Ureide Permeases): φυτά AtUPS1 AtUPS5

11 Μεταφορείς νουκλεοτιδικών βάσεων της οικογένειας ΝΑΤ µεταφορείς δευτερογενούς ενεργότητας συντηρηµένη περιοχή 12 αµινοξέων, αλληλουχία υπογραφής >21% ταυτότητα, > 40% οµοιότητα αµινοξικής αλληλουχίας

12 Γιατί ο Aspergillus nidulans??? Στους περισσότερους µικροοργανισµούς η πρόσληψη πουρινών και πυριµιδινών εξυπηρετεί δύο κύριες λειτουργίες: τη βιοσύνθεση νουκλεοτιδίων και νουκλεικών οξέων τη χρήση κυρίως των πουρινών ως πηγές αζώτου µετονκαταβολισµότουςσε ουρία και αµµωνία S. cerevisiae: έχει χάσει την ικανότητά του να καταβολίζει πουρίνες. Αυτό το γεγονός αντανακλάται στην εξέλιξη των συστηµάτων πρόσληψης νουκλεοτιδικών βάσεων του µύκητα, που περιλαµβάνουν µεταφορείς ειδικούς για την πρόσληψη πουρινών και πυριµιδινών που ανακυκλώνονται κατά τη βιοσύνθεση νουκλεικών οξέων ενώ δεν διαθέτουν µεταφορείς οξειδωµένων πουρινών, ουρικού οξέος και ξανθίνης που µπορούν να χρησιµοποιηθούν ως πηγές αζώτου 1. Ικανότητα χρήσης ευρέος φάσµατος νουκλεοτιδικών βάσεων ως µοναδικές πηγές αζώτου (ουρικό οξύ, ξανθίνη, αδενίνη, γουανίνη, υποξανθίνη) 2. Καλά µελετηµένο σύστηµα µεταφοράς πουρινών


14 Μεταφορείς πουρινών του Aspergillus nidulans UapA: υψηλής συγγένειας, υψηλής µεταφορικής ικανότητας υπεύθυνος για τη µεταφορά των οξειδωµένων πουρινών (ουρικό οξύ και ξανθίνη) UapC: υψηλής συγγένειας, µέσης/χαµηλής µεταφορικής ικανότητας γενικός µεταφορέας πουρινών και αναλόγων τους ΑzgA: υψηλής συγγένειας, υψηλής µεταφορικής ικανότητας µεταφορέας αδενίνης, γουανίνης και υποξανθίνης UapA και UapC: 62% ταύτιση αµινοξικής αλληλουχίας









23 ΝΑΤ ΜΕΤΑΦΟΡΕΙΣ ΣΤΑ ΦΥΤΑ 13 φυτικά γονίδια 1 παράλογο από το ice plant (Mesembryanthenum crystallium) 11 παράλογα από την Arabidopsis 30 EST κλώνοι (ρύζι, ντοµάτα, σόγια κλπ) LPE1 (Leaf permease1) από το καλαµπόκι

24 LPE1 πρωτεΐνη Χαρακτηριστικά των µελών της οικογένειας ΝΑΤ 487 αµινοξέα, ΜW 53.2 kd 25% ταυτότητα µε τοµεταφορέα UapA, πιθανά διαµεµβρανικά τµήµατα Όχι αλληλουχίες πρόσδεσης στο DNA Όχι σηµατοδοτικές αλληλουχίες για στόχευση σε ενδοκυτταρικές δοµές (µιτοχόνδρια, χλωροπλάστες) αλληλουχία υπογραφής ανενεργοποίηση του γονιδίου lpe1 προκαλεί δοµικές αλλαγές στους χλωροπλάστες τον κατ εξοχήν τόπο βιοσύνθεσης των πουρινών

25 Ενδείξεις ότι η πρωτεΐνη LPE1 συµµετέχει σε µονοπάτια διακίνησης των νουκλεοτιδικών βάσεων διαµέσου µεµβρανών Η µελέτη των µηχανισµών και των συστηµάτων µεταφοράς νουκλεοτιδικών βάσεων δεν είναι εύκολο να πραγµατοποιηθεί σε φυτικά κύτταρα: ο χειρισµός τους σε εργαστηριακές συνθήκες είναι σύνθετος και η παρουσία στα φυτικά κύτταρα πολλαπλών µεταφορέων ΝΑΤ ή PUT οδηγεί σε αυξηµένη πιθανότητα παρουσίας αλληλο-επικαλυπτόµενων εξειδικεύσεων στα διαφορετικά συστήµατα µεταφοράς Το γονίδιο lpe1 παρουσιάζει παρόµοια περιεκτικότητα σε GC µε το γονίδιο uapa Λειτουργική έκφραση της φυτικής πρωτεΐνης στον ασκοµύκητα (βιοχηµική και φυσιολογική λειτουργία)

26 Γενετικός µετασχηµατισµός του στελέχους ACZ (uapa - uapc - azga - argb-) µε κατάλληλο φορέα έκφρασης (pan-lpe1) SstI uapa promoter NcoI XbaI uapa terminator SalI/XhoI KpnI Φορέας έκφρασης pan-lpe1 5 και 3 ρυθµιστικές περιοχές του γονιδίου uapa το γονίδιο argb που κωδικοποιεί το ένζυµο ornithine carbamoyl transferase που εµπλέκεται στο µονοπάτι βιοσύνθεσης της αργινίνης cdna lpe1 κλώνο 1.6kb 5 UapA 3 UapA ArgB LPE1 NcoI-BamHI XbaI CCATGGATCCCGTGAAGGCCGAG//AGGTACTTCCCCTCGCTCTAGTCTAGA Fusion protein M D P V K A E //R Y F P S L * LPE1 M P P V K A E //R Y F P S L * ACZ: αυξότροφο για την αργινίνη πλήρη απώλεια λειτουργίας των ενδογενών µεταφορέων πουρινών µη ανάπτυξη σε ΜΜ παρουσία διαφορετικών πουρινών ως µοναδικές πηγές αζώτου

27 γενετικός µετασχηµατισµός στελέχους - δέκτη uapa uapc azga argb εκφράζει µη λειτουργικούς τους ενδογενείς µεταφορείς πουρινών και το ένζυµο ArgB του µονοπατιού βιοσύνθεσης της αργινίνης + κυκλικός φορέας έκφρασης αποµόνωση µετασχηµατισµένων στελεχών σε ελάχιστο θρεπτικό υλικό απουσία αργινίνης

28 Γενετικές µελέτες µετασχηµατισµένων στελεχών ACZ:pAN-Lpe1 urea NH 4 + Τα µετασχηµατισµένα µε τις φυτικές αλληλουχίες στελέχη αναπτύσσονται µε διαφορετικό ρυθµό σεουρικόοξύκαι ξανθίνη αλλά όχι παρουσία υποξανθίνης, αδενίνης ή γουανιδίνης ως µοναδικές πηγές αζώτου proline uric acid Τα στελέχη LP2 και LP5 αναπτύσσονται έχοντας συµπαγή µορφολογία ανάλογη του στελέχους φυσικού τύπου και του στελέχους που εκφράζει το µεταφορέα UapA TαστελέχηLP4 και LP6 δεν έχουν συµπαγή µορφολογία και παρουσιάζουν µειωµένο ρυθµό ανάπτυξης και σε πηγές αζώτου διαφορετικές των πουρινών uapa - uapa + LP5 LP6 LP2 LP4

29 Μοριακή Ανάλυση lpe1- Μετασχηµατισµένων Στελεχών ανάλυση κατά Southern uapa uapa+ LP2 LP5 LP4 LP6 lpe1

30 Μοριακή Ανάλυση lpe1- Μετασχηµατισµένων Στελεχών ανάλυση κατά Southern uapa uapa+ LP2 LP5 lpe1 αριθµός αντιγράφων γονιδίου lpe1 ανάλυση κατά Northern lpe1 επίπεδα έκφρασης γονιδίου lpe1 acn

31 η ικανότητα ανάπτυξης των lpe1-µετασχηµατισµένων στελεχών σε ουρικό οξύ ή ξανθίνη οφείλεται στην ενσωµάτωση των φυτικών αλληλουχιών στο γονιδίωµα τουµύκητα και την έκφρασή τους ο ρυθµός ανάπτυξης εξαρτάται από τη θέση ενσωµάτωσης των φυτικών αλληλουχιών και τον αριθµό των αντιγράφων τους, ο οποίος καθορίζει τα επίπεδα έκφρασης της αλληλουχίας lpe1

32 Αυτογονιµοποίηση-Selfing Κατά τη διάρκεια του φυλετικού κύκλου ανάπτυξης του µύκητα (µειώσεις) όταν υπάρχουν πολλαπλά αντίγραφα πλασµιδιακής αλληλουχίας ενσωµατωµένα στο γονιδίωµάτου, ευνοείται οµόλογος ανασυνδυασµός µεταξύ των αντιγράφων αυτών, που συχνά οδηγεί σε άνιση ανακατανοµή τουαριθµού τους σε µερικούς απογόνους που προέρχονται από διαφορετικά ασκοσπόρια Αποµόνωση απογόνων είτε µε µειωµένο είτε µε αυξηµένο αριθµό αντιγράφων µιας αλληλουχίας LP2 X LP2

33 Γενετικές µελέτες απόγονων στελεχών LP2, µετά από αυτογονιµοποίηση (selfing) uapa - uapa + LP5 LP2 LP2-S2 LP2-S1 LP2-S0 ουρία Ουρικό οξύ ξανθίνη

34 Ανάλυση κατά Southern Lpe1 (~9 kb) uapa - uapa + LP2 LP5 LP2-S0 LP2-S1 LP2-S2

35 Ανάλυση κατά Northern Lpe1 acn uapa + uapa - LP2 LP5 LP2-S0 LP2-S1 LP2-S2

36 τα επίπεδα έκφρασης της αλληλουχίας lpe1, που είναι ευθέως ανάλογα του αριθµού των ενσωµατωµένων πλασµιδιακών αντιγράφων, καθορίζουν την ικανότητα ανάπτυξης σε ουρικό οξύ ή ξανθίνη

37 Βιοχηµικά Χαρακτηριστικά Μεταφορέα LPΕ1 ρυθµός πρόσληψης ξανθίνης ρυθµός πρόσληψης ξανθίνης (pmol min κονίδια) 0,3 0,2 0, συγκέντρωση υποστρώµατος (µμ) K m = 30 µμ ±2.5µΜ 1/[V] (1/pmol min κονιδιοσπόρια) Γράφηµα Lineweaver-Burk y = 141,83x + 4, ,2 0,4 0,6 0,8 1 1,2 1/[S] (1/µΜ) V max = 0.22 pmol min κονιδιοσπόρια

38 ο Μεταφορέας LPE1 Είναι ευτερογενούς Ενεργότητας επίδραση ενώσεων που διαταράσσουν την ηλεκτροχηµική προωθητική δύναµητηςµεµβράνης στην πρόσληψη ξανθίνης από το µεταφορέα LPE1 LPE1 UapA % πρόσληψη 3 Η -ξανθίνης απουσία αναστολέα DCCD CCCP

39 % πρόσληψης 3 Η-ξανθίνης Προσδιορισµός της Ειδίκευσης της πρωτεΐνης LPE1 1. Πειράµατα ανταγωνισµού πρόσληψης 10µΜ 3 Η-ξανθίνης παρουσία 300µΜ µηραδιοσηµασµένου ανταγωνιστή UapA LPE1 0 καφεΐνη ουρακίλη κυτοσίνη θυµίνη γουανίνη αδενίνη υποξανθίνη ουρικό οξύ ξανθίνη

40 % πρόσληψης 3 Η-ξανθίνης 2. Πειράµατα ανταγωνισµού πρόσληψης 10µΜ 3 Η-ξανθίνης παρουσία διαφορετικών συγκεντρώσεων ασκορβικού οξέος 100 UapA LPE mM 90mM 75mM 45mM 10mM 5mM 0.3mM 35mM 22.5mM 20mM L-ασκορβικό οξύ 0.3mΜ ξανθίνη

41 το Ασκορβικό Οξύ Προσδένεται Εξειδικευµένα στο Μεταφορέα LPE LP2 % πρόσληψης 3 H-προλίνης 0 10 mm 5 mm 0.3 mm προλίνη 20 mm 35 mm 45 mm L-ασκορβικό οξύ

42 3. Ανταγωνιστική αναστολή (competitive ihhibition) της πρόσληψηςξανθίνηςαπότοασκορβικόοξύ Τιµές K m συγγένειας του µεταφορέα LPE1 για τη ξανθίνη παρουσία διαφορετικών συγκεντρώσεων ασκορβικού οξέος Συγκεντρώσεις Ασκορβικού οξέος 5 mm 10 mm 45 mm K m 34 µμ 47 µμ 59 µμ 92 µμ

43 Λειτουργικός χαρακτηρισµός της πρωτεΐνης LPE1 απότοκαλαµπόκι µε την έκφρασή της στον Aspergillus nidulans Η πρωτεΐνη LPE1 είναι ένας υψηλής συγγένειας, υψηλής µεταφορικής ικανότητας εξειδικευµένος µεταφορέας οξειδωµένων πουρινών (ξανθίνης και ουρικού οξέος) Είναι µεταφορέας δευτερογενούς ενεργότητας και λειτουργεί ως συµµεταφορέας πρωτονίων εσµεύει αλλά δεν µεταφέρει ασκορβικό οξύ Ηθέσηενσωµάτωσης, αριθµόςτωναντιγράφωνκαι τα επίπεδα έκφρασης του γονιδίου lpe1 καθορίζουν τη λειτουργική έκφραση της πρωτεΐνης LPE1

44 O Aspergillus nidulans εισάγεται ως πρότυπο σύστηµα έκφρασης ετερόλογων µεταφορέων νουκλεοτιδικών βάσεων Argyrou, Sophianopoulou, Shultes, Diallinas, Plant Cell 13, (2001)

45 ΝΑΤ ΜΕΤΑΦΟΡΕΙΣ ΣΤΟΝ ΑΝΘΡΩΠΟ (ΜΕΤΑΦΟΡΕΙΣ ΑΣΚΟΡΒΙΚΟΥ ΟΞΕΟΣ) hsvct1, hsvct2 (human Sodium-dependent Vitamin C Transporters) hsvct1(yslp3): νεφρός, έντερο, ήπαρ (Km=233,8 µμ) hsvct2 (YSLP2): στους περισσότερους από τους ιστούς που έχουν µελετηθεί (Km=22,6 µμ)

46 Γενετικός µετασχηµατισµός του στελέχους ACZ (uapa - uapc - azga - argb - ) µε κατάλληλο φορέα έκφρασης (pns335/svct2/argb) SstI uapa promoter NcoI XbaI uapa terminator SalI/XhoI KpnI 5 UapA 3 UapA ArgB SVCT2/SVCT1 NcoI / BamHI XbaI φορέας pns335/svct2/argb

47 Γενετικές και Λειτουργικές Μελέτες ACZ : hsvct2 - Μετασχηµατισµένων Στελεχών αµµωνία ουρικό οξύ WT S2 510 S5 Μετρήσεις Πρόσληψης 3 H ξανθίνης τα µετασχηµατισµένα στελέχη δεν µεταφέρουν ξανθίνη

48 Λειτουργική έκφραση του δεύτερου ανθρώπινου µεταφορέα ασκορβικού οξέος, hsvct1, στον A. nidulans απουσία ασκορβικού παρουσία ασκορβικού uapa uapa + W2 WT W1 W3

49 Μεταφορείς ασκορβικού οξέος ARGB 510 W2 W1 wt B - S3 -L-ασκορβικό οξύ + 0.5%L-ασκορβικό οξύ + 0.5%L- ασκορβικό οξύ, 100mΜ NaCl

50 o A. nidulans µπορεί να χρησιµοποιηθεί ως σύστηµα ετερόλογης έκφρασης και µελετών σχέσεων δοµής/λειτουργίας µεταφορέων ασκορβικού οξέος της οικογένειας ΝΑΤ από τα θηλαστικά

51 O Αspergillus nidulans καθιερώνεται ως πρότυπο σύστηµα για το λειτουργικό χαρακτηρισµόκαιτη µελέτη των σχέσεων δοµής λειτουργίας γονιδίων που κωδικοποιούν µεταφορείς της οικογένειας ΝΑΤ από ανώτερους οργανισµούς

52 ηµοσιεύσεις: Βιβλιογραφία: 1. G. Diallinas, J. Valdez, V. Sophianopoulou, A. Rosa and C. Scazzocchio, Chimeric purine transportersof Aspergillus nidulans define a domain critical for function and specificity conserved in bacteria, plant and metazoan homologues. EMBO J. 17 (14): E. Argyrou, V. Sophianopoulou, N. Schultes and G. Diallinas, Functional characterization of a maize purine transporter by expression in Aspergillus nidulans. Plant Cell 13 (4): G. Diallinas and V. Sophianopoulou, Nucleobase transporters as a novel tool in molecular pharmacology. Rev. Clin. Pharmacokinetics, International Edition 16: 33-35



Διαβάστε περισσότερα

Σχέσεις Δομής-Λειτουργίας στους μεταφορείς πουρινών μυκήτων. Η παρούσα διδακτορική διατριβή αφορά στη μελέτη διαμεμβρανικών

Σχέσεις Δομής-Λειτουργίας στους μεταφορείς πουρινών μυκήτων. Η παρούσα διδακτορική διατριβή αφορά στη μελέτη διαμεμβρανικών Περίληψη της διδακτορικής διατριβής Σχέσεις Δομής-Λειτουργίας στους μεταφορείς πουρινών μυκήτων Η παρούσα διδακτορική διατριβή αφορά στη μελέτη διαμεμβρανικών μεταφορέων πουρινών κάνοντας χρήση του μη

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες;

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Οι πρωτεΐνες αποτελούν δομικά ή λειτουργικά συστατικά των κυττάρων και δομούνται από απλούστερες ενώσεις, τα αμινοξέα.

Διαβάστε περισσότερα

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά;

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; ΒΙΟΛΟΓΙΚΗ ΑΝΘΡΩΠΟΛΟΓΙΑ 12 26/10/2016 Κεφάλαιο 3 Α μέρος Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; Ποια είναι η δομή

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΧΗΜΕΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ. Στοιχείο O C H N Ca P K S Na Mg περιεκτικότητα % ,5 1 0,35 0,25 0,15 0,05

ΒΙΟΧΗΜΕΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ. Στοιχείο O C H N Ca P K S Na Mg περιεκτικότητα % ,5 1 0,35 0,25 0,15 0,05 ΒΙΟΧΗΜΕΙΑ Βιοχημεία: είναι η επιστήμη που ασχολείται με τη μελέτη των οργανικών ενώσεων που συναντώνται στον οργανισμό, καθώς και με τον μεταβολισμό τους. ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ 108 στοιχεία

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ-ΙΟΥΣ) 1 ΔΗΜΙΟΥΡΓΙΑ ΦΥΤΩΝ ΜΕ ΑΝΤΟΧΗ ΣΕ ΕΝΤΟΜΑ 19 Παράγοντες που συμβάλλουν σε αύξηση των εντόμων 1. Μονοκαλλιέργειες 2. Βελτίωση με κριτήριο αποκλειστικά την

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

Η ανόργανη θρέψη των φυτών

Η ανόργανη θρέψη των φυτών Η ανόργανη θρέψη των φυτών Οργανικά θρεπτικά στοιχεία σάκχαρα που προέρχονται από τη διαδικασία της φωτοσύνθεσης με τις επακόλουθες μετατροπές Ανόργανα θρεπτικά στοιχεία προέρχονται από το έδαφος, με τη

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 12/04/2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ο.Π. ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΟΧΤΩ (8) ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση:

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Α1. Ο Griffith απέδειξε: Α. ότι

Διαβάστε περισσότερα


ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

Ηδοµή των λιπαρών οξέων

Ηδοµή των λιπαρών οξέων Μεµβρανική Μεταφορά Ηδοµή των λιπαρών οξέων Λιπαρά οξέα-λιπίδια- µεµβράνες Κυτταρικές µεµβράνες: ρόλος διαχωριστικού τοίχους ιαφορετικές λειτουργίες της κυτταρικής µεµβράνης Ενδoκυτταρικές µεµβράνες

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ 1 ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ άμεση πρόσβαση στο γενετικό υλικό εφαρμογές στην υγεία, βελτίωση φυτών και ζώων, προστασία

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

13. Μεµβρανικοί δίαυλοι και αντλίες

13. Μεµβρανικοί δίαυλοι και αντλίες 13. Μεµβρανικοί δίαυλοι και αντλίες 5/09 Ενεργός και παθητική µεταφορά µορίων/ιόντων µέσω µεµβρανών (αντλίες και δίαυλοι). Αντλίες ιόντων που δρουν µέσω υδρόλυσης ΑΤΡ και φωσφορυλίωσης. Αντλίες µε περιοχές

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα


ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% Ο άνθρακας, το υδρογόνο, το οξυγόνο και το άζωτο συμμετέχουν, σε σημαντικό βαθμό, στη

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Εσπερινών Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Α Α.1 Β Α.2 Β Α.3 Δ Α.4 Γ Α.5 Γ ΘΕΜΑ B B.1 1.

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου 2011 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Κατά τη λανθάνουσα φάση σε μια κλειστή καλλιέργεια

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ (Γενετικό υλικό των βακτηρίων ρύθμιση της γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 Γενετικό υλικό των βακτηρίων Αποτελείται από ένα μόριο DNA σε υπερελιγμένη μορφή και τα άκρα του

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ ο ΕΚΦΩΝΗΣΕΙΣ.. Υδατικό διάλυµα οξέος ΗΑ συγκέντρωσης 0, Μ έχει pη = στους 5 C, Αν το διάλυµα ΗΑ αραιωθεί σε δεκαπλάσιο όγκο το pη του θα είναι

Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Γενετική μηχανική Γενετικά τροποποιημένοι οργανισμοί Διαγονιδιακοί οργανισμοί

Γενετική μηχανική Γενετικά τροποποιημένοι οργανισμοί Διαγονιδιακοί οργανισμοί Γενετική μηχανική Γενετικά τροποποιημένοι οργανισμοί Διαγονιδιακοί οργανισμοί Εργασία στο μάθημα της Βιολογίας Υπεύθυνος καθηγητής : Κ.Κεραμάρης Μαθητές : Λιούμη Κυριακή, Μωραΐτης Βαγγέλης Περιεχόμενα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα

Στρατηγικές αντιµετώπισης αντίξοων περιβαλλοντικών (αβιοτικών) παραγόντων από τους φωτοσυνθετικούς οργανισµούς

Στρατηγικές αντιµετώπισης αντίξοων περιβαλλοντικών (αβιοτικών) παραγόντων από τους φωτοσυνθετικούς οργανισµούς Στρατηγικές αντιµετώπισης αντίξοων περιβαλλοντικών (αβιοτικών) παραγόντων από τους φωτοσυνθετικούς οργανισµούς ρ. Κ. Σταµατάκης, Εργαστήριο Βιοφυσικής και Βιοτεχνολογίας Μεµβρανών, Ινστιτούτο Βιολογίας,

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

Μέθοδοι μελέτης εξέλιξης

Μέθοδοι μελέτης εξέλιξης H διερεύνηση της μοριακής βάσης της εξέλιξης βασίζεται σε μεγάλο βαθμό στη διευκρίνιση της διαδικασίας με την οποία μετασχηματίσθηκαν στη διάρκεια της εξέλιξης πρωτεϊνες, άλλα μόρια και βιοχημικές πορείες

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 1 ο -Το γενετικό υλικό Το γενετικό υλικό Ιστορική αναδρομή 1869: Το DNA εντοπίζεται στον πυρήνα των κυττάρων 1944: Μέχρι τότε δεν ήταν γνωστό ότι αποτελεί το γενετικό

Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα