Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1"


1 ΓΗ_Β_ΒΙΟ_0_ Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και η χημική αντίδραση Δ; β) Ποιο είναι το μόριο Χ και ποια είναι η σχέση του με τις αντιδράσεις Γ και Δ; (12μ) ΙΙ. Ο δεσμός Ε που δημιουργείται λόγω της χημικής αντίδρασης Γ συναντάται κατά τη δημιουργία βιομορίων που αποτελούνται από πολυάριθμους δομικούς λίθους. Να απαντήσετε στις ερωτήσεις: α) Τι είδους χημικός δεσμός είναι ο Ε και ποια είναι η σημασία του για τα μόρια Α; β) Πώς ονομάζεται το μόριο που θα προκύψει από τη συνένωση πολυάριθμων μορίων Α; γ) Στο μόριο που θα προκύψει εκτός από τον χημικό δεσμό Ε είναι πιθανό να προκύψουν και άλλοι χημικοί δεσμοί. Να αναφέρετε δύο από αυτούς και να εξηγήσετε τη σημασία τους. (13μ) ΓΗ_Β_ΒΙΟ_0_14351 Β2 Ι. Στα κύτταρα υπάρχει ποικιλία χημικών στοιχείων, όπως και ποικιλία στις ποσότητες και στις αναλογίες με τις οποίες συναντώνται τα στοιχεία αυτά. α) Ποια είναι τα κύρια στοιχεία που συνιστούν τα μακρομόρια ενός κυττάρου. Σε ποιο ποσοστό συμμετέχουν στη δομή του; Ποια στοιχεία ονομάζονται ιχνοστοιχεία; (4μ) β) Δυο βασικές ιδιότητες που πρέπει να διακρίνουν τα μακρομόρια είναι η σταθερότητα και η ποικιλομορφία. Να εξηγήσετε για ποιο λόγο τα μακρομόρια πρέπει να πληρούν τις παραπάνω προϋποθέσεις. (4μ) γ) Να αναφέρετε δύο ιδιότητες των κύριων χημικών στοιχείων, που συνιστούν τα μακρομόρια, οι οποίες συμβάλλουν στην σταθερότητα και στην ποικιλομορφία των μορίων αυτών. (4μ) Πιτσιλαδής Βασίλης - Βιολόγος 1

2 ΓΗ_Β_ΒΙΟ_0_14363 Β4 Ι. Είκοσι επτά χημικά στοιχεία είναι απαραίτητα για τη ζωή. Τα τέσσερα από αυτά τα στοιχεία είναι τα επικρατέστερα στους οργανισμούς. α) Ποια είναι τα τέσσερα στοιχεία, που συμμετέχουν σε σημαντικό βαθμό στη σύνθεση των πρωτεϊνών; (4μ) β) Να τοποθετήσετε στη σωστή σειρά από το μικρότερο προς το μεγαλύτερο σε μέγεθος, τα παρακάτω: αμινοξύ, άζωτο, τριπεπτίδιο, πρωτεΐνη, αμινομάδα. (4μ) γ) Να αναφέρετε αναλυτικά τα τμήματα, από τα οποία αποτελείται ένα αμινοξύ. (4μ) ΙΙ. Οι υδατάνθρακες διακρίνονται σε μονοσακχαρίτες, δισακχαρίτες και πολυσακχαρίτες. α) Να περιγράψετε το ρόλο της συμπύκνωσης και της υδρόλυσης στη σχέση μεταξύ μονοσακχαριτών, δισακχαριτών και πολυσακχαριτών. (6μ) β) Να ονομάσετε τον δομικό πολυσακχαρίτη του κυτταρικού τοιχώματος ενός φυτικού κυττάρου. (1μ) γ) Ένας μύκητας, ένα ζωικό κύτταρο και ένα φυτικό κύτταρο αποθηκεύουν μόρια γλυκόζης. Με ποια μορφή τα αποθηκεύει το καθένα από αυτά; (6μ) ΓΗ_Β_ΒΙΟ_0_14364 Β5 Ι. Στο φλοιό της Γης απαντώνται 92 χημικά στοιχεία. Από αυτά τα είκοσι επτά είναι απαραίτητα για τη ζωή. α) Ποια είναι τα πέντε χημικά στοιχεία, που συμμετέχουν στη σύνθεση των νουκλεϊκών οξέων; (5μ) β) Να τοποθετήσετε στη σωστή σειρά, από το μικρότερο προς το μεγαλύτερο σε μέγεθος, τα παρακάτω: άνθρακας, νουκλεοτίδιο, αζωτούχος βάση, νουκλεϊκό οξύ. (4μ) γ) Να αναφέρετε τρία διαφορετικά μόρια από τη σύνδεση των οποίων σχηματίζεται ένα νουκλεοτίδιο. (3μ) Χημικά στοιχεία, μικρά μόρια αλλά και μεγάλα μόρια αποτελούν συστατικά του κυττάρου και συνεπώς συμμετέχουν στην κατασκευή των δομών του και επηρεάζουν τις λειτουργίες του. Ι. Να εξηγήσετε συνοπτικά τη σημασία που έχουν για το κύτταρο ο Άνθρακας, το Νερό, τα Άλατα και τα Φωσφολιπίδια. (12μ) ΙΙ. Η βιολογική λειτουργία των μακρομορίων απορρέει από τη δομή τους. Με βάση την αρχή αυτή, να εξηγήσετε γιατί η μορφή μιας πρωτεΐνης καθορίζει τη λειτουργία της, κάνοντας χρήση ενός σχετικού παραδείγματος. Να αναφέρετε δύο τρόπους με τους οποίους μπορεί να τροποποιηθεί η μορφή της πρωτεΐνης, ώστε το μόριο να πάψει να είναι λειτουργικό. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 2

3 ΓΗ_Β_ΒΙΟ_0_14366 Β6 I. Τα μονομερή των πρωτεϊνών είναι τα αμινοξέα. Να απαντήσετε στις ερωτήσεις: α) Ποιες είναι οι σταθερές χημικές ομάδες που δομούν κάθε αμινοξύ; (3μ) β) Πόσα είναι τα διαφορετικά είδη μεταβλητής ομάδας των αμινοξέων τα οποία συμμετέχουν στη σύνθεση των πρωτεϊνών; Να εξηγήσετε γιατί η ύπαρξη διαφορετικών ειδών μεταβλητών ομάδων είναι σημαντική για την εκτέλεση του βιολογικού ρόλου των πρωτεϊνών. (6μ) γ) Να δείξετε σχηματικά πώς συνδέονται δύο αμινοξέα μεταξύ τους για να σχηματίσουν ένα διπεπτίδιο. Ποιο άλλο μόριο παράγεται κατά το σχηματισμό ενός διπεπτιδίου; (3μ) ΓΗ_Β_ΒΙΟ_0_14367 Β7 ΙΙ. Μια κατηγορία ενώσεων μεγάλου μοριακού βάρους στα κύτταρα είναι τα λιπίδια. α) Να περιγράψετε το ρόλο της συμπύκνωσης και το ρόλο της υδρόλυσης στη σχέση μεταξύ λιπαρών οξέων, γλυκερόλης και τριγλυκεριδίων. (8μ) β) Σε ποιες κατηγορίες διακρίνονται τα ουδέτερα λίπη; Αν ένα ουδέτερο λίπος στη συνήθη θερμοκρασία παραμένει στην υγρή κατάσταση, σε ποιο συμπέρασμα οδηγείστε για τη χημική σύστασή του; Να αναφέρετε 2 ρόλους των λιπών στους οργανισμούς. (5μ) ΓΗ_Β_ΒΙΟ_0_14369 Β8 Ι. Οι υδατάνθρακες διακρίνονται σε μονοσακχαρίτες, δισακχαρίτες και πολυσακχαρίτες. α) Να αναφέρετε από δύο παραδείγματα μονοσακχαριτών, δισακχαριτών και πολυσακχαριτών. (6μ) β) Σε ένα κύτταρο συναντώνται άμυλο και κυτταρίνη. Το κύτταρο αυτό είναι φυτικό ή ζωικό. Να αιτιολογήσετε την απάντησή σας. Ποιος είναι ο βιολογικός ρόλος καθεμιάς από τις ενώσεις αυτές; (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 3

4 ΓΗ_Β_ΒΙΟ_0_14372 Β10 ΙΙ. Μεταξύ των χημικών δεσμών που υπάρχουν στα βιομόρια, περιλαμβάνονται οι δεσμοί Υδρογόνου. α) Να ονομάσετε δύο διαφορετικά βιολογικά μακρομόρια στα οποία συναντώνται δεσμοί υδρογόνου. Μεταξύ ποιων χημικών ομάδων καθενός από τα μακρομόρια που αναφέρατε δημιουργούνται δεσμοί υδρογόνου; (4μ) β) Να εξηγήσετε τη σημασία των δεσμών υδρογόνου στη βιολογική λειτουργία των μακρομορίων που αναφέρατε στο α. ερώτημα. (9μ) Η πρωτεΐνη της εικόνας αποτελείται από 300 αμινοξέα. Στο διάγραμμα παρουσιάζεται η πρωτοταγής, η δευτεροταγής και η τριτοταγής δομή της. Ι. Τι είναι η πρωτοταγής δομή μιας πρωτεΐνης; Να εξηγήσετε ποια είναι η αιτία που προκαλεί μεταβολή στις διαστάσεις της πρωτεΐνης από την πρωτοταγή στη δευτεροταγή δομή της. (12μ) ΙΙ. Τι είναι η τριτοταγής δομή μιας πρωτεΐνης; Γιατί όλες οι πρωτεΐνες δεν διαθέτουν τεταρτοταγή δομή; Να εξηγήσετε αν θα επηρεαστεί η τριτοταγής δομή της πρωτεΐνης, σε περίπτωση που η πρωτεΐνη εκτεθεί σε ακραία τιμή θερμοκρασίας. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 4

5 ΓΗ_Β_ΒΙΟ_0_14375 Β12 Σε ένα φυτικό κύτταρο συνέβησαν δύο μεταβολές σε δύο μακρομόριά του: Σε ένα μόριο κυτταρίνης, το 5 ο κατά σειρά μονομερές του αντικαταστάθηκε από το 17 ο, και σε ένα μόριο πρωτεΐνης, το 25 ο μονομερές του αντικαταστάθηκε από το 93 ο. Να απαντήσετε στις ερωτήσεις: Ι. Ποια είναι τα μονομερή καθενός από τα δύο είδη μακρομορίων; Τι κοινό χαρακτηρίζει τον χημικό μηχανισμό με τον οποίο τα μονομερή καθενός μακρομορίου, συνδέονται μεταξύ τους; (12μ) ΙΙ. Στην κυτταρίνη ή στην πρωτεΐνη είναι πιθανότερο να τροποποιηθεί η βιολογική λειτουργία, μετά την αντικατάσταση του αντίστοιχου μονομερούς; Να αιτιολογήσετε την απάντησή σας. (13μ) ΓΗ_Β_ΒΙΟ_0_14377 Β13 Ι. Δύο νευροπεπτίδια έχουν την εξής αλληλουχία αμινοξέων. Πεπτίδιο Α: H 2 Ν-μεθειονίνη-τρυπτοφάνη-λυσίνη-λυσίνη-προλίνη-βαλίνη-COOH Πεπτίδιο Β: Η 2 Ν-μεθειονίνη-λυσίνη-τρυπτοφάνη-λυσίνη-βαλίνη-προλίνη-COOH. Να απαντήσετε στις ερωτήσεις: α) Με ποιο είδος δεσμού συνδέονται τα αμινοξέα των πεπτιδίων μεταξύ τους, με ποια χημική αντίδραση δημιουργείται αυτός ο δεσμός. (4μ) β) Ποιοι άλλοι χημικοί δεσμοί είναι πιθανόν να συμβάλλουν στην τελική διαμόρφωση των πεπτιδίων Α και Β στο χώρο; (8μ) ΙΙ. Κάθε βιολογικό μόριο εκτελεί μια συγκεκριμένη βιολογική λειτουργία. Να απαντήσετε στις ερωτήσεις: α) Είναι δυνατόν τα διαφορετικά πεπτίδια Α και Β να εκτελούν την ίδια λειτουργία; (6μ) β) Ποιοι παράγοντες και με ποιο τρόπο μπορούν να τροποποιήσουν τη λειτουργία που εκτελεί κάθε πεπτίδιο; (7μ) Πιτσιλαδής Βασίλης - Βιολόγος 5

6 ΓΗ_Β_ΒΙΟ_0_14384 Β17 ΙΙ. Ο βιολογικός ρόλος που έχουν οι υδατάνθρακες στο κύτταρο είναι σημαντικός και ποικίλος. α) Να ονομάσετε τον υδατάνθρακα που υπάρχει στα νουκλεοτίδια του DNA και τον υδατάνθρακα που υπάρχει στα νουκλεοτίδια του RNA. Σε ποια κατηγορία υπάγονται οι υδατάνθρακες αυτοί, με βάση τον αριθμό των ατόμων άνθρακα που υπάρχουν στο μόριο τους; (3μ) β) Να ονομάσετε δύο δισακχαρίτες και να προσδιορίσετε την πηγή από την οποία μπορούμε να τους προσλάβουμε με τη διατροφή μας. (4μ) γ) Ποια είναι τα γνωστά είδη πολυσακχαριτών; Σε ποια είδη οργανισμών εντοπίζεται ο καθένας, και με ποιο βιολογικό ρόλο; (6μ) ΓΗ_Β_ΒΙΟ_0_14389 Β19 Ι. Στην εικόνα παρατίθενται δύο από τα είκοσι αμινοξέα που αποτελούν συστατικά πρωτεϊνών. Το αμινοξύ αλανίνη (Α) και το αμινοξύ γλυκίνη (Β): Α. Αμινοξύ Αλανίνη Β. Αμινοξύ Γλυκίνη α) Ποια είναι η πλευρική ομάδα (R) για το καθένα από αυτά τα αμινοξέα; (6μ) β) Πώς χαρακτηρίζεται το τμήμα του αμινοξέος που αποτελείται από την πλευρική ομάδα (R) και γιατί; (4μ) γ) Να κυκλώσετε το κοινό άτομο με το οποίο ενώνονται όλα τα τμήματα ενός αμινοξέος. (2μ) Πιτσιλαδής Βασίλης - Βιολόγος 6

7 ΓΗ_Β_ΒΙΟ_0_14391 Β20 Ι. Μεταξύ των διαφορών που υπάρχουν στο DNA και στο RNA, είναι το είδος των μονομερών που τα αποτελούν, αλλά και η θέση των μορίων αυτών στο ευκαρυωτικό κύτταρο. Να απαντήσετε στις ερωτήσεις: α) Ποια είναι τα διαφορετικά νουκλεοτίδια που συναντώνται στο DNA; Ποια είναι τα διαφορετικά νουκλεοτίδια που συναντώνται στο RNA; (4μ) β) Ποια είναι η σημασία, για το βιολογικό ρόλο του DNA, ότι το μόριο αυτό δομείται από 4 διαφορετικά νουκλεοτίδια, και όχι από ένα μόνο; (4μ) γ) Να ονομάσετε μια κυτταρική δομή και μια κυτταρική περιοχή ενός μη διαιρούμενου κυττάρου στην οποία υπάρχει το RNA, όχι όμως το DNA. (4μ) Στην ακόλουθη εικόνα παρατίθενται οι συντακτικοί τύποι των αμινοξέων Αλανίνη (Α) και Γλυκίνη (Γ). Να απαντήσετε στις ερωτήσεις: Αλανίνη Γλυκίνη Ι. Ποια είναι τα διαφορετικά τριπεπτίδια που μπορούν να συντεθούν με την χρήση των δύο αμινοξέων; (Να χρησιμοποιήσετε τα αρχικά τους Α και Γ) (12μ) ΙΙ. Να δείξετε τον συντακτικό τύπο του τριπεπτιδίου: Η2Ν-Α-Α-Γ-COOH. Για ποιο λόγο το τριπεπτίδιο αυτό είναι διαφορετικό από το τριπεπτίδιο: Η2Ν-Γ-Α-Α-COOH (13μ) ΓΗ_Β_ΒΙΟ_0_14419 Β22 Ι. Οι πρωτεΐνες είναι βιολογικά μακρομόρια που αποτελούνται από ένα ή περισσότερα πολυπεπτίδια. α) Να προσδιορίσετε το ρόλο της συμπύκνωσης και το ρόλο της υδρόλυσης στη σχέση μεταξύ αμινοξέων και πολυπεπτιδίων. (6μ) β) Να ονομάσετε δύο διαφορετικές πρωτεΐνες των κυττάρων του ανθρώπου και να προσδιορίσετε το βιολογικό ρόλο τους. Τι θα πρέπει να συμβεί σε κάποια από τις πρωτεΐνες που αναφέρατε, ώστε να μην μπορεί πλέον να εκτελεί τη βιολογική λειτουργία της; Πώς ονομάζεται το φαινόμενο αυτό; (6μ) ΙΙ. Να ονομάσετε έναν πολυσακχαρίτη στο ζωικό κύτταρο και δύο πολυσακχαρίτες στο φυτικό κύτταρο. Τι κοινό έχουν αυτοί οι 3 πολυσακχαρίτες; Που διαφέρουν ο ένας από τον άλλο; Να προσδιορίσετε το βιολογικό ρόλο καθενός από αυτούς. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 7

8 ΓΗ_Β_ΒΙΟ_0_14421 Β24 ΙΙ. Μια από τις κατηγορίες λιπιδίων είναι τα φωσφολιπίδια. α) Να περιγράψετε τη δομή ενός μορίου φωσφολιπιδίου. (4μ) β) Να αναφέρετε δύο διαφορές στη δομή των φωσφολιπιδίων σε σχέση με τη δομή των ουδετέρων λιπών. (4μ) γ) Να εξηγήσετε πώς τα φωσφολιπίδια συγκροτούν διπλοστιβάδα και να αναφέρετε τη βιολογική της σημασία για το κύτταρο. (5μ) ΓΗ_Β_ΒΙΟ_0_14422 Β25 Ι. Στον πίνακα που δίνεται να τοποθετήσετε το σύμβολο + στα ορθογώνια στα οποία υπάρχει αντιστοιχία ανάμεσα στις προτάσεις της οριζόντιας σειράς και στα μακρομόρια της κατακόρυφης στήλης. DNA Πρωτεΐνες Πολυσακχαρίτες RNA Λιπίδια Επιταχύνουν τις βιοχημικές αντιδράσεις Είναι το γενετικό υλικό των κυττάρων Αποτελούν δομικά συστατικά της πλασματικής μεμβράνης Αποτελούν κύριες πηγές ενέργειας (12μ) ΓΗ_Β_ΒΙΟ_0_14423 Β26 ΙΙ. Tα μόρια του DNA φέρουν μια σειρά πληροφοριών οι οποίες καθορίζουν το σύνολο σχεδόν των χαρακτηριστικών των οργανισμών. Να απαντήσετε στις παρακάτω ερωτήσεις : α) Σε ποια τμήματα ενός φυτικού και σε ποια τμήματα ενός ζωικού κυττάρου μπορούμε να εντοπίσουμε μόρια DNA; (5μ) β) Ποια χαρακτηριστικά του μορίου του DNA του επιτρέπουν να έχει καταγεγραμμένη τη γενετική πληροφορία και να αποτελεί ένα σταθερό, από χημική άποψη, μόριο; (8μ) Πιτσιλαδής Βασίλης - Βιολόγος 8

9 ΓΗ_Β_ΒΙΟ_0_14424 Β27 Δυο φίλες, μαθήτριες της Β λυκείου προετοίμασαν καθεμία μόνη της ένα γλύκισμα, με ζελέ και φρούτα ανανά, για μια εκδήλωση του σχολείου τους. Η πρώτη αφού προετοίμασε το μείγμα του ζελέ, με βάση τις οδηγίες της συσκευασίας του ζελέ που αγόρασε από το σούπερ μάρκετ, προσέθεσε φρούτο από ανανά κονσέρβας και το γλύκισμα της έπηξε κανονικά. Η δεύτερη ακολούθησε την ίδιαν ακριβώς διαδικασία με τη διαφορά ότι χρησιμοποίησε κομμάτια φρέσκου ανανά αλλά το γλυκό που παρασκεύασε δεν έπηξε καθόλου. Αναζητώντας πληροφορίες στο διαδίκτυο για τις αιτίες της αποτυχίας του γλυκού η μαθήτρια βρήκε ότι: α) το ζελέ πήζει σε χαμηλή θερμοκρασία εξαιτίας μια πρωτεΐνης, της ζελατίνης, η οποία περιέχεται σε αυτό, β) ότι ο φρέσκος ανανάς όπως και κάποια άλλα φρούτα περιέχει μεταξύ άλλων, το ένζυμο βρομελίνη, που διασπά πρωτεΐνες και γ) ότι η κονσερβοποίηση περιλαμβάνει μεταξύ των άλλων σταδίων και θέρμανση του τροφίμου σε υψηλή θερμοκρασία. Ι. Πώς ονομάζονται τα μόρια που προκύπτουν από τη δράση της βρομελίνης στις πρωτεΐνες; Να ονομάσετε το είδος του χημικού μηχανισμού με τον οποίον προέκυψαν τα μόρια αυτά και να προσδιορίσετε αν κατά τη διεξαγωγή του, έγινε κατανάλωση ή παραγωγή νερού; Ποια σχέση υπάρχει ανάμεσα στη δομή των μακρομορίων, όπως π.χ. η βρομελίνη, με τη βιολογική λειτουργία που εκδηλώνουν; Να αιτιολογήσετε τις απαντήσεις σας. (12μ) ΙΙ. Συνδυάζοντας τις απαντήσεις που δώσατε στο προηγούμενο ερώτημα, να εξηγήσετε τα αίτια της αποτυχίας του γλυκού της δεύτερης μαθήτριας και αντίστοιχα της επιτυχίας στο γλυκό της πρώτης. (13μ) ΓΗ_Β_ΒΙΟ_0_14426 Β29 Ένα δίκλωνο μόριο DNA αποτελείται από νουκλεοτίδια, από τα οποία περιέχουν την αζωτούχο βάση αδενίνη (Α). Να απαντήσετε στις ερωτήσεις: Ι. Από πόσα νουκλεοτίδια αποτελείται η κάθε αλυσίδα αυτού του μορίου; Να υπολογίσετε τον αριθμό των δεσμών που αναπτύσσονται μεταξύ τους. Να αιτιολογήσετε τις απαντήσεις σας. (12μ) ΙΙ. Να υπολογίσετε τον αριθμό κάθε είδους αζωτούχων βάσεων, καθώς και τον συνολικό αριθμό δεσμών υδρογόνου που υπάρχουν στο μόριο. Να αιτιολογήσετε τις απαντήσεις σας. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 9

10 ΓΗ_Β_ΒΙΟ_0_14428 Β31 Ι. Μια κατηγορία λιπιδίων είναι τα ουδέτερα λίπη ή τριγλυκερίδια, τα οποία είναι πολύ διαδεδομένα στη φύση. α) Από ποιες επιμέρους χημικές ομάδες αποτελείται ένα ουδέτερο λίπος; (4μ) β) Σε ποιες κατηγορίες και με ποιο κριτήριο διακρίνονται τα ουδέτερα λίπη; (4μ) γ) Ποιος είναι ο βιολογικός ρόλος των ουδέτερων λιπών; (4μ) ΙΙ. Οι υδατάνθρακες αποτελούν πηγή ενέργειας για τα κύτταρα. Μια κατηγορία εξ αυτών αποτελούν οι πολυσακχαρίτες, οι οποίοι είναι πολύ διαδεδομένοι στη φύση. α) Σε ποιες άλλες κατηγορίες και με ποιο κριτήριο διακρίνονται οι υδατάνθρακες; Να αναφέρετε δύο παραδείγματα από κάθε κατηγορία. (6μ) β) Ποιοι είναι οι κύριοι πολυσακχαρίτες του φυτικού κυττάρου και ποιος είναι ο βιολογικός ρόλος του καθενός; Ποιος είναι ο κοινός πολυσακχαρίτης των ζωικών κυττάρων και των κυττάρων των μυκήτων, ποιος είναι ο βιολογικός ρόλος του; (7μ) ΓΗ_Β_ΒΙΟ_0_14429 Β32 Δίνεται τμήμα αλυσίδας DNA. Α κλώνος A A T G A T T C T G T A A G A T T T G T A Β κλώνος Ι. Να βρεθεί ο αριθμός των δεσμών που συνδέουν τα νουκλεοτίδια του κλώνου Α και να συμπληρωθεί η αλληλουχία των νουκλεοτιδίων του κλώνου Β. Να αιτιολογήσετε τις απαντήσεις σας.(12μ) ΙΙ. Πόσες φωσφορικές ομάδες υπάρχουν σε αυτό το μόριο; Πόσοι δεσμοί υδρογόνου συγκρατούν μεταξύ τους τις δύο πολυνουκλεοτιδικές αλυσίδες; Να αιτιολογήσετε τις απαντήσεις σας. (13μ) ΓΗ_Β_ΒΙΟ_0_14431 Β33 Ι. Τα νουκλεϊκά οξέα, το DNA και το RNA, αποτελούν τα μακρομόρια που καθορίζουν τα είδη των πρωτεϊνών που παράγουν τα κύτταρα. α) Πώς ονομάζονται τα μονομερή των νουκλεϊκών οξέων; Από ποια είδη απλούστερων μορίων δημιουργούνται αυτά τα μονομερή;(6μ) β) Να προσδιορίσετε τρεις διαφορές που υπάρχουν ανάμεσα στο DNA και στο RNA, ως προς τη δομή και τη χημική σύστασή τους. (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 10

11 ΓΗ_Β_ΒΙΟ_0_14434 Β36 Ι. Σε ένα δοχείο με νερό προστέθηκε μια ποσότητα φωσφολιπιδίων. Ποια από τις δύο εικονιζόμενες διαμορφώσεις θα πάρουν τα φωσφολιπίδια; Για ποιο λόγο η διαμόρφωση που επιλέξατε είναι σημαντική από βιολογική σκοπιά; Να αιτιολογήσετε τις απαντήσεις σας. (12μ) ΙΙ. Τα κύτταρα των σπερμάτων των φυτών αποθηκεύουν λίπη στη μορφή σταγονιδίων που περιβάλλονται από μεμβράνη. Αντίθετα από τις άλλες μεμβράνες των κυττάρων τα σταγονίδια αυτά περιβάλλονται από ένα απλό στρώμα φωσφολιπιδίων και όχι από διπλό. Να σχεδιάσετε το πιθανό μοντέλο για τη διάταξη των φωσφολιπιδίων στις μεμβράνες αυτές και να εξηγήσετε πού οφείλεται η σταθερότητά του. (13μ) ΓΗ_Β_ΒΙΟ_0_14436 Β38 Στην εικόνα παρουσιάζεται ένα τμήμα της μοναδικής πολυπεπτιδικής αλυσίδας μιας πρωτεΐνης. Να απαντήσετε στις ερωτήσεις: Ι. Ποια από τις υπάρχουσες δομές των πρωτεϊνών (1 ο, 2 ο, 3 ο, ταγής) είναι η εικονιζόμενη; Η πρωτεΐνη αυτή μπορεί να διαθέτει τεταρτοταγή δομή; Να αιτιολογήσετε τις απαντήσεις σας. (12μ) ΙΙ. Πόσα αμινοξέα περιλαμβάνονται στο εικονιζόμενο τμήμα της πρωτεΐνης; Αν το τμήμα αυτό υδρολυθεί, πόσα μόρια νερού θα χρειαστούν; Να αιτιολογήσετε την απάντησή σας. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 11

12 ΓΗ_Β_ΒΙΟ_0_14438 Β40 Ι. Η σημασία του νερού για την εμφάνιση αλλά και για τη διατήρηση της ζωής είναι τόσο μεγάλη, ώστε το πρώτο ερώτημα που θέτουν οι επιστήμονες προκειμένου να διερευνήσουν, αν ένας πλανήτης φιλοξενεί ζωή, είναι αν έχει νερό σε υγρή μορφή. Να απαντήσετε στις ερωτήσεις: α) Πώς ονομάζεται το υγρό που περιβάλλει τα κύτταρα στους ιστούς των οργανισμών; (2μ) β) Γιατί τα φωσφολιπίδια της πλασματικής μεμβράνης σχηματίζουν διπλοστιβάδα; (4μ) γ) Να αναφέρετε τρεις λειτουργίες για τις οποίες είναι απαραίτητο το υδατικό περιβάλλον στο εσωτερικό ενός κυττάρου. (6μ) ΙΙ. Το DNA είναι ένα από τα σημαντικότερα μακρομόρια του κυττάρου. α) Ποιος είναι ο βιολογικός ρόλος του DNA και ποιες λειτουργίες είναι ικανό να ασκεί; (6μ) β) Σε ποια οργανίδια του κυττάρου μπορεί να εντοπιστεί DNA; (3μ) γ) Ποια είναι η σημασία της συμπληρωματικότητας των βάσεων στο DNA; (4μ) Πιτσιλαδής Βασίλης - Βιολόγος 12

13 ΓΗ_Β_ΒΙΟ_0_14905 Β41 Ι. Μεταξύ των διαφορετικών χημικών δεσμών που συναντώνται στα βιολογικά μακρομόρια περιλαμβάνονται οι ομοιοπολικοί δεσμοί καθώς και άλλα είδη δεσμών. Να απαντήσετε στις ερωτήσεις: α) Πώς ονομάζεται ο βασικός χημικός μηχανισμός με τον οποίο συνδέονται τα μονομερή όταν σχηματίζουν ένα πολυμερές; Ποιο είδος μορίου αφαιρείται κατά την αντίδραση των δύο μονομερών με το μηχανισμό που αναφέρατε; (4μ) β) Για ποιο λόγο ο ομοιοπολικός δεσμός έχει επικρατήσει στη σύνδεση των μονομερών σε πολυμερή σε σχέση με τα άλλα είδη δεσμών. Ποια είναι γενικά η σημασία των άλλων ειδών δεσμών; (4μ) γ) Εκτός από τον ομοιοπολικό δεσμό που συναντάται στο DNA, ποιο άλλο είδος δεσμού υπάρχει και μεταξύ ποιων χημικών ομάδων αναπτύσσεται; Ποια είναι η σημασία του δεσμού αυτού στο μόριο του DNA; (4μ) Ι. Τα αντισώματα είναι εξειδικευμένες αμυντικές πρωτεΐνες που εξουδετερώνουν τα μικρόβια αφού συνδεθούν με αυτά. Όλα τα αντισώματα αποτελούνται από 4 πολυπεπτιδικές αλυσίδες ανά δύο όμοιες. Τα διαφορετικά αντισώματα που έχουμε, είναι κατά βάση όμοια μεταξύ τους. Διαφέρουν όμως στις αλληλουχίες των αμινοξέων που αποτελούν την περιοχή σύνδεσής τους με τα μικρόβια. Αξιοποιώντας τις πληροφορίες που σας παρέχει το ακόλουθο σχήμα, να απαντήσετε στις ακόλουθες ερωτήσεις: α) Ποια επίπεδα οργάνωσης (δομής) αναμένετε να υπάρχουν στο μόριο των αντισωμάτων; Να αιτιολογήσετε την απάντησή σας. (6μ) β) Μελετώντας το σχήμα, στο οποίο εικονίζονται δύο διαφορετικά μικρόβια, που έχουν συνδεθεί με τα ειδικά, γι αυτά, αντισώματα, να εξηγήσετε για ποιο λόγο είναι αναγκαίο οι περιοχές των αντισωμάτων που συνδέονται με τα μικρόβια, να έχουν διαφορετική αλληλουχία αμινοξέων, σε καθένα από τα αντισώματα αυτά. (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 13

14 ΓΗ_Β_ΒΙΟ_0_14909 Β44 ΙΙ. Από τα 92 χημικά στοιχεία που υπάρχουν στο φλοιό της Γης, ο άνθρακας, το υδρογόνο, το οξυγόνο και το άζωτο, κυριαρχούν στους έμβιους οργανισμούς, καθώς αποτελούν το 96% του βάρους τους. Ωστόσο σε μικρότερο ποσοστό υπάρχουν και άλλα χημικά στοιχεία, μεταξύ των οποίων και ο φώσφορος, που ενώ είναι σημαντικά για τη ζωή, δεν ξεπερνούν το 4% του βάρους των οργανισμών. Να απαντήσετε στις ερωτήσεις: α) Ποια από τα 4 βασικά χημικά στοιχεία με τα οποία δομείται η ζωή, συναντώνται στους πολυσακχαρίτες; (3μ) β) Σε ποια είδη μονομερών συναντάται το άζωτο; Πώς ονομάζονται τα πολυμερή που συντίθενται από τα μονομερή που αναφέρατε; (4μ) γ) Αν ένα μακρομόριο περιέχει φώσφορο, τι είδους μακρομόριο μπορεί να είναι αυτό; Να αιτιολογήσετε την απάντησή σας. (6μ) Σε μερικές από τις εφαρμογές και τα πειράματα της Μοριακής Βιολογίας χρησιμοποιείται ένα ένζυμο που έχει απομονωθεί από ένα βακτήριο (Thermophilus aquaticus), το οποίο ζει στις θερμοπηγές στις οποίες η θερμοκρασία του περιβάλλοντος φθάνει τους 80 ο C. Να απαντήσετε στις ερωτήσεις: Ι. Σε ποια από τα διαφορετικά είδη διαμορφώσεων (δομών) μιας ενζυμικής πρωτεΐνης, οφείλεται η καταλυτική δράση της; Γιατί μας προξενεί εντύπωση το γεγονός ότι το ένζυμο που απομονώθηκε από τον Thermophilus aquaticus, διατηρεί την καταλυτική δράση του, ακόμη και στη θερμοκρασία των 80 ο C; (12μ) ΙΙ. Από την ανάλυση του DNA του βακτηρίου αυτού διαπιστώθηκε ότι περιέχει αυξημένο ποσοστό G και C σε σχέση με Α και Τ. Mε δεδομένο ότι η υψηλή θερμοκρασία προκαλεί θραύση των δεσμών υδρογόνου, πώς μπορεί το εύρημα αυτό να εξηγήσει την ικανότητα του βακτηριδίου να επιβιώνει σε υψηλές θερμοκρασίες, χωρίς να καταστρέφεται η στερεοδιάταξη του DNA του; (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 14

15 ΓΗ_Β_ΒΙΟ_0_16213 Β46 Ι. Στην εικόνα παρουσιάζεται τμήμα ενός μακρομορίου. Να απαντήσετε στις ερωτήσεις: α) Η εικόνα είναι πιθανό να παρουσιάζει το τμήμα ενός πολυπεπτιδίου; Να αιτιολογήσετε την απάντησή σας. (4μ) β) Πόσα μόρια νερού θα χρειαστούν για τη διάσπαση του εικονιζόμενου τμήματος του μορίου; Να αιτιολογήσετε την απάντησή σας. (6μ) γ) Αν το εικονιζόμενο μακρομόριο έχει δομικό ρόλο, πώς ονομάζεται; Ποιας κυτταρικής δομής αποτελεί συστατικό; (2μ) ΓΗ_Β_ΒΙΟ_0_16214 Β47 Ι. Στο σχήμα εικονίζεται μια χημική ένωση που αποτελείται από 3 μονομερή. Να απαντήσετε στις ερωτήσεις: α) Είναι πιθανό το σχήμα να απεικονίζει ένα τρινουκλεοτίδιο; Να αιτιολογήσετε την απάντησή σας. (6μ) β) Για να συντεθεί αυτή η χημική ένωση από τα μονομερή της, χρειάζεται να απομακρυνθούν ή να προστεθούν μόρια νερού και πόσα; Να αιτιολογήσετε την απάντησή σας και να κατονομάσετε το χημικό μηχανισμό. (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 15

16 ΓΗ_Β_ΒΙΟ_0_16218 Β50 Ι. Το μόριο του RNA είναι ένα, κυρίως, μονόκλωνο μακρομόριο που συμμετέχει με ποικίλους τρόπους στη σύνθεση των πρωτεϊνών. Να απαντήσετε στις ερωτήσεις: α) Ποια είναι τα μονομερή που συνιστούν το μόριο; Σε ποιες περιοχές του κυττάρου συντίθεται; (4μ) β) Ποια είναι τα διαφορετικά είδη του μορίου; Να περιγράψετε συνοπτικά το βιολογικό ρόλο καθεμιάς από αυτές. (6μ) γ) Πώς εξηγείται ότι μερικά μόρια RNA, έστω και τοπικά, παρουσιάζονται ως δίκλωνα; (2μ) Πιτσιλαδής Βασίλης - Βιολόγος 16

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου 1 Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Χανιά 2014-2015 2 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1ο 4-21 σελ. Θέμα Β 22-33 σελ. Θέμα Δ Κεφάλαιο 2ο 35-55 σελ. Θέμα Β 56-72 σελ. Θέμα Δ Κεφάλαιο 3ο 74 76 σελ.

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015)

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015) Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Ομαδοποιημένα ανά κεφάλαιο (σχολικό έτος 2014-2015) Ιωαννίδης Θωμάς Βιολόγος 11 ου ΓΕΛ Ηρακλείου 1 ΠΕΡΙΕΧΟΜΕΝΑ Εξεταστέα Ύλη 2014-15.. σελ.3 1 ο Κεφάλαιο..σελ.

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα


ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα


ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% Ο άνθρακας, το υδρογόνο, το οξυγόνο και το άζωτο συμμετέχουν, σε σημαντικό βαθμό, στη

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις:

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: ΘΕΜΑ Β: Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και

Διαβάστε περισσότερα



Διαβάστε περισσότερα

α) Σε ποια σημεία ενός ευκαρυωτικού κυττάρου που βρίσκεται στη μεσόφαση, μπορούμε να εντοπίσουμε μόρια DNA; (6μ)

α) Σε ποια σημεία ενός ευκαρυωτικού κυττάρου που βρίσκεται στη μεσόφαση, μπορούμε να εντοπίσουμε μόρια DNA; (6μ) ΘΕΜΑ Β: Ι. Οι πολυσακχαρίτες αποτελούν μια πολύ διαδεδομένη ομάδα μακρομορίων στα ζωικά και φυτικά κύτταρα. Να απαντήσετε στις ερωτήσεις: α) Ποιοι είναι οι κύριοι πολυσακχαρίτες και ποιο είναι το κοινό

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα


ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα


ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 4ο/Κεφάλαιο. 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα Κεφάλαιο 1 ο... 2 ΘΕΜΑ 14364... 2 ΘΕΜΑ 14372... 2 ΘΕΜΑ 14375... 2 ΘΕΜΑ 14384... 3 ΘΕΜΑ 14391... 3 ΘΕΜΑ 14424...

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Οι James Watson και Francis Crick δίπλα από το μοντέλο της διπλής έλικας του DNA που τους εξασφάλισε το Βραβείο Νόμπελ. 2015 2 Β.

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Α. Εισαγωγικές έννοιες ΜΕΣΑ ΣΤΑ ΚΥΤΤΑΡΑ Μπορούμε να διακρίνουμε δύο περιβάλλοντα ΥΔΡΟΦΙΛΟ υδατικό κυτταρόπλασμα ΥΔΡΟΦΟΒΟ λιπιδικο-μεμβρανικό Δηλαδή τα μόρια χαρακτηρίζονται έτσι λόγω της υδρόφοβης φύσης

Διαβάστε περισσότερα


ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του;

ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του; ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του; Β-Α γιατί το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του άρα θα γράφεται

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ / Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: 1 ΗΜΕΡΟΜΗΝΙΑ: 21 / 09 /2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ / Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: 1 ΗΜΕΡΟΜΗΝΙΑ: 21 / 09 /2014 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως και Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ 1 ο. 1.2 Όξινο είναι το υδατικό διάλυμα του α. ΝaCl. β. ΝΗ 4 Cl. γ. CH 3 COONa. δ. KOH. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΤΕΛΟΣ 1ΗΣ ΑΠΟ 7 ΣΕΛΙ ΕΣ


Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5


Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα



Διαβάστε περισσότερα

σελ 1 από 8 Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο a 2 η Εξέταση στην Βιοχημεία

σελ 1 από 8 Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο a 2 η Εξέταση στην Βιοχημεία Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο 2006 2007 a 2 η Εξέταση στην Βιοχημεία σελ 1 από 8 Ονοματεπώνυμο : Τυπικό εξάμηνο : Αριθμός Μητρώου : Σε κάθε ερώτηση αντιστοιχούν πέντε απαντήσεις

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ_1.1 In vivo πειράματα απόδειξης της έννοιας του μετασχηματισμού και in vitro απόδειξη ότι το DNA είναι αυτό που προκαλεί το μετασχηματισμό. ΕΡΩΤΗΣΕΙΣ 1. Γιατί πιστεύετε ότι θανατώνονται τα βακτήρια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια

πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια πρωτεϊνες νουκλεϊκά οξέα Βιολογικά Μακρομόρια υδατάνθρακες λιπίδια Περιγραφή μαθήματος Επανάληψη σημαντικών εννοιών από την Οργανική Χημεία Χημική σύσταση των κυττάρων Μονοσακχαρίτες Αμινοξέα Νουκλεοτίδια

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου. 1.1 Η χημεία της ζωής 1.2 Μακρομόρια

Χημική σύσταση του κυττάρου. 1.1 Η χημεία της ζωής 1.2 Μακρομόρια Πρότυπο του μορίου της δεϋδρογονασης της αλκοόλης (ένζυμο), Οι μοβ σφαίρες αντιστοιχούν σε μορια συνένζυμου NAD. Χημική σύσταση του κυττάρου 1.1 Η χημεία της ζωής 1.2 Μακρομόρια ΔΙΔΑΚΤΙΚΟΙ ΣΤΟΧΟΙ Στο τέλος

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 5 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε υδατικά

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα


ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 3 ΚΕΦΑΛΑΙΟ 3

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 3 ΚΕΦΑΛΑΙΟ 3 ΓΗ_Β_ΒΙΟ_0_14306 Β6 (ΚΕΦ. 2, 3) ΚΕΦΑΛΑΙΟ 3 ΙΙ. Στο φυτικό κύτταρο συνυπάρχουν δύο οργανίδια τα οποία διαθέτουν γενετικό υλικό και τα οποία σχετίζονται λειτουργικά, στο πλαίσιο δύο βασικών μεταβολικών διεργασιών.

Διαβάστε περισσότερα

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες ΠΡΩΤΕΙΝΕΣ Οι πρωτεΐνες είναι πολυμερείς ουσίες με κυρίαρχο και πρωταρχικό ρόλο στη ζωή. Πρωτεΐνες είναι οι ουσίες που κυρίως δομούν και λειτουργούν τους οργανισμούς. Λέγονται και λευκώματα λόγω του λευκού

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα ΚΕΦΑΛΑΙΟ 1 Οργάνωση της ζωής βιολογικά συστήματα 1.2 Κύτταρο: η μονάδα της ζωής Ιστορικά 1665: Ο Ρ.Χουκ μιλά για κύτταρα. Σύγχρονη κυτταρική θεωρία: Το κύτταρο είναι η θεμελιώδης δομική και λειτουργική

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) : ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα


ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εργασία για το μάθημα της Βιολογίας Περίληψη πάνω στο κεφάλαιο 3 του σχολικού βιβλίου

Εργασία για το μάθημα της Βιολογίας Περίληψη πάνω στο κεφάλαιο 3 του σχολικού βιβλίου Εργασία για το μάθημα της Βιολογίας Περίληψη πάνω στο κεφάλαιο 3 του σχολικού βιβλίου Τ. ΘΕΟΔΩΡΑ ΤΜΗΜΑ Β3 ΚΕΦΑΛΑΙΟ ΤΡΙΤΟ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Ο όρος ενέργεια σημαίνει δυνατότητα παραγωγής έργου.

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Ζήτηµα 1ο Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 2 Στα ακόλουθα σχήματα απεικονίζονται δύο κύτταρα. Ι. Να ονομάσετε 3 δομές που υπάρχουν και στα δύο είδη κυττάρων. Να ονομάσετε επίσης μια δομή που ενώ υπάρχει στα κύτταρα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4 Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: καταλύτες


Διαβάστε περισσότερα

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ

Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τίτλος Μαθήματος: Ενζυμολογία Ενότητα: Εισαγωγή Διδάσκων: Καθηγητής Εμμανουήλ Μ. Παπαμιχαήλ Τμήμα: Χημείας 8 1. EIΣAΓΩΓH Tα ένζυμα είναι οι καταλύτες της ζώσης ύλης. Καταλύουν τις χημικές αντιδράσεις,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους:

2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους: 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους: (α) Αποτελούν βασικά δομικά συστατικά του σώματος (β) Εξυπηρετούν ενεργειακές

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ: Η ΕΠΙΣΤΗΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ ΒΙΟΛΟΓΙΑ: Η ΕΠΙΣΤΗΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ Παρατήρηση του φυσικού κόσμου και συλλογή πληροφοριών προς επιβίωση Κυνηγοί και συλλέκτες Γεωργοί Κτηνοτρόφοι Γιατροί - Θεραπευτές Τι είναι ζωή; Ποια είναι

Διαβάστε περισσότερα