Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1"

Transcript

1 ΓΗ_Β_ΒΙΟ_0_ Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και η χημική αντίδραση Δ; β) Ποιο είναι το μόριο Χ και ποια είναι η σχέση του με τις αντιδράσεις Γ και Δ; (12μ) ΙΙ. Ο δεσμός Ε που δημιουργείται λόγω της χημικής αντίδρασης Γ συναντάται κατά τη δημιουργία βιομορίων που αποτελούνται από πολυάριθμους δομικούς λίθους. Να απαντήσετε στις ερωτήσεις: α) Τι είδους χημικός δεσμός είναι ο Ε και ποια είναι η σημασία του για τα μόρια Α; β) Πώς ονομάζεται το μόριο που θα προκύψει από τη συνένωση πολυάριθμων μορίων Α; γ) Στο μόριο που θα προκύψει εκτός από τον χημικό δεσμό Ε είναι πιθανό να προκύψουν και άλλοι χημικοί δεσμοί. Να αναφέρετε δύο από αυτούς και να εξηγήσετε τη σημασία τους. (13μ) ΓΗ_Β_ΒΙΟ_0_14351 Β2 Ι. Στα κύτταρα υπάρχει ποικιλία χημικών στοιχείων, όπως και ποικιλία στις ποσότητες και στις αναλογίες με τις οποίες συναντώνται τα στοιχεία αυτά. α) Ποια είναι τα κύρια στοιχεία που συνιστούν τα μακρομόρια ενός κυττάρου. Σε ποιο ποσοστό συμμετέχουν στη δομή του; Ποια στοιχεία ονομάζονται ιχνοστοιχεία; (4μ) β) Δυο βασικές ιδιότητες που πρέπει να διακρίνουν τα μακρομόρια είναι η σταθερότητα και η ποικιλομορφία. Να εξηγήσετε για ποιο λόγο τα μακρομόρια πρέπει να πληρούν τις παραπάνω προϋποθέσεις. (4μ) γ) Να αναφέρετε δύο ιδιότητες των κύριων χημικών στοιχείων, που συνιστούν τα μακρομόρια, οι οποίες συμβάλλουν στην σταθερότητα και στην ποικιλομορφία των μορίων αυτών. (4μ) Πιτσιλαδής Βασίλης - Βιολόγος 1

2 ΓΗ_Β_ΒΙΟ_0_14363 Β4 Ι. Είκοσι επτά χημικά στοιχεία είναι απαραίτητα για τη ζωή. Τα τέσσερα από αυτά τα στοιχεία είναι τα επικρατέστερα στους οργανισμούς. α) Ποια είναι τα τέσσερα στοιχεία, που συμμετέχουν σε σημαντικό βαθμό στη σύνθεση των πρωτεϊνών; (4μ) β) Να τοποθετήσετε στη σωστή σειρά από το μικρότερο προς το μεγαλύτερο σε μέγεθος, τα παρακάτω: αμινοξύ, άζωτο, τριπεπτίδιο, πρωτεΐνη, αμινομάδα. (4μ) γ) Να αναφέρετε αναλυτικά τα τμήματα, από τα οποία αποτελείται ένα αμινοξύ. (4μ) ΙΙ. Οι υδατάνθρακες διακρίνονται σε μονοσακχαρίτες, δισακχαρίτες και πολυσακχαρίτες. α) Να περιγράψετε το ρόλο της συμπύκνωσης και της υδρόλυσης στη σχέση μεταξύ μονοσακχαριτών, δισακχαριτών και πολυσακχαριτών. (6μ) β) Να ονομάσετε τον δομικό πολυσακχαρίτη του κυτταρικού τοιχώματος ενός φυτικού κυττάρου. (1μ) γ) Ένας μύκητας, ένα ζωικό κύτταρο και ένα φυτικό κύτταρο αποθηκεύουν μόρια γλυκόζης. Με ποια μορφή τα αποθηκεύει το καθένα από αυτά; (6μ) ΓΗ_Β_ΒΙΟ_0_14364 Β5 Ι. Στο φλοιό της Γης απαντώνται 92 χημικά στοιχεία. Από αυτά τα είκοσι επτά είναι απαραίτητα για τη ζωή. α) Ποια είναι τα πέντε χημικά στοιχεία, που συμμετέχουν στη σύνθεση των νουκλεϊκών οξέων; (5μ) β) Να τοποθετήσετε στη σωστή σειρά, από το μικρότερο προς το μεγαλύτερο σε μέγεθος, τα παρακάτω: άνθρακας, νουκλεοτίδιο, αζωτούχος βάση, νουκλεϊκό οξύ. (4μ) γ) Να αναφέρετε τρία διαφορετικά μόρια από τη σύνδεση των οποίων σχηματίζεται ένα νουκλεοτίδιο. (3μ) Χημικά στοιχεία, μικρά μόρια αλλά και μεγάλα μόρια αποτελούν συστατικά του κυττάρου και συνεπώς συμμετέχουν στην κατασκευή των δομών του και επηρεάζουν τις λειτουργίες του. Ι. Να εξηγήσετε συνοπτικά τη σημασία που έχουν για το κύτταρο ο Άνθρακας, το Νερό, τα Άλατα και τα Φωσφολιπίδια. (12μ) ΙΙ. Η βιολογική λειτουργία των μακρομορίων απορρέει από τη δομή τους. Με βάση την αρχή αυτή, να εξηγήσετε γιατί η μορφή μιας πρωτεΐνης καθορίζει τη λειτουργία της, κάνοντας χρήση ενός σχετικού παραδείγματος. Να αναφέρετε δύο τρόπους με τους οποίους μπορεί να τροποποιηθεί η μορφή της πρωτεΐνης, ώστε το μόριο να πάψει να είναι λειτουργικό. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 2

3 ΓΗ_Β_ΒΙΟ_0_14366 Β6 I. Τα μονομερή των πρωτεϊνών είναι τα αμινοξέα. Να απαντήσετε στις ερωτήσεις: α) Ποιες είναι οι σταθερές χημικές ομάδες που δομούν κάθε αμινοξύ; (3μ) β) Πόσα είναι τα διαφορετικά είδη μεταβλητής ομάδας των αμινοξέων τα οποία συμμετέχουν στη σύνθεση των πρωτεϊνών; Να εξηγήσετε γιατί η ύπαρξη διαφορετικών ειδών μεταβλητών ομάδων είναι σημαντική για την εκτέλεση του βιολογικού ρόλου των πρωτεϊνών. (6μ) γ) Να δείξετε σχηματικά πώς συνδέονται δύο αμινοξέα μεταξύ τους για να σχηματίσουν ένα διπεπτίδιο. Ποιο άλλο μόριο παράγεται κατά το σχηματισμό ενός διπεπτιδίου; (3μ) ΓΗ_Β_ΒΙΟ_0_14367 Β7 ΙΙ. Μια κατηγορία ενώσεων μεγάλου μοριακού βάρους στα κύτταρα είναι τα λιπίδια. α) Να περιγράψετε το ρόλο της συμπύκνωσης και το ρόλο της υδρόλυσης στη σχέση μεταξύ λιπαρών οξέων, γλυκερόλης και τριγλυκεριδίων. (8μ) β) Σε ποιες κατηγορίες διακρίνονται τα ουδέτερα λίπη; Αν ένα ουδέτερο λίπος στη συνήθη θερμοκρασία παραμένει στην υγρή κατάσταση, σε ποιο συμπέρασμα οδηγείστε για τη χημική σύστασή του; Να αναφέρετε 2 ρόλους των λιπών στους οργανισμούς. (5μ) ΓΗ_Β_ΒΙΟ_0_14369 Β8 Ι. Οι υδατάνθρακες διακρίνονται σε μονοσακχαρίτες, δισακχαρίτες και πολυσακχαρίτες. α) Να αναφέρετε από δύο παραδείγματα μονοσακχαριτών, δισακχαριτών και πολυσακχαριτών. (6μ) β) Σε ένα κύτταρο συναντώνται άμυλο και κυτταρίνη. Το κύτταρο αυτό είναι φυτικό ή ζωικό. Να αιτιολογήσετε την απάντησή σας. Ποιος είναι ο βιολογικός ρόλος καθεμιάς από τις ενώσεις αυτές; (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 3

4 ΓΗ_Β_ΒΙΟ_0_14372 Β10 ΙΙ. Μεταξύ των χημικών δεσμών που υπάρχουν στα βιομόρια, περιλαμβάνονται οι δεσμοί Υδρογόνου. α) Να ονομάσετε δύο διαφορετικά βιολογικά μακρομόρια στα οποία συναντώνται δεσμοί υδρογόνου. Μεταξύ ποιων χημικών ομάδων καθενός από τα μακρομόρια που αναφέρατε δημιουργούνται δεσμοί υδρογόνου; (4μ) β) Να εξηγήσετε τη σημασία των δεσμών υδρογόνου στη βιολογική λειτουργία των μακρομορίων που αναφέρατε στο α. ερώτημα. (9μ) Η πρωτεΐνη της εικόνας αποτελείται από 300 αμινοξέα. Στο διάγραμμα παρουσιάζεται η πρωτοταγής, η δευτεροταγής και η τριτοταγής δομή της. Ι. Τι είναι η πρωτοταγής δομή μιας πρωτεΐνης; Να εξηγήσετε ποια είναι η αιτία που προκαλεί μεταβολή στις διαστάσεις της πρωτεΐνης από την πρωτοταγή στη δευτεροταγή δομή της. (12μ) ΙΙ. Τι είναι η τριτοταγής δομή μιας πρωτεΐνης; Γιατί όλες οι πρωτεΐνες δεν διαθέτουν τεταρτοταγή δομή; Να εξηγήσετε αν θα επηρεαστεί η τριτοταγής δομή της πρωτεΐνης, σε περίπτωση που η πρωτεΐνη εκτεθεί σε ακραία τιμή θερμοκρασίας. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 4

5 ΓΗ_Β_ΒΙΟ_0_14375 Β12 Σε ένα φυτικό κύτταρο συνέβησαν δύο μεταβολές σε δύο μακρομόριά του: Σε ένα μόριο κυτταρίνης, το 5 ο κατά σειρά μονομερές του αντικαταστάθηκε από το 17 ο, και σε ένα μόριο πρωτεΐνης, το 25 ο μονομερές του αντικαταστάθηκε από το 93 ο. Να απαντήσετε στις ερωτήσεις: Ι. Ποια είναι τα μονομερή καθενός από τα δύο είδη μακρομορίων; Τι κοινό χαρακτηρίζει τον χημικό μηχανισμό με τον οποίο τα μονομερή καθενός μακρομορίου, συνδέονται μεταξύ τους; (12μ) ΙΙ. Στην κυτταρίνη ή στην πρωτεΐνη είναι πιθανότερο να τροποποιηθεί η βιολογική λειτουργία, μετά την αντικατάσταση του αντίστοιχου μονομερούς; Να αιτιολογήσετε την απάντησή σας. (13μ) ΓΗ_Β_ΒΙΟ_0_14377 Β13 Ι. Δύο νευροπεπτίδια έχουν την εξής αλληλουχία αμινοξέων. Πεπτίδιο Α: H 2 Ν-μεθειονίνη-τρυπτοφάνη-λυσίνη-λυσίνη-προλίνη-βαλίνη-COOH Πεπτίδιο Β: Η 2 Ν-μεθειονίνη-λυσίνη-τρυπτοφάνη-λυσίνη-βαλίνη-προλίνη-COOH. Να απαντήσετε στις ερωτήσεις: α) Με ποιο είδος δεσμού συνδέονται τα αμινοξέα των πεπτιδίων μεταξύ τους, με ποια χημική αντίδραση δημιουργείται αυτός ο δεσμός. (4μ) β) Ποιοι άλλοι χημικοί δεσμοί είναι πιθανόν να συμβάλλουν στην τελική διαμόρφωση των πεπτιδίων Α και Β στο χώρο; (8μ) ΙΙ. Κάθε βιολογικό μόριο εκτελεί μια συγκεκριμένη βιολογική λειτουργία. Να απαντήσετε στις ερωτήσεις: α) Είναι δυνατόν τα διαφορετικά πεπτίδια Α και Β να εκτελούν την ίδια λειτουργία; (6μ) β) Ποιοι παράγοντες και με ποιο τρόπο μπορούν να τροποποιήσουν τη λειτουργία που εκτελεί κάθε πεπτίδιο; (7μ) Πιτσιλαδής Βασίλης - Βιολόγος 5

6 ΓΗ_Β_ΒΙΟ_0_14384 Β17 ΙΙ. Ο βιολογικός ρόλος που έχουν οι υδατάνθρακες στο κύτταρο είναι σημαντικός και ποικίλος. α) Να ονομάσετε τον υδατάνθρακα που υπάρχει στα νουκλεοτίδια του DNA και τον υδατάνθρακα που υπάρχει στα νουκλεοτίδια του RNA. Σε ποια κατηγορία υπάγονται οι υδατάνθρακες αυτοί, με βάση τον αριθμό των ατόμων άνθρακα που υπάρχουν στο μόριο τους; (3μ) β) Να ονομάσετε δύο δισακχαρίτες και να προσδιορίσετε την πηγή από την οποία μπορούμε να τους προσλάβουμε με τη διατροφή μας. (4μ) γ) Ποια είναι τα γνωστά είδη πολυσακχαριτών; Σε ποια είδη οργανισμών εντοπίζεται ο καθένας, και με ποιο βιολογικό ρόλο; (6μ) ΓΗ_Β_ΒΙΟ_0_14389 Β19 Ι. Στην εικόνα παρατίθενται δύο από τα είκοσι αμινοξέα που αποτελούν συστατικά πρωτεϊνών. Το αμινοξύ αλανίνη (Α) και το αμινοξύ γλυκίνη (Β): Α. Αμινοξύ Αλανίνη Β. Αμινοξύ Γλυκίνη α) Ποια είναι η πλευρική ομάδα (R) για το καθένα από αυτά τα αμινοξέα; (6μ) β) Πώς χαρακτηρίζεται το τμήμα του αμινοξέος που αποτελείται από την πλευρική ομάδα (R) και γιατί; (4μ) γ) Να κυκλώσετε το κοινό άτομο με το οποίο ενώνονται όλα τα τμήματα ενός αμινοξέος. (2μ) Πιτσιλαδής Βασίλης - Βιολόγος 6

7 ΓΗ_Β_ΒΙΟ_0_14391 Β20 Ι. Μεταξύ των διαφορών που υπάρχουν στο DNA και στο RNA, είναι το είδος των μονομερών που τα αποτελούν, αλλά και η θέση των μορίων αυτών στο ευκαρυωτικό κύτταρο. Να απαντήσετε στις ερωτήσεις: α) Ποια είναι τα διαφορετικά νουκλεοτίδια που συναντώνται στο DNA; Ποια είναι τα διαφορετικά νουκλεοτίδια που συναντώνται στο RNA; (4μ) β) Ποια είναι η σημασία, για το βιολογικό ρόλο του DNA, ότι το μόριο αυτό δομείται από 4 διαφορετικά νουκλεοτίδια, και όχι από ένα μόνο; (4μ) γ) Να ονομάσετε μια κυτταρική δομή και μια κυτταρική περιοχή ενός μη διαιρούμενου κυττάρου στην οποία υπάρχει το RNA, όχι όμως το DNA. (4μ) Στην ακόλουθη εικόνα παρατίθενται οι συντακτικοί τύποι των αμινοξέων Αλανίνη (Α) και Γλυκίνη (Γ). Να απαντήσετε στις ερωτήσεις: Αλανίνη Γλυκίνη Ι. Ποια είναι τα διαφορετικά τριπεπτίδια που μπορούν να συντεθούν με την χρήση των δύο αμινοξέων; (Να χρησιμοποιήσετε τα αρχικά τους Α και Γ) (12μ) ΙΙ. Να δείξετε τον συντακτικό τύπο του τριπεπτιδίου: Η2Ν-Α-Α-Γ-COOH. Για ποιο λόγο το τριπεπτίδιο αυτό είναι διαφορετικό από το τριπεπτίδιο: Η2Ν-Γ-Α-Α-COOH (13μ) ΓΗ_Β_ΒΙΟ_0_14419 Β22 Ι. Οι πρωτεΐνες είναι βιολογικά μακρομόρια που αποτελούνται από ένα ή περισσότερα πολυπεπτίδια. α) Να προσδιορίσετε το ρόλο της συμπύκνωσης και το ρόλο της υδρόλυσης στη σχέση μεταξύ αμινοξέων και πολυπεπτιδίων. (6μ) β) Να ονομάσετε δύο διαφορετικές πρωτεΐνες των κυττάρων του ανθρώπου και να προσδιορίσετε το βιολογικό ρόλο τους. Τι θα πρέπει να συμβεί σε κάποια από τις πρωτεΐνες που αναφέρατε, ώστε να μην μπορεί πλέον να εκτελεί τη βιολογική λειτουργία της; Πώς ονομάζεται το φαινόμενο αυτό; (6μ) ΙΙ. Να ονομάσετε έναν πολυσακχαρίτη στο ζωικό κύτταρο και δύο πολυσακχαρίτες στο φυτικό κύτταρο. Τι κοινό έχουν αυτοί οι 3 πολυσακχαρίτες; Που διαφέρουν ο ένας από τον άλλο; Να προσδιορίσετε το βιολογικό ρόλο καθενός από αυτούς. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 7

8 ΓΗ_Β_ΒΙΟ_0_14421 Β24 ΙΙ. Μια από τις κατηγορίες λιπιδίων είναι τα φωσφολιπίδια. α) Να περιγράψετε τη δομή ενός μορίου φωσφολιπιδίου. (4μ) β) Να αναφέρετε δύο διαφορές στη δομή των φωσφολιπιδίων σε σχέση με τη δομή των ουδετέρων λιπών. (4μ) γ) Να εξηγήσετε πώς τα φωσφολιπίδια συγκροτούν διπλοστιβάδα και να αναφέρετε τη βιολογική της σημασία για το κύτταρο. (5μ) ΓΗ_Β_ΒΙΟ_0_14422 Β25 Ι. Στον πίνακα που δίνεται να τοποθετήσετε το σύμβολο + στα ορθογώνια στα οποία υπάρχει αντιστοιχία ανάμεσα στις προτάσεις της οριζόντιας σειράς και στα μακρομόρια της κατακόρυφης στήλης. DNA Πρωτεΐνες Πολυσακχαρίτες RNA Λιπίδια Επιταχύνουν τις βιοχημικές αντιδράσεις Είναι το γενετικό υλικό των κυττάρων Αποτελούν δομικά συστατικά της πλασματικής μεμβράνης Αποτελούν κύριες πηγές ενέργειας (12μ) ΓΗ_Β_ΒΙΟ_0_14423 Β26 ΙΙ. Tα μόρια του DNA φέρουν μια σειρά πληροφοριών οι οποίες καθορίζουν το σύνολο σχεδόν των χαρακτηριστικών των οργανισμών. Να απαντήσετε στις παρακάτω ερωτήσεις : α) Σε ποια τμήματα ενός φυτικού και σε ποια τμήματα ενός ζωικού κυττάρου μπορούμε να εντοπίσουμε μόρια DNA; (5μ) β) Ποια χαρακτηριστικά του μορίου του DNA του επιτρέπουν να έχει καταγεγραμμένη τη γενετική πληροφορία και να αποτελεί ένα σταθερό, από χημική άποψη, μόριο; (8μ) Πιτσιλαδής Βασίλης - Βιολόγος 8

9 ΓΗ_Β_ΒΙΟ_0_14424 Β27 Δυο φίλες, μαθήτριες της Β λυκείου προετοίμασαν καθεμία μόνη της ένα γλύκισμα, με ζελέ και φρούτα ανανά, για μια εκδήλωση του σχολείου τους. Η πρώτη αφού προετοίμασε το μείγμα του ζελέ, με βάση τις οδηγίες της συσκευασίας του ζελέ που αγόρασε από το σούπερ μάρκετ, προσέθεσε φρούτο από ανανά κονσέρβας και το γλύκισμα της έπηξε κανονικά. Η δεύτερη ακολούθησε την ίδιαν ακριβώς διαδικασία με τη διαφορά ότι χρησιμοποίησε κομμάτια φρέσκου ανανά αλλά το γλυκό που παρασκεύασε δεν έπηξε καθόλου. Αναζητώντας πληροφορίες στο διαδίκτυο για τις αιτίες της αποτυχίας του γλυκού η μαθήτρια βρήκε ότι: α) το ζελέ πήζει σε χαμηλή θερμοκρασία εξαιτίας μια πρωτεΐνης, της ζελατίνης, η οποία περιέχεται σε αυτό, β) ότι ο φρέσκος ανανάς όπως και κάποια άλλα φρούτα περιέχει μεταξύ άλλων, το ένζυμο βρομελίνη, που διασπά πρωτεΐνες και γ) ότι η κονσερβοποίηση περιλαμβάνει μεταξύ των άλλων σταδίων και θέρμανση του τροφίμου σε υψηλή θερμοκρασία. Ι. Πώς ονομάζονται τα μόρια που προκύπτουν από τη δράση της βρομελίνης στις πρωτεΐνες; Να ονομάσετε το είδος του χημικού μηχανισμού με τον οποίον προέκυψαν τα μόρια αυτά και να προσδιορίσετε αν κατά τη διεξαγωγή του, έγινε κατανάλωση ή παραγωγή νερού; Ποια σχέση υπάρχει ανάμεσα στη δομή των μακρομορίων, όπως π.χ. η βρομελίνη, με τη βιολογική λειτουργία που εκδηλώνουν; Να αιτιολογήσετε τις απαντήσεις σας. (12μ) ΙΙ. Συνδυάζοντας τις απαντήσεις που δώσατε στο προηγούμενο ερώτημα, να εξηγήσετε τα αίτια της αποτυχίας του γλυκού της δεύτερης μαθήτριας και αντίστοιχα της επιτυχίας στο γλυκό της πρώτης. (13μ) ΓΗ_Β_ΒΙΟ_0_14426 Β29 Ένα δίκλωνο μόριο DNA αποτελείται από νουκλεοτίδια, από τα οποία περιέχουν την αζωτούχο βάση αδενίνη (Α). Να απαντήσετε στις ερωτήσεις: Ι. Από πόσα νουκλεοτίδια αποτελείται η κάθε αλυσίδα αυτού του μορίου; Να υπολογίσετε τον αριθμό των δεσμών που αναπτύσσονται μεταξύ τους. Να αιτιολογήσετε τις απαντήσεις σας. (12μ) ΙΙ. Να υπολογίσετε τον αριθμό κάθε είδους αζωτούχων βάσεων, καθώς και τον συνολικό αριθμό δεσμών υδρογόνου που υπάρχουν στο μόριο. Να αιτιολογήσετε τις απαντήσεις σας. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 9

10 ΓΗ_Β_ΒΙΟ_0_14428 Β31 Ι. Μια κατηγορία λιπιδίων είναι τα ουδέτερα λίπη ή τριγλυκερίδια, τα οποία είναι πολύ διαδεδομένα στη φύση. α) Από ποιες επιμέρους χημικές ομάδες αποτελείται ένα ουδέτερο λίπος; (4μ) β) Σε ποιες κατηγορίες και με ποιο κριτήριο διακρίνονται τα ουδέτερα λίπη; (4μ) γ) Ποιος είναι ο βιολογικός ρόλος των ουδέτερων λιπών; (4μ) ΙΙ. Οι υδατάνθρακες αποτελούν πηγή ενέργειας για τα κύτταρα. Μια κατηγορία εξ αυτών αποτελούν οι πολυσακχαρίτες, οι οποίοι είναι πολύ διαδεδομένοι στη φύση. α) Σε ποιες άλλες κατηγορίες και με ποιο κριτήριο διακρίνονται οι υδατάνθρακες; Να αναφέρετε δύο παραδείγματα από κάθε κατηγορία. (6μ) β) Ποιοι είναι οι κύριοι πολυσακχαρίτες του φυτικού κυττάρου και ποιος είναι ο βιολογικός ρόλος του καθενός; Ποιος είναι ο κοινός πολυσακχαρίτης των ζωικών κυττάρων και των κυττάρων των μυκήτων, ποιος είναι ο βιολογικός ρόλος του; (7μ) ΓΗ_Β_ΒΙΟ_0_14429 Β32 Δίνεται τμήμα αλυσίδας DNA. Α κλώνος A A T G A T T C T G T A A G A T T T G T A Β κλώνος Ι. Να βρεθεί ο αριθμός των δεσμών που συνδέουν τα νουκλεοτίδια του κλώνου Α και να συμπληρωθεί η αλληλουχία των νουκλεοτιδίων του κλώνου Β. Να αιτιολογήσετε τις απαντήσεις σας.(12μ) ΙΙ. Πόσες φωσφορικές ομάδες υπάρχουν σε αυτό το μόριο; Πόσοι δεσμοί υδρογόνου συγκρατούν μεταξύ τους τις δύο πολυνουκλεοτιδικές αλυσίδες; Να αιτιολογήσετε τις απαντήσεις σας. (13μ) ΓΗ_Β_ΒΙΟ_0_14431 Β33 Ι. Τα νουκλεϊκά οξέα, το DNA και το RNA, αποτελούν τα μακρομόρια που καθορίζουν τα είδη των πρωτεϊνών που παράγουν τα κύτταρα. α) Πώς ονομάζονται τα μονομερή των νουκλεϊκών οξέων; Από ποια είδη απλούστερων μορίων δημιουργούνται αυτά τα μονομερή;(6μ) β) Να προσδιορίσετε τρεις διαφορές που υπάρχουν ανάμεσα στο DNA και στο RNA, ως προς τη δομή και τη χημική σύστασή τους. (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 10

11 ΓΗ_Β_ΒΙΟ_0_14434 Β36 Ι. Σε ένα δοχείο με νερό προστέθηκε μια ποσότητα φωσφολιπιδίων. Ποια από τις δύο εικονιζόμενες διαμορφώσεις θα πάρουν τα φωσφολιπίδια; Για ποιο λόγο η διαμόρφωση που επιλέξατε είναι σημαντική από βιολογική σκοπιά; Να αιτιολογήσετε τις απαντήσεις σας. (12μ) ΙΙ. Τα κύτταρα των σπερμάτων των φυτών αποθηκεύουν λίπη στη μορφή σταγονιδίων που περιβάλλονται από μεμβράνη. Αντίθετα από τις άλλες μεμβράνες των κυττάρων τα σταγονίδια αυτά περιβάλλονται από ένα απλό στρώμα φωσφολιπιδίων και όχι από διπλό. Να σχεδιάσετε το πιθανό μοντέλο για τη διάταξη των φωσφολιπιδίων στις μεμβράνες αυτές και να εξηγήσετε πού οφείλεται η σταθερότητά του. (13μ) ΓΗ_Β_ΒΙΟ_0_14436 Β38 Στην εικόνα παρουσιάζεται ένα τμήμα της μοναδικής πολυπεπτιδικής αλυσίδας μιας πρωτεΐνης. Να απαντήσετε στις ερωτήσεις: Ι. Ποια από τις υπάρχουσες δομές των πρωτεϊνών (1 ο, 2 ο, 3 ο, ταγής) είναι η εικονιζόμενη; Η πρωτεΐνη αυτή μπορεί να διαθέτει τεταρτοταγή δομή; Να αιτιολογήσετε τις απαντήσεις σας. (12μ) ΙΙ. Πόσα αμινοξέα περιλαμβάνονται στο εικονιζόμενο τμήμα της πρωτεΐνης; Αν το τμήμα αυτό υδρολυθεί, πόσα μόρια νερού θα χρειαστούν; Να αιτιολογήσετε την απάντησή σας. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 11

12 ΓΗ_Β_ΒΙΟ_0_14438 Β40 Ι. Η σημασία του νερού για την εμφάνιση αλλά και για τη διατήρηση της ζωής είναι τόσο μεγάλη, ώστε το πρώτο ερώτημα που θέτουν οι επιστήμονες προκειμένου να διερευνήσουν, αν ένας πλανήτης φιλοξενεί ζωή, είναι αν έχει νερό σε υγρή μορφή. Να απαντήσετε στις ερωτήσεις: α) Πώς ονομάζεται το υγρό που περιβάλλει τα κύτταρα στους ιστούς των οργανισμών; (2μ) β) Γιατί τα φωσφολιπίδια της πλασματικής μεμβράνης σχηματίζουν διπλοστιβάδα; (4μ) γ) Να αναφέρετε τρεις λειτουργίες για τις οποίες είναι απαραίτητο το υδατικό περιβάλλον στο εσωτερικό ενός κυττάρου. (6μ) ΙΙ. Το DNA είναι ένα από τα σημαντικότερα μακρομόρια του κυττάρου. α) Ποιος είναι ο βιολογικός ρόλος του DNA και ποιες λειτουργίες είναι ικανό να ασκεί; (6μ) β) Σε ποια οργανίδια του κυττάρου μπορεί να εντοπιστεί DNA; (3μ) γ) Ποια είναι η σημασία της συμπληρωματικότητας των βάσεων στο DNA; (4μ) Πιτσιλαδής Βασίλης - Βιολόγος 12

13 ΓΗ_Β_ΒΙΟ_0_14905 Β41 Ι. Μεταξύ των διαφορετικών χημικών δεσμών που συναντώνται στα βιολογικά μακρομόρια περιλαμβάνονται οι ομοιοπολικοί δεσμοί καθώς και άλλα είδη δεσμών. Να απαντήσετε στις ερωτήσεις: α) Πώς ονομάζεται ο βασικός χημικός μηχανισμός με τον οποίο συνδέονται τα μονομερή όταν σχηματίζουν ένα πολυμερές; Ποιο είδος μορίου αφαιρείται κατά την αντίδραση των δύο μονομερών με το μηχανισμό που αναφέρατε; (4μ) β) Για ποιο λόγο ο ομοιοπολικός δεσμός έχει επικρατήσει στη σύνδεση των μονομερών σε πολυμερή σε σχέση με τα άλλα είδη δεσμών. Ποια είναι γενικά η σημασία των άλλων ειδών δεσμών; (4μ) γ) Εκτός από τον ομοιοπολικό δεσμό που συναντάται στο DNA, ποιο άλλο είδος δεσμού υπάρχει και μεταξύ ποιων χημικών ομάδων αναπτύσσεται; Ποια είναι η σημασία του δεσμού αυτού στο μόριο του DNA; (4μ) Ι. Τα αντισώματα είναι εξειδικευμένες αμυντικές πρωτεΐνες που εξουδετερώνουν τα μικρόβια αφού συνδεθούν με αυτά. Όλα τα αντισώματα αποτελούνται από 4 πολυπεπτιδικές αλυσίδες ανά δύο όμοιες. Τα διαφορετικά αντισώματα που έχουμε, είναι κατά βάση όμοια μεταξύ τους. Διαφέρουν όμως στις αλληλουχίες των αμινοξέων που αποτελούν την περιοχή σύνδεσής τους με τα μικρόβια. Αξιοποιώντας τις πληροφορίες που σας παρέχει το ακόλουθο σχήμα, να απαντήσετε στις ακόλουθες ερωτήσεις: α) Ποια επίπεδα οργάνωσης (δομής) αναμένετε να υπάρχουν στο μόριο των αντισωμάτων; Να αιτιολογήσετε την απάντησή σας. (6μ) β) Μελετώντας το σχήμα, στο οποίο εικονίζονται δύο διαφορετικά μικρόβια, που έχουν συνδεθεί με τα ειδικά, γι αυτά, αντισώματα, να εξηγήσετε για ποιο λόγο είναι αναγκαίο οι περιοχές των αντισωμάτων που συνδέονται με τα μικρόβια, να έχουν διαφορετική αλληλουχία αμινοξέων, σε καθένα από τα αντισώματα αυτά. (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 13

14 ΓΗ_Β_ΒΙΟ_0_14909 Β44 ΙΙ. Από τα 92 χημικά στοιχεία που υπάρχουν στο φλοιό της Γης, ο άνθρακας, το υδρογόνο, το οξυγόνο και το άζωτο, κυριαρχούν στους έμβιους οργανισμούς, καθώς αποτελούν το 96% του βάρους τους. Ωστόσο σε μικρότερο ποσοστό υπάρχουν και άλλα χημικά στοιχεία, μεταξύ των οποίων και ο φώσφορος, που ενώ είναι σημαντικά για τη ζωή, δεν ξεπερνούν το 4% του βάρους των οργανισμών. Να απαντήσετε στις ερωτήσεις: α) Ποια από τα 4 βασικά χημικά στοιχεία με τα οποία δομείται η ζωή, συναντώνται στους πολυσακχαρίτες; (3μ) β) Σε ποια είδη μονομερών συναντάται το άζωτο; Πώς ονομάζονται τα πολυμερή που συντίθενται από τα μονομερή που αναφέρατε; (4μ) γ) Αν ένα μακρομόριο περιέχει φώσφορο, τι είδους μακρομόριο μπορεί να είναι αυτό; Να αιτιολογήσετε την απάντησή σας. (6μ) Σε μερικές από τις εφαρμογές και τα πειράματα της Μοριακής Βιολογίας χρησιμοποιείται ένα ένζυμο που έχει απομονωθεί από ένα βακτήριο (Thermophilus aquaticus), το οποίο ζει στις θερμοπηγές στις οποίες η θερμοκρασία του περιβάλλοντος φθάνει τους 80 ο C. Να απαντήσετε στις ερωτήσεις: Ι. Σε ποια από τα διαφορετικά είδη διαμορφώσεων (δομών) μιας ενζυμικής πρωτεΐνης, οφείλεται η καταλυτική δράση της; Γιατί μας προξενεί εντύπωση το γεγονός ότι το ένζυμο που απομονώθηκε από τον Thermophilus aquaticus, διατηρεί την καταλυτική δράση του, ακόμη και στη θερμοκρασία των 80 ο C; (12μ) ΙΙ. Από την ανάλυση του DNA του βακτηρίου αυτού διαπιστώθηκε ότι περιέχει αυξημένο ποσοστό G και C σε σχέση με Α και Τ. Mε δεδομένο ότι η υψηλή θερμοκρασία προκαλεί θραύση των δεσμών υδρογόνου, πώς μπορεί το εύρημα αυτό να εξηγήσει την ικανότητα του βακτηριδίου να επιβιώνει σε υψηλές θερμοκρασίες, χωρίς να καταστρέφεται η στερεοδιάταξη του DNA του; (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 14

15 ΓΗ_Β_ΒΙΟ_0_16213 Β46 Ι. Στην εικόνα παρουσιάζεται τμήμα ενός μακρομορίου. Να απαντήσετε στις ερωτήσεις: α) Η εικόνα είναι πιθανό να παρουσιάζει το τμήμα ενός πολυπεπτιδίου; Να αιτιολογήσετε την απάντησή σας. (4μ) β) Πόσα μόρια νερού θα χρειαστούν για τη διάσπαση του εικονιζόμενου τμήματος του μορίου; Να αιτιολογήσετε την απάντησή σας. (6μ) γ) Αν το εικονιζόμενο μακρομόριο έχει δομικό ρόλο, πώς ονομάζεται; Ποιας κυτταρικής δομής αποτελεί συστατικό; (2μ) ΓΗ_Β_ΒΙΟ_0_16214 Β47 Ι. Στο σχήμα εικονίζεται μια χημική ένωση που αποτελείται από 3 μονομερή. Να απαντήσετε στις ερωτήσεις: α) Είναι πιθανό το σχήμα να απεικονίζει ένα τρινουκλεοτίδιο; Να αιτιολογήσετε την απάντησή σας. (6μ) β) Για να συντεθεί αυτή η χημική ένωση από τα μονομερή της, χρειάζεται να απομακρυνθούν ή να προστεθούν μόρια νερού και πόσα; Να αιτιολογήσετε την απάντησή σας και να κατονομάσετε το χημικό μηχανισμό. (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 15

16 ΓΗ_Β_ΒΙΟ_0_16218 Β50 Ι. Το μόριο του RNA είναι ένα, κυρίως, μονόκλωνο μακρομόριο που συμμετέχει με ποικίλους τρόπους στη σύνθεση των πρωτεϊνών. Να απαντήσετε στις ερωτήσεις: α) Ποια είναι τα μονομερή που συνιστούν το μόριο; Σε ποιες περιοχές του κυττάρου συντίθεται; (4μ) β) Ποια είναι τα διαφορετικά είδη του μορίου; Να περιγράψετε συνοπτικά το βιολογικό ρόλο καθεμιάς από αυτές. (6μ) γ) Πώς εξηγείται ότι μερικά μόρια RNA, έστω και τοπικά, παρουσιάζονται ως δίκλωνα; (2μ) Πιτσιλαδής Βασίλης - Βιολόγος 16

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου 1 Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Χανιά 2014-2015 2 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1ο 4-21 σελ. Θέμα Β 22-33 σελ. Θέμα Δ Κεφάλαιο 2ο 35-55 σελ. Θέμα Β 56-72 σελ. Θέμα Δ Κεφάλαιο 3ο 74 76 σελ.

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015)

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015) Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Ομαδοποιημένα ανά κεφάλαιο (σχολικό έτος 2014-2015) Ιωαννίδης Θωμάς Βιολόγος 11 ου ΓΕΛ Ηρακλείου 1 ΠΕΡΙΕΧΟΜΕΝΑ Εξεταστέα Ύλη 2014-15.. σελ.3 1 ο Κεφάλαιο..σελ.

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις:

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: ΘΕΜΑ Β: Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

α) Σε ποια σημεία ενός ευκαρυωτικού κυττάρου που βρίσκεται στη μεσόφαση, μπορούμε να εντοπίσουμε μόρια DNA; (6μ)

α) Σε ποια σημεία ενός ευκαρυωτικού κυττάρου που βρίσκεται στη μεσόφαση, μπορούμε να εντοπίσουμε μόρια DNA; (6μ) ΘΕΜΑ Β: Ι. Οι πολυσακχαρίτες αποτελούν μια πολύ διαδεδομένη ομάδα μακρομορίων στα ζωικά και φυτικά κύτταρα. Να απαντήσετε στις ερωτήσεις: α) Ποιοι είναι οι κύριοι πολυσακχαρίτες και ποιο είναι το κοινό

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 4ο/Κεφάλαιο. 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα Κεφάλαιο 1 ο... 2 ΘΕΜΑ 14364... 2 ΘΕΜΑ 14372... 2 ΘΕΜΑ 14375... 2 ΘΕΜΑ 14384... 3 ΘΕΜΑ 14391... 3 ΘΕΜΑ 14424...

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 7 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛ. ΜΑΚΡΟΜΟΡΙΑ 1 ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ 2010 2 ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Βιολογία είναι η επιστήμη

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ

ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟ ΚΕΝΤΡΟ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Ν. ΜΑΓΝΗΣΙΑΣ ( Ε.Κ.Φ.Ε ) ΕΡΓΑΣΤΗΡΙΟ ΒΙΟΛΟΓΙΑΣ Θέμα: ΜΕΤΟΥΣΙΩΣΗ ΠΡΩΤΕΪΝΩΝ (άσκηση 7 του εργαστηριακού οδηγού) Μέσος χρόνος πειράματος: 45 λεπτά Α. ΑΝΑΛΩΣΙΜΑ Εργαλεία

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 3 ΚΕΦΑΛΑΙΟ 3

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 3 ΚΕΦΑΛΑΙΟ 3 ΓΗ_Β_ΒΙΟ_0_14306 Β6 (ΚΕΦ. 2, 3) ΚΕΦΑΛΑΙΟ 3 ΙΙ. Στο φυτικό κύτταρο συνυπάρχουν δύο οργανίδια τα οποία διαθέτουν γενετικό υλικό και τα οποία σχετίζονται λειτουργικά, στο πλαίσιο δύο βασικών μεταβολικών διεργασιών.

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ] ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 2 Στα ακόλουθα σχήματα απεικονίζονται δύο κύτταρα. Ι. Να ονομάσετε 3 δομές που υπάρχουν και στα δύο είδη κυττάρων. Να ονομάσετε επίσης μια δομή που ενώ υπάρχει στα κύτταρα

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ 1 ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Οι James Watson Francis Crick δίπλα το μοντέλο της διπλής έλικας του DNA που τους εξασφάλισε το Βραβείο Νόμπελ. 2013 2 ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα

Διαβάστε περισσότερα

ΧΗΜΕΙΑ ΚΑΙ ΖΩΝΤΑΝΟΙ ΟΡΓΑΝΙΣΜΟΙ

ΧΗΜΕΙΑ ΚΑΙ ΖΩΝΤΑΝΟΙ ΟΡΓΑΝΙΣΜΟΙ ΥΠΟΥΡΓΕΙΟ ΠΟΛΙΤΙΣΜΟΥ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΧΗΜΕΙΑ ΚΑΙ ΖΩΝΤΑΝΟΙ ΟΡΓΑΝΙΣΜΟΙ ΕΠΑΛ Γ Τάξη Ι.Ε.Π. 2015 ΥΠΟΥΡΓΕΙΟ ΠΟΛΙΤΙΣΜΟΥ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΙΝΣΤΙΤΟΥΤΟ ΕΚΠΑΙΔΕΥΤΙΚΗΣ

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους:

2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους: 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους: (α) Αποτελούν βασικά δομικά συστατικά του σώματος (β) Εξυπηρετούν ενεργειακές

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΛΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια BIO111 Μικροβιολογια ιαλεξη 3 Κυτταρικη Χηµεια Mικροβιολογία = Bιολογία των µονοκύτταρων οργανισµών και των ιών H µεγάλη σας φίλη Το βακτηριο E.coli 1.000.000X C Γλυκόζη trna αντισωµα ριβοσωµα ATP DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΕΝΖΥΜΑ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ 1. Να εξηγήσετε γιατί πολλές βιταμίνες, παρά τη μικρή συγκέντρωσή τους στον οργανισμό, είναι πολύ σημαντικές για

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1

ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ. Χημεία της ζωής 1 ΚΕΦΑΛΑΙΟ 2 Ο H XHΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημεία της ζωής 1 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ Η Βιολογία μπορεί να μελετηθεί μέσα από πολλά και διαφορετικά επίπεδα. Οι βιοχημικοί, για παράδειγμα, ενδιαφέρονται περισσότερο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Βιολογία(Γενικής(Παιδείας Β Λυκείου

Βιολογία(Γενικής(Παιδείας Β Λυκείου Βιολογία(Γενικής(Παιδείας Β Λυκείου Ελληνογαλλική Σχολή Jeanne D Arc 2011-2012 Δημοσθένης Καρυοφύλλης email: dkariofi@e-biology.gr www.ibrain.gr Κεφ. 1 ο Χημική σύσταση του κυττάρου Χαρακτηριστικά των

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 3 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2015 Α ΦΑΣΗ

ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2015 Α ΦΑΣΗ ΤΑΞΗ B ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2015 Α ΦΑΣΗ Απαντήστε στο απαντητικό φύλλο: για τις ερωτήσεις πολλαπλής επιλογής με το γράμμα που αντιστοιχεί στη σωστή απάντηση και για τις ερωτήσεις ανάπτυξης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Το συζυγές οξύ της ΝΗ 3 είναι: α. ΝΗ 2 - β.νa

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ 2 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 23 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

Ποια η χρησιμότητα των πρωτεϊνών;

Ποια η χρησιμότητα των πρωτεϊνών; ΠΡΩΤΕΪΝΕΣ Τι είναι οι πρωτεϊνες; Η ονομασία πρωτεϊνες προέρχεται από το ρήμα πρωτεύω και σημαίνει την εξαιρετική σημασία που έχουν οι πρωτεϊνες για την υγεία του ανθρώπινου σώματος. Από την εποχή των Ολυμπιακών

Διαβάστε περισσότερα

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1.

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 21 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις:

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ÊÏÑÕÖÇ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ÊÏÑÕÖÇ ΕΚΦΩΝΗΣΕΙΣ 1 Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 ο ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Χηµείας Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Ζήτηµα 1ο Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο στους

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Φ ΣΙ Σ Ο Ι Λ Ο Ο Λ Γ Ο Ι Γ Α

Φ ΣΙ Σ Ο Ι Λ Ο Ο Λ Γ Ο Ι Γ Α Δηµοκρίτειο Πανεπιστήµιο Θράκης Τµήµα Αγροτικής Ανάπτυξης Οξείδωση της γλυκόζης ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ «Καταβολισµός ή ανοµοίωση» C 6 H 12 O+6O 2 +6H 2 O 12H 2 O+6CO 2 +686 Kcal/mol Πηγές ενέργειας κατά την

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4 Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες:

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4 Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Δίνονται: Κ a CH 3 COOH = 10 5, Κ b NH 3 = 10 5 Μονάδες 3 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

Καθηγητής Δ. Μόσιαλος

Καθηγητής Δ. Μόσιαλος Μικροβιολογία-Ιολογία Επίκουρος Καθηγητής Καθηγητής Δ. Μόσιαλος Βιοενεργητική μικροβίων Βακτηριακή Γενετική Επισκόπηση Βακτηριοφάγων Προκαρυωτική ποικιλότητα (Βακτήρια) Προκαρυωτική ποικιλότητα (Αρχαία)

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΑΠΑΝΤΗΣΕΙΣ

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΑΠΑΝΤΗΣΕΙΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 16/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΟΚΤΩ (8) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις

Διαβάστε περισσότερα